The regulation of the DCT system in
Rhizobium leguminosarum biovar viciae
Colm J Reid
Ph.D. 1995
2
Chapter 1___________________________________________________1
1.1 General Introduction. _________________________________________ 1
1.1.1 Introduction.____________________________________________________ 1
1.1.2 Economic and social aspects of this association.Error! Bookmark not defined.
1.1.3 General overview. _______________________________________________ 1
1.1.4 Taxonomy of the rhizobia family. ___________________________________ 4
. _______________________________________________________________ 6
1.2 The symbiotic process _________________________________________ 7
1.2.1 Formation of the nodule. __________________________________________ 8
1.2.2 Development of the nodule. _______________________________________ 11
1.2.3 The nif and fix genes encoding for the nitrogen fixing function of the
rhizobia. ____________________________________________________________ 14
1.3 The carbon source supplied by the plant to the bacteroid to fuel the
nitrogen fixation process. ______________________________________________ 20
1.3.1 Evidence that sugars are not the carbon source supplied by the plant to fuel the
nitrogen fixation process. ____________________________________________________ 21
1.3.2 Evidence that C4-dicarboxylates are the carbon source supplied by the plant to
the bacteroid to fuel the nitrogen fixation process._________________________________ 21
1.3.2.1 Physiological evidence that C4-dicarboxylates fuel the nitrogen fixation
process in the bacteroid. __________________________________________________ 22
1.3.2.2 Enzymatic evidence that C4-dicarboxylates fuel the nitrogen fixation process
in the bacteroid. ___________________________________________________________ 22
1.3.2.3 Evidence that a functioning C4-dicarboxylate specific transport system is
required to fuel the nitrogen fixation process. _________________________________ 24
1.3.2.4 Proposed enzymatic pathway involved in C4-dicarboxylate metabolism in
the bacteroid.___________________________________________________________ 25
1.4 Physiology of the DCT transport system. ________________________ 27
1.4.1 Description of the DCT transport system. ____________________________ 27
1.4.2 C4-dicarboxylate transport by the DCT system.________________________ 27
1.4.3 Aspartate transport by the DCT system.______________________________ 28
1.5 Genetic characterisation and regulation of the DCT system. ________ 30
1.5.1 The gene dctA, encoding the C4-dicarboxylate transport permease, DctA. __ 31
1.5.1.1 Description of the dctA gene.__________________________________ 31
1.5.1.2 Description of the DctA protein. _______________________________ 34
1.5.2 The gene ntrA, encoding the alternative symbiotic factor 54. ___________ 35
1.5.3 The gene dctB, encoding DctB, the sensor half of the two-component
sensor/regulator pair, DctB/DctD.. ____________________________________________ 36
1.5.3.1 Description of the dctB gene.__________________________________ 36
1.5.3.2 Description of the DctB protein. _______________________________ 37
1.5.4 The gene dctD, encoding DctD, the regulator half of the two-component
sensor/regulator pair DctB/DctD. ______________________________________________ 40
1.5.4.1 Description of the dctD gene. _________________________________ 40
1.5.4.2 Description of the DctD protein. _______________________________ 40
1.5.4.3 Activation of DctD by phosphorylation via DctB. _________________ 43
1.5.4.4 Binding of DctD to the UAS’s located in the dctAB intergenic region. _ 45
1.5.4.5 Proposed mechanism of transcription initiation from the dctAp with DctD
interacting with the 54 RNA polymerase. ____________________________________ 47
1.5.4.6 Summary._________________________ Error! Bookmark not defined.
1.6 Regulation of transcription of dctA in the free-living and symbiotic form.48
1.6.1 Regulation of transcription of dctA in free-living cells. __________________ 48
1.6.2 Regulation of transcription of dctA in the symbiotic state. _______________ 52
1.7 Cross-regulation of transcription from the dctAp by systems other than
DctBD.______________________________________________________________ 54
1.7.1 Introduction.___________________________________________________ 54
4
1.7.2 Evidence for cross-regulation of transport from the dctAp by systems other than
DctBD. __________________________________________________________________ 55
1.7.3 Potential role of DctD in minimising cross-regulation of transcription from the
dctAp. ___________________________________________________________________ 58
1.8 The role of C4-dicarboxylates in mediating catabolite repression. ____ 61
1.9 The role of the DCT system in mediating chemotaxis.______________ 63
1.10 Effect of over-expression of dctA on nitrogen fixation. ____________ 64
1.11 Aspartate transport in R. leguminosarum and R. meliloti by systems
other than the DCT system. ____________________________________________ 65
1.11.1 Aspartate transport in R. meliloti.__________________________________ 65
1.11.2 Aspartate transport in R. leguminosarum. ___________________________ 65
1.12 Regulation of ammonia assimilation and the NTR system in Rhizobium.68
1.12.1 The NTR system and regulation of ammonia assimilation in the Enterics. __ 68
1.12.2 Ammonia assimilation in Rhizobium and its regulation by the NTR system. 70
3.1 Introduction _______________________________________________ 121
3.2 Results____________________________________________________ 121
3.2.1 Construction of the dctAp and dctBp reporter plasmids, pRU103 and pRU104.121
3.2.2 Transcriptional analysis of the dctAp reporter in the wildtype, strain RU364
(3841/pRU103). __________________________________________________________ 124
3.2.3 Induction of transcription from the dctAp in various dct backgrounds. _____ 126
3.2.3.1 Generation of dct strains.____________________________________ 126
3.2.4 Analysis of transcription from the dctD promoter. ____________________ 139
3.2.4.1 Analysis of dctD expression using reporter probes. _______________ 139
3.2.4.2 Complementation analysis of the dctD promoter. _________________ 146
3.2.5 Expression from the dctAp in various strains mutated in the dct genes. ____ 151
3.2.6 Investigation of induction of transcription from the dctAp in response to
analogues of C4-dicarboxylates. ______________________________________________ 155
3.2.6.1 Investigation of the ability of various succinate analogues and asparagine
to support growth of R. leguminosarum biovar viciae strain 3841. ________________ 157
3.2.6.2 Investigation of transcription from the dctAp in response to analogues of
succinate and asparagine. ________________________________________________ 159
3.3 Discussion _________________________________________________ 163
3.3.1 Investigation of the role of DctA, DctB and DctD in sensing and induction of
transcription from the dctAp. ________________________________________________ 163
3.3.2 Investigation of the dctD promoter. ________________________________ 163
3.3.3 Role of DctA in regulating induction of transcription from the dctAp. _____ 165
3.3.4 Role of DctB in sensing C4-dicarboxylates and aspartate. _______________ 167
3.3.5 Role of DctA in interacting with DctB. _____________________________ 169
3.3.6 Conclusion.___________________________________________________ 171
Chapter One
1.1 General Introduction.
1.1.1 Introduction.
The root nodule and first strain of the rhizobia were first described more
than 100 years ago by the soil microbiologist, Beijerinck 5396. Subsequent
research has indicated that this dramatic partnership between the rhizobia and
leguminous plants is of great importance in the maintenance of an environment
suitable for life on this planet.
It is estimated that leguminous root nodules provide by far the largest
source of biologically fixed nitrogen to the nitrogen cycle 5386. In turn the
biologically fixed nitrogen is conservatively estimated to account for ~80% of
the global nitrogen fixed and available to support life on this planet 5397,5387.
As early as Roman times the benefits of leguminous plants in promoting
soil fertility were recognised and suitable crop rotation was carried out 5385.
The nitrogen fixed by this process contributes directly to the productivity of
forage and grain legumes which are important crop plants as well as indirectly to
the fertility of soils, by the release of the fixed nitrogen from these plants after
death 5387,5386,5313. Therefore the nitrogen fixed by this symbiotic process
is considered to be of great importance to all forms of agriculture. The general
importance of this process has fuelled a large amount of research into how this
association works with a view to increasing productivity and also tailoring this
process to the advantage of current agricultural practice.
1.1.2 General overview.
The symbiotic interaction between the rhizobia and leguminous plants is a
highly sophisticated process where under conditions of low fixed nitrogen in the
soil, rhizobia can infect their appropriate hosts eliciting the formation of a
2
nitrogen fixing organelle, the nodule, on the roots or stems of their partners.
Within this nodule are contained bacteroids, the differentiated form of the
bacteria where the actual nitrogen fixation occurs 1426 (Fig. 1.1). The
enzyme nitrogenase is made within these bacteroids and converts N2 into NH3
by reduction of di-nitrogen gas and protons as indicated in the following reaction
5284.
8H+ + N2 + 8e- → 2NH3 + H2.
This is a very energy intensive process requiring a minimum of 16 ATP per
molecule of nitrogen reduced and it has been estimated that the energy
requirements under certain circumstances may be as high as 42 molecules of
ATP per molecule of nitrogen fixed 437. Hence the bacteroid requires a ready
supply of carbon to produce this large amount of ATP. This is provided by the
plant, in the form of sugars produced by photosynthesis, which are translocated
to the root and used by the bacteroids in the form of C4-dicarboylic acids 3333.
Finally the bacteroid excretes the fixed nitrogen to the plant in the form of
ammonia and amino acids, completing the symbiotic relationship. This process
continues until the plant dies hence releasing its nitrogen into the biomass and
contributing to the nitrogen cycle 5387.
Fig 1.1. Diagram of bacteroid.
4
1.1.3 Taxonomy of the rhizobia family.
The rhizobia consists of three genera; Rhizobium, Bradyrhizobium and
Azorhizobium (Table 1.1). These divisions are based on modern methods of
bacterial systematics such as numerical taxonomy, Southern blotting and
hybridisation and sequencing as well as more classical criteria such as their
growth rate and host range (Table 1.2) (Young and Johnston, 1989; Jarvis et al.,
1986; Jordan, 1984)1737,5358.
The genus Rhizobium is composed of fast growing organisms with a
generation time of 2-4 hours which all fix nitrogen in association with
leguminous plants. They have in general a narrow host range and usually infect
plants found in temperate environments (Jarvis et al., 1986; Jordan, 1984)
5388. In addition, the specific genes required for the symbiotic interaction
tend to be located on large plasmids of ~1400kb in size called the sym
plasmids1737. The genera is divided into five species including Rhizobium
leguminosarum and Rhizobium meliloti. The species R. leguminosarum is
further subdivided into three biovars, R. leguminosarum biovar viciae, R.
leguminosarum biovar phaesoli and R. leguminosarum biovar trifolii, due to
their specific host range. For example R. leguminosarum biovar viciae is
capable of fixing nitrogen in association with the plant genera, Pisum, Viciae,
Lathyrus and Lens.
Members of the genera Bradyrhizobium are usually slow growing and fix
nitrogen in association with tropical plants such as soybean (Jarvis et al., 1986;
Jordan et al., 1984) The genus Azorhizobium contains only one member,
Azorhizobium caulinodans and is distinguished due to its ability to form nodules
and fix nitrogen with members of the the non-legume plant family Parasponia,
and the nodules are located on the stem (Dreyfus et al., 1988).
The organism studied in this thesis is R. leguminosarum biovar viciae.
Therefore the rest of this introduction Chapter focuses on this and other closely
related organisms such as R. leguminosarum biovar phaesoli and R. meliloti and
only includes other members of the rhizobia where pertinent and relevant to the
discussion of R. leguminosarum.
6
Table 1.1 The rhizobia family and host range.
Rhizobium leguminosarum biovar viciae Peas (Pisum spp. ); vetches (Vicia and
Lathyrus spp. ); lentils(lens esculenta ) biovar trifolii Clover (Trifolium spp.) biovar phaesoli Common beans (Phaseolus vulgaris); scarlet
runner bean (Phaseolus coccineus)Rhizobium meliloti Alfalfa/medics (Medicago spp.); sweet
clovers (Melilotus spp.); fenugreek (Trigonella foenumgraecum )
Rhizobium fredii Soybean (Glycine max )Rhizobium tropicii Bean (Phaseolus and Leucaena )Rhizobium loti Trefoils (Lotus corniculatus and L. tenuis );
lupine (lupinus densiflorus ); serradella (Ornithopus sativus ); kidney vetch (Antyyliss vulneraria ).
Rhizobium galegae Goat's rue (Galega orientalis )Rhizobium spp. Leucaena (Leucaena spp.); Gliricidia
sepium, Sesbania grandiflora, Calliandra callothyrsus, Pithocellobium dulce, Prosopis pallida, P. juliflora, Acacia senegal, A. farnsiana, Robinia pseudoacacia.
Rhizobium spp. Chickpea (Cicer arietinum )
Bradyrhizobium japonicum Soybean (Glycine max )Bradyrhizobium spp. Pigeon pea (Cajanus cajan );
peanut/groundnut (Arachis hypogaea ); limabean (Phaesolus lunatus ); winged bean (Phosphocarpus tetragonoloba ); siratro (Macroptilium atropupureum ) Guar bean (Cyamopsis tetragonolobus ); cowpea, mungbean black/green gram, rice bean (Vigna spp.)
Azorhizobium caulinodans Sesbania (Stem nodulating)
Rhizobium spp. (miscellaneous) e.g. NGR234
Various tropical legumes and the non-legume, Parasponia
Bacterial genera Host plants
From 5709.
.
Table 1.2 Relevant features of the rhizobia.
Feature Rhizobium Bradyrhizobium Azorhizobium
Growth rate in culture
usually fast usually slow fast
Location of nod and nif
genes
mainly plasmid
mainly chromosomal
probably chromosomal
Host specificity
range
usually narrow
often broad .
only one species identified
Adapted from Sprent and Sprent, 1991.
8
1.2 The symbiotic process
1.2.1 Formation of the nodule.
The first step in the establishment of a successful symbiosis is the
formation of the nodule structure on the host plant, a process known as
nodulation 1737,1488. In the genus Rhizobium, this process may be defined
as the interaction of the bacteria with the plant culminating in the development of
a successful nitrogen fixing organelle located on the roots, known as the nodule.
This process involves a series of sequential steps involving a two way
communication between the bacteria and its prospective host which is dictated by
their genetic backgrounds (Fig. 1.2) 1488.
Fig 1.2 Signalling cycle between the plant and bacteria.
Plant root morphogenesis, Root hair curling etc. leading to nodule formation.
As mentioned previously, each member of the Rhizobium species is able to
inoculate a restricted number of plant types and each host plant is nodulated by a
limited number of rhizobia. This specificity is determined by the complement of
genes the bacteria carries, known as the nod genes 1737. By extensive
genetic and complementational analysis, thirteen different nod genes have been
identified in R. leguminosarum biovar viciae and are organised into five operons
nodABCIJ, nodD, nodFEL, nodMNT and nodO
2225,1420,140,206,4718,5390,5399,3961,4357,5357,3772. These are all
located on a mega plasmid called the symbiotic plasmid pRLJI and span a ~15kb
region bounded by the two operons, nifHDK and nifAB 4718.
The nod genes can be divided into three classes known as common, host
specific and nodD. In response to a suitable inducer (provided by the plant),
these co-ordinately synthesize a molecule known as the nod factor which causes
nodule development in the plant 1737.
The first nod gene involved in nodulation is nodD 1737,4357. Its
protein, NodD, is a member of the LysR family of transcriptional activators
1737,5354,1289 and functions to promote transcription of the other nod genes
when activated in response to specific plant stimuli 1737,4357. The plant
stimuli which are required for activation of NodD have been identified as
flavonoids or related compounds and are present in plant root exudates
2225,1737,1742,5399. These compounds are highly potent activators of
NodD, in the plant’s respective symbiont, operating at concentrations as low as
10-9 M 273,5399.
Different rhizobia have different NodD proteins which respond to different
flavones, specific for different legume types. The ability of NodD to respond to
specific flavones plays a large part in determining the range of plants which a
specific species of Rhizobium can nodulate 742. R. leguminosarum biovar
viciae responds to hesperitin which is released by pea and vetch roots 1737,
while R. meliloti contains three nodD genes and responds to a wider array of
10
flavones and hence leguminous plants 2141. In addition, the number of hosts
infectable by a specific bacterium is not only dependant on the range of nodD
genes available but also the ability of the NodD proteins to respond to a spectrum
of flavones (from different plants). So while R. meliloti has three nodD genes its
host range is still narrow when compared to Rhizobium NGR234 which is a
broad host range Rhizobium whose NodD proteins respond to a wider variety of
flavones 1737.
Upon activation of NodD, it binds to a consensus sequence, known as a
nod box, which is located upstream of the operons encoding the nod genes and
allows their co-ordinate expression 1737,5399,1742,4357. The products of
these genes result in the synthesis of molecules known as nod factors
1737,5399. These compounds are secreted by the bacteria and have been
shown to induce marked deformation of root hairs 1282,1420 and induce
nodule development. 1282 at concentrations as low as 10-11. For example,
the nod factor alone from R. leguminosarum biovar viciae can induce nodule
meristems on the leguminous plant, Viciae sativa 1420.
The structure of many of these nod factors have been determined and in
both the Rhizobium and Bradyrhizobium genera, have been shown to be
variations on a theme; they all contain an acylated chito- 1-4 linked
oligosaccharide with a variety of interchangeable side groups
1787,5399,5401,5300, 1667,1282.
The complement of nod genes carryed by the specific bacteria encodes the
backbone, different side groups and final shape of the nod factors. The genes
nodABC which are among the common nod genes present in all rhizobia are
responsible for the synthesis of the core nod factor consisting of four or five n-
acetyl glucosamine residues, the first of which carries an n-linked C 18:1 acyl
group 1420,5401. Most of the host specific nod genes are involved in
modifying this basic molecule by adding or replacing specific side groups
5401 The diversity in shape of the final nod factor synthesised by the
rhizobia determines its specificity of nodulation on a particular host
5300,5399,5401. For example, in R. leguminosarum, nodF and nodE maybe
involved in the synthesis of an unusual acyl group which appears to be a key
determinant in its ability to noduluate peas and vetch 5347,1420. In addition
the final shape of the nod factor is responsible for intra cross-inoculation group
specificity, where some bacteria in the same group nodulate some legumes
preferentially 1667.
In addition to the wide range of nod genes responsible for modifying the
nod factors, other nod genes are involved in secretion of the final molecule, for
example NodI and NodJ in R. leguminosarum biovar trifolii 2680.
1.2.2 Development of the nodule.
As previously mentioned, the nod factors can induce morphogenesis in the
plant root and this leads to development of the nodule. This process takes place
in a series of co-ordinated steps defined by different stages of development of the
nodule in the plant (Fig. 1.3) 1488.
The first step is attachment of the bacteria to the root hairs, where upon
flavones secreted by the plant root are detected by the bacteria and nod factors
are produced in return 1488,5387,52. This initial stage is followed by root
curling, branching and deformation induced by the excreted nod factors (Long et
al., 1990). Bacteria become entrapped in the root hair curls and actual infection
is initiated 52,229. Bacteria enter a root hair cell and the plant responds by
forming a tube like structure known as an infection thread 52,229,1488.
Within the infection thread, the bacteria grow and it functions to deliver the
bacteria to the newly forming nodule 229. This infection thread grows in
towards the root cortex cells, some of which start to divide and form a nodule
primordium, the structure from which the nodule actually develops 229. The
nodule primordium is thought to form while the infection thread is actually
12
growing, indicating the presence of some signal generated by the formation of
the infection thread signalling ahead to the cortex cells.
Fig. 1.3 Diagram of an indeterminate nodule indicating stages in its
development.
This signal is thought to result in the plant synthesising certain molecules
known as early nodulins which are involved in the nodule primordia formation
(Vijn et al., 1992, Horvath et al., 1993). The type of nodule a particular
member of the rhizobia develops is determined by the particular cells of the root
cortex in which the nodule promordium forms 229. In R. leguminosarum
biovar viciae, the nodule primordium formed in peas and vetch is in the cells
located in the inner cortex 1488. This results in nodules which are club
shaped, have a persistent apical meristem and are known as indeterminate
Earley symbiotic zone Late symbiotic
zone. Nitrogen fixing region.
Adapted from Sprent and Sprent, 1991.
nodules 1488. The bacteroids contained within this type of nodule are
pleomorphic and individually encased in a plant derived membrane called the
peribacteroid membrane 229,5387. This type of nodule is formed in most
temperate legumes. In tropical and subtropical legumes such as soybean a
different nodule type, known as a determinate nodule, is formed which
originates from the outer root cortex cells 1488. In this type, cell division
ceases during development and cell expansion is the driving force in increasing
nodule size, which results in a nodule with a globose structure 1488. In this
type of nodule, several hundred bacteroids are surrounded by one peribacteroid
membrane 1488.
Eventually the infection thread and nodule primordium join and the threads
invade the cells located around the nodule primordium 1488. The bacteria
carried in the infection thread bud off into the cell cytoplasm and are engulfed by
the plant plasma membrane, known as the peribacteroid membrane 5400,229,
and occupy a discrete compartment within the plant cell. These begin to
differentiate and are now known as bacteroids 1488, while the infected cells
plus the bacteroids are known as symbiosomes 5400. These bacteroids within
the symbiosomes multiply until several thousand are present in a nodule. In
indeterminate nodules, the peribacteroid membrane also divides so there is
usually one bacteroid surrounded by a peribacteroid membrane 229.
Subsequent to this, division ceases and the enclosed bacteroids differentiate into
mature symbiotic bacteroids which now fix nitrogen 5400.
Concomitant with the release of bacteria by the infection thread and
bacteroid formation, further development of the nodule primordium occurs
leading to the generation of a structure known as the nodule meristem (Nap and
Bisseling, 1990) 1488. The various plant tissue types found in the mature
nodule originate from this meristem 1488. In indeterminate nodules, the
mature nodule can be divided into four zones. The invasion zone is immediately
adjacent to the nodule meristem, where release of the bacteria via the infection
14
threads continue to establish newly infected cells. This is followed by the early
symbiotic zone, where bacteria divide and plant cells enlarge. Adjacent to this
is the late symbiotic zone, in which the cells are filled with fully differentiated
bacteroids and where the nitrogen fixation process actually occurs. A fourth
zone is present in older nodules called the senescent zone in which the plant cells
and bacteroids degenerate (Nap and Bisseling, 1991; Sprent and Sprent, 1990)
1488.
In concert with this process another class of nodulins known as late
nodulins are synthesised (Nap and Bisseling, 1990). One of these, known as
legehemoglobin, is formed by the plant in the nodule and functions to control
the available oxygen in the nodule environment 1488,2080,5371. This allows
the enzyme nitrogenase, which is extremely oxygen sensitive to function and fix
nitrogen. In addition it maintains an adequate supply of oxygen to allow
metabolism of C4-dicarboxylates to actually fuel the nitrogen fixation process
5371,1488.
1.2.3 The nif and fix genes of the rhizobia.
During the development of the mature nodule, the differentiating bacteria
within it are exposed to a lowering oxygen gradient, which has been shown to
induce the expression of several bacterial genes 117,1329. As mentioned,
this lowered oxygen concentration is mediated by the nodulin, legehemoglobin,
which reversibly binds oxygen and gives rise to concentrations of between three
and thirty nmolar in the nodule environment 1634,2503,5391. A specific set
of bacterial genes are induced in response to this low oxygen level, and are those
involved in nitrogen fixation; for example the enzyme nitrogenase, which is
oxygen sensitive, and genes whose products are involved in functions related to
nitrogen fixation 3259.
The genes involved in nitrogen fixation can be divided into two groups;
the nif genes which are similar to the nif genes found in Klebsiella pneumonia
and the fix genes which are essential for nitrogen fixation but do not have
corresponding homologues in K. pneumonia (Fischer, 1994) . The nif and fix
genes of R. meliloti and R. leguminosarum are similar and their functions are as
described in Table 1.3. In R. meliloti the nif and fix genes are organised into two
clusters located on the pSymA or the megaplasmid I. Cluster one contains
fixABCX, nifHDKE, nifA, nifN and nifB while cluster II contains fixLJ, fixK,
fixNOQP and fixGHIS 2286,4127.
16
Table 1.3 The nif and fix genes of R. meliloti and R. leguminosarum.
R. meliloti
R. leguminosarum
Function
nif genes
nifH ( ) Fe protein of nitrogenasenifD ( ) subunit of MoFe protein of
nitrogenasenifK ( ) subunit of MoFe protein of
nitrogenasenifE ( ) involved in MoFe cofactor
biosynthesisnifN ( ) involved in MoFe cofactor
biosynthesisnifB involved in MoFe cofactor
biosynthesisnifA positive regulator of nif and fix
genes
fix genesfixABCX Unknown function, required for
nitrogenase activityfixNOQP microaerobically induced membrane
bound cytochrome oxidasefixGHIS redox coupled cation pump?fixLJ O2 responsive two component
sensor regulator pair involved in positive control of fixK and nifA
fixK positive regulator of fixNOQP , negative regulator of nifA and fixK .
fnrN O2 responsive analogue of fixK . Thought to replace fixLJ in R. leguminosarum.
Adapted from Fischer, 1994. indicates confirmed presence. ( ) indicates presence not confirmed but
assumed indicates not present
R. leguminosarum has been shown to posses all the major fix and most of
the nif genes. Those whose presence has not been formally shown i.e. nifHDKE
and nifN, are assumed to be present since they appear to be ubiquitous in the
rhizobia and are essential for an active nitrogenase complex (Fischer, 1994).
The regulation of the R. leguminosarum nif and fix genes is not completely
understood and differs substantially from the regulatory cascade present in R.
meliloti which is the most extensively studied (Fig. 1.4).
Fig. 1.4 Regulation of nif and fix gene transcription in R. meliloti and
R. leguminosarum.
18
In R. meliloti a two-component regulator pair, FixLJ, is responsible for
activating transcription of fixK and nifA which encode for two transcriptional
activators 2286,2287,5356. FixL is a membrane bound oxygen sensor
2092,1590,1731,836,2603, which in the absence or in the presence of low
levels of oxygen is thought to autophosphorylate at a histidine residue and
transfer this to an aspartate residue of Fix J (Bourret et al., 1991; Stock et al.,
1989). Fix J is a transcriptional activator which is thought to bind upstream of
nifA and fixK, and when phosphorylated, allows their transcription, although no
direct interaction has yet been shown 879,514,1686,5356.
FixK is a member of the Crp-FNR family of transcriptional activators
(Fisher et al., 1994) 4127 possessing a characteristic helix turn helix motif. It
is thought to bind upstream of fixN and probably fixG at a characteristic
consensus sequence known as an FNR box, allowing transcription from the
fixNOQP and fixGHIS operons, 2747,3190,2440,916,2708,5345.
Transcription of fixK is itself under positive regulation and negative auto-
regulation, thus controlling its own synthesis 1861.
NifA is also a transcriptional activator which in conjunction with 54 (an
alternative factor for RNA polymerase) 2683,5382,5375,4102 promotes the
transcription of the operons nifHDKE, fixABCX, nifN and nifB
1290,4490,4597,4124,4819. NifA binds to an upstream activator site located
approximately 80 to 150 base pairs upstream of the transcriptional start site of
most NifA dependant promoters and allows their transcription in conjunction
with 54 908,5362,5372,5361,658. Transcription of nifA is positively
regulated by FixJ and is negatively regulated by FixK 2037,2441,4217. In
addition NifA is thought to be oxygen sensitive either directly or via the redox
state of the cell in a similar fashion to FNR in E. coli. 5333,3259.
The regulation cascade in R. leguminosarum differs substantially from R.
meliloti in several key respects:
(1) No fixLJ homologues have been found in R. leguminosarum. This
has been shown by Southern blotting and hybridising with fixL and fixJ DNA
from R. meliloti, where no significant hybridisation was detected 67. In
addition a R. meliloti fixK-lacZ fusion was not expressed in R. leguminosarum
1686.
(2) Since the FixLJ system may be absent in R. leguminosarum, it
follows that the regulation of transcription of fixK and nifA are different. A fixK
homologue has been found in R. leguminosarum called fnrN, which has been
shown to activate transcription of fixN from R. meliloti, by-passing the
requirement for the FixLJK system 67. At the amino acid level, it is 30%
homologous to FixK from R. meliloti and 26% homologous to E. coli FNR 67.
Maximum homology was found in a stretch of ~22 amino acids, thought to
encode a helix-turn-helix DNA binding motif in both FixK from R. meliloti and
FNR from E. Coli. It differs form FixK in that it has an extra 21 amino acids at
its amino terminus which contains a characteristic cysteine motif which is similar
to that found in FNR in E. coli. 67,1797. It is thought that this motif,
similar to FNR, is responsible for oxygen sensing and it has been shown that
fnrN can complement some of the phenotypes of an fnr E. coli strain under
anaerobic conditions 1797. The gene fnrN has been shown to be
preferentially expressed under oxygen limiting conditions and also only to
activate R. meliloti fixN under oxygen limitation 1797. Thus FnrN is
considered to replace the FixLJK system in R. leguminosarum acting as an
oxygen responsive FixK type protein, promoting positive transcription from the
same operons;
(3) NifA, found in R. leguminosarum is similar to that from R. meliloti,
but differs in its regulation of transcription. Its upstream region contains a
typical -35,-10 housekeeping consensus sequence and so nifA is thought to be
transcribed constitutively. Its product, NifA, is thought only to become active
20
under low oxygen conditions and hence promote transcription of nifH, in
concert with 54 dependent RNA polymerase 316,149,
(4) Tn5 mutations in fnrN reduce symbiotic nitrogen fixation by
approximately 60% in comparison to the wildtype rate but do not completely
abolish it 67. This suggests that there may be other potential activators that
have yet to be elucidated from the R. leguminosarum nif and fix control systems,
which can replace or act in conjunction with FnrN and also may influence the
transcription and activation of NifA.
The result of transcription of the nif and fix genes, in response to the
conditions in the nodule environment, is that the enzyme nitrogenase is
produced and is capable of reducing atmospheric di-nitrogen to ammonia. This
ammonia produced diffuses into the plant cytosol where it is assimilated by the
plant via the enzymes glutamine synthetase and glutamate synthase, producing
glutamine and glutamate respectively 3288. These metabolites are then used
to synthesise other nitrogenous compounds, which are exported to the rest of the
plant 1685. Generally, in nodules formed by the genus Rhizobium, this
nitrogen is exported as asparagine 1685.
1.3 The carbon source supplied by the plant to the bacteroid to fuel the nitrogen fixation process.
As mentioned the enzyme nitrogenase requires a large amount of energy to
fuel the nitrogen fixation process within the bacteroid. Moreover a source of
carbon is also required for establishment and maintenance of the bacteroids and
also for the plant to assimilate the ammonia into organic compounds such as
amino acids 3333,1731.
1.3.1 Sugars are not the carbon source supplied by the
plant to fuel the nitrogen fixation process.
It has been shown that sucrose, recently formed by the plant through
photosynthesis, is translocated to the nodule 5402. However, a variety of
evidence indicates that sucrose itself is not actually used by the bacteroid as the
carbon source to support nitrogen fixation. Metabolism of sucrose in the nodule
generates significant amounts of the monosaccharides, glucose and fructose as
well as several organic acids including L-malate and succinate 5383,5404. It
is most likely that the C4-dicarboxylates, L-malate and succinate, recently
formed from sucrose, actually fuel the nitrogen fixation process in the bacteroid
1021,4403.
It has been demonstrated that strains specifically defective in the enzymes
involved in sugar metabolism, (other than those of the TCA cycle), and which
cannot grow on a variety of sugars, form normal nodules and fix nitrogen at
similar rates to the wildtype 2464,1003,1975,1976,1970. Moreover, it has
been shown that the peribacteroid membrane which surrounds the bacteroids
formed by R. leguminosarum and R. meliloti is relatively impermeable to sugars
only allowing their slow diffusion which is insufficient to support nitrogenase
activity 1183,1966. Additionally, bacteroids of R. leguminosarum free from
the peribacteroid membrane are unable to either actively transport or oxidise
glucose 1969,2111. Hence, it has been concluded that sugars are not the
carbon source used by the bacteroid to fuel nitrogenase activity.
1.3.2 Evidence that C4-dicarboxylates are the carbon source
supplied by the plant to the bacteroid to fuel nitrogen fixation.
A large body of evidence indicates that the C4-dicarboylic acids, succinate,
fumarate and L-malate, formed in the plant from carbohydrates generated by
22
photosynthesis, are the carbon source supplied by the plant to the bacteroid
3333,885.
1.3.2.1 Physiological evidence that C4-dicarboxylates fuel
the nitrogen fixation process in the bacteroid.
L-malate and succinate have been shown to be present in large amounts in
nodules formed by rhizobia 2030,5404 and are rapidly transported across the
peribacteroid membrane 1966,2033,5364,5405. It has also been shown that
C4-dicarboxylates are actively transported across the bacteroid membrane of
isolated bacteroids from nodules formed by R. leguminosarum and R. meliloti
and this is via a specific transport system
2034,885,1101,1985,756,2073,1000,2033. Moreover, C4-dicarboxylates and
especially L-malate are readily oxidised by isolated bacteroids 2111, while L-
malate and succinate support the highest rates of nitrogen fixation in isolated
bacteroids from R. leguminosarum (Bergesen and Turner, 1967) 2080.
1.3.2.2 Enzymatic evidence that C4-dicarboxylates fuel the
nitrogen fixation process in the bacteroid.
Investigation of the enzymes of the tricarboxylic acid cycle has implicated
it as a central pathway for C4-dicarboxylate metabolism in the free-living and
bacteroid form of the rhizobia 1021. Strains of R. leguminosarum or R.
meliloti deficient in succinate dehydrogenase 5411,4933 or R. meliloti with a
defective 2-oxoglutarate dehydrogenase 1978 form nodules which are unable
to fix nitrogen. In addition, in bacteroids the activities of the various
component enzymes of the TCA cycle show altered activities in comparison to
the wildtype grown on C4-dicarboxylates or glucose. Many of the component
enzymes display substantially elevated activities, indicative of C4-dicarboxylate
metabolism 339. In bacteroids of R. leguminosarum almost the whole TCA
cycle has been shown to be elevated when compared with free-living cells grown
on fumarate or glucose 339. Malate dehydrogenase displayed the highest
increase, 16-fold, followed by a 14-fold increase in citrate synthase and a 2-to 3-
fold increase in fumarase, succinate dehydrogenase and cis-aconitase. Only
isocitrate dehydrogenase remained unaltered 339,1990. This increase in the
activity of malate dehydrogenase is comparable to its activitiy measured in
bacteroids formed by R. meliloti, where malate dehydrogenase was also shown
to be elevated, though only when compared to free-living cells grown on
glucose or L-malate 106. In this case, succinate grown cells displayed
similar activities to that recorded in bacteroids 106. It has been suggested that
this significant elevation in the enzyme activities of the TCA cycle, evident in
bacteroids formed by R. leguminosarum, may be due to some mechanism
functioning in the bacteroid that either increases their rates of transcription or
increases the stability of their gene products 339.
Gluconeogenic enzymes, necessary for growth on C4-dicarboxylates by
free-living cells, have also been shown to be essential for nitrogen fixation
2035,756. Both NAD+ and NADP+ forms of malic enzyme have been
detected in free-living cells of R. leguminosarum grown on succinate or L-
malate. These are thought to function in an anapleurotic fashion, converting L-
malate into pyruvate which feeds back into the TCA cycle as Acetyl-CoA
2462,756,339. In bacteroids of R. leguminosarum both forms of the enzyme
were shown to have activities two-fold higher than their free-living counterparts
grown on fumarate or sucrose, suggesting that they are responsible for pyruvate
formation. Pyruvate dehydrogenase which converts pyruvate to Acetyl-CoA
was also two-fold elevated in the bacteroid state in comparison to the free-living
form 756. Moreover, a strain of R. meliloti which is defective in NAD+
dependent malic enzyme forms nodules but is unable to fix nitrogen, further
confirming the importance of malic enzyme 2385,1292. It has also been
shown that in R. leguminosarum phosphoenol-pyruvatecarboxykinase (PEPCK),
which functions to convert oxaloacetic acid into phosphonelpyruvate, is
24
necessary for gluconeogenisis 2464. A Tn5 induced mutant of PEPCK failed
to grow on a wide range of simple organic acids including pyruvate and
succinate 2464. In free-living cells, this enzyme displays similar activities to
both types of malic enzyme when grown on fumarate but in the bacteroid state
was almost 12-fold depressed 2462. Moreover, a Tn5 mutant of PEPCK was
still able to nodulate and fix nitrogen as effectively as the wildtype indicating
that it is dispensable 2464. Therefore, PEPCK is considered quantitatively
insignificant in the metabolism of bacteroids 756,2464. However, since it is
still detectable at low levels (in the bacteroid) it provides further evidence that
mature bacteroids do not have access to C6-carbohydrates, as it is usually
completely repressed in their presence 2464.
1.3.2.3 A functional C4-dicarboxylate specific transport
system is required for nitrogen fixation.
A functioning C4-dicarboxylate transporter is necessary for nitrogen
fixation. Bacteroids possess a specific C4-dicarboxylate transport system that is
the same system that operates in the free-living form of the bacteria
2034,885,1101,1985,756,2073, 1000,2033. Mutants impaired for C4-
dicarboxylate transport do not grow on C4-dicarboylic acids but grow on other
carbon sources and are unable to fix N2. Bacteroids formed from these Fix
minus strains have also been shown not to be able to transport C4-dicarboylic
acids 1981,1078, 1985,1986,275,2081. This directly implicates C4-
dicarboxylates in fuelling nitrogen fixation.
Strains which are defective in C4-dicarboylic acid transport still form
nodules, whose ultra structure appears the same as those formed by the wildtype
but they differ due to their small size and apparent lack of legehemoglobin
1985,1981. Invading rhizobia may utilise carbon sources other than C4-
dicarboylic acids to fuel development into morphologically differentiated
bacteroids but thereafter require a supply of C4-dicarboylic acids for effective
nitrogen fixation. 1985,1981. This is consistent with the involvement of C4-
dicarboylic acids in fuelling nitrogen fixation and not necessarily in nodule
formation. The existence of a specific C4-dicarboylic acid transport system and
its necessity for nitrogen fixation has also been demonstrated for members of the
Bradyrhizobia and Azorhizobia 1570.
1.3.2.4 Proposed enzymatic pathway involved in C4-
dicarboxylate metabolism in the bacteroid.
Based on the above evidence the likely enzyme pathways operating in the
bacteroid using C4-dicarboylic acids as the carbon source have been described
2385,3333,339 (Fig. 1.5). Succinate or L-malate is fed to the bacteroids by
the plant via the DCT system located in the bacteroid membrane. Succinate is
converted to L-malate via succinate dehydrogenase, or L-malate directly, is
cycled through the TCA cycle via malate dehydrogenase. In addition L-malate
is converted to pyruvate via a NAD+ (and possibly a separate NADP+) dependant
malic enzyme 756,2385. The pyruvate formed is converted into Acetyl-CoA
by the action of pyruvate dehydrogenase and is condensed with oxaloacetic acid
to form citrate. This allows the TCA cycle to function and generate NADH and
ATP required to fuel the nitrogen fixation process.
26
Fig. 1.5 Proposed enzymatic pathway of C4-dicarboxylate metabolism
in the bacteriod.
C4-dicarboxylates transported by the DCT system
1.4 Physiology of the DCT transport system.
1.4.1 Description of the DCT transport system.
In free-living cells transport of occurs via a C4-dicarboxylate and aspartate
inducible system which is specific for succinate, fumarate and L-malate (Finan
et al., 1981) 2073,1101. In both R. leguminosarum and R. meliloti the DCT
system has been shown to inducible by C4-dicarboxylates. High levels of
succinate transport were detected in cells grown on C4-dicarboxylates, where as
low transport rates were detected in cells grown on glucose, sucrose, arabinose
or pyruvate as the sole carbon source 275,5411. Specificity for C4-
dicarboxylates has been shown by measuring uptake of radioactive C4-
dicarboxylates in free-living cells and bacteroids. This demonstrates that they
cross- inhibit their own uptake. Other compounds such as glucose or glutamate
do not compete with C4-dicarboxylate for uptake by this system indicating that
the transporter is specific for C4-dicarboxylates
2007,756,1101,2073,1985,5411. Isolated bacteroids have also been shown to
transport C4-dicarboxylates actively 2073,1985,2007,756,1101,1981
Mutants specifically affected in their ability to grow on C4-dicarboxylates
and to transport them are also impaired for nitrogen fixation and it is assumed
that the same system operates in the symbiotic form of the bacteria as in the free-
living form 1101,1985,1981,5417.
1.4.2 C4-dicarboxylate transport by the DCT system.
The kinetic data for succinate uptake has been determined in both R.
leguminosarum and R. meliloti. In R. leguminosarum, a Km for succinate
uptake of between 1 and 3 M and a Vmax of between 20-23 nmol.(min)-1.(mg
protein)-1 has been reported for both free-living and bacteroid forms 1985.
These values are similar to those reported for succinate uptake in R. meliloti in
its free-living state; Km of 5.3 M and a Vmax of 23.9 nmol.(min)-1.(mg
28
protein)-1 1101. However the bacteroid form R. meliloti has a higher Km for
succinate of 68 M and the Vmax was similar to its free-living counterpart
(22.1 nmol.(min)-1.(mg protein)-1) 2007. Similar values are evident for uptake
of L-malate and fumarate indicating that the DCT system transports C4-
dicarboylic acids at high affinity 2007.
The uptake of C4-dicarboxylates by the DCT system has been shown to be
an active process, probably requiring an energised membrane
2073,1985,2007. In R. leguminosarum succincate uptake by this system was
reduced by 95% in the presence of the energy uncouplers, azide, CCCP
(Carbonyl Cyanide mChlorophenylhydrazone) and dinitrophenol in both free-
living cells and bacteroids while sodium arsenate had little effect on either
2073,1985. Succinate transport in the free-living form of R. leguminosarum
has also been shown to be inhibited by KCN 2075.
Similar results have also been recorded for the above energy uncouplers in
R. meliloti 2007,2559,1101. However, in bacteroids of R. meliloti, KCN
does not affect succinate transport 2007. This is thought to indicate that that
the electron transport chain responsible for energisation of the bacteroid
membrane in support of succinate uptake in bacteroids of R. leguminosarum and
R. meliloti is not dependent on a cyanide sensitive terminal oxidase and is
different to the wildtype 4541,2007.
1.4.3 Aspartate transport by the DCT system.
R. meliloti has also been shown to transport aspartate via the DCT system,
but at a much lower affinity than for C4-dicarboylic acids. A Km of 10 mM and
a Vmax of 75.8 nmol.(min)-1.(mg protein)-1 has been reported for the bacteroid
form 2007,2559. While free-living cells grown on 20mM aspartate are
reported to transport aspartate, at a rate of 40 nmol.(min)-1.(mg protein)-1 (when
assayed at 5mM) 2559. It has been shown that aspartate transport by the DCT
system is completely inhibited in the presence of low amounts of succinate
2559,2007. For example, in bacteroids, it has been demonstrated that 1/200
the amount of succinate can prevent aspartate uptake 2007. As succinate, L-
malate and aspartate have been shown to be present in the R. meliloti nodule at
concentrations ranging from 0.1-0.6 mM 2007, it is concluded that active
uptake of aspartate by the DCT system in the nodule environment is unlikely, as
it would be out-competed for transport by the amounts of C4-dicarboxylates
present 2007. This inhibition of aspartate uptake by a small amount of
succinate further indicates that in R. meliloti, aspartate has a low affinity for
transport by the DCT system.
Although the affinity of aspartate for transport by the DCT system, as
indicated, is low, aspartate is an effective inducer of the DCT system and is
capable of transporting it at high rates (when present at a high concentration)
2007. Moreover, it has been shown that mutants of any of the components of
the dct genes are unable to grow on aspartate as a sole carbon source 2559and
so it is necessary for the free-living form to grow on aspartate as a sole carbon
source and is also capable of supplying aspartate as a nitrogen source in
conjunction with another carbon source; for example when grown on
mannitol/aspartate, the DCT system is thought to supply most of the aspartate
2559.
Aspartate transport in R. leguminosarum bovar viciae strain 3841 via the
DCT system has also been measured (P. S. Poole, personal comm.). In cells
grown on glucose/aspartate and when assayed at 10mM, aspartate is transported
at ~12 nmol.(min)-1.(mg protein)-1 protein and has a Km of 4.8mM. In addition,
similar to R. meliloti, succinate inhibits aspartate uptake at a low relative
concentration. A Ki for aspartate uptake by succinate via the DCT system has
been calculated at 5 M. R. leguminosarum differs from R. meliloti in that it is
unable to grow on aspartate as a sole carbon/nitrogen source.
30
1.5 Genetic characterisation and regulation of the DCT system.
In both R. leguminosarum and R. meliloti, four genes have been identified
as necessary for transport of C4-dicarboylic acids in free-living cells. These
were found by the generation of mutants which would not grow on C4-
dicarboxylates as a carbon source and there subsequent complementation using
cosmid clones 983,801,275, 375,2561,1112,5225,5417. Two loci have been
identified; one, called the DCT region, contains three adjacent genes, dctA,
dctB and dctD and the other is ntrA which encodes for the alternative RNA
polymerase subunit, 54 275,1112,3333.
The three genes in the DCT region in both R. leguminosarum and R.
meliloti have been sequenced and analysed in detail and are comprised of a
structural gene dctA, which is transcribed divergently from the two regulatory
genes dctB and dctD (Fig. 1.6) 983,2561,375,275.. The dct genes are located
on the chromosome of R. leguminosarum 3319 and on the second mega
plasmid of R. meliloti 190,80.
Fig. 1.6 Operon structure of the DCT system.
1.5.1 The gene dctA, encoding the C4-dicarboxylate
transport permease, DctA.
1.5.1.1 Description of the dctA gene.
The dctA gene in R. leguminosarum is 1332 nucleotides in length and
encodes a protein of 444 amino acids with a molecular weight of 49000 2560.
In both R. leguminosarum and R. meliloti, analysis of the upstream promoter
region of dctA, the dctA-B intergenic region (Fig. 1.7), has identified a classical
ribosome binding site consensus sequence (AGGAGG) located 5 bp upstream
from the dctA start codon 377,2560. In addition, three regions indicative of a 54 dependent promoter have been identified which are involved in transcription
from the dctA promoter (dctAp)377,2560. A putative 54 binding site
sequence, CTGGCACGGCGATTGC, is located 93bp upstream from the dctA
start codon in R. leguminosarum and is also present in R. meliloti
2560,2173,377. This sequence is in good agreement with the accepted 54
consensus sequence, TGGCAC-N5-TTGCa/t 309 and contains the highly
conserved GG and GC doublets indicative of 54 binding sites 377. Two
inverted repeats displaying partial dyad symmetry are also located 75 bp
upstream from the end of the putative 54 binding site 377,2560. These sites
known as upstream activator sites (UAS’s), are again indicative of 54 RNA
polymerase dependant promoters which usually require an activator protein to
bind at these sites initiating transcription 122,2682 (Merrick, 1993). These
two sites are called the promoter proximal site (75bp upstream from the 54
binding site) and the promoter distal site (~15bp past the promoter distal site).
In both R. leguminosarum and R. meliloti these are ~ 24bp long and are separated
by about one turn of the double helix and so are in close proximity 377.
Transcription of dctA is positively regulated by DctB and DctD with the latter
binding to the UAS’s acting as a classical 54 dependent transcriptional activator
122,2683. Finally it has been shown that integration host factor (IHF) from E.
32
coli can bind to the promoter region of R. leguminosarum between the 54
consensus sequence and the UAS’s presumably acting to bend the DNA
3229,3169, suggesting that a homologue may exist in R. leguminosarum
although no such binding has been shown for R. meliloti.
At the 3’ end of dctA, a stable stem loop structure which is characteristic
of a rho independent transcriptional terminator is located approximately 40 bp
down stream from the dctA termination codon 2560.
Fig. 1.7 Diagram of the dctA-dctB intergenic region.
DctD binding sites
CTGGCACGGCGATTGC
34
1.5.1.2 Description of the DctA protein.
The DctA protein is highly hydrophobic with 68% apolar residues (typical
of membrane proteins) indicating it is probably located in the inner membrane
2560. Structural analysis and secondary structure predictions of DctA from R.
meliloti (which has 82% identity to R. leguminosarum at the amino acid level),
indicate the presence of 12 putative membrane spanning helices 375,5173.
In addition it has been predicted that the amino- and carboxy- terminii of DctA
are located in the cytoplasm and four conserved amino acid motifs, present in
many eucaryotic and prokaryotic transport proteins, have been identified
5173. Sequence comparisons have also indicated that it shares 40% identity
at the amino acid level to a variety of known bacterial transport proteins such as
the glutamate/aspartate transport proteins (GltP) of E. coli and Bacillus
caldotenax, as well as 26% homology to the rat GltP protein 5173,5192. The
presence of these homologies to other known transport proteins and also the
existence of these motifs indicative of transport proteins provide circumstantial
evidence that DctA is a transport protein 5173.
In addition to the sequence analysis, genetic evidence exists that implicate
dctA as coding for a protein which is the C4-dicarboxylate permease.
Transcription of dctA has been shown to be under the positive control of the two
other genes in the DCT region, DctB and DctD 950,2561,2173,1876. In the
wildtype, mutations in any of these three genes results in the loss of the ability
to grow on, or transport C4-dicarboxylates 687,1981,1101,2173,1876,950.
However in the symbiotic form, while strains mutated in dctA always display a
fix minus phenotype and do not transport C4-dicarboxylates, some strains
mutated in dctB or dctD do fix nitrogen and transport C4-dicarboxylates, albeit
at a reduced rate 1981,1101,1985. This indicates that under certain
circumstances, dctB and dctD are dispensable while dctA is absolutely required,
providing evidence that dctA actually encodes the transport permease. This is
further supported by results presented in this thesis which show that in free-
living cells when dctA is transcribed constitutively and independent of DctB and
DctD, succinate transport occurs. However, when dctA is mutated, no growth
or succinate transport is detectable indicating again that DctA is the actual
transport permease.
1.5.2 The ntrA gene, encoding for the alternative symbiotic
factor, 54.
As mentioned, transcription from the dctAp and uptake of C4-
dicarboxylates is dependent on the presence of the product of the ntrA gene,
which encodes for an alternative factor, 54 687,1112,5171. Strains mutated
in this gene display a pleotrophic phenotype and are deficient in C4-
dicarboxylate transport, nitrate assimilation and are incapable of symbiotic
nitrogen fixation 1112,687. The ntrA gene has been sequenced in R. meliloti
1112 and is 38% homologous with ntrA from K. pneumonia.
As mentioned, the dctA-B intergenic region contains a stretch of
nucleotides (CTGGCACGGCGATTGC) which is highly homologous to the
accepted 54 consensus sequence and 54 is thought to bind here
122,1815,375,2173,377. The 54 subunit of RNA polymerase confers
specificity on the core RNA polymerase for those promoters containing the 54
consensus sequence 5171. Upon binding to the 54 dependent promoter
consensus sequence, the RNA polymerase forms a closed promoter complex
(Merrick, 1993). Indicative of 54 dependent promoters, the binding of an
activator protein to the UAS’s located upstream is required to convert this closed
complex to an open promoter complex 5239,5242. As indicated previously
DctD is such an activator protein 122,2683. By a process of looping of the
DNA between the 54 binding site and the UAS’s, the activator is thought to
contact the 54 subunit 5217. As a result and probably coupled with ATP
hydrolysis, transcription from the promoter is initiated 5321,596. Once the
36
open promoter complex is formed, it can be maintained without the presence of
the activator 5239.
1.5.3 The dctB gene, encoding DctB, the sensor half of the
two-component sensor/regulator pair, DctB/DctD.
1.5.3.1 Description of the dctB gene.
Based on homology, DctB is thought to function as a sensor in a two-
component sensor/regulator system, of which the response regulator is DctD
2173,2561. In R. leguminosarum the dctB gene is 1866 basepairs in length
and is transcribed in the opposite direction to dctA encoding a protein of 622
amino acids. In the free-living state, DctB is essential for transcription from the
dctAp, as Tn5 mutants of dctB have been shown to prevent transcription from a
dctA-lacZ fusion, C4-dicarboxylate uptake and also growth on C4-dicarboxylates
as a carbon source 2173,1876,2560. The dctB gene has been shown to be
transcribed constitutively and this is thought to be from a typical 70
housekeeping type promoter 1876,2173,2560.
1.5.3.2 Description of the DctB protein.
Sequence comparisons to DctB have revealed that its C-terminus shares
homology over 200 amino acids with the C-terminus of a large number of sensor
proteins from two-component sensor-regulators 950,2173. Other examples of
these are NtrB/NtrC, EvnZ/OmpR and PhoR/PhoB 950,5226,2173.
Generally, the sensor half responds to a signal or inducer and
autophosphorylates at a conserved histidine residue located in its C-terminus. It
subsequently transfers this phosphate to an aspartate residue in its cognate
response regulator. This, now active response regulator, functions to promote
transcription from its cognate promoter(s) 5226.
DctB contains a highly conserved region, indicative of this type of protein,
from residues 412-422 and within which the conserved histidine residue is
located at position 416 (Fig. 1.8) 2173,2561. Therefore DctB is thought to
function like other members of the histidine protein kinase family, presumably
becoming autophosphorylated at this histidine residue in response to a suitable
stimulus (Stock et al., 1989). Again, indicative of this type of sensor protein,
DctB also contains two other conserved regions located in its C-terminus
2173,2561 (Stock et al., 1989). A region stretching from residue 517 to
residue 532, located ~100 amino acids past the conserved histidine residue
contains a conserved asparagine residue at position 530. A third region is
located 143 residues past the conserved histidine and extends from residue 559 to
593. This region contains five highly conserved glycine residues at positions
563, 565, 585, 587 and 589 respectively as well as a conserved asparagine
residue at position 561 2173,2561 (Stock et al., 1989).
In addition to these three conserved domains, the histidine protein kinase
family (with the exception of NtrB and CheA) usually contain a number of
hydrophobic regions located in their N-terminus which are thought to be capable
of spanning the inner membrane 2173 (Stock et al., 1989). DctB contains two
such uncharged highly hydrophobic regions at residues 25-42 and 321-328
38
2173. It is considered likely that most of the N-terminal amino acids,
residues 43-320, form a periplasmically located loop, bounded by the two
putative membrane spanning domains while the C-terminus containing the three
aforementioned highly conserved regions is located in the cytoplasm (Fig. 1.8)
2173,2561. This periplasmic loop is analogous to those found in the
chemosensory proteins of E. coli which sense signals in the periplasm.
5272,5273,5256. Hence, it has been suggested that in both R. leguminosarum
and R. meliloti, DctB acts as a membrane bound sensor that responds to the
presence of C4-dicarboxylates and transduces this signal across the membrane to
activate (phosphorylate) DctD via its cytoplasmically located C-terminus
2173,2561,333.
Fig. 1.8 Diagram of DctB indicating conserved regions and predicted
secondary structure.
Proposed membrane spanning domains.
WLALLILPLLAGAAFLL Conserved domains.
GVAH*EINQPVAConserved histidine, proposed site of phosphorylation
Predicted secondary structure of DctB
Proposed C4-dicarboxylate sensor domain
C terminal cytoplasmic tail thought to be involved in phosphorylating DctD.
Conserved Histidine 416, thought to be site of autophosphorylation
Cytoplasmic membrane
40
1.5.4 The dctD gene, encoding DctD, the regulator half of
the two-component sensor/regulator pair DctB/DctD.
1.5.4.1 Description of the dctD gene.
In R. leguminosarum, the dctD gene is 1344 basepairs in length and is
transcribed in the same direction as dctB encoding a protein 446 amino acids in
length 2173. The translation initiation site of dctD is separated from the end
of dctB by 4 bp and a potential ribosome binding site for dctD overlaps the 5’
end of dctB 2173. The dctD gene is transcribed constitutively at a low level,
although a promoter sequence has not been identified for it 2173. Hence it is
possible that dctD may be transcribed from the dctB promoter.
In R. meliloti, dctD is separated from dctB by 3 bp (377, 2561) and is has
been shown to be transcribed constitutively at approximately three times the
level of dctB 1876. This is based on a Tn5 mutation in dctB which still results
in transcription from a dctD-lacZ promoter probe, suggesting that dctD has its
own promoter 1876. This has also been indicated by complementation
analysis which suggested that dctD is a transcriptional unit with a distinct
promoter 275. However, in these reports it is acknowledged that the
possibility that weak promoter activity from vector sequences or the Tn5 located
in dctB may account for the constitutive low level dctD expression observed
275,1876. This is not an uncommon effect found with some vectors and
definitely Tn5 (Berg et al., 1980; Reid and Poole, this work) 2804. Therefore,
the reports indicating that in R. meliloti dctD has its own promoter, should be
judged with caution.
1.5.4.2 Description of the DctD protein.
DctD is thought to function as the cognate response regulator protein for
DctB and as a result of phosphorylation promotes transcription from the dctAp
2561,1815,122,2173. Based on sequence analysis DctD is a typical
cytoplasmic protein and is a member of a highly conserved group of DNA
binding, response regulator proteins 2173(Stock et al., 1989). Other
members of this group include NtrC from E. Coli, K. pneumonia, Salmonella
typhimurium, R. leguminosarum biovar phaesoli as well as NifA from R.
leguminosarum and R. meliloti 2173(Stock et al., 1989).
Based on homology with NtrC, DctD can be divided into three distinct
domains (Fig. 1.9) 2173,3229. These are the N-terminal domain comprising
the first 120 amino acids, the central domain of approximately 220 amino acids
and the C-terminal domain containing approximately the last 100 amino acids
2173,3229. The N-terminal and central domains are thought to be separated
by a protease sensitive flexible linker located at positions 332 to 345
5375,5325 and the central and C-terminal domains are also thought to be
separated by an inter domain linker (residues 332-345) 2173. The N-terminal
domain contains two highly conserved aspartate residues, at positions 12 and 55
and a conserved lysine at position 105 2173 (Stock et al., 1989). In common
with other response regulators, such as CheA, 5226,5222 this aspartate 55
residue is thought to receive a phosphate from its cognate histidine protein
kinase, DctB, when activated in response to the presence of C4-dicarboylic
acids (Stock et al., 1989). This addition of a phosphate group to aspartate 55 is
thought to lead to the activation of DctD.
42
Fig 1.9 Diagram of DctD showing conserved domains and predicted regulation of its central domain by its N-terminal domain.
N-terminal domain Central domain C-terminal domain
174-181 GETGSGKE. ATP binding motif.
417-436 VRRTIEALGIPRKTFYDKLQ. Helix-turn-Helix motif.
The Nterminal domain is thought to shield the central domain in unphosphorylated DctD.
Upon phosphorylation, the N-terminal domain of DctD is thought to un-cover the central domain, allowing ATP hydrolysis to occur and hence activation of transcription.
Central domain Central domain
Phosphorylation of DctD via activated DctB
43
The central domain of DctD contains a structural motif (residues 174-181)
known as a phosphate loop, which is common to ATP and GTP binding proteins
2173,5274,5209 and is postulated to contact the 54 RNA polymerase and play
a role in the binding of Mg-ATP and its hydrolysis. This is thought to allow
activation of transcription by the 54 dependent RNA polymerase from the dctAp
1499,5321.
Finally the C-terminus of DctD contains a helix-turn-helix motif from
residues 417 to 436, which is similar to that found in NtrC and NifA 2173.
This is probably involved in sequence specific binding of DctD to the UAS’s
located in the dctAp region 3229,5375.
1.5.4.3 Activation of DctD by phosphorylation via DctB.
Phosphorylation of both DctD and NtrC has been shown to be required for
activation of transcription from their respective promoters 3229. In the case
of NtrC, phosphorylation has also been shown to; stimulate its ability to bind to
its specific UAS’s, promote co-operative binding to adjacent UAS’s and to
stimulate the ATPase activity of NtrC 5231,5246,5203’5202,5321,1596,5172.
It is possible that phosphorylated DctD acts in a similar fashion 3229 (Stock et
al., 1989). It has been shown in R. leguminosarum, that deletion of the N-
terminal domain of DctD containing the aspartate 55 residue generates a
transcriptionally competent form of DctD. This activates transcription from the
dctAp independent of DctB and so apparently removes the requirement for
phosphorylation 1499. This suggests that the N-terminal domain of DctD
functions to control the activity of the central and possibly the C-terminal
domains of DctD (Fig. 1.9) 1499,1815. This may occur by the N-terminal
domain covering the central domain which is exposed upon phosphorylation
1499,1815.
In a comparable fashion to NtrC and NifA, as well as other 54 dependent
transcriptional activators (Stock et al., 1989), DctD has been shown to bind to its
44
specific UAS’s located ~100 basepairs upstream from the 54 RNA polymerase
binding site in the dctAp 122,2682. The C-terminal domain of DctD, which
contains the helix-turn-helix motif is thought to be responsible for the actual
binding of DctD to the UAS’s located in the dctAp region 3229,122,1815.
The dctAp contains two UAS’s and both are considered necessary for normal
transcription from the dctAp. Deletion of either results in a significant reduction
in transcription 122,1815. These UAS’s in common with those located
upstream of other 54 promoters are thought to increase the local concentration of
the proper activator protein in the vicinity of the promoter. This increases the
likelihood of productive interactions occurring between the upstream activator
protein and 54 encoded RNA polymerase. In common with NtrC, deletion of
the UAS’s does not completely abolish transcription indicating that NtrC/DctD
can also interact directly with 54 RNA polymerase although much less
effectively 122, 1815. The reciprocal of this has also been shown to occur,
where a truncated form of DctD missing its C-terminal domain and therefore its
helix-turn was capable of promoting transcription from the dctAp, presumably
by direct interaction with the 54 RNA polymerase 1499.
The central domain of DctD is thought to interact with the 54 RNA
polymerase and also hydrolyse ATP 1499. This is thought to supply the
necessary energy to open the closed promoter complex that exists prior to
phosphorylated DctD binding 3169,3229. Phosphorylation of the N-terminal
domain of NtrC increases the ATPase activity of its central domain (Weiss et al.,
1991) and DctD-Pi probably behaves in a similar fashion. In addition, ATP
hydrolysis by DctD~Pi is stimulated by it binding to its UAS’s
3229,1499,5321.
45
1.5.4.4 Binding of DctD to the UAS’s located in the dctA-
dctB intergenic region.
In both R. leguminosarum and R. meliloti, the dctA-dctB intergenic region
has been shown to contain two UAS’s known as the promoter proximal and
promoter distal site. Both sites have been shown to be essential for proper
activation of transcription of dctA, as deletion of either leads to a drastic
reduction in the levels of transcription observed from the dctAp 122, 1815.
DctD from both R. leguminosarum and R. meliloti has been shown to bind to
these tandem sites 122,3229,1815.
The interaction of DctD with the UAS’s has been studied in detail in R.
meliloti and has been shown to bind co-operatively to the tandem UAS’s in equal
concentrations. However, the promoter proximal site has been shown to have a
50- to 100- fold greater intrinsic affinity for DctD than the distal site 1815. It
has therefore been suggested that the two UAS’s may have separate roles in
allowing transcription to occur 1815. In common with NtrC, phosphorylation
of DctD is thought to aid a process of co-operative binding at the UAS’s
3169,5231,5246,5203,5202,5321,1596,5172. Therefore, it is postulated that
under non-inducing conditions, DctD is bound to the promoter proximal site for
much of the time and that upon induction by C4-dicarboxylates, DctD~Pi may
replace DctD bound to it. In addition, it is considered possible that this DctD or
DctD~Pi bound to the proximal site may encourage another molecule of DctD~Pi
to bind to the low affinity promoter distal site in a protein-protein dependent
manner 1815. It has been suggested that DctD~Pi bound to the promoter
distal site may be optimally positioned to interact with the 54 subunit of the
RNA polymerase while DctD~Pi bound to the other site would not 1815 (Fig.
1.10).
46
Fig 1.10 Diagram of proposed binding of DctD~Pi to the UAS’s in the
dctA intergenic region.
DctD has been shown to migrate as a dimer in gel filtration
chromatography 3229 and it has been shown that NtrC which also exists as a
dimer in solution must assemble into a higher order complex before it can
hydrolyse ATP and hence promote transcription 5321,1596,5185. In addition
it has been shown that an NtrC~Pi dimer alone, is unable to initiate transcription
from glnAp2 promoter and that formation of a protein complex containing at
least two NtrC~Pi dimers is required 5172. Therefore, these different
affinities for binding of DctD to the tandem UAS’s may be involved in enabling
the multimerisation of DctD molecules in a similar fashion to that thought to
occur for NtrC~Pi, giving rise to higher order protein complexes which are
functional activator complexes 3229,1815,3169. It has been reported that the
Promoter distal UAS (optimal?)
Promoter proximal UAS
Looping of the DNA between the promoter and the UAS’s allows active DctD to contact the 54 RNA polymerase.
It is considered possible that DctD~Pi bound to the promoter distal UAS may be optimally positioned to interact with the 54 RNA polymerase.
47
Vmax of ATP hydrolysis by a truncated transcriptionally active form of DctD
was increased in the presence of it UAS’s, while it had little effect on the
apparent Km for Mg-ATP 3229. Thus it is suggested that, as Vmax is due to
the amount of protein present, the increase in Vmax in the presence of the
UAS’s may be due to an increase in the number of active oligomeric complexes
that are formed, upon binding of the DctD protein to the UAS’s. This suggests
that DctD may assemble into a higher order complex prior to ATP hydrolysis and
transcription and this is mediated by it binding to the UAS’s 3229.
1.5.4.5 DctD interacts with the 54 RNA polymerase to
initiate transcription from the dctAp.
Whatever the precise mechanism of binding of DctD~Pi to the UAS’s, it is
likely that the DctD~Pi complex, in a comparable fashion to NtrC~Pi, interacts
with the 54 RNA polymerase bound downstream, promoting transcription (Fig
1.10) 3229. These interactions are thought to occur by a process of DNA
looping which may be mediated by DctD/DctD~Pi, and in which the bound
activator complex contacts the closed 54 RNA polymerase bound to the
promoter 32295361,5217,5221. In R. leguminosarum it is considered possible
that this process of looping is aided by an homologue of integration host factor
found in E. coli: DNA-protein binding assays have shown that IHF from E. coli
binds tightly upstream of the dctAp at a predicted IHF site 122,3169. Similar
to NtrC~Pi, productive interactions between the activator complex (possibly
DctD~Pi bound to the promoter distal site) and the 54 RNA polymerase are
thought to allow the isomerization of the closed complexes at the dctAp to
transcriptionally competent open complexes 5242,309,5239,5217,5221,5228.
In concert with this process, Mg-ATP is hydrolysed by the central core of the
activator protein (DctD~Pi) similar to the activation of transcription from the
glnAp2 by NtrC~Pi 5239,5321.
48
1.6 Regulation of transcription of dctA in the free-living and symbiotic form.
1.6.1 Regulation of transcription of dctA in free-living cells.
In free-living cells it has been shown that transcription of dctA is induced
in the presence of the C4-dicarboylic acids, succinate, fumarate and L-malate as
well as by aspartate 1101,2173,2560,2559. Using dctA-lacZ or dctA-phoA
fusions it has been demonstrated that in both R. leguminosarum and R. meliloti
that transcription from the dctAp is elevated approximately ten fold in cells
grown on C4-dicarboylates/ammonia (inducing conditions), in comparison to
cells grown on glucose/ammonia (non-inducing
conditions)2560,275,1876,5225. This activation of transcription has been
shown to be absolutely dependent on the two-component sensor-regulator pair,
DctB and DctD, as well as 54, as mutants in the genes encoding any of these
prevent transcription from the dctAp 275,1876,1876,2560,5225.
A model for how induction of transcription from the dctAp occurs in the
wildtype has been proposed (Fig. 11) 2173. DctB and DctD are transcribed
constitutively and DctB is thought to function as a sensor protein located in the
cytoplasmic membrane. It has been suggested that the presence of C4-
dicarboylic acids are detected via the periplasmic loop of DctB which
consequently induces DctB to undergo a conformational change. In this mode it
is thought to be autophosphorylated at its conserved histidine residue located in
its C-terminus and this is transferred to an aspartate residue (aspartate 55) located
in the N-terminus of its cognate response regulator, DctD. This induces a
conformational change in DctD whereby its central domain is exposed
enchancing its ability to bind to the UAS’s. In conjunction with 54, DctD~Pi
hydrolyses ATP and causes transcription from the dctAp. Therefore the DctB/D
two-component sensor-regulator system acts as a positive regulator system for
49
transcription from the dctAp in response to the presence of C4-dicarboylic acids
or aspartate 2173,2560,275.
Fig. 11 Proposed model of regulation of transcription of dctA in the
free-living form.
C4-dicarboxylates
C4-dicarboxylate accumulation
C4-dicarboxylates sensed via DctA or DctB
Inner membrane
DctB activates DctD
DctD~Pi promotes transcription of dctA
In the absence of DctA, DctB is thought to be permenantly activated as a default.
Inner membrane
DctB activates DctD DctD~Pi promotes
constitutive transcription from the dctAp
50
In addition to this basic model, the transport permease, DctA, has been
implicated in playing a role in controlling its own synthesis (Fig. 1.12). A
number of reports have shown that strains mutated in dctA display constitutive
levels of transcription from the dctAp 2560,1876,275.
In a dctA::Tn5 strain of R. leguminosarum, expression from a dctA-lacZ
fusion was constitutive in cells grown on glucose/ammonia and the level of
transcription evident (on glucose/ammonia) was ~ 1/2 that found in the wildtype
when grown under inducing conditions (succinate/ammonia)2560. However,
while transcription from the dctAp in a dctA strain was constitutive in cells
grown on glucose/ammonia, when this strain was grown in the presence of
succinate, a further two fold increase in transcription from the dctAp was
apparent (2560. This level was 2-3-foldhigher again than that seen in the
wildtype grown under inducing conditions conditions. Therefore this suggests
that expression from the dctAp is de-regulated in the absence of DctA although
some succinate induction effect is still evident 2560.
Two reports have demonstrated a similar occurrence in regulation of
transcription of dctA in dctA strains of R. meliloti. The first of these indicated
that transcription from a dctA-phoA translational fusion on a plasmid was
expressed constitutively when cells were grown on glucose/ammonia giving
values that were ~20 fold higher than that observed in the wildtype grown on
glucose/ammonia (non-inducing conditions) and double the values for
transcription in the wildtype grown on succinate/ammonia (inducing conditions)
275. Again, a higher level of transcription from the dctAp was recorded in a
dctA strain tested in the presence of succinate (~25% increase over that seen in
the dctA strain when grown on succinate/ammonia) indicating that succinate still
displayed some inducing ability 275. In addition, it was also shown that this
constitutive expression from the dctAp was dependent on DctB and DctD, as
dctA/dctB and dctA/dctD double mutants only had background levels of
transcription grown under the same conditions 275. In the second report,
51
again a dctA-phoA fusion was employed and constitutive expression from the
dctAp was observed 1876. In this case the level of transcription observed
from the dctAp grown on glucose/ammonia was similar to that observed in cells
grown on succinate/ammonia, suggesting no succinate induction effect. These
levels of transcription were ~6 fold higher than the values evident in the wildtype
grown on succinate/ammonia 1876.
In contrast to the above reports, another report has shown that a R. meliloti
strain containing a dctA-lacZ fusion integrated into the chromosomal copy of
dctA and displaying a succinate minus growth phenotype showed normal
induction of transcription from the dctAp in response to C4-dicarboylic acids and
aspartate and was not expressed constitutively in cells grown on
glucose/ammonia (Bastista et al., 1992). They suggest that the use of a different
R. meliloti strain may be a possible reason for the apparent discrepancy in
comparison to the above reports.
Based on the reports indicating constitutive un-regulated or partially
regulated transcription from the dctAp in the absence of DctA, it has been
suggested that DctA plays a role in regulating its own synthesis and is required
for correct regulation of transcription from the dctAp 1876,275,950. As
mentioned this regulation has been shown to be mediated by DctB and DctD and
the following model, which is an extension of that previously described includes
a role for DctA in the regulation of transcription from the dctAp in free-living
cells (Fig. 1.11) 2173. As mentioned, DctB is thought to be located in the
periplasmic membrane and sense the presence of C4-dicarboylic acids
2173,3333. In addition it is suggested that in the absence of substrate, DctA
and DctB may interact with each other in the cytoplasmic membrane and prevent
activation of DctB. Upon binding of a C4-dicarboxylate, DctB would be
released and activate DctD as before. Implicit in this model, is the concept that
in a dctA strain, DctB is thought to be converted into the same activated mode as
when C4-dicarboxylates are detected in the wildtype 275, 3333. This suggests
52
that the role of DctB, in being regulated by DctA, is passive and dependent on
the state of DctA. When DctA dissociates from DctB either by binding of C4-
dicarboxylates or due to mutation of dctA, DctB is thought to be converted into
its active form.
A modification of this model, whereby DctB senses the C4-dicarboxylate
dependent conformational state of DctA, rather than sensing C4-dicarboxylates
directly has been proposed 275. Thus, the transport protein would undergo a
conformational change, as a result of binding or transporting substrate, which
would result in the release and/or activation of DctB. However, another report
using R. meliloti has disputed this latter proposition 2559. By measuring the
ability of aspartate to induce C4-dicarboxylate transport, high levels of induction
of DctA dependent transport (measured using succinate) were observed at
concentrations of aspartate which were severely limiting for its transport as a
substrate. This suggests that a high rate of aspartate transport via DctA is not a
prerequisite to induction of transcription from the dctAp suggesting that transport
of the substrate by DctA is not necessary for activation of DctB 2559.
1.6.2 Regulation of transcription of dctA in bacteroid.
Transcription from the dctAp in bacteroids also requires DctB/ DctD and 54 for optimal rates of nitrogen fixation 275,1876. However, it differs from
free-living cells in that under certain circumstances DctB and DctD are
dispensable, although a ~50% reduction in nitrogen fixation is evident
2173,1876,275,3333. It has been shown that in the symbiotic state, some
strains mutated in dctB and all strains mutated in dctD, display transcription from
the dctAp independent of DctD. Succinate is transported at a reduced rate
375,275,801 and nitrogen fixation takes place, although at a lower rate than in
the wildtype 275,375,2560 (O'Gara et al., 1989). Thus it has been suggested
that an alternative symbiotic activator may exist which can replace the role of
53
DctD~Pi as the transcriptional activator of transcription from the dctAp in the
symbiotic state2173.
As discussed later (section 1.7), it has been documented that under certain
conditions, two-component sensor-regulator pairs are capable of cross regulating
other non-cognate promoters (Stock et al., 1989) 5191,2684. Since DctB and
DctD comprise a two-component sensor-regulator pair, a variety of candidates
which function as transcriptional activators, have been considered as the
postulated alternative symbiotic activator of dctA transcription in the symbiotic
state 3333.
One such candidate is NifA whose UAS is similar to that of the UAS’s
found in the dctAp and which is active in the nodule environment 1876,2173.
However, it has been demonstrated that dctA transcription was not activated by
NifA, even under oxygen limitation, where NifA is capable of promoting
transcription from the nifHDK promoter 2237,5225. It was further shown
that, in a dctB/nifA or a dctD/nifA double mutant, transcription from a dctA-lacZ
fusion still occured in the symbiotic state 1876. This indicates that NifA can
be excluded as the postulated alternative symbiotic activator. Other regulators
of the nitrogen fixation genes, such as FixL and FixJ, which also function as
transcriptional activators and are active in the nodule environment, were also
unable to promote transcription from the dctAp in the wildtype, under conditions
where they are capable of promoting transcription from their cognate promoters
1876,5408.
To date no alternative symbiotic activator has been identified and it
remains unknown whether the putative alternative symbiotic activator is a
specific protein for transcription from the dctAp under symbiotic conditions or
possibly cross-regulation at the dctAp by other response regulators.
It is also possible that this alternative symbiotic activation may be partly
caused by the environment of the nodule which may exert specific effects on
DctA transcription 3333. It has been shown that in a R. meliloti dctA strain,
54
transcription from the dctAp can be induced by osmotic stress, low calcium
levels, and also may be influenced by DNA topology and supercoiling 1536.
Therefore, these or other factors found in the symbiotic environment, possibly
mediated by as yet undiscovered two-component sensor-regulator pairs, may
influence transcription from the dctAp 3333.
As mentioned previously, succinate transport and nitrogen fixation rates
are substantially reduced in dctB or dctD strains. Therefore it is most likely that
DctB and DctD function to activate transcription from the dctAp in the symbiotic
state under normal wildtype conditions and that the proposed altenative
symbiotic activator is an artifact of generating dctB or dctD mutants. However
it is possible that any or combinations of the above may augment this DctB/D
dependent transcription under normal conditions.
1.7 Cross-regulation of transcription from the dctAp by systems other than DctB/D.
1.7.1 Introduction.
A variety of reports have suggested that cross-regulation in response to
signals other than those propagated by C4-dicarboxylates and aspartate may,
under certain conditions, cause transcription from the dctAp. As previously
described, DctB and DctD comprise a two-component sensor-regulator pair
2173. A large family of similar systems are known to exist in bacteria and
based on hybridisation studies using known response regulators as probes, it is
postulated that up to ten distinct two-component sensor-regulator systems which
regulate transcription from 54 dependent promoters, may exist in R. meliloti
377. In general 54 dependent two-component sensor-regulator pairs display
significant homology to each other at the amino acid level and are thought to
operate in a similar fashion 5191,5226. A conserved histidine residue in the
55
C-terminus of the sensor partner is thought to be phosphorylated in response to a
specific stimulus. This activated sensor is thought to transfer its phosphate
group to a conserved aspartate residue located in the N-terminus of its cognate
response regulator, causing its activation 5226,5191,2684,2683. In 54
dependent promoters, an activated response regulator usually binds to specific
sequences (UAS’s), located upstream from the promoter and interacts with the 54 RNA polymerase, causing transcription 5226,2683. A variety of reports
have indicated that, due to their modular structure, two-component sensor-
regulator pairs are susceptible to cross-regulation by other two-component
sensor-regulator systems 2684,5226,5191. This is thought to occur in two
ways:
(1) The response regulator may become phosphorylated by a non-
cognate sensor protein,
(2) Under certain circumstances an activated transcriptional response
regulator may bind to non-cognate UASs or may interact directly with a 54 RNA polymerase bound to a non-cognate promoter, causing
transcription.
1.7.2 Evidence for cross-regulation of transport from the
dctAp by systems other than DctB/D.
It has been reported that in a dctA strain of R. meliloti, transcription from a
dctA-lacZ fusion was observed in cells grown under osmotic stress and calcium
limitation 1536 indicating that disparate environmental conditions can cause
transcription from the dctAp.
One possibility that may account for these results is that cross-regulatuion
may occur. It is unknown what systems mediate the cells response to these
conditions, but it is possible that it responds by inducing transcription of specific
genes whose products function to adjust to the altered conditions. In E. coli the
56
system that responds to osmotic stress is the EnvZ/OmpR two-component
sensor-regulator pair, where OmpR is a response regulator 5226. Thus, a
similar system may exist in the rhizobia and under suitable conditions, and at
least in an dctA strain, cross-regulate transcription from the dctAp.
It has also been suggested that transcription from the dctAp may occur in
response to nitrogen starvation (B. Gu and B.T. Nixon, unpublished results in
1815). Wildtype R. meliloti grown under such conditions are reported to
display a three-fold increase in transcription from the dctAp (presumably above
background levels under non-nitrogen limiting conditions). This again suggests
the possibility that a response regulator, active under such conditions (such as
NtrC~Pi) can function to promote transcription from the dctAp, under conditions
where transcription would not normally be expected to occur.
Another report has also suggested the possibility that NtrC may cross-
regulate transcription from the dctAp. In this report, a mutated allele of NtrC
was isolated which contained a basepair change in its helix-turn-helix motif,
involved in DNA binding. This appeared to cause a derepression of its
synthesis, with the result that it was constitutively expressed and active 2447.
This allele suppresses the phenotype of a dctD::Tn5 mutant, allowing growth on
succinate2447. In addition, it promotes transcription from the three 54
encoded promoters, nifHDKEp, glnIIp and dctAp, which require the activator
proteins, NifA, NtrC and DctD respectively for transcription 2447. Due to
the high concentration of this protein and because it is constitutively active, it is
considered likely that the activation of transcription from the three 54 encoded
promoters is due to the mutated NtrC protein directly contacting the 54 RNA
polymerase 2447. In so doing this is thought to catalyse the opening of a
closed promoter complex, allowing transcription. This is further supported by
the fact that activation of transcription from the dctAp by this altered NtrC
occurred in the absence of the dctA UASs. However, in the presence of its
UASs, a further ten-fold increase in transcription from the dctAp was evident.
57
This suggests that the altered NtrC may be capable of binding, perhaps at low
affinity, to the dctAp UASs enhancing the level of transcription 2447. These
results show that under certain circumstances, activated response regulators
(such as NtrC~Pi) may cross-regulate transcription from other non cognate 54
encoded promoters such as from the dctAp.
It has been suggested that transcription from the dctAp can also be affected
by global regulatory changes such as DNA supercoiling 1536 which may
result from environmental changes experienced by the cell. It has been shown
that DNA supercoiling affects transcription from many bacterial promoters and is
controlled by maintaining a balance between DNA gyrase and DNA
topoisomerase I 5365. It has been reported that in a dctA strain, transcription
from the dctAp occurred in cells grown under osmotic stress or calcium
limitation 1536. It was also demonstrated that the addition of specific
inhibitors of DNA gyrase prevented this transcription from the dctAp caused by
the aforementioned environmental changes. This suggests that transcription
from the dctAp may be susceptible to changes in DNA supercoiling mediated by
the environment of the cell 1536.
58
1.7.3 Potential role of DctD in minimising cross-regulation
of transcription from the dctAp.
Besides the role of DctD in promoting transcription from the dctAp, it has
also been demonstrated that DctD may act to repress transcription from the
dctAp, and by doing so, possibly prevent cross-regulation of transcription from
the dctAp by non-cognate response-regulators under non-inducing conditions
2448,1815.
Using the altered ntrC allele described above, it has been reported that
while constitutive dctA transcription was evident in a dctD strain, that in a dctD+
strain containing this altered allele, a high level of dctA transcription was only
evident in succinate grown cells (inducing conditions for dctA transcription in
the wildtype) and not in glucose grown cells 2448. Therefore, it has been
suggested that in un-induced cells, inactive DctD binds to the dctAp and
prevents transcription by this altered ntrC allele 2448. This was further
supported by the observation that over-expression of dctD from a plasmid
promoter in this strain prevented dctA transcription, resulting in a Dct minus
phenotype 2448. This suggests that inactive DctD may bind to its UAS’s and
prevent other active response regulators from activating transcription from the
dctAp.
A similar role for inactive DctD in preventing cross-regulation of
transcription from the dctAp has been suggested to account for the fact that while
most dctB strains still fix nitrogen, some lose this ability 2173. In these
particular strains, the mutation in dctB (induced by Tn5 or NTG mutagenesis)
may be polar on dctD. Therefore, it is suggested that dctD is transcribed
(possibly from a promoter in Tn5 or in the case of NTG mutagenisis by a cryptic
promoter in DctB) and DctD would be inactive, due to dctB being mutated and
unable to phosphorylate it. This inactive DctD is envisaged as binding to the
dctAp UASs and preventing activation by other promiscuous response regulators,
or a postulated specific alternative symbiotic activator 2173.
59
In addition to inactive DctD occupying its UASs, it has been suggested
that DctD bound to the UASs may form a complex with 54 RNA polymerase,
rendering it inaccessible to direct activation by promiscuous response regulators
through direct contact with the 54 RNA polymerase and so minimise the
occurrence of cross-regulation 2448. It is considered possible that the
previously described altered ntrC allele 2447, can promote transcription from 54 encoded promoters by direct interaction with the 54 RNA polymerase.
However, when dctD is present under non-inducing conditions or when it is
over-expressed, transcription from the dctAp is prevented 2448.
Over-expressed inactive DctD bound to the UAS’s is also thought to
prevent transcription from the dctAp by DctD~Pi 1815. This may be due to
DctD causing suppressed looping of the DNA between the UAS’s and the 54
binding site preventing active DctD~Pi from gaining access to the 54 RNA
polymerase 1815. In R. meliloti, DctD is thought to bind to the promoter
proximal UAS at a ~100 fold greater affinity than to the promoter distal UAS and
DctD~Pi bound to the promoter distal UAS may be optimally positioned for
interacting with the 54 RNA polymerase 1815,3229,3169. Moreover, it has
been suggested that DctD would be bound to the promoter proximal UAS for
much of the time under non-inducing conditions. When induced, DctD bound
at this site may function to encourage DctD~Pi to bind to the promoter distal
UAS by a protein-protein interaction, allowing transcription to occur. It is
postulated that sometimes, either of these two sites may be occupied by the
wrong response regulator and that occupancy of the promoter proximal UAS by
DctD may act to insulate the promoter from other promiscuous response
regulators binding to the promoter distal site. This is thought to be due to the
postulated ability of DctD bound at the promoter proximal UAS to play a role in
recruiting another molecule of DctD to the promoter distal UAS. This might
occur by a specific protein-protein interaction between DctD molecules. This
60
contact would not be as effective when DctD encounters other response
regulators, introducing specificity 1815.
In summary, evidence exists that cross-regulation of transcription from the
dctAp can occur either by the binding of an inappropriate response regulator to
the UAS's or by direct interaction of a activated response regulator with the 54
RNA polymerase bound at the dctAp. In addition DNA supercoiling may
influence expression from the dctAp. There is also evidence that the dctAp
minimises this cross-regulation by DctD occupying its UASs under non-inducing
conditions and preventing other active response regulators from gaining access.
It is also possible that bound DctD may loop the DNA between the promoter and
the UASs preventing direct access to the 54 RNA polymerase by an
inappropriate activator protein.
61
1.8 The role of C4-dicarboxylates in mediating catabolite repression.
A variety of reports have indicated that R. leguminosarum is subject to
catabolite repression by C4-dicarboxylates. 2553, 339, 2536. These reports
are in agreement with C4-dicarboxylates being the preferred carbon source in
Rhizobium 339. In the presence of two carbon sources, succinate and
glucose, R. meliloti has been shown to exhibit di-auxic growth, utilising the
succinate first and only then using the glucose 3333 and similar results for
succinate in conjunction with lactose and fructose have been obtained
2536,5412. This is comparable to Pseudomonas aeruginosa, where succinate
has also been reported to be the preferred carbon source, and displays catabolite
repression mediated by C4-dicarboxylates 2537, 1429. It has recently been
shown that the myo-inositol catabolic pathway in R. leguminosarum is subject to
C4-dicarboxylate mediated catabolite repression3320. In addition, a
functioning DCT system was necessary and intracellular accumulation of a C4-
dicarboxylates via the DCT system was required 3320. This was
demonstrated by using a strain which transcribes dctA constitutively and showing
that repression of the myo-inositol pathway only occurred in the presence of C4-
dicarboxylates; i.e. expression of the DctA protein alone was not sufficient to
mediate this catabolite repression effect 3320. Succinate has also been shown
to exert a repressive effect on -galactosidase expression in R. meliloti and
again it has been shown that this repression requires an intact DCT system
2804. It has therefore been suggested that accumulation of C4-dicarboylic
acids via the DCT system is a prerequisite for any catabolite repression to occur
by them.
It is not known how this catabolite repression is actually mediated in
rhizobia. In E. coli, catabolite repression is mediated by the phosphoenol
dependent phospho-transferase system (PTS) and control is exerted by level of
62
cAMP in circulation, which is a function of the carbon source. When cells are
grown on carbohydrates transported by the PTS system such as glucose (its
preferred carbon source), cAMP levels are low, while in the presence of non
PTS carbohydrate such as maltose or succinate, cAMP levels are elevated. A
further protein, cAMP Receptor Protein (CRP), mediates the activation of the
required catabolic genes at the transcriptional level, in conjunction with this
increased level of cAMP 5414.
An analogous system has not been identified in the rhizobia 1021 and
cAMP has been shown not to be taken up by rhizobia (Borsford and Harman,
1992). However it has been suggested that an as yet unidentified CRP like
protein may have a role in mediating catabolite repression in R. meliloti 2453.
This is based on evidence that in E. coli, CRP can repress transcription from the
R. meliloti dctAp, suggesting that a similar type protein may exist 2453.
63
1.9 The role of the DCT system in mediating chemotaxis.
R. leguminosarum and R. meliloti have been shown to respond
chemotactically to the presence of C4-dicarboxylates 2435,5352,4986. In R.
meliloti chemotaxis has been shown to be independent of C4-dicarboxylate
transport as a response was still evident in a dctA or dctABD strain 2435.
However is was also noted that in the presence of a functioning DCT system,
chemotaxis to succinate was enhanced by approximately one third. This
suggests that, while chemotaxis to C4-dicarboxylic acids and transport are
independent, there is some form of interconnection between the two 2453.
R. meliloti and R. leguminosarum also display chemotaxis to aspartate
2435,5352,4986. In R. meliloti, this chemotaxis is thought to require DctD,
as no reduction in it was evident in dctA or dctB strain while it was severely
diminished in a dctABD strain 2435. In addition it was shown that a mutated
rpoN gene encoding 54 displayed a similar effect on aspartate chemotaxis as the
dctABD strain. Therefore, it is suggested that in R. meliloti, besides
transcribing dctA, DctD in conjunction with 54, may also play a role in
transcription of one or more genes involved in, but not essential for, aspartate
chemotaxis 2435.
64
1.10 Effect of over-expression of dctA on nitrogen fixation.
The effect of dctA expression and C4-dicarboxylate transport in R. meliloti
has been examined in the wildtype and a series of Fix minus strains and it is
reported that the level of dctA transcription in the Fix minus strains was the same
as in the wildtype 1876. However, C4-dicarboxylate transport was reduced by
about 50% in all the fix minus strains. Therefore, it was concluded that the rate
of C4-dicarboxylate transport is a function of the nitrogen fixation process. In
the presence of an active nitrogenase, succinate transport is highest 1876.
This suggests that the rate of nitrogen fixation may limit the C4-dicarboxylate
transport rate 3333.
The effect of over-expressing an integrated copy of dctA under the control
of the constitutive trpPO promoter from Salmonella typhimurium 1697 has
also been investigated. Analysis of dctA mRNA indicated that the level of dctA
transcription in this strain was five-fold elevated in comparison to the wildtype,
but no increase in succinate transport was detected when compared to the
wildtype grown on succinate 1697. Acetylene reduction assays indicated that
the plants innoculated with this strain displayed a significant increase in the rate
of nitrogen fixation when compared to the wildtype. However, this was not
reflected in the plant yield, with plants innoculated with the wildtype or the
mutant having the same top dry weight. Therefore, it was concluded that if the
increased acetylene reduction rates are indicative of an increase in nitrogen
fixation, then the extra nitrogen is either unavailable to the plant or is in excess
of its requirements 1673.
However, the yield of Alfalfa grown in the field, inoculated with R.
meliloti containing an extra copy of the dctABD genes and nifA integrated into
the chromosome did show an increase in yield at least under conditions of
nitrogen limitation, low levels endogenous rhizobia competitors and sufficient
65
moisture (Bosworth et al., 1994). However this increase in yield could be due to
the extra copy of nifA.
1.11 Aspartate transport in R. leguminosarum and
R. meliloti by systems other than the DCT system. 1.11.1 Aspartate transport in R. meliloti.
Besides the low affinity aspartate uptake mediated by the DCT system,
both R. leguminosarum and R. meliloti possess other amino acid specific
transport systems which are capable of transporting aspartate. In R. meliloti, an
aspartate transport system which can also transport glutamate at a high affinity
has been reported 2559. This aspartate/glutamate specific transport system
was shown to be regulated independently of the DCT system and its induction
did not co-activate it. It is regulated partly in response to nitrogen status but
does not show direct induction by aspartate 2559. It has a Km for aspartate
of 1.5mM which is 1/4 that of the DCT system for aspartate.
1.11.2 Aspartate transport in R. leguminosarum.
A general amino acid permease (AAP) has been shown to exist in R.
leguminosarum 1026. This system transports a wide range of amino acids at a
high affinity including glutamate, aspartate, alanine, leucine, histidine and
proline 1026. The operon encoding this transporter has recently been cloned
and is comprised of four genes aapJ, aapQ, aapM and aapP (Walshaw and
Poole, personal comm). The gene aapP is thought to encode the ATP binding
subunit of an ABC type transport protein (AapP) while aapQ and aapM encode
the integral membrane components. The gene aapJ is thought to encode a
periplasmic amino acid binding protein (AapJ). Moreover, transcription from
66
this operon appears to be subject to control by NtrC (Walshaw and Poole,
personal comm.).
This concurs with the pattern of regulation of actual amino acid transport
observed. Amino acids are transported constitutively by this system in cells
grown on glucose/ammonia and show a 1-to 4-fold increase in corresponding
transports rates when grown on glucose/glutamate suggesting that it is regulated
in response to nitrogen source 1026 A Km for glutamate transport by this
system has been determined at 0.081 m and glutamate transport is
competitively inhibited by both aspartate and alanine with apparent Ki values of
0.16 m and 2.3 m respectively. Aspartate uptake by this system is easily
distinguished from aspartate uptake by the DCT system by measuring rates of
uptake at 25 M. At this concentration aspartate uptake occurs at very low rates
via the DCT system due to its low affinity for aspartate (5mM) while the AAP
transports aspartate at a much higher affinity.
Aspartate transport by this system has been studied in detail (Poole and
Walshaw, p.c.). In cells grown on glucose/ammonia, a nitrogen excess
condition, aspartate uptake by the AAP is ~2 nmol.(min)-1.(mg protein)-1 while
when grown on glucose/glutamate, which is a nitrogen limiting condition, the
transport rate is increased to ~12 nmol.(min)-1.(mg protein)-1. Interestingly,
when uptake by this system is measured in cells grown on glucose/aspartate,
which should be a nitrogen limiting condition comparable to cells grown on
glucose/glutamate, a repressed level of transport by the AAP is observed and
this rate is lower than the rate observed in glucose/ammonia grown cells (Poole
and Walshaw, personal comm.). Under these conditions uptake of other amino
acids such as glutamate and alanine is also repressed . This effect is specific to
aspartate when supplied as the nitrogen source in conjunction with a non-C4-
dicarboylic acid as the carbon source. When other amino acids are supplied in
conjunction with glucose or when aspartate is supplied in conjunction with
succinate, normal derepression of aspartate uptake by the AAP is observed.
67
This suggests that in cells grown on aspartate and a non-C4-dicarboxylate,
aspartate functions to repress uptake of amino acids by the AAP (Poole, personal
comm.).
68
1.12 Regulation of ammonia assimilation and the NTR system in Rhizobium.
The enzymes of ammonia assimilation and their regulation by the NTR
system have been studied extensively in Rhizobium. They are comparable to
that found in the enteric bacteria, which is considered to be a model system.
Therefore, regulation of ammonia assimilation and its control by the NTR
system is first described in the enteric bacteria and is subsequently compared to
R. leguminosarum.
1.12.1 The NTR system and regulation of ammonia
assimilation in the Enteric bacteria.
In the enteric bacteria, E. coli, Salmonella typhimurium and Klebsiella
pneumonia, two pathways of ammonia assimilation have been identified
5410. One is a low affinity system which functions optimally at high levels of
ammonia. This utilises the enzyme glutamate dehydrogenase and by a process of
reductive animation, α-ketoglutarate is combined with ammonia forming
glutamate. The other is a high affinity system, functioning at levels of ammonia
below 1mM, and utilises the two enzymes glutamine sythetase (GS) and
glutamate 2−oxoglutarate amino transferase (GOGAT) as follows:
GS: Glutamate + NH4+ + ATP→ Glutamine +ADP
GOGAT: Glutamine + 2- ketoglutarate +NADH→
2 Glutamate+NAD+
This process requires ATP and is consequently finely controlled, only
operating under nitrogen limiting conditions where it is most effective, while the
GDH pathway operates under nitrogen excess 5410.
Regulation of the GS/GOGAT pathway is manifested in tight control of GS
in response to ammonia availability and this is mediated both at the
transcriptional and post-translational level 5410,5409. GS is subject to
69
adenylylation which occurs in response to nitrogen excess conditions and
reduces its activity for ammonia assimilation. GS functions optimally when the
enzyme is completely deadenylylated. Adenylylation of GS is carried out by an
enzyme called adenylyl transferase which can also act in reverse to
deadenylylate GS under conditions of low available ammonia, and its activity is
controlled by another protein, called PII. PII exists in two forms; PII
adenylylating and PII deadenylylating, and switches between them according to
the extent by which it, itself is modified by uridylylation. The enzyme
uridylyltransferase is responsible for attaching and removing a UMP residue to
PII. This occurs in response to the glutamine/α-ketoglutarate ratio in the cell,
which is a reflection of ammonia availability. Under conditions of low
glutamine/α-ketoglutarate, uridylyltransferase is active and transfers uridylyl
groups to PII. PII in its uridylylated form interacts with adenylyl transferase,
causing de-adenylylation of GS and hence converting it into its active form. The
reverse occurs when a high glutamine/α-ketoglutarate ratio is detected in the
cell, indicative of nitrogen excess conditions. PII is deuridylylated and interacts
with the PII allowing it to adenylylate GS, reducing its ability to assimilate
ammonia 5410,5409.
The transcription of the gene encoding GS, glnA, is also regulated in
response to ammonia availability, and three regulatory genes have been
identified as necessary to regulate its transcription. They are ntrA (encoding 54), and ntrB and ntrC which encode a two-component sensor-regulator pair. In
all the members of the enterobacteriacia studied so far the genes, glnA-ntrB-
ntrC comprise a complex operon whose expression can be initiated by either a
promoter located between glnA and ntrB (glnP) or by either of two promoters
located upstream of glnA (glnAp1 and glnAp2) and reading through into ntrB and
ntrC. Under nitrogen limiting conditions expression of ntrB-ntrC is primarily
due to glnAp2. This promoter contains a σ54 binding site and requires an
accessory activator protein to bind upstream of the 54 RNA polymerase, to
70
allow transcription. This protein is NtrC, which is the response-regulator of
NtrB/NtrC pair. NtrB, the sensor half, responds to levels of available nitrogen
mediated ny PII and URtase acting as a kinase or phosphatase on NtrC. Under
conditions of low available nitrogen, it acts as a kinase on NtrC,
phosphorylating it, which enables it to activate transcription from the glnA-ntrB-
ntrC operon, hence producing GS 5253,503.
The state of NtrB is controlled by the same cascade of enzymes that control
adenylylation/deadenylylation of GS 5410,5409,5253. Under conditions
where the glutamine/α-ketoglutarate ratio is high, PII is in its deuridylylated
form and is capable of interacting with NtrB, forcing it to be a phosphatase with
respect to NtrC. As a consequence NtrC is inactive and no transcription from
the glnAp2 occurs. When the glutamine/α-ketoglutarate ratio is low, PII is
uridylylated and in this form it no longer interacts with ntrB. NtrB then acts as a
kinase on NtrC which promotes transcription of GS from the glnAp2 promoter
and hence ammonia assimilation by GS 5410,5409.
1.12.2 Ammonia assimilation in Rhizobium and its
regulation by the NTR system.
The assimilation of ammonia by R. leguminosarum and R. meliloti occurs
in a similar fashion to that found in the enteric bacteria. Under conditions of
ammonia excess, the primary assimilatory enzyme is glutamate dehydrogenase,
while under ammonia limiting conditions, GS and GOGAT are active 2058.
Most of the members of the rhizobia family possess two glutamine
synthetase isozymes, GSI and GSII while a few members including R.
leguminosarum also possess a third form of the enzyme, GSIII
5416,1747,2314,1749. GSI in R. leguminosarum, encoded by glnA, is
similar to the form of GS found in the enteric bacteria and its activity is regulated
by the adenylylation deadenylylation mechanism 1410,512. GSII in R.
leguminosarum, encoded by glnII, is similar to the form of GS found in
71
eukaryotes and its transcription is regulated by nitrogen and oxygen availability
512,1749. GSIII from R. leguminosarum, encoded by glnT, is also
homologous to several members of the GS family of enzymes 1747.
In a comparable fashion to the enteric bacteria, similar genes and
signalling systems that control the cells response to ammonia and nitrogen
availability are present in R. leguminosarum, although some differences are
apparent (Fig. 1.12). In R. leguminosarum biovar phaesoli, three operons have
been identified as playing key roles in nitrogen regulation:
(1) orfI-ntrB-ntrC, where ntrB and ntrC code for the two-component
sensor-regulator pair, NtrB/NtrC, which is analogous to the NtrB/NtrC
two-component sensor-regulator pair found in the enteric bacteria 2587.
The function of the orfI located upstream of ntrB-ntrC is unknown, but in
contrast to the enteric bacteria, the whole operon is transcribed from a
normal housekeeping promoter located upstream of orfI 2587. In
addition, putative NtrC repressor binding sites are located here, so
transcription of the orfI-ntrB-ntrC operon is autogenously repressed by
NtrC. This is again, in contrast to the operon encoding NtrB and NtrC in
the enteric bacteria which is positively transcribed by NtrC~Pi
2587,1556;
(2) The gene glnII, encoding GSII, is subject to positive regulation of
transcription by NtrC~Pi in response to nitrogen availability,
(3) The glnBA operon, which encodes for a PII homologue and GSI is
also positively transcribed by NtrC~Pi in response to nitrogen availability.
It has also been suggested that, in a comparable fashion to the enteric
bacteria, PII controls the ability of NtrB to act as kinase/phosphatase with
respect to NtrC (Fig. 1.12) 2613,2815. It is considered likely that PII is
regulated by uridylylation and deuridylylation, in response to the
72
glutamine/ ketoglutarate ratio of the cell 503,2815. Under nitrogen excess
conditions, when the glutamine/ ketoglutarate ratio is high, PII is
deuridylylated and thereby in an active form. This form of the enzyme, similar
to that previously described for the enteric bacteria, interacts with NtrB, causing
it to act as a phosphatase with respect to NtrC. When the reverse situation
occurs and the glutamine/ ketoglutarate level is low, PII is uridylylated,
thereby inactivating it. This inactive form is thought to allow NtrB to function
as a kinase with respect to NtrC and so activates it. NtrC~Pi has been shown to
promote transcription of the glnII and glnA genes in conjunction with 54, and
also functions to repress transcription from the orfI/ntrB/ntrC operon 2815.
73
Fig. 1.12 Proposed NTR regulatory pathway in R. leguminosarum.
Uridylylated PII inactive. Unable to prevent NtrB acting as a kinase on NtrC.
Deuridylylated PII active. Functions to prevent NtrB acting as a kinase on NtrC.
NtrC~Pi promotes transcription from the operons encoding GS
d
NtrC represses its transcription.
74
In summary, nitrogen assimilation and its regulation by the NTR system in
R. leguminosarum is similar to that of the enteric bacteria although three key
differences are apparent:
(1) Transcription of ntrC is constitutive (not regulated by nitrogen
source) and is subject to autogenous repression by its product, NtrC;
(2) The glnB gene encoding for PII is transcribed from a 54 encoded
promoter and is positively regulated by NtrC~Pi,
(3) Up to three isozymes of GS have been identified in strains of
Rhizobium.
81
Chapter Two Materials and Methods
2.1 Bacterial strains.
2.1.1 Echerichia coli strains.
Strain Genotype Reference
S17-1 pro, hsdR,recA [RP4-2(Tc::Mu) (Kn::Tn7 ) ]; RP4 integrated into it's chromosome.
Simon et al., 1983.
DH5 80dlacZ M15, recA 1, endA 1, gyrA 96, thi-1, hsdR 17,(rk-, mk+), supE44, relA 1, deoR ,
(lacZYA-argF )U169
Hanahan, 1983
Strains of Escherichia coli
2.2.2 Rhizobium strains.
Strain Genotype Parent strain Description Reference
3841 w.t. StrR derivative of R. leguminosarum biovar viciae strain 300.
Johnston and
Beringer, 3855 w.t. R. leguminosarum biovar
viciae StrRRonson et al., 1987.
CE3 w.t. R. leguminosarum biovar phaesoli.
Noel et al., 1984
CFN2012 ntrC ::Tn5 ntrC ::Tn5 mutant of CE3. KmR
Morret et al., 1985
82
83
84
85
86
87
88
89
90
2.2 Plasmids
Fig 2.1 Map of dct region in R. leguminosarum biovar viciae strain
3841.
91
Plasmid list.
Bacteriophage or Plasmid
Host strain Description Reference
RL38 Generalized transducing phage of R. leguminosarum.
Buchanan-Wollaston, 1979
pSUP202-1 ::Tn5
S17-1 Contains mob site, used for Tn5 mutagenisis. AmpR KmR
Simon et al., 1983
pRK2013 DH5 ColEI replicon with RK2 tra genes, helper plasmid used for mobilizing Inc.P and Inc.Q group plasmids. NmR KmR
Figurski et al., 1979
Bluescript II SK-
DH5 Phagemid, fl(-) origin of replication, ColEI replicon, SK polylinker, 2.96kb. Standard cloning vector. AmpR
Stratagene Ltd.
Bluescript II SK+
DH5 Phagemid, fl(+) origin of replication, ColEI replicon, SK polylinker, 2.96kb. Standard cloning vector. AmpR
Stratagene Ltd.
Bluescript II KS+
DH5 Phagemid, fl(+) origin of replication, ColEI replicon, KS polylinker, 2.96kb. Standard cloning vector. AmpR
Stratagene Ltd.
Bluescript pBC SK+
DH5 Phagemid, fl(+) origin of replication, ColEI replicon, SK polylinker, 3.4kb. Standard cloning vector. CmR
Stratagene Ltd.
pGEM-T DH5 Vector for cloning PCR products, supplied Eco RV digested with 3' T added on both ends. 3.0kb. AmpR
Promega Ltd.
pML122 DH5 RSF1010 based IncQ broad host range expression vector containing the mob genes, using the promoter from the NmR gene (npt II) from Tn5. ~11.3kb. GmR
Labes et al., 1990
92
93
94
95
96
97
98
99
100
101
2.3 Materials.
Chemicals and enzymes: All chemicals were analytical grade from
Sigma Chemical Company or BDH. Restriction endonucleases and DNA
enzymes were from Gibco BRL, New England Biolabs, Promega or Strategene
unless otherwise stated. Primers used as are described in Table 2.4.
Table 2.4 List of primers
Primer Sequence Description
SK CGCTCTAGAACTAGTGGATC Sequencing primer for Bluescript II
KS TCGAGGTCGACGGTATC Sequencing primer for Bluescript II
P1 AGGTTCCGTTCAGGACGCTACTTG IS50 R primer binds to nucleotides 14-32 in Tn5
P3 TCTGATGGCGCAGGGGATCAAGAT IS50 R primer binds to nucletides 1484-1508 in Tn5
P6 AAGGCCACAATTTCTGCGACACGG Binds to 5' end of dctB reading towards dctA.
P7 GTTTCTAAGGATAAGGGGATAGCG Binds to 3' end of dctA reading into dctA
102
2.4 Methods.
2.4.1 Bacterial culture conditions.
Rhizobium strains were routinely grown on TY medium with CaCl2 (6mM)
2054, or on acid minimal salts (AMS) medium, which is derived from that of
Brown and Dilworth #2058 with the changes being; potassium phosphate
(0.5mM), MgSO4 (2mM), CaCl2 (0.17mM) and buffering provided by MOPS
(20mM), pH 7.0. Y medium, used in transductions, was prepared as previously
described by Sherwood #2083. E. coli strains were grown on Luria Bertani
(LB) broth containing per litre, 10g tryptone, 5g yeast extract, 5g NaCl. Agar
(Difco, Bitek) was added to media at 15g/l.
Antibiotics were used at the following concentrations ( g ml-1):
Streptomycin 500; kanamycin, E. coli 25, Rhizobium 40; tetracycline, E. coli
(Inc. Q plasmids) 10, Rhizobium, (TY medium) 5, (AMS) 2; gentamycin, E.
coli 5, Rhizobium 20; spectinomycin, E. coli 50, Rhizobium 100; ampicillin,
50; chloramphenicol, 10.
Stocks of E. coli and Rhizobium were routinely maintained at -70 °C in
15% glycerol (sterile), snap frozen in liquid nitrogen (800 l of cells : 500 l
50% glycerol). Rhizobium was grown at 25 °C for 5 days on TY agar plates or
over night from slope cultures at 25 °C 250 rpm in liquid cultures. E. coli was
grown at 37 °C overnight (plates) or at 37 °C, 250 rpm (liquid).
2.4.2 Genetic manipulations
2.4.2.1 Transductions.
Transductions were performed according to #2053Buchanan-Wollaston,
(1979), using the phage RL38. Tn5 containing kanamycin resistant
transductants were obtained by plating the transduction mixture on TY medium
103
with kanamycin at 80 g/ml-1. These were subsequently purified three times on
TY medium prior to analysing their phenotypes.
2.4.2.2 Conjugations.
Conjugations were performed using either strain S17-1 as the donor strain
according to #2084 Simon et al., (1983) or as triparental conjugations
according to #2089 Figurski et al., (1979) with E. coli DH5 as the donor
strain and strain 803 containing pRK2013 providing the transfer functions.
Protocol:
(1) Inoculate donor strain and helper plasmid strain (pRK2013) into
10mls of LB broth with appropriate antibiotics and grow over night at 37 °C,
125rpm.
(2) Next morning, sub 200 l of each culture into 10mls of LB broth
containing appropriate antibiotics and incubate for four hours 37 °C, 125rpm
(mid log).
(3) Using cut off tips, centrifuge 1 ml of the donor and helper strains
(6500rpm, 2 min) and resuspend in 1ml of TY broth. Wash twice in TY broth
and resuspend in 1 ml of TY broth.
(4) Resuspend recipient strain (grown on TY slope 3-5 days, 25°C) in
2mls of TY broth and shake.
(5) Mix together; 400 l of Donor strain, 200 l of helper strain and
400 l of recipient strain or on the case of S17-1, 500 l and 500 l of recipient
strain.
(6) Centrifuge (6500rpm, 2 min)
(7) Shake of supernatant and resuspend pellet in remaining ~50 l TY
broth.
(8) Spot onto sterile nylon filters (Hybond N , Amersham) on TY agar
plates and also as controls, the doner and recipient strains separately.
(9) Incubate overnight at 25°C, face up.
104
(10) The next day, using sterile forceps, place filter in a microfuge tube
and add 1ml of TY broth, vortex, and streak one loopful on appropriate agar
plates with appropriate antibiotics and stock rest at -70°C. Also plate all
controls on the same media.
(11) Purify resultant transconjugants three times and stock at -70°C.
2.4.2.3 Tn5 mutagenesis
Transposon mutagenesis was carried out on R. leguminosarum biovar
viciae strain 3841 with Tn5 using the suicide vector pSUP202-1::Tn5 as
described by Simon et al., (1983).
2.4.2.4 Gene replacement strains
All the insertion or deletion mutants were constructed using a common
scheme. Gene replacement strains were created using the suicide vector
pJQ200KS as described by #2472 Quandt and Hynes, (1993). All the mutants
were marked by an interposon encoding spectinomycin resistance 5271.
This resistance marker was chosen because R. leguminosarum does not exhibit a
high level of spontaneous resistance to it and tetracycline and kanamycin were
already used as antibitic resistance markers. This interposon is also useful
because it contains transcriptional and translational stop signals in all three
reading frames at either end minimising promoter out activity.
The insertions and deletions were generated in Bluescript II SK+, ensuring
that the final clones containing the mutated allele had sufficient flanking DNA
(>700 base-pairs), for a cross over event to occur. All these alleles were cloned
into the suicide vector pJQ200KS. This vector has the narrow host range origin
of replication p15A, encodes gentamicin resistance, contains the Lac system
which allows blue/white selection and also carries the sacB gene from Bacillus
subtilis, which is inducible by sucrose and lethal when expressed in Gram-
negative bacteria.
105
Plasmids containing the appropriate DNA were triparentally conjugated
into the recipient strain and the whole conjugation mix plated on TY containing
5% sucrose and the appropriate antibiotics (streptomycin and kanamycin). This
allowed direct selection for colonies containing rare double recombination events
which appeared after 3-4 days incubation at 25 ºC (Fig. 2.2). These were then
shown to be gentimicin sensitive indicating loss of the plasmid indicative of a
gene replacment event. They were also checked for the correct phenotype
(where possible) and also by Southern blotting.
106
Fig. 2.2 Diagram of double recombination event.
First recombination event GmR SpR
SucroseS
Second recombination event SpR SucroseR GmS
Cells plated on TY with Str, Sp and 5% sucrose.
107
2.4.3 DNA manipulations
2.4.3.1 Routine DNA manipulations.
All routine DNA analysis, such as restriction digests and ligations were
done according to Sambrook et al., 1989 #2044. DNA was routinely
electrophoresed in a 0.8% agarose gel (1X TAE) with 1X TAE buffer as
described in Sambrook et al., 1989. This was visualised by staining with
ethidium bromide and exposing to UV light. DNA loading buffer (6X) was
prepared as follows: 25% w/v bromophenol blue, 15% w/v ficoll in 1X TAE.
DNA was purified from agarose gels using a Prep-A-Gene kit (Biorad). Plasmid
transformations were conducted by the CaCl2 method as described in Sambrook
et al., 1989.
5’ Overhang fill ins were done as follows;
DNA
1X Klenow Buffer
dNTPs (20 M each)
1-3 units of Klenow polymerase
Sterile H2O to 20 l
Incubate 37°C for 30 min and terminate by heat shocking at 75°C for 10
min, followed by phenol:chloroform extraction and ethanol precipitation.
Klenow buffer (10X) contains 500mM Tris-HCl pH7.5, 10mM MgCl2
and10mM dithiolthreitol.
3’ Overhang exonuclease reactions were conducted as follows:
DNA
1X T4 DNA polymerase buffer
dNTPs (100 M each)
5 units of T4 DNA polymerase
Sterile H2O to 10 l
108
Incubate 15°C for 30 min and terminate by heat shocking at 75°C for 10
min, followed by phenol:chloroform extraction and ethanol precipitation. T4
DNA polymerase buffer (10X) contains 500mM Tris-HCL pH8.8, 50mM
MgCl2, 50mM dithiolthreitol.
2.4.3.2 Plasmid preparation.
Alkaline lysis.
Plasmid DNA was routinely obtained using the alkaline lysis method as
described in Sambrook et al., 1989. Cosmid DNA was prepared by a modified
alkaline lysis protocol where upon after the lysis step, the cells were inverted
twice and solution three added immediately.
Boiling method.
Certain plasmids such as the pML series of vectors were obtained using the
boiling method as described by Arnold and Pühler, (1988).
Prorocol:
(1) Grow strains were grown over night in LB broth with appropriate
antibiotic.
(2) Centrifuged A 1.5ml volume of cells (13000rpm, 5 min) and
resuspend the pellet in 50ml of STE (50mM Tris-HCL pH8.0, 50mM EDTA,
8% sucrose) containing 10mg/ml freshly diluted lysozyme and incubate at room
temperature for 5 min.
(3) Add 700 l of STET (STE containing 0.5% Triton) to the side of the
tube, invert three times and boil for 50 seconds (pierce lid of microfuge tube).
(4) Centrifuge, (13000rpm, 30 min, 5ºC), and phenol:chloroform
extract the supernatant twice.
(5) Add one volume of iosoproponal and precipitate the DNA overnight.
(6) Centrifuge (13000rpm, 5 min, 4ºC) and rinse pellet in 70% ethanol,
dry and resuspend in 50 l of H2O.
109
Sequencing grade DNA.
Sequencing grade DNA was obtained by using Magic Mini preps (Promega
Ltd.) or by the Moscow method.
Moscow method.
(1) Pellet a 10ml culture of E. coli grown overnight in a microfuge tube
and resuspend in solution 1. Solution I is 50mM Tris-HCl pH8.0, 10mM
EDTA, 100mg RNase A/ml. (50ml 1M Tris-HCl pH7.4 + 20ml 0.5M EDTA
pH8.0, add distilled H2O to 1 litre and adjust pH to 8.0. with 10M NaOH). Add
heat treated RNase to a final concentration of 0.1mg/ml prior to use.
(2) Add 0.3ml of solution 2, mix gently, and incubate at room
temperature for 5 min. Solution 2 is 200mM NaOH, 1% SDS.
(3) Add 0.3ml of solution 3, mix immediately but gently, and centrifuge
at (4ºC, 15 min, 13000rpm). Remove supernatant promptly. Solution 3 is
2.55M potassium acetate pH4.8 (Dissolve 250.26g of potassium acetate in 400ml
of distilled water. Add concentrated acetic acid to a volume of 950ml. Adjust
the pH to 4.8 and make up to 1 litre with H2O).
(4) Add 250 l of 40% PEG 6000 to 750 l of supernatant and
vortex(final conc. of PEG, 10%). PEG was not autoclavedand the pH was not
adjusted).
(5) Precipitate on ice for 30 min.
(6) Centrifuge, (13000rpm, 5 min, room temperature).
(7) Remove supernatant (pulse and remove last few drops).
(8) Dissolve pellet in 100 l of TE pH 8.0, add 50 l of 7.5M
ammonium acetate and150 l of isoproponal and vortex. The 7.5M ammonium
acetate was not autoclaved and the pH was not adjustedand.
(9) Centrifuge immediately (13000rpm, 2 min, room temperature).
(10) Remove supernatant and wash with 80% ethanol X2.
(11) Dry pellet and resuspend in 50 l TE pH8.0.
110
2.4.3.3 PCR Amplification.
Normal PCR.
PCR amplification of DNA was routinely done using Promega Taq
polymerase and buffer as follows:
200ng template DNA
200ng of each primer
0.2mM of each dNTP,2ul of 10mM stock of each.
Buffer X10 (from Promega) 10ul
MgCl2 (2mM final conc.) 8ul of 25mM stock.
Taq polymerase 1ul (5 units)
H2O to 100ml
Promega PCR buffer (10X) is 500mM KCl, 100mM Tris-HCl pH9.0 and
1.0% triton. Samples were covered in mineral oil and amplified using the
following conditions:
denaturation 94ºC, 1.5 min
annealing 55ºC, 1.5 min
extension 72ºC, 1.5 min
X30 cycles followed by
completion 72ºC, 10 min
Inverse PCR.
Conditions were as described for normal PCR. The template DNA was
purified using a Prep-A-Gene kit (Biorad), phenol:chloroform extracted and
ethanol precipitated. This was circularised (ligated) as usual but in a volume of
50 l. This was phenol:extracted, ethanol precipitated and used for inverse
PCR.
Cloning of PCR products.
PCR products were usually visualised on a 0.8 % agarose gel, the band
purified using a Prep-A-Gene kit (Biorad), phenol:chloroform extracted and
111
ethanol precipitated. This was ligated into pGEM-T (a T-A vector for cloning
PCR products, Promega Ltd.)
2.4.3.4 Chromosomal DNA
Protocol:
Chromosomal DNA from Rhizobium was prepared as follows:
(1) Grow a 50 ml culture of cells overnight with appropriate antibiotics
to ~ O.D. 0.6.
(2) Harvest Cells (15ºC, Sorval centrifuge, 9000rpm, SS-34 rotor),
wash in 4 ml of 1X TES and resuspend in 4 ml of 1X TES. 10X TES contains
0.2M Tris-HCL pH7.5, 5mM EDTA and 100mM NaCl, autoclaved.
(3) Add 0.2ml of lysozyme (10mg/ml in 1X TES) and 40 l of RNase
(10mg/ml stock solution) and incubate ( 30 min, 37ºC).
(4) Add 4 ml of 1X TES, 0.4ml of pronase (10mg/ml in 1X TES, self-
digested, 1 hour, 37ºC) and 10% sarkosyl and incubate (30 min, 37ºC).
(5) Add an equal volume of chlorform:isoamyl alcohol (24:1) added and
incubate on ice, 30 min, swirling occasionally.
(6) Centrifuge (9000rpm, 15min, 6ºC, SS-34 rotor).
(7) Decant top (aqueous) layer into a sterile centrifuge tube (50ml) using
an inverted sterile 10ml glass pipette and re-extract as in steps 5 and 6.
(8) Decant top (aqueous) layer into a sterile McCartney tube (1oz, glass,
sterile) and incubate as in step 5 and centrifuge (Denley bench top, 4500rpm,
4ºC).
(9) Decant top layer as before into a new sterile McCartney tube leaving
behind as much protein (white) as possible.
(10) Precipitate DNA by adding two volumes of ethanol(-20ºC). A
visible clump should form.
112
(11) Place the DNA clump in a microfuge tube using a ‘Gilson blue tip’,
rinse pellet in 70% ethanol and dry (if possible). Resuspend in 750 l of TE
pH8.0 and dissolve overnight at 4ºC on a windmill.
(12) The next day, phenol:chloroform the DNA with an equal volume of
phenol:chlorform X4. Then phenol:chloroform extract overnight on a windmill.
(13) Next day, phenol:chlorform extract DNA X1 and ethanol precipitate
with 1/10 volume of 3M sodium acetate pH5.2 and two volumes of 100% ethanol
(a clump should be visible).
(14) Dissolve the pellet in 300 l of TE pH 8.0 and digest 1-2 l.
2.4.3.5 Southern blotting and hybridisation.
Chromosomal DNA, digested with an appropriate enzyme was
electrophoresed on a 0.8% agarose gel and transferred to positively charged
nylon membrane (Hybond N+ Amersham) and hybridised using an Amersham
ECL kit according to the manufacturers instructions. Hybridisation was done at
60ºC overnight followed by a washe at 60ºC in1X SSC, 1% SDS for 15 min and
a second wash in 0.5X SSC, 1% SDS for15 min. The blot was developed and
exposed for 5-60 min depending on signal intensity. Probes were prepared and
labeled using an Amersham ECL kit according to the manufacturers instructions.
2.4.3.6 DNA sequencing.
DNA sequencing using template DNA prepared by magic mini preps or the
Moscow method was performed by the cycle sequencing method using a
Promega fmol kit according to the manufacturers instructions.
113
2.4.4 RNA Analysis.
2.4.4.1 General preperation.
All glass ware and spatulas were baked overnight at 200ºC. Pipette tips
and centrifuge tubes were autoclaved. All solutions were prepared in \DEPC
treated water and autoclaved. Gel rigs were washed in 70% etanol and rinsed
with DEPC treated water. DEPC treated water was prepared byby adding DEPC
to a final concentation of 0.1%, stirring overnight and autoclaving twice.
2.4.4.1 Isolation of RNA from R. leguminosarum.
Protocol:
(1) Grow a 200ml culture under appropriate conditions to O.D. 0.5.
(2) Harvest cells were by centrifuging (6000rpm, 10 min room
temperature, Sorval, GSA rotor.).
(3) Resuspend pellet in 10ml of solution I. Solution I is 15mM Tris-
HCl pH7.4, 0.45M sucrose, 8mM EDTA in DEPC treated H2O.
(4) Add 80 l of fresh lysozyme (50mg/ml) and incubate on ice for 15
min.
(5) Centrifuge (6000rpm, 5 min, 5ºC, Sorval, SS-34 rotor).
(6) Resuspend pellet in 0.5ml of solution II, divide into two equal
volumes and transfer to microfuge tubes. Solution II is 1mM sodium citrate,
10mM Tris-HCL pH 8.0, 10mM NaCl in DEPC treated H2O.
(7) Add 75 l of 10% SDS (1.5% SDS final concentration) and invert
three times.
(8) Immediately add 250 l of ice cold solution III, mix by inversion
and store on ice for 10 min. Solution III contains a saturated solution of NaCl
dissolved in DEPC treated H2O.
(9) Centrifuge (13000rpm, 15 min, 4ºC).
114
(10) Recombine supernatants from two fractions in new microfuge tube
and extract with an equal volume of phenol/TE pH8.0.
(11) Extract twice with an equal volume of phenol:chloroform.
(12) Ethanol precipitate (1/10 vol. of 3M sodium acetate PH5.2 and two
vol. of ice cold etahnol) overnight at -20ºCand rinse in 80% ethanol (prepared
with DEPC H2O). Dry pellet and resuspend in 40 l of DEPC H2O.
(13) Digest with RNase free DNase for 25 min at 25ºC as follows: To
40 l of RNA add 5 L of DNase (50 units) (Boehringer Mannheim) and 5 l of
10X DNase buffer. 10X DNase buffer contains 0.1M sodium acetate pH5.0,
5mM MgSO4.7H2O in DEPC H2O.
(14) Phenol :chloroform extract with an equal vol. once.
(15) Ethanol precipitate and resuspend in 50 l of DEPC H2O.
(16) Quantify the RNA by gel electrophoresis and by spectrophotometry
(260nm, O.D. 1.0 = 40 g) and store at -70ºC.
The RNA can be visualized similar to DNA on a 0.8% agarose gel at step
12 or 16. Ensure gel rig is well rinsed with DEPC H2O.
2.4.4.2 Radioactive DNA probe labeling.
DNA probes for mRNA hybridization were labeled as described by Brown,
(1991) as follows:
DNA (25-250ng) (denatured boil 5min)
Nucleotides (100 M dATP, dGTP, dTTP)
10X Klenow buffer (described in section 2.4.3.1)
Random primers (2-5 g) (Promega)
50 mCi of [ 32P] dCTP (3000 Ci mmol-1) (5 l)
Klenow polymerase (3 units)
Sterile H2O to final vol. of 50 l
115
Incubate for 1 hour at 37ºC and terminate by adding 2 l of 0.5M EDTA
pH 8.0. Ethanol precipitate overnight and airdry in fume hood. Resuspend in
200 l of TE pH8.0 and denature by boiling for 5 min prior to addition.
2.4.4.3 RNA Northern blotting.
RNA was electrophoresed and Northern blotted as follows:
RNA formaldehyde gel protocol:
(1) Add 1.8g of ultra pure agarose to 80ml of DEPC H2O.
(2) Melt (microwave) and let cool for approximately 5 min, (Swirl
gently so as not to introduce air bubbles).
(3) Add 30ml of 5X formaldehyde gel running buffer (FGRB). 5X
FGRB is made as follows: Dissolve 20.6g of MOPS in 800ml of DEPC H2O
containing 50mM sodium acetate (4.1g/l). Adjust pH to 7.0 using 1M NaOH.
Add 10ml of 0.5M EDTA pH8.0 and make up to 1 litre with DEPC H2O.
Sterilise by filtration using a 2 m filter and store at room temperature protected
from light. This can also be autoclaved and goes straw yellow but works fine.
This buffer can be reused between runs but requires thorough mixing. FGRB
goes dark when it is off.
(4) Add 26.8ml of formaldehyde.
(5) Make up to 150ml with DEPC H2O and pour immediately. Ensure
that gel rig is well rinsed with DEPC H2O.
(6) When set, pre-run for 5 min at 200 volts in fume hood in 1X FGRB.
(7) Load samples and run at 250 volts. Samples are prepared as
follows:
RNA 4.5 l
DEPC H2O 3.0 l
5X FGRB 2.0 l
116
formamide 10 l
formaldehyde 3.5 l
Heat at 65ºC for15 min, cool on ice for 5 min and centrifuge (13000rpm,
5min, 4ºC). Add 2 l of formaldehyde gel loading buffer (FGLB). FGLB
contains 50% glycerol in DEPC H2O, 1mM EDTA pH 8.0, 0.25% w/v
bromophenol blue and 0.25% w/v xylane cyanol FF made up to 10ml in DEPC
H2O.
(8) RNA can be visualised by staining in RNase free ethidium bromide
solution and exposing to UV light.
Northern transfer:
Northern gels were transferred onto Hybond N (Amersham) according to
the manufacturers instructions. Membranes were air dried (I hour) and UV
fixed for 2 min on a UV transilluminator.
Hybridisation protocol:
(1) Pre-hybridise membranes at 61ºC for 4 hours in 25 ml of
hybridization buffer (0.5ml/cm2). Hybridization buffer contains:
20X SSPE 25ml
100X Denhardts 5ml
10% SDS 5ml
DEPC H2O 65ml
Calf thymus DNA (10mg/ml of hybridization
buffer), denatured, boiling 3 min.
(2) Add denatured DNA probe (boil 5min and store on ice) and hybridize
overnight at 61ºC.
(3) Wash membranes in 2X SSPE, 0.1% SDS (50ml) for 20 min at 60ºC.
(4) Check corners of membrane for radioactivity; if hot wash again with
1X SSPE, 0.05% SDS, 5 min.
(5) Blot dry membranes on 3MM paper and wrap in Saran wrap.
Expose to X-ray film for approimately 30 hours at -80ºC.
117
2.4.4.4 RNA dot blots.
(1) Prepare RNA as for Northern blotting but do not add the loading
buffer.
(2) Prior to addition, heat to 65ºC for 15 min and place on ice for 3min.
Then add 100 l of 20X SSC (ice cold).
(3) Assemble dot blot apparatus (Biorad) (autoclaved) as follows: Place
2 sheets of 3MM paper (12x8cm) soaked in 20X SSC placed on the rubber
gasket. Place a sheet of Hybond N (Amersham) (12x8cm) on top of the 3MM
paper. Screwed top in position and fill the wells with 10X SSC and suck
through slowly.
(4) Apply samples with vacuum off and suck through slowly maintaining
the vacuum for 5 min.
(5) Dismantle the apparatus and air dry the membrane for 1 hour.
(6) UV fix the RNA for 2 min on a UV trans illuminator. Hybridize
membrane as for Northern blots.
2.4.5 galactosidase assays.
Promoter activity was measured by monitoring -galactosidase activity
from lacZ gene fusions of cells grown under various conditions according to the
following protocol:
(1) Inoculate cells into AMS with 10mM carbon/nitrogen source and
appropriate antibiotics and grow at 25ºC, 250rpm to O.D.600 0.5 (mid log).
(2) Centrifuge (3000rpm, 15ºC, 5 min in Denley bench top).
(3) Rinse pellets in AMS (-carbon/-nitrogen) and centrifuge as in step 2.
(4) Resuspend cells in 20ml of Z buffer and read O.D.600. Z buffer is
0.06M Na2HPO4, 0.04M NaH2PO4, 0.01 KCl, 0.001M MgSO4.7H20 (not
autoclaved).
118
(5) Aliquot three 630 l volumes into microfuge tubes and add 70 l
lysozyme (5mg/ml in 10mM Pi buffer pH 8.0 final concentration 0.5mg/ml
containing 350 l 2-mercapto ethanol/10ml final concentration in assay 50mM),
vortex and incubate for 5 min at room temperature.
(6) Add 14 l of 0.05M EDTA pH8.0 (1mM final concentration in
assay), vortex and incubate for 15 min at room temperature.
(7) Add 7 l of 0.1% SDS (final concentration 0.01%) and vortex.
(8) Equilibrate samples at 30ºC for 5min.
(9) Add 140 l of o-Nitrophenyl -D-galacto pyranoside (ONPG)
(4mg/ml in Z buffer containing 35 l of 2-mercapto ethanol/10ml, 50mM) and
vortex.
(10) Incubate samples for 10 min (they should turn yellow if active) and
terminate the reaction by adding 0.35ml of 1M Na2CO3 and vortexing.
(11) Centrifuge samples (13000rpm, 3 min, room temperature) to remove
debris and read the O.D.A420. Absorbance is linear from O.D. 0.1 to O.D 1.2 as
determined by a standard curve of [p-Nitrophenol] V A420 (Fig. 2.2). o-
Nitrophenol is the product of ONPG hydrolysis and absorbs at 420.
(12) Results calculated as follows:
Average Abs. S1-S3.protein (mg/ml-1).vol=A420.mg protein-1
A420.mg protein-1. time (min-1) = A420.mg protein-1.min-1
A420.mg protein.min-1/ m o-Nitrophenol(4017.82) =moles.mg protein-
1.min-1
moles.mg protein-1.min-1.109=nmol.mg protein-1.min-1of ONPG hydrolysed
to o-Nitrophenol.
Calculation of molar m for o-Nitrophenol:
A420/nmol = 0.003315 (slope from standard curve (Fig. 2.2))
A420/mol = 0.003315 x 109 (3315034)
(3315034 x Volume (ml)(1.2120))/1000 = m 4017.821
119
Fig. 2.3 Plot of [p-Nitrophenol](nmoles) v Abs 420.
p-Nitrophenol Standard Curve
0
0.5
1
1.5
2
2.5
0 200 400 600 800
p-NP (nmoles)
A42
0
slope=0.003315r=0.997255
A variety of different lysis conditions were tested and 0.01% SDS (final
concentration) gave higher galactosidase activities than Triton X 100 ( at a
variety of different concentrations), which is a weaker detergent than SDS,
indicating that the SDS lysis procedure is more effective than Triton X 100 lysis
(data not shown). This SDS cell lysis procedure also gave comparable results to
cells disrupted by sonication or French pressing (data not shown).
O
A420
O
120
2.4.6 Transport assays.
Cells were prepared and succinate and aspartate transport measured as
previously described (Poole et al., 1985) using 18.5 kBq [2,3-14C] succinate
(4.0GBq mmol-1) or 18.5 kBq [U-14C] aspartic acid (7.88 GBq mmol-1) obtained
from Amersham, at a total substrate concentration of 25 M. Assays were
conducted at 30ºC in 0.5 ml of minimal salts medium buffered at pH 7.0 with
10mM phosphate. The Cell suspension (0.1ml) (0.04-0.13 mg protein.ml-1) was
sampled at 1 min intervals for 5 min after addition of labeled substrate. After
filtration under vacuum, cells were washed twice with minimal salts medium at
30ºC, added to 0.5 ml of Beckman “Ready Safe” scintillation fluid and the
counts measured.
121
Chapter Three
3.1 Introduction
The aim of the work described in this chapter was to investigate the roles
of the proteins comprising the DCT system in induction, by C4-dicarboxylic
acids, of the dctA promoter (dctAp). As described in the introduction (section
1.6), DctA is thought to play a role in regulating its transcription and either
DctA, DctB or both are considered to be involved in sensing C4-dicarboxylates.
To further elucidate the regulation of the dctAp, it was necessary to construct a
suitable reporter system and test it in various genetic backgrounds under
different growth conditions. This chapter reports the regulation of transcription
from the dctAp under such conditions.
3.2 Results 3.2.1 Construction of the dctAp and dctBp reporter
plasmids, pRU103 and pRU104.
To test transcriptional activity from the dctAp and dctBp, it was necessary
to construct suitable reporter probes. As mentioned in the introduction dctA is
transcribed divergently from dctB with an intergenic region of 231 basepairs,
which contains the promoters of both genes 2560,950,122. This entire
intergenic region was ligated in both orientations to lacZ, creating dctA and dctB
reporter fusions (Fig. 3.1). The dctAp and dctBp promoter probes, pRU103
(dctAp) and pRU104 (dctBp), were conjugated into R. leguminosarum biovar
viciae 3841 (wild-type), yielding the strains RU364 and RU365 respectively.
122
Fig. 3.1 Construction of pRU103 and pRU104.
The cosmid pRU3001, derived from R. leguminosarum biovar viciae 3841
DNA, complements a dctA::Tn5 mutant (RU467) and contains the dct genes as
confirmed by Southern blotting 3319. After digestion with EcoRI, the dctA-B
intergenic region, previously mapped on a 0.9kb fragment, was ligated into
Bluescript II SK+, yielding pRU16. This was partially sequenced confirming it
was correct (Fig. 3.2). The EcoRI insert from pRU16 was cloned in both
pRU3001 digested with EcoRIand the 0.9kb dct IR region cloned into Bluescript II SK+.
pRU16 digested with EcoRIand the 0.9kb insert cloned in both orientations into pMP220.
pRU3001 TcR (~50kb)
pRU16 TcR (3.8kb)
* indicates a truncated site or gene.
123
orientations into the EcoR1 site of pMP220 to obtain both a dctAp and dctBp
promoter probe and called pRU103 and pRU104 respectively.
Fig. 3.2 Sequencing of pRU16.
SK primer KS primer
pRU16 TcR (3.8kb)
* indicates a truncated site or gene.
Sequenced regions
124
3.2.2 Transcriptional analysis of the dctAp reporter in the
wildtype, strain RU364 (3841/pRU103).
Strain RU364 was tested for induction of transcription from the dctAp in
response to succinate and aspartate, which are known to induce expression from
the dctAp in R. leguminosarum and R. meliloti 275,1876,2560,122,2559.
When grown on glucose/ammonia, strain RU364 displayed a small background
level of transcriptional activity (Table 3.1). Succinate as the carbon source
caused an ~8-fold induction in transcription, while aspartate supplied as the
nitrogen source (in conjunction with glucose) was a slightly less effective
inducer giving a ~6-fold increase. These results are comparable to those
obtained in other reports 2560,122. Higher levels of transcription (~14-fold )
were observed when strain RU364 was grown in the presence of both succinate
and aspartate indicating an additive effect.
Strain RU364 was also tested after growth on a combination of substrates
to assess if glucose or ammonia could affect the induction by succinate or
aspartate. Cells grown on glucose/succinate/ ammonia or
glucose/succinate/aspartate gave similar results to cells grown in the absence of
glucose indicating that the presence of glucose did not significantly enhance
transcription from the dctAp under these conditions. Similarly, cells grown on
glucose/aspartate/ammonia displayed comparable activities to glucose/aspartate
grown cells. However, cells grown on succinate/aspartate/ammonia showed a
~50% reduction in activity when compared to succinate/aspartate grown cells.
One possibility that could account for this is that cells grown on
succinate/aspartate are thought to be nitrogen limited while
succinate/aspartate/ammonia grown cells are not due to the presence of
ammonia. Therefore, this extra activity observed on succinate/aspartate grown
cells could be due to the dctAp responding not only to the presence of succinate
but also responding to nitrogen limitation conditions caused by the presence of
aspartate alone.
125
Table 3.1 -galactosidase activity from the dctAp in strain RU364
(3841/pRU103).
Parent Parent Strain Genotype Strain
G/N G/ASP S/N S/ASP
3841 w.t. RU 364 266±61 1533±356 2067±267 3433±101
G/S/N G/S/ASP G/ASP/N S/ASP/N
3841 w.t. RU 364 2228±257 3997±273 1944±128 1751±253
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
In summary, the dctAp in the wildtype shows normal induction in response
to succinate and aspartate and the possibility also exists that the aspartate
response may be partially mediated by nitrogen limitation. It was decided next
to examine the regulation of transcription from the dctAp in a variety of dct
backgrounds to further investigate the roles of the genes comprising the dct
operon.
126
3.2.3 Induction of transcription from the dctAp in various
dct backgrounds.
To examine the regulation of transcription from the dctAp and to show as
previously described for the dctAp 2560,1876 that it is DctB/D dependent, a
series of strains deficient in one or more of the three genes comprising the dct
system were constructed.
3.2.3.1 Generation of dct strains.
All the insertion or deletion mutants were constructed using a common
scheme as described in Chapter Two (section 2.4.2.4). Construction of the
required plasmids are diagrammed in Figs. 3.3-3.8. These plasmids, pRU324
(dctA:: ), pRU325 (dctB:: ), pRU168 ( dctD), pRU294 ( dctBD) and
pRU193 ( dctABD), were conjugated into strain 3841 (wildtype) and using
appropriate selections, strains containing double crossover events were selected.
These were purified three times and were designated, strains RU727 (dctA:: ),
RU730 (dctB:: ), RU711 ( dctD), RU865 ( dctBD) and RU714( dctABD).
All were confirmed as being correct by checking their growth phenotypes (Table
3.2). In addition Southern blotting confirmed the absence of the vector and the
presence of only one copy of the gene of interest, containing the interposon
(Fig. 3.9). In all cases the results were consistent with a double crossover event
leading to gene replacement.
127
Fig. 3.3 Construction of pRU151; the starting plasmid for all the
gene replacement plasmids.
Plasmid pRU47 is a HindIII fragment from the cosmid pIJ1848 spanning
the complete dct region, cloned in Bluescript II SK+. This was digested with
Cla1 and religated to form pRU150. This was further digested with Xba1 and
HindIII, filled-in and religated to remove part of the Bluescript II SK+
polylinker yielding pRU151. pRU151 was the starting point for the construction
of all subsequent mutated dct alleles.
pRU47 AmpR (13.3kb)
pRU150 AmpR (9.1kb)
pRU151 AmpR (9.1kb)
pRU47 digested with ClaI and religated.
pRU150 digested with XbaI/HindIII, filled in and religated.
* indicates a truncated site or gene.
128
Fig. 3.4 Construction of pRU324; dctA:: suicide plasmid.
Plasmid pRU324 contains dctA with an interposon insertion at its
BamH1 site and flanked by 1.8kb on the dctA side and 4.2kb on the dctB side,
cloned in the suicide vector pJQ200KS.
pRU151 AmpR (9.1kb)
pRU321 AmpR SpR
(11.1kb)
pRU324 GmR SpR (13.6kb)
pJQ200KS
interposon (BamHI)
pJQ200KS (NotI/ApaI)
pRU151 digested with BamHI and interposon ligated in.
pRU321 digested with NotI/ApaI and ligated into pJQ200KS.
* indicates a truncated site or gene.
129
Fig. 3.5 Construction of pRU325; dctB:: suicide plasmid.
Plasmid pRU325 contains the complete dct region with dctB mutated with
an interposon at its EcoRI site and flanked by 3.0kb on the dctA side and 3.2kb
on the dctB side.
pRU322 AmpRSpR (11.1kb)
pRU325 GmRSpR (13.6kb) dctB suicide vector
interposon EcoRI
pRU151 digested with EcoRI at the unique site located 591bp from the start of dctB and the
interposon ligated in.
pRU322 digested with NotI/ApaI and ligated into pJQ200KS.
* indicates a truncated site or gene.
130
Fig. 3.6 Construction of pRU168; dctD suicide plasmid.
Plasmid pRU168 contains dctD with a 123bp deletion, 895bp from its start
codon replaced with an interposon, flanked by 0.73kb on the dctB side and
0.9kb on the dctD side.
pRU151 AmpR (9.1kb)
pRU153 AmpR (4.5kb)
pRU157 AmpRSpR (6.5kb)
pRU168 GmRSpR (9.0kb) dctD suicide vector
pRU151 digested with EcoRV and religated.
pRU157 was digested at the two NruI sites located in the centre of dctD and interposon ligated in resulting in a 123bp deletion.
pRU157 digested with NotI/ApaI and ligated into pJQ200KS.
* indicates a truncated site or gene.
131
Fig. 3.7 Construction of pRU294; dctBD suicide plasmid.
Plasmid pRU294 contains a 1.4kb deletion spanning dctB from its EcoRI
site to the first 164bp of dctD replaced by an Ω interposon. This is flanked by
3.0kb of homologous DNA on the dctA side and 1.7kb on the dctD side.
Fig. 3.8 Construction of pRU193; dctABD suicide plasmid.
pRU322 AmpRSpR (11.1kb)
pRU323 AmpRSpR (9.7kb)
pRU294 GmRSpR (12.2kb) dctBD suicide vector
pRU322 digested with SmaI/EcoRV generating a 1.4kb deletion spanning 2/3 of dctBfrom its 3’ end (1277bp), the dctA-B IR and the first 164bp of dctD and the interposon. This fragment was purified and the interposon (SmaI) religated in.
pRU323 digested with NotI/ApaI and ligated into pJQ200KS.
* indicates a truncated site or gene.
132
Plasmid pRU193 contains the dct region deleted in dctA (379bp 5’ end),
dctB and dctD (164bp 5’ end), the deleted regions replaced by an interposon
and flanked by 1.8kb on the dctA side and 1.7kb on the dctD side.
pRU323 AmpRSpR (9.7kb)
pRU401 AmpRSpR (8.4kb)
pRU193 GmRSpR (10.9kb) dctABD suicide vector
pRU323 digested with BamHI generating a 2.6kb deletion spanning dctA, dctB and dctD and the interposon and the interposon religated in.
pRU401 digested with NotI/ApaI and ligated into pJQ200KS.
* indicates a truncated site or gene.
133
Table 3.2 Growth phenotypes of the gene replacement strains.
Strain Genotype
G/N S/N
3841 w.t. +++ +++
RU 727 dctA :: +++
RU 730 dctB :: +++
RU 711 dctD :: +++
RU 865 dct BD :: +++
RU 714 dctA BD :: +++
Growth conditions
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
134
Fig. 3.9a Southern blots of gene replacement strains.
Blot 1 Lane A. 1-kb ladder Lane B. 3841 HindIII Lane C. RU727 HindIII Hybridised with dctA probe (pRU365).
Blot 2 Lane A. 3841 HindIII Lane B. RU730 HindIII Lane C. RU711 HindIII Lane D. RU865 HindIII Lane E. RU714 HindIII Lane F. RU3841HindIII Lane G. 1-kb ladder Hybridised with dctA probe pRU365.
Blot 2
Blot 1
135
Blot 3 Lane A. 1-kb ladder Lane B. 3841 HindIII Lane C. RU727 HindIII Hybridised with dctB probe pRU327.
Blot 3
Blot 4 Lane A. 3841 HindIII Lane B. RU730 HindIII Lane C. RU711 HindIII Lane D. RU865 HindIII Lane E. RU714 HindIII Lane F. RU3841HindIII Lane G. 1-kb ladder Hybridised with dctB probe pRU327.
Blot 4
136
Blot 5 Lane A. 1-kb ladder Lane B. 3841 HindIII Lane C. RU727 HindIII Hybridised with dctD probe pRU326.
Blot 5
Blot 6 Lane A. 3841 HindIII Lane B. RU730 HindIII Lane C. RU711 HindIII Lane D. RU865 HindIII Lane E. RU714 HindIII Lane F. RU3841HindIII Lane G. 1-kb ladder Hybridised with dctD probe pRU326.
Blot 6
137
Fig. 3.9b HindIII restriction map of dct region in gene replacement
strains hybridised with dctA, dctB and dctD probes.
138
Fig. 3.9c Table of expected HindIII restriction fragment sizes (kb) of
gene replacement strains hybridised with dctA, dctB and dctD probes which
concur with those obtained in the Southern blots.
Strain RU727 RU730 RU711 RU865 RU714 3841Genotype dctA :: dctB :: dctD :: dctBD :: dctABD :: w.t.
dctA probe 1.8, 8.6 3.0 5.3 3.0 1.8 10.4
dctB probe 8.6 3.0, 7.3 5.3 3.0, 5.9 5.9 10.4
dctD probe 8.6 7.3 5.1, 5.3 5.9 5.9 10.4
139
3.2.4 Analysis of transcription from the dctD promoter.
During the process of construction of the dctB and dctD gene replacement
strains, it became apparent that it is important to determine if dctD has its own
promoter. If dctD lacks its own promoter, then a dctB mutant would be in
effect a dctBD double mutant. As discussed in the introduction, a variety of
reports have suggested that dctD has its own promoter 2173,1876,275.
However, these reports are potentially flawed since any transcription of dctD
could result from promoter out activity from the Tn5 situated in dctB. To
address this question two different approaches were taken:
(1) the construction of suitable reporter probes,
(2) complementation analysis.
3.2.4.1 Analysis of dctD expression using reporter probes.
Two dctD promoter (dctDp) probes containing different amounts of DNA
preceding the potential dctD promoter region, were constructed (Fig. 3.10a and
b). In addition, to monitor the contribution that the dctB promoter makes to
dctD expression, a dctBD promoter (dctBDp) probe was constructed (Fig. 3.11).
Finally a dctB promoter (dctBp) probe was also used to determine if dctD
expression from the dctBDp reporter was similar to that of dctB. The
construction of this latter plasmid is previously described in Fig. 3.1.
140
Fig. 3.10a Construction of the dctD reporter probe pRU392 (long).
pRU150 AmpR (9.1kb)
pRU327 AmpR SpR (11.1kb)
pRU348 AmpR (6.5kb)
pRU392 TcR (12.9kb) dctDp reporter probe (long) (L )
pRU150 digested with MluI, filled in and the interposon blunt end ligated in.
pRU327 BamHI, the 3.6kbfragment ligated into Bluescript II SK+ BamHI digested.
pRU348 digested with EcoRI/XbaI and directionally cloned into pMP220.
* indicates a truncated site or gene.
141
Plasmid pRU292 is a dctDp reporter probe containing 0.53kb (339bp
preceding the dctD start site (i.e. in dctB) and the first 193bp of the 5’ end of
dctD) of DNA spanning the potential dctD promoter region.
Fig. 3.10b Construction of the dctD reporter probe pRU292 (short).
Plasmid pRU392 is a dctDp reporter probe containing 2.4kb of DNA
(truncated dctD up to the MluI site (i.e. the first 1.1kb) and the preceding DNA in
dctB up to the EcoRI site (1.3kb) ) directionally cloned into pMP220
142
* indicates a truncated site or gene.
pRU381 digested with PstI and ligated into pMP220. This was orientated by using the SphI site.
pRU152 digested with NruI and the 1.8kb band purified. This was digested with PstI and the 0.53kb band spanning the dctB-D intergenic region ligated into Bluescript II SK+.
pRU150 digested with EcoRI and religated.
143
Fig 3.11 Construction of the dctBDp reporter probe, pRU354.
Plasmid pRU354 is a dctBDp reporter probe containing a 3.5kb BamHI
fragment comprising the first 1.1kb of dctD, all of dctB and the dctA-B
intergenic region and the 5’ end of dctA to the BamHI site.
pRU348 AmpR (6.5kb)
pRU354 TcR (14.1kb) dctBDp promoter probe
pRU348 digested with BamHI and cloned into pMP220. This was orientated with EcoRI.
* indicates a truncated site or gene.
144
All four reporters, pRU104 (dctBp), pRU292 (dctDp (short)), pRU392
(dctDp (long)) and pRU354 (dctBDp) were conjugated into strain 3841
(wildtype) generating respectively strains RU365, RU767, RU970 and RU768.
Expression from their respective promoters was assayed by monitoring β-
galactosidase activity under appropriate conditions. Comparable to that
previously reported 1876,275,2173, expression from the dctBp was
constitutive after cells were grown on all substrates tested with a small increase
evident when in glucose/aspartate and succinate/ammonia grown cells (Table
3.3). Expression from both the dctDp promoter probes was low and similar to
that obtained from a control strain (RU368), which contains the basic pMP220
replicon. As both of the dctDp promoter probes were made independently, this
diminishes the possibility that this lack of expression is due to a mutation
encountered in the process of construction. In addition, since pRU392 contains
1.3kb of dctB DNA which directly precedes the start site of dctD, this makes it
unlikely that there is not enough upstream DNA to allow a potential promoter to
function. This indicates that either dctD has no promoter or a very weak one
which is difficult to detect due to the background encountered in the assay.
Expression of lacZ from the dctBDp probe was also measured and it
displayed similar activity to the dctBp fusion (Table 3.3) This indicates that the
dctBp also drives transcription of dctD and that the two genes are probably
transcribed as a single unit.
145
Table 3.3 Expression of various dctBp, dctDp and dctBDp reporter probes.
Parent Parent Plasmid Description StrainStrain Genotype
G/N G/ASP S/N S/ASP
3841 w.t. pRU104 dctB p Rep. RU 365 778±90 1318±403 1211±40 743±116
3841 w.t. pRU 292 dctD p Rep.(Short) RU 767 172±5 192±14 214±8 174±9
3841 w.t. pRU392 dctD p Rep.(long) RU 970 166±40 265±79 228±34 230±77
3841 w.t. pRU 354 dctBD p Rep. RU 768 788±18 1180±88 1454±56 749±50
3841 w.t. pMP220 Basic replicon RU368 120±40 180±42 168±21 205±62
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
146
3.2.4.2 Complementation analysis of the dctD promoter.
As suggested by the previous results, the possibility existed that dctD had
its own weak promoter. In order to further address this, complementation
analysis was carried out. A plasmid carrying dctA and dctB was constructed.
This was tested for complementation of strains mutated in dctA, dctB and strains
deleted in dctD and dctBD for growth on succinate as the carbon source using the
following strategy; If dctD has its own promoter, DctD should be made in a
dctB:: strain (i.e. independent of the dctBp). This DctD should be capable of
being activated by a plasmid encoded copy of DctB, hence causing transcription
of dctA and allowing complementation of the dctB strain for growth on succinate
(Fig. 3.12). Construction of the necessary plasmid, pRU339, which carries a
copy of dctA and dctB is shown in Fig. 3.13.
Fig 3.12 Diagram of complementation strategy of a dctB strain by
dctD.
Fig. 3.13 Construction of pRU339.
Chromosomal DCT region mutated in dctB
Is sufficent DctD produced from its own promoter, indepent of the dctBp, to allow expression of dctA via the plasmid encoded copy of dctB.
Plasmid carrying dctA and dctB.
dctB
147
Plasmid pML122 is a broad host range IncQ expression vector encoding
gentamicin-resistance 5216. This was digested with SalI, filled in and an Ω
interposon encoding spectinomycin resistance was ligated in, creating pRU330.
This is the basic plasmid containing the interposon but devoid of all the
promoter and polylinker DNA. Plasmid pRU327 was digested with HindIII and
the dctA dctB containing HindIII fragment was cloned into HindIII-digested
pRU330 forming pRU339. This plasmid contains dctA, the dctA-B IR, dctB and
a truncated dctD.
* indicates a truncated site or gene.
148
Plasmid pRU339 was conjugated into strains 3841, RU727 (dctA), RU730
(dctB), RU711 (dctD) and RU865 (dctBD) generating respectively strains
RU1008, RU1010, RU1011, RU1009 and RU1012. Plasmid pRU339
complemented strain RU1008 (RU727/dctA) for growth on succinate indicating
the copy of dctA on the plasmid is intact (Table 3.4). Plasmid pRU339 also
complemented strain RU1010 (RU730/dctB) for growth on succinate, indicating
that the copy of dctB is intact. This expression was dctD dependent since
pRU339 was unable to complement strains RU1011 (RU711/dctD) or RU1009
(RU865/dctBD) (Table 3.4). This eliminates any possibility that the
complementation observed was simply due to extra copies of dctA being
expressed independently of DctD. This provides evidence that dctD may have
its own promoter and that it functions at physiological levels. However the
possibility that a promoter from within the interposon could drive some
expression of dctD cannot be excluded. To try and avoid the possibility of read through from the interposon
causing dctD expression, dctD was cloned into the promoterless vector pMP220
creating plasmid pRU109 (Fig. 3.14) and tested for complementation of a dctD
strain in trans.
This plasmid was conjugated into strains 3841, RU727, RU730 and
RU711 creating RU466, RU1210, RU1211 and RU1212. These were tested
for growth on succinate (Table 3.4). Plasmid pRU109 complemented strain
RU1212 (RU711/dctD) indicating that sufficient DctD is made from this plasmid
to allow transcription from the dctAp while strain RU1210 (RU727/dctA) and
RU1211 (RU730/dctB) were not complemented confirming that this was DctD
dependent.
149
Fig. 3.14 Construction of pRU109.
pRU109 contains an intact copy of dctD cloned into pMP220 in the
opposite orientation to lacZ.
However this approach suffers from the possibility that weak promoter
activity from the vector amplified by the copy number of the replicon could
account for the complementation observed. In conclusion, it is difficult to
confirm the presence of a weak dctD specific promoter using these techniques
and it is still probable that most of the expression of dctD under normal
circumstances is accomplished by readthrough from the dctB promoter.
150
Table 3.4 Complementation analysis of dctD using plasmids pRU339
and pRU109
Parent Parent Plasmid StrainStrain Genotype
G/N S/N
3841 w.t. pRU339 RU1008 +++ +++
RU727 dctA :: pRU339 RU1010 +++ +++
RU730 dctB :: pRU339 RU1011 +++ +++
RU711 dctD :: pRU339 RU1009 +++
RU865 dctBD :: pRU339 RU1012 +++
3841 w.t. pRU109 RU466 +++ +++
RU727 dctA :: pRU109 RU1210 +++
RU730 dctB :: pRU109 RU1211 +++
RU711 dctD :: pRU109 RU1212 +++ +++
Growth conditions
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. indicates no growth.
Growth
151
3.2.5 Expression from the dctAp in various strains mutated
in the dct genes.
The previous two sections described the construction of dct strains and
investigated the possibility that dctD has its own promoter. This section
examines expression from the dctAp in these strains, to investigate if it is dctB/D
dependent and to explore the roles of the various genes comprising the DCT
operon in regulating transcription from the dctAp.
The dctAp reporter plasmid (pRU103) was conjugated into the strains,
RU727 (dctA), RU730 (dctB), RU711 (dctD), RU865 (dctBD) and RU714
(dctABD) generating strains RU940, RU941, RU942, RU943 and RU944.
Expression from the dctAp was monitored using β-galactosidase activity as
before under various growth conditions. As all of these strains are defective for
growth on C4-dicarboxylates, induction of the dctAp was tested by growing the
strains on glucose/ammonia in the presence of succinate or aspartate and also on
glucose/aspartate. This was possible as succinate in the presence of glucose
/ammonia induces the dctAp normally in the wildtype as shown previously
(Table 3.1).
Expression from the dctAp in a DctA deficient background is inducible by
succinate and aspartate. Production of -galactosidase in strain RU940
(dctA/pRU103) in the presence of succinate or aspartate is elevated ~10-fold
when compared to levels of expression observed on glucose/ammonia grown
cells (Table 3.5), and this is similar to strain 3841. This indicates that
transcription from the dctAp in response to C4-dicarboxylates or aspartate can
occur in the absence of DctA. Moreover, it also demonstrates that, similar to
the wildtype, neither glucose or ammonia have any effect on induction of
transcription from the dctAp by succinate or aspartate in a dctA strain. Strain
RU940 grown on glucose/succinate/aspartate gave the highest level of
expression (Table 3.5), again similar to that observed in the wildtype where
152
succinate and aspartate together displayed an additive effect on dctAp
transcription.
No transcription from the dctAp was evident in any strain mutated in dctB,
dctD, dctBD or dctABD. These strains were tested after growth on
glucose/ammonia in conjunction with succinate and also after growth on
glucose/aspartate and glucose /aspartate/ammonia (Table 3.5). In addition after
growth on glucose/succinate/aspartate, again, no increase in -galactosidase
activity was detected. These results indicate that expression from the dctAp is
dependent on DctB and DctD.
To investigate if this inducibility of the dctAp is strain specific, -
galactosidase activity was measured from the dctAp in a different strain of R.
leguminosarum, strain 3855 and dct::Tn5 mutants derived from it. Plasmid
pRU103 was conjugated into strains 8401, RU527 (dctA::Tn5), RU528
(dctB::Tn5) and RU529 (dctD::Tn5) and measured as before (Table 3.5). Thses
results concurred with those above indicating that transcription from the dctAp is
inducible in the absence of DctA and this was DctB/D dependent.
In addition, to test whether this effect was unique to strain RU727, -
galactosidase activity from the dctAp was also measured in two dctA::Tn5 strains
of R. leguminosarum biovar viciae strain 3841, strains RU436 and RU437.
Plasmid pRU103 was conjugated into these strains generating strains RU694 and
RU695. These were tested as before and and both showed induction of
transcription from thre dctAp after growth on glucose/aspartate and
glucose/succinate/ ammonia similar to strain 3841. This indicates that this
inducibility of transcription from the dctAp is not specific to strain RU727.
These results, where in a dctA strain the dctAp is inducible is in contrast to
almost all those obtained in other studies (with the exception of Batista et al.,
1992) and is discussed later. In summary it is clearly evident from the results
presented here that the dctAp responds normally to induction by succinate and
153
aspartate in the absence of DctA and also that its transcription is DctB/D
dependent.
154
Table 3.5 -galactosidase activity from the dctAp in various strains mutated in the dct genes.
Parent Strain
Genotype Strain
G/N G/ASP G/S/N G/S/ASP G/ASP/N
3841 w.t. RU 364 266±61 1533±356 2228±257 3997±273 1944±128
RU 727 dctA :: RU 940 297±25 3417±248 2073±212 3396±354 2558±341
RU 730 dctB :: RU 941 184±27 273±36 102±20 237±112 102±33
RU 711 dctD :: RU 942 150±26 235±6 91±5 198±35 136±47
RU 865 dct BD :: RU 943 168±10 255±61 141±53 460±157 210±73
RU 714 dctA BD :: RU 944 179±65 264±46 205±50 380±122 161±35
RU 436 dctA ::Tn5 RU 694 286±12 2945±123 2407±122 4080±147 1886±58
RU 437 dctA ::Tn5 RU 695 230±37 3078±369 3057±107 4475±143 2281±165
3855 w.t. RU376 260±45 1620±75 1960±104
RU 527 dctA ::Tn5 RU 991 315±85 2755±84 3119±123
RU 528 dctB ::Tn5 RU 992 113±12 95±3 97±12
RU 529 dctD ::Tn5 RU 993 111±21 120±12 111±23
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
155
3.2.6 Investigation of induction of transcription from the
dctAp in response to analogues of C4-dicarboxylates.
As described in the introduction, it is postulated that DctB is the C4-
dicarboxylate sensor although it is difficult to confirm this or determine its
precise role1816,2173,2560,2561. As described in the previous section
(3.2.5), in the absence of DctA, the dctAp still shows normal induction in
response to C4-dicarboxylates and aspartate; and is not as previously reported
expressed constitutively. Hence, it is considered likely that DctB is responsible
for sensing the presence of C4-dicarboxylates.
One way to further define the role of DctB is by the use of analogues of C4-
dicarboxylates. By choosing non-metabolizable analogues which, from
competition studies, are considered to bind to DctA, it should be possible to
determine whether sensing of C4-dicarboxylates and aspartate by DctB is extra-
cellular or intra-cellular with a possible requirement for metabolism. Moreover,
this should allow the role that DctA may play in regulating DctB, to be
addressed.
2-Methyl succinate, itaconic acid and 2,2-dimethyl succinic acid were
chosen as suitable analogues since they are similar in structure to succinate (Fig.
3.15), and so would be expected to present a similar stereochemical
configuration to the DCT sensor. Moreover, they have all been shown to
compete for succinate transport by DctA, indicating that they can bind to DctA,
and they are all non-metabolisable 2073. Asparagine was also selected
because it cannot not induce transcription from the dctAp in strain 3841
(wildtype), but is closely related to aspartate (which is a good inducer) and
because it is metabolised directly to aspartate within the cell (Poole, 1986).
Fig. 3.15 Structure of succinate, aspartate and asparagine and
various analogues of succinate.
156
Succinate Aspartate Asparagine
Itaconic acid 2,2-dimethyl succinate
2--methyl succinate
157
3.2.6.1 Investigation of the ability of various succinate
analogues and asparagine to support growth of R. leguminosarum
biovar viciae strain 3841.
As a prerequisite to these experiments, all these analogues were tested for
their ability to support growth as a sole carbon source. Asparagine was tested as
a sole nitrogen source in conjunction with glucose and also as a sole
carbon/nitrogen source. The succinate analogues were also tested for their
ability to inhibit growth by assessing the cell’s ability to grow on
glucose/ammonia in their presence.
2-Methyl succinate, itaconic acid and 2,2-dimethyl succinate were all
unable to support growth of both strain 3841 (wild type) and RU727 (dctA) when
present as the sole carbon source (Table 3.6). In addition, they did not cause any
inhibition of growth of these strains when the cells were grown on
glucose/ammonia. Asparagine behaves in a similar fashion to aspartate being
unable to support growth when supplied as a carbon source or as a
carbon/nitrogen source, but supports growth when supplied as the sole nitrogen
source.
158
Table 3.6 Growth phenotypes of strain 3841 on asparagine and analogues of succinate.
Strain Genotype
Succinate /N
Aspartate /N
2-Methyl succinate
/N
2,2-Dimethyl succinate
/N
Itaconic acid /N
Asparagine /N
Asparagine
3841 w.t. +++ +++ +++ +++
G/N Succinate
G/N Aspartate
G/N 2-Methyl succinate
G/N 2,2-
Dimethyl succinate
G/N Itaconic
acid
G/N Asparagine
3841 w.t. +++ +++ +++ +++ +++ +++
Growth conditions
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
Growth conditions
159
3.2.6.2 Investigation of transcription from the dctAp in
response to analogues of succinate and asparagine.
Various strains carrying the dctAp reporter were tested for induction of
transcription from the dctAp in response to 2-methyl succinate, itaconic acid and
2,2-dimethyl succinate. It was necessary to grow these cells, so the analogue
was tested with glucose/ammonia supplied as the growth substrates. Induction
is possible under these conditions since it has been previously shown that
aspartate or succinate can induce the dctAp in the presence of glucose/ammonia
in both, strain 3841 (wildtype) and RU727 (dctA) (section 3.2.2).
Transcription from the dctAp occurred in strain 3841 after growth in the
presence of itaconic acid and this was similar to that observed in the presence of
aspartate, while no induction of transcription from the dctAp was evident after
growth in the presence of 2-methyl succinate, 2,2-dimethyl succinate or
asparagine (Table 3.7). However, in strain RU940 (dctA) 2-methyl succinate
and 2,2-dimethyl succinate as well as itaconic acid caused transcription from the
dctAp and at similar levels to that recorded after growth in the presence of
aspartate. This suggests that the presence of DctA prevents transcription form
the dctAp by 2-methyl succinate and 2,2-dimethyl succinate. No induction was
evident in dctB, dctD, dctBD or dctABD strains in response to any substrate,
indicating that induction is DctB/D dependent (Table 3.7).
160
Table 3.7 -galactosidase activity from dctAp in the wild type and various dct strains in response to analogues of succinate.
Parent Strain
Genotype Strain
G/N G/N G/N G/N G/N10mM ASP 10mM Itaconic 10mM 2 methyl 10mM 2,2 Dimethyl
acid Succinate Succinic Acid
3841 w.t. RU 364 153±12 1582±112 1317±118 199±7 202±3
RU 727 dctA :: RU 940 274±52 1771±179 1889±233 1777±103 1530±214
RU 730 dctB :: RU 941 184±27 107±4 75±21 143±27 65±28
RU 711 dctD :: RU 942 150±26 70±13 211±81 164±37 85±25
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
161
Asparagine was also tested for induction of transcription from the dctAp.
When cells were grown on glucose/ammonia/asparagine or on glucose in
conjunction with asparagine as the sole nitrogen source no transcription from the
dctAp was evident either in strain 3841 (wildtype) or in RU730 (dctB) and
RU711 (dctD). However in strain RU940 (dctA) a small increase in
transcription was evident indicating that asparagine can cause transcription form
the dctAp in the absence of DctA in a similar fashion to 2-methyl succinate and
2,2-dimethyl succinate although not to the same extent. Induction of
transcription from the dctAp by asparagine was also tested in the presence of
glucose/aspartate and as expected, transcription was evident, similar to that
obtained on glucose/aspartate indicating that asparagine does not affect induction
of transcription from the dctAp by aspartate (Table 3.8).
Table 3.8 -galactosidase activity from the dctAp in response to
asparagine in strain 3841 and various dct strains.
Parent Geno- Strain Strain type
G/N G/N G/Asp G/10mM 10mM 10mM
Asparagine Asparagine Asparagine
3841 w.t. RU 364 153±12 229±41 1802±110 290±5
RU 727 dctA :: RU 940 274±52 507±71 1955±74 782±88
RU 730 dctB :: RU 941 184±27 87±63RU 711 dctD :: RU 942 150±26 94±5
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
It is evident that the inducer profile to which the dctAp can respond is
limited in the wildtype and that this specificity is determined by DctA. In the
absence of DctA, the dctAp shows DctB/D dependent transcription in response
162
to an increased range of molecules. This reinforces the idea that DctA is not
required for sensing inducers since the DCT system shows normal regulation in
response to suitable substrates in its absence and even to ones which are non-
metabolizable and possibly not transported. If DctB is the sensor (discussed
later) then it is possible that DctA may control the signals to which DctB
responds. Upon removal of DctA, the spectrum of molecules (or signals) to
which DctB can respond is increased.
163
3.3 Discussion
3.3.1 Investigation of the role of DctA, DctB and DctD in
sensing and induction of transcription from the dctAp.
The results presented in this chapter suggest the following roles for DctA
and DctB in induction of transcription from the dctAp:
(1) Expression of dctD is predominantly driven by the dctB promoter;
(2) DctA is not required for induction of transcriptionfrom the dctAp;
(3) DctB senses C4-dicarboxylic acids,
(4) DctA controls what DctB can respond to.
3.3.2 Investigation of the dctD promoter.
The results presented in Section 3.2.4 of this Chapter indicate that
expression of dctD is driven predominantly by the dctB promoter. Two
independently constructed dctD-lacZ transcriptional reporters with different
amounts of dctB DNA upstream of the potential dctD promoter region gave
background levels of -galactosidase activity. In contrast a dctBD-lacZ
reporter gave a high level of expression that was similar to that obtained from a
dctB-lacZ reporter probe. As the expression from the dctBp probe is similar to
that from the dctBDp probe, this suggests that these genes are probably
expressed as a single transcriptional unit. This is also reinforced by
circumstantial evidence. Four nucleotides separate dctB and dctD 2173 so
any promoter for dctD would have to be located in the 3’ end of dctB and any
transcriptional terminator for dctB would have to be located in the 5’ end of
dctD. In addition, a transcriptional terminator in the 5’ end of dctD would be
expected to prevent transcription from a dctD specific promoter.
This is in contrast to a report by #2173 that indicated that in R. meliloti,
dctD is expressed at three times the level of dctB. However as discussed in the
164
introduction (Chapter One), this was measured in a dctB::Tn5 mutant and it is
possible that a promoter reading out of the transposon into dctD could result in
this expression. Such an effect has been shown in this thesis (Chapter Six),
where a Tn5 insertion upstream of dctA results in its constitutive expression.
This is presumably due to a promoter in Tn5 reading into dctA. Moreover, a
promoter reading out of IS50 in Tn5 and capable of causing expression of
downstrean genes has previously been identified (Kendrick and Reznikoff,
1988).
However, the possibility still exists that dctA may have its own weak
promoter that cannot be detected by the use of lacZ fusions. This possibility
was addressed by complementation analysis. A strain mutated in dctB by an
interposon carrying a gene for spectinomycin resistance, still made sufficient
DctD to enable complementation in trans by a plasmid encoded copy of dctB.
While this result suggests that dctD has a weak but physiologically significant
promoter, complementation for growth on succinate in strain RU730 (dctB)
could be due to promoter out activity from the interposon located in dctB. It
has been shown that some expression of downstream genes due to promoters in
the spectinomycin gene may occur 5271. A similar type of problem is
encountered in the use of Tn5 and this is probably worse than using an
interposon as the latter has transcriptional and translational terminators at either
end which potentially reduce promoter out activity.
Complementation of a dctD::Tn5 strain was achieved by a plasmid
encoded copy of dctD. However it is not known how physiologically significant
this is as a copy number is necessarily evident and also it is possible that weak
promoters within the vector sequence could cause some transcription of dctD.
Therefore, unless the actual level of DctD present in this strain is
measured, for example by measuring protein or mRNA levels, it is not possible
to conclude with certainty that this expression is due to a promoter unique to
165
dctD. However it demonstrates that strain RU730 (dctB) is not deficient in
DctD; producing enough to enable transcription from the dctAp.
In conclusion these results suggest that expression of dctD is driven by the
dctB promoter although the possibility that dctD has its own weak promoter
cannot be entirely eliminated.
3.3.3 Role of DctA in regulating induction of transcription
from the dctAp.
A model for how induction from the dctAp occurs in response to C4-
dicarboxylic acids has previously been suggested in a number of reports
2173,275. This model proposes that DctB acts as a sensor protein and C4-
dicarboxylates bind to it, causing autophosphorylation. DctB then activates
DctD by phosphorylation which together with the Sigma factor, 54, induces
transcription from the dctAp. This is based on evidence that DctB is membrane
bound, containing a periplasmic loop postulated to be involved in sensing, and
that DctB and DctD comprise a two component regulatory system
2173,5226,1885. It is also postulated that DctA may be in contact with DctB
and hold it in a particular conformation in the absence of C4-dicarboxylates.
This is based on reports that the absence of DctA causes constitutive expression
from the dctAp implying that DctA controls its own expression. This control is
postulated to occur through contact with DctB such that upon binding of C4-
dicarboxylates by DctA, it dissociates form DctB allowing DctB’s
autophosphorylation which causes induction from the dctAp. A more refined
version of this model based on the DCT system in R. meliloti has been described
by #275. They suggest that since the absence of DctA gives rise to
constitutive expression from the dctAp, and DctB and DctD are required for this
transcription, DctB senses the C4-dicarboxylate-dependent conformational state
of DctA rather than C4-dicarboxylates directly. C4-dicarboxylates would bind to
dctA, inducing a conformational change which is sensed by DctB. This signal
166
would allow the activation (and release) of DctB and hence induce transcription
from the dctAp. Intrinsic in these models is that the default state of DctB is that
it is autophosphorylated and that DctA when associated with DctB prevents its
autophosphorylation.
The results presented in this Chapter are not compatible with these models.
This report shows that in the absence of DctA expression from the dctAp is
regulated normally in response to C4-dicarboxylates. This was shown in a dctA
interposon mutant, two independent dctA::Tn5 mutants and also in a dctA::Tn5
of a different strain of R. leguminosarum. When expression from the dctAp was
examined in these strains, after growth on glucose/ammonia, no induction was
evident indicating that expression from the dctAp is not constitutive. When
grown on glucose/ammonia in the presence of succinate or aspartate a ~6-10 fold
increase in transcription was evident, similar to that of strain 3841 (wildtype).
This indicates that normal induction of transcription from the dctAp occurs in the
absence of DctA and therefore that DctA is not essential for regulation of
transcription in response to C4-dicarboxylic acids or aspartate.
This is comparable to a report by #1536, which showed that a Tn5
transcriptional fusion to dctA integrated into the chromosome also shows normal
regulation of transcription from the dctAp in response to C4-dicarboxylates
although a wildtype control was not measured. In addition, the constitutive
expression of a dctA-lacZ fusion as reported by #2560 still showed a four fold
increase in transcription in the presence of C4-dicarboxylates indicating that in
the absence of dctA some regulation of the dctAp occurs.
In contrast two reports in R. meliloti have shown that dctA-phoA
translational reporter fusions are expressed in the absence of DctA and do not
show C4-dicarboxylate-dependent induction. The discrepancies evident in all
these results could be due to a number of factors:
167
(1) Differences in regulation of transcription from the dctAp may exist
between R. leguminosarum and R. meliloti. However the report by
#1536 indicating proper regulation was in R. meliloti and this work is in
R. leguminosarum.
(2) As the two reports suggesting complete loss of induction by
succinate from the dctAp used dctA-phoA translational fusions it is
possible that some intrinsic difference exists between transcriptional and
translational reporter systems or between lacZ and phoA as the reporter
gene.
(3) The location of the mutation in dctA could play a role although no
simple correlation between location and effect is immediately obvious
since a variety of different dctA strains show normal regulation.
The results presented here indicate that the dctAp is inducible in the
absence of DctA indicating that DctA is not essential for sensing of C4-
dicarboxylates and that normal regulation in response to C4-dicarboxylates can
occur in its absence. Moreover, any model suggesting that DctA interacts with
DctB, based on constitutive expression of dctAp in the absence of DctA, is
untenable.
3.3.4 Role of DctB in sensing C4-dicarboxylates and
aspartate.
It is generally accepted that DctB is involved in sensing C4-dicarboxylates.
DctB is absolutely required for induction of transcription from the dctAp in
response to C4-dicarboxylates in the wildtype 950,2173,2560,3333,275,1876.
Moreover, DctB is thought to be membrane bound with its N-terminus
containing a periplasmic domain thought to be involved in sensing. This
domain is postulated to respond to the presence of C4-dicarboxylates either
directly or due to the state of DctA in response to C4-dicarboxylates. In
168
addition, extensive mutagenesis has not revealed any other genes besides those
already described, as essential for transcription of dctA. The fact that the dctAp
shows normal induction in the absence of DctA supports the possibility that
DctB responds directly to C4-dicarboxylates and excludes the possibility that
DctB only senses the conformation of DctA in the presence of C4-dicarboxylates.
As DctB is capable of inducing transcription from the dctAp in the absence
of DctA this suggests that transport of C4-dicarboxylates by DctA is not essential
for sensing. As a corollary, this also suggests that sensing of C4-dicarboxylates
by DctB is periplasmic. This is again supported by the proposed structure of
DctB which contains a periplasmic domain thought to be involved in C4-
dicarboxylate sensing.
However, the possibility that C4-dicarboxylates can be sensed in the
cytoplasm cannot be ruled out. It is possible that a second transport system,
distinct from the DCT system may exist in R. leguminosarum. A second C4-
dicarboxylate transport system has been reported in Rhizobium NGR234 1513.
In addition, in strains mutated in the DCT system some growth is evident on
succinate/ammonia although at a much reduced rate (colonies are observed
after~10 days). Therefore this raises the possibility that C4-dicarboxylates could
enter the cell at a low level in the absence of DctA and as a consequence induce
DctB. This possibility has been addressed by examination of the ability of
asparagine and itaconic acid to induce transcription from the dctAp.
Asparagine is unable to induce transcription from the dctAp in the wildtype
and only poorly in a dctA strain. However the closely related amino acid
aspartate is a very efficient inducer. Asparagine is transported by a distinct
transport system (i.e. not the DCT system) 1026. Once inside the cell it is
rapidly converted to aspartate by asparaginase and follows the same metabolic
route as aspartate Poole, 1985. Therefore high levels of aspartate are thought
to be present in cells grown on asparagine as the nitrogen source. However,
when grown on asparagine this aspartate pool is unable to induce transcription
169
from the dctAp in the wildtype, suggesting that induction of the dctAp by
aspartate does not occur intracellularly and that aspartate (and C4-dicarboxylic
acids) must be detected in the periplasm.
Examination of induction of the dctAp by itaconic acid also supports the
view that DctB does not sense in the cytoplasm. Itaconic acid is an analogue of
succinate, which can induce expression from the dctAp in both the wildtype and
in a dctA strain. In addition it can compete with succinate for transport by DctA
2073, and while it is unknown if it is actually transported this indicates that it
can at least bind to DctA and if it is transported, it is most likely to require
DctA. Itaconic acid is unable to support growth of R. leguminosarum biovar
viciae strain 3841 when supplied as the carbon source and this is considered
most likely to be due to it being non-metabolizable. However, itaconic acid is
capable of inducing transcription from the dctAp under these circumstances
suggesting that metabolism of the inducer molecule is not required. Moreover,
induction of transcription from the dctAp still occurs in a dctA strain,
circumstances where it is unlikely to be transported, indicating again that
internalisation of C4-dicarboxylates is unnecessary for transcription from the
dctAp.
3.3.5 Role of DctA in interacting with DctB.
The possibility that DctA interacts with DctB to control its phosphorylation
state, supported largely on the evidence that transcription from the dctAp is
constitutive in the absence of DctA, is not supported in this thesis. However,
based on the results presented here, a role for DctA in interacting with DctB is
still possible.
Induction of transcription from the dctAp was examined in the wildtype
and in a dctA strain in response to analogues of succinate. These analogues do
not support growth of R. leguminosarum and therefore are either not transported
at a significant rate or metabolised within the cell 2073. When tested for
170
induction of transcription from the dctAp in the wildtype only itaconic acid
induced transcription. However in a dctA strain, expression from the dctAp was
evident in the presence of 2-methyl succinate and 2,2-dimethyl succinate as well
as itaconic acid. This suggests that in the absence of DctA the range of
molecules that DctB can respond to is increased and that DctA plays a role in
limiting what can induce the dctAp. If DctB is considered to be the sensor of
C4-dicarboxylates, then DctA must achieve this by controlling what DctB can
respond to.
One way in which DctA can control DctB is if it directly interacts with it.
Two possibilities for direct interaction can be considered:
(1) DctA may only transport molecules of a defined shape and this
transport by DctA signals to DctB, leading to its activation,
(2) DctA may physically shield the sensor domain of DctB and only
allow access to suitably shaped molecules.
The first possibility is unlikely as induction of transcription from the dctAp
occurs in the absence of DctA indicating that the presence of DctA is not
essential for sensing to occur. However it is still possible that the
conformational state of DctA modifies signalling by DctB.
In the second possibility the role of DctA in controlling the specificity of
DctB would be a purely physical one, in that its presence dictates what can
interact with DctB. DctB could have an intrinsic ability to respond to other
molecules, besides C4-dicarboxylates and aspartate, and this is only evident
when DctA, which acts as a steric barrier, is removed. Therefore, activation by
2-methyl succinate and 2,2-dimethyl succinate could occur in a dctA strain.
In conclusion, both models encompass the idea that DctA and DctB
physically interact and that in doing so DctA exerts control over what DctB can
respond.
171
3.3.6 Conclusion.
Based on the evidence presented in this Chapter a model of how induction
of transcription from the dctAp occurs can be proposed. DctA and DctB
associate in the inner membrane and upon the addition of a suitable substrate,
DctB senses this externally via its proposed sensor domain. Access to this
sensor domain is controlled by the presence of DctA, allowing activation to
occur only by molecules of a defined shape. Upon sensing of the substrate by
DctB this signal is transmitted across the membrane to its cytoplasmically
located C-terminus which first autophosphorylates and then transfers its
phosphate group to DctD. DctD~Pi in conjunction with σ54-dependent RNA
polymerase allows transcription from the dctAp.
Further experiments are required to fully test this model and elucidate how
DctA and DctB interact. For example, if the aforementioned analogues were
available in a radio-isotope labelled form they could be tested for transport. If
they are not transported this would confirm that DctB senses C4-dicarboxylates
externally in the periplasm. Also, if antibodies or a bank of site-directed
mutants were available for DctA and DctB it may be possible to determine
whether they actually interact.
173
Chapter 4
4.1 Introduction
The aim of the work described in this chapter was to investigate the
possibility that expression from the dctAp may occur in response to disparate
environmental conditions such as osmotic stress and nitrogen limitation.
The results in the previous Chapter demonstrated that in the absence of
DctA, the dctAp shows normal induction in response to C4-dicarboxylic acids.
This is consistent with another report, 1536, in which expression from the
dctAp in a dctA background also displayed comparable regulation. In addition,
they reported that transcription from the dctAp was induced in response to other
conditions such as osmotic stress and calcium limitation. This suggested that
the dctAp could be susceptible to cross-regulation by other stimuli, besides C4-
dicarboxylates and aspartate.
As described in Chapter One (1.5), transcription from the dctAp is
dependent on DctB and DctD, which comprise a two-component sensor-
regulator system. DctD is phosphorylated by DctB, enabling it to activate
transcription by binding upstream from the dctAp. DctB and DctD share
extensive homology with other two-component sensor-regulator systems such as
NtrB/NtrC 5226,2173. It has been reported that two-component sensor-
regulator systems may cross-activate other similar systems under certain
circumstances 5226,1885.
This is thought to occur in two ways:
(1) the sensor half may phosphorylate a non-cognate response-regulator
(for example NtrB to DctD),
174
(2) the response regulator may interact with non-cognate promoters and
cause transcription in place of the normal response-regulator (for example
NtrC~Pi to dctAp).
Therefore, the possibility exists that cross-regulation via components of
two-component sensor-regulator systems other than DctB/D may cause
transcription from the dctAp under certain circumstances. Therefore it was
decided to test expression from the dctAp in response to various environmental
conditions.
175
4.2 Results 4.2.1 Transcription from the dctAp in response to nitrogen
limitation and osmotic stress.
Nitrogen limitation was chosen as it has been reported that in R.
leguminosarum the cells response to this is partly mediated by a two-component
sensor-regulator pair, NtrB/NtrC, as part of the NTR system which is well
characterised in R. leguminosarum 2587,1556. In addition, it has been shown
that a mutated allele of ntrC, which is active under nitrogen limiting conditions
and is structurally similar to DctD, may cause transcription from the dctAp
2447 and some evidence suggests that normal NtrC may also be capable of
causing transcription from the dctAp under such conditions (B. Gu and B.T.
Nixon unpublished results in 1815).
The effect of osmotic stress its on transcription from the dctAp was also
examined. The system(s) controlling the cells response to this stimulus is not
documented in R. leguminosarum. However, it is well characterised in E. coli;
the major system being the EnvZ/OmpR two-component sensor-regulator pair
where EnvZ is thought to be a membrane bound sensor while ompR is a
transcriptional activator 5226. It is considered likely that an analogous
system exists in R. leguminosarum and therefore could potentially cross-regulate
transcription from the dctAp under conditions of osmotic stress.
4.2.2 Effect of nitrogen limitation on transcription from the
dctAp.
Transcription from the dctAp was measured under conditions of nitrogen
limitation by monitoring -galactosidase production. Cells were grown on a
carbon source such as glucose, which does not induce transcription from the
dctAp, while testing the affect of limiting ammonia as the nitrogen source.
176
4.2.2.1 Determination of onset of nitrogen limitation using
ammonia as the nitrogen source in R. leguminosarum.
As a prerequisite to these experiments it was necessary to determine what
level of ammonia would cause nitrogen limitation but still support normal growth
rates. To determine the onset of nitrogen limitation, transcription from a glnII
promoter (glnIIp) probe which is nitrogen regulated was used as an assay.
pAR36A is a glnIIp reporter probe employing galactosidase as the reporter
gene 1749 and was conjugated into strain 3841 (wildtype) generating strain
RU622. This was grown on glucose as the carbon source with different amounts
of ammonia and -galactosidase activity from the glnIIp measured (Table 4.1).
Ammonia (0.5mM) caused derepressed levels of transcription, indicative of
nitrogen limitation, while supporting normal growth. It was therefore chosen as
the level to induce nitrogen limitation.
Table 4.1 -galactosidase activity from the glnIIp after growth of
RU622 on different amounts of ammonia.
177
Parent Parent Strain Strain Genotype
G/ G/ G/ G/10mM 2.0mM 1.0mM 0.5mM
ammonia ammonia ammonia ammonia
3841 w.t. RU 622 288±26 342±26 350±34 1126±31
Growth conditions
Results are shown as ONPG hydrolysed (nmol.min-1.(mg protein)-1)±S.E.M.and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
4.2.2.2 Transcription from the dctAp under nitrogen
limitation.
Strains RU364 (3841/pRU103), RU940, RU941, RU942, RU943 and
RU944, (various dct mutants carrying the dctAp reporter probe, pRU103), were
grown on glucose with ammonia (0.5mM) and -galactosidase activity from the
dctAp measured. Strain RU364 displayed a 5-6 fold increase in transcription
from the dctAp under these conditions (Table 4.2) and strain RU940
(dctA/pRU103) also showed an increase giving comparable values to the
wildtype. This suggests that the presence of DctA is not essential for expression
of the dctAp in response to nitrogen limitation. Strains mutated in dctB
(RU941), dctD (RU942), dctBD (RU943) and dctABD (RU944) all prevented
transcription from the dctAp in response to nitrogen limitation (Table 4.2). This
demonstrates that expression from the dctAp in response to nitrogen limitation is
DctB/D dependent.
To examine if expression from the dctAp in response to nitrogen limitation
was unique to interposon mutants, two dctA::Tn5 mutants, strains RU436 and
178
RU437 were utilised. The dctAp reporter probe, pRU103, had previously been
conjugated into these generating strains RU694 and RU695 (Chapter Three) and
were tested as above. Both showed induction of transcription from the dctAp in
response to nitrogen limitation (Table 4.2) although at a lower level than in strain
3841, 3-4 fold above background levels.
In addition, to test whether this nitrogen limitation response was unique to
R. leguminosarum biovar viciae, transcription from the dctAp was measured in
another strain of R. leguminosarum, strain 3855 and dctA, dctB and dctD Tn5
mutants of it (RU527, Ru528 and RU529 respectively) 2173. The dctAp
reporter probe,, pRU103, had again been previously conjugated into these
strains generating strains RU376, RU991, RU992 and RU993 respectively.
Transcription from the dctAp was tested as before in response to nitrogen
limitation. Strain 3855 (wildtype) and RU991 (dctA::Tn5) displayed increased
transcription from the dctAp in response to nitrogen limitation, similar to strains
3841, RU940, RU694 and RU695. The dctB and dctD Tn5 mutants of strain
3855 (RU992 and RU993) showed no transcription from the dctAp in response to
nitrogen limiting conditions indicating that, similar to strain 3841, the response
is DctB/D dependent. These results demonstrate that induction of transcription
from the dctAp in response to nitrogen limitation is not unique to R.
leguminosarum biovar vicae strain 3841 and that it can occur in dctA::Tn5
mutants as well as dctA:: mutants.
Table 4.2 -galactosidase activity from the dctAp in response to
ammonia limitation in various wildtype and dct strains.
179
Parent Parent Strain Strain Genotype
G/ G/10mM 0.5mM
ammonia ammonia*
3841 w.t. RU 364 266±61 1040±230RU 727 dctA :: RU 940 297±25 1362±81
RU 730 dctB :: RU 941 184±27 182±43
RU 711 dctD :: RU 942 150±26 252±62
RU 865 dct BD :: RU 943 168±10 204±44
RU 714 dctA BD :: RU 944 179±65 205±35
RU 436 dctA ::Tn5 RU 694 286±12 822±121
RU 437 dctA ::Tn5 RU 695 230±37 725±87
3855 w.t. RU 376 280±74 1010±190
RU 527 dctA ::Tn5 RU 991 315±85 1152±86
RU 528 dctB ::Tn5 RU 992 113±12 104±7
RU 529 dctD ::Tn5 RU 993 111±21 167±21
Growth conditions
* indicates nitrogen limiting conditions.Results are shown as ONPG hydrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
180
4.2.3 The role of the NTR system in mediating transcription
from the dctAp in response to nitrogen limitation.
As transcription from the dctAp occurred in response to nitrogen limitation,
it was considered possible that the NTR system could play a role in mediating it.
The NTR system is relatively well understood in R. leguminosarum. Nitrogen
limitation is thought to be mediated within the cell by the protein UR/URtase
acting in response to the glutamine/ -ketoglutarate ratio on the protein PII and
it transmitting its signal to appropriate systems by the two-component sensor-
regulator pair NtrB/NtrC. When the glutamine/ -ketoglutarate ratio is low,
indicative of nitrogen limiting conditions, PII causes NtrB to function as a
kinase on NtrC. Phosphorylated NtrC acts as a transcriptional activator binding
upstream of appropriate 54 encoded promoters causing the induction of genes
such as glnII 1749.
Since it is known that cross-regulation can occur between different two-
component sensor-regulator systems such as NtrB/C, the possibility exists that
cross-regulation between NtrB/C and DctB/D could be involved in expression
from the dctAp under nitrogen limitation. Therefore it was decided to construct
a R. leguminosarum biovar viciae 3841 strain mutated in ntrC, and investigate
its affect on induction of transcription from the dctAp in response to nitrogen
limitation.
4.2.3.1 Construction of RU929 (3841 ntrC:: ).
As an ntrC mutant (CFN2012 ntrC::Tn5) was available in R.
leguminosarum biovar phaseoli 1556 it was decided to use this in construction
of an ntrC mutant of strain 3841. The appropriate fragment containing the
mutated ntrC allele and Tn5 was cloned from CFN2012 and the Tn5 replaced
with an interposon encoding spectinomycin resistance. This was inserted into
a suicide plasmid forming pRU343 and a gene replacement event selected for
after conjugation into strain 3841 (wildtype) , generating strain RU929. This
181
technique is as described in Chapter Two. The construction of the necessary
plasmids are described in Fig. 4.1. This is an NtrC deficient strain and was
confirmed as being correct by two methods. Southern blotting with an ntrC
specific probe confirmed that the mutant allele had replaced the wildtype allele
and the suicide vector had been excised (Fig. 4.2). Secondly, the glnIIp
reporter probe (pAR36A) which is ntrC dependent was conjugated into strain
RU929 (ntrC strain) creating strain RU934. This was tested for expression from
the glnIIp using ammonia at 0.5mM and glutamate at 10mM, both of which
cause nitrogen limitation (Table 4.3). Neither displayed any induction of
transcription from the glnIIp in contrast to the wildtype control, RU622
indicating that these strains were deficient in NtrC.
Fig. 4.1. Construction of pRU314.
Total CFN2012 chromosomal DNA was digested with EcoRI (this was
appropriate as a map was available of the region and EcoRI does not cut in Tn5)
and the resulting fragments were cloned into Bluescript II SK+ selecting for
kanamycin resistance. One clone obtained, was extensively mapped,
confirming that it was identical to a previously reported EcoRI fragment
containing Tn5 and ntrC 1556 and was designated pRU341. This was
digested at the two unique HpaI sites located at either end of Tn5. Most of the
Tn5 was excised and replaced with a SmaI digested interposon, creating
pRU314. This was necessary, otherwise the Tn5 introduced on a suicide
plasmid would be capable of transposing and give rise to random Tn5 mutants.
Plasmid pRU314 was digested at the two XhoI sites which flanked the whole
insert and cloned into the suicide vector pJQ200SK yielding pRU343.
182
11.6kb EcoRI Tn5 ntrC containing fragment shot gun cloned into Bluescript II SK+.
pRU314 digested with XhoI and cloned into the suicide vector pJQ200KS.
pRU341 AmpR KmR (14.4kb)
pRU314 AmpR SpR (10.7kb)
pRU343 GmR SpR (13.0kb) ntrC suicide plasmid
* indicates a truncated site.
pRU341 digested with HpaI, excising most of the Tn5 and replaced with an interposon.
183
Fig. 4.2 Southern blotting of chromosomal DNA from RU929 (ntrC)
hybridised with an ntrC specific probe.
Table 4.3 -galactosidase activity from the glnIIp reporter probe in
RU934 (RU929/pAR36A).
Parent Parent Strain Strain Genotype
G/ G/ G/10mM 0.5mM 10mM
ammonia ammonia* glutamate*
3841 w.t. RU 622 288±26 1242±40 1126±31
RU 929 ntrC :: RU 934 290±21 284±42 310±32
Growth conditions
* indicates nitrogen limiting conditions.Results are shown as ONPG hydrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in tripliacte.
-galactosidase activity
Lane A. 1-kb ladder Lane B. 3841 HindIII Lane C. RU929 HindIII Hybridised with an ntrC specific probe (pRU314).
184
4.2.3.2 Induction of transcription from the dctAp in strain
RU966 (RU929/pRU103) in response to nitrogen limitation.
The dctAp reporter plasmid, pRU103, was conjugated into RU929
forming RU966. RU966 was tested for -galactosidase activity in response to
nitrogen limitation and none was evident in comparison to strain RU364
(3841/pRU103) (Table 4.4). This result shows that NtrC is necessary for
induction of transcription from the dctAp in response to nitrogen limitation and
implicates the NTR system in this induction.
Table 4.4 -galactosidase activity from the dctAp in RU966
(RU929/pRU103) in response to nitrogen limitation.
Parent Parent Strain Strain Genotype
G/ G/10mM 0.5mM
ammonia ammonia*
3841 w.t. RU 364 266±61 1040±230
RU929 ntrC:: RU 966 139±10 93±15
Growth conditions
* indicates nitrogen limiting conditions.Results are shown as ONPG hydrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
185
4.2.4 Effect of osmotic stress on induction of transcription
from the dctAp.
Transcription from the dctAp by monitoring production of -galactosidase
was measured under conditions of osmotic stress. To examine induction of
dctAp under these conditions, it was necessary to grow the cells in the absence of
C4-dicarboxylic acids with osmotic stress induced by using high levels of
sucrose. Sucrose was chosen because it has been reported that when present in
sufficient amounts it can cause osmotic stress in R. meliloti (Batista et al., 1992).
Glucose/ammonia were used as the growth substrates. Transcription from the
dctAp was examined in the presence of 0.05M sucrose and 0.1M sucrose.
Sucrose (0.1M) did not affect cell growth and was considered high enough to
cause osmotic stress while higher levels (0.2-0.5M) did affect cell growth.
Strains RU364 (3841/dctAp) and RU940-944 (various dct strains/dctAp), were
grown on glucose/ammonia with low (0.05M) and a high (0.1M) (osmotic stress
inducing) level of sucrose. Strain RU364 displayed no increase in transcription
from the dctAp in response to these conditions, or to higher levels of sucrose
(Table 4.5). However, in a dctA strain (RU940) the dctAp did show a five-fold
increase in transcription when grown on 0.1M sucrose while on 0.05M sucrose
no increase was evident (Table 4.5). This suggests that transcription from the
dctAp in response to osmotic stress only occurs in the absence of DctA. This
induction of the dctAp by osmotic stress in a dctA strain is similar to that
reported by Batista et al. (1992). Mutations in dctB (RU941), dctD (RU942),
dctBD (RU943) or deletion of the whole dctABD operon (RU944) abolished this
effect giving low values similar to strain RU364 (3841/dctAp) indicating that this
induction is DctB/D dependent (Table 4.5). As mutations in dctD or dctB
prevent transcription from the dctAp, strains with these mutations are in effect
dctA/dctB or dctA/dctD double mutants. As shown in Chapter Three, the
majority of DctD is transcribed from the dctBp. Taken together, these results
indicate that at least DctD (but probably DctD~Pi phosphorylated by DctB) is
186
required for transcription from the dctAp in response to osmotic stress and that a
lack of DctA is not sufficient.
In addition transcription from the dctAp was measured using two dctA::Tn5
mutants of strain 3841, RU436 and RU437. Both of these showed induction of
transcription from the dctAp when grown under osmotic stress indicating that this
is a general effect of mutating dctA and not specific to strain RU727 (dctA:: ).
Transcription from the dctAp in response to osmotic stress was also
measured in another strain of R. leguminosarum, strain 3855 and dctA, dctB
and dctD Tn5 derivatives of it, all carrying the dctAp reporter probe as described
in Chapter Three. These strains showed the same pattern of expression from the
dctAp as that observed in strain 3841 and its dct derivatives. Strain RU376
(3855/pRU103) did not respond to osmotic stress while RU991
(dctA::Tn5/pRU103) did. These results indicate that transcription from the
dctAp in response to osmotic stress is not specific to dctA strains derived from
3841 and that it only occurs in strains mutated in dctA.
In summary the two criteria which appear to be necessary for induction of
dctAp in response to osmotic stress are the presence of DctB/D and the absence
of a functional DctA.
187
Table 4.5 -galactosidase activity from the dctAp in response to
osmotic stress.
Parent Parent Strain Strain Genotype
G/N G/N G/N0.05M 0.1Msucrose sucrose*
3841 w.t. RU 364 266±61 231±38 236±41RU 727 dctA :: RU 940 297±25 406±57 2011±322
RU 730 dctB :: RU 941 184±27 266±14 210±8
RU 711 dctD :: RU 942 150±26 191±14 171±25
RU 865 dct BD :: RU 943 168±10 117±12 78±21
RU 714 dctA BD :: RU 944 179±65 123±41 168±51
RU 436 dctA ::Tn5 RU 694 286±12 903±207 920±87RU 437 dctA ::Tn5 RU 695 230±37 690±64 744±67
3855 w.t. RU376 222±51 212±32 202±29
RU 527 dctA ::Tn5 RU 991 315±85 2507±59 2599±154RU 528 dctB ::Tn5 RU 992 113±12 110±15 106±13
RU 529 dctD ::Tn5 RU 993 111±21 108±14 117±20
Growth conditions
* indicates osmotic stress conditions.Results are expressed as ONPG hydrolysed (nmol.min-1.(mg protein)-1)±S.E.M and are based on at least three independent cultures each assayed intriplicate.
-galactosidase activity
188
4.3 Discussion
4.3.1 Introduction
The results presented in this chapter suggest the following:
(1) Expression from the dctAp in both the wildtype and a dctA strain can
occur in response to nitrogen limitation and this is DctB/D dependent;
(2) The NTR system appears to be involved in induction of transcription
from the the dctAp under nitrogen limitation,
(3) Induction of transcription from the dctAp in a dctA strain can occur
under osmotic stress and is in a DctB/D dependent manner.
4.3.2 Transcription from the dctAp in response to nitrogen
limitation.
When cells are grown under nitrogen limiting conditions, transcription
from the dctAp is induced and this activation requires DctB/D as well as NtrC.
Since NtrC is required, this suggests that the NTR system may play a role in this
activation. Any models to explain this must account for how the NTR system in
conjunction with DctB/D activates transcription from the dctAp.
4.3.2.1 Role of DctB and DctD in activating transcription
from the dctAp in response to nitrogen limitation.
Transcription from the dctAp in response to nitrogen limitation occurs in
both the wildtype and in a dctA strain. The fact that it can occur in a dctA strain
indicates that DctA is not essential for this expression to occur. This
transcription from the dctAp due to nitrogen limitation is dependent on DctB and
DctD since mutations in these genes prevent induction of it. As DctB and DctD
are required, they may play a role in responding to a nitrogen limitation signal.
Two possibilities exist that can account for the role of DctB or DctD:
189
(1) DctB may sense nitrogen limitation directly and transmit this signal
to DctD,
(2) DctB or DctB may be activated by some signal generated by a
component of the NTR system.
4.3.2.2 Role of DctB in responding directly to nitrogen
limitation.
The direct activation of DctB by nitrogen limitation is unlikely for a
number of reasons. Most of the available evidence indicates that sensor proteins
do not respond to abnormal signals; the sensory machinery of the cell is
generally considered to be specific to a particular stimulus. DctB responds to
the presence of C4-dicarboxylates and aspartate and no role has been reported for
it in responding to other stimuli. In addition, the sensor domain of DctB is
thought to be located in the periplasm and so is probably unable to sense
intracellular signals. The sensing components of the NTR system are located in
the cytoplasm of the cell to detect internal changes in nitrogen availability.
However evidence does exist that suggests that some species of bacteria
may sense nitrogen levels external to the cytoplasm. In Azorhizobium
cualinodans, a relative of R. leguminosarum a second regulatory pair known as
NtrY/X, analogous to NtrB and NtrC has been reported. In contrast to NtrB
which is cytoplasmic, NtrY shows two putative transmembrane domains in its N
terminal end suggesting that it may be membrane bound and involved in sensing
the periplasmic nitrogen concentration 1460. Therefore, the possibility that
nitrogen limitation can be sensed externally in R. leguminosarum cannot be ruled
out. However, mutations in ntrY/ntrX and ntrB/ntrC usually display a leaky
phenotype in this organism in that they can be complemented for by each other.
In R. leguminosarum a leaky phenotype for ntrC strains has not been reported
190
suggesting that a second NtrB/NtrC system such as theNtrY/NtrX system is not
present.
Perhaps the strongest evidence that DctB does not sense nitrogen directly is
that the ntrC mutant (RU929) prevents induction of transcription from the dctAp
under nitrogen limiting conditions indicating that the NTR system is responsible
for sensing nitrogen limitation.
4.3.2.3 Role of DctB and DctD in responding to some signal
generated by the NTR system when grown under nitrogen
limitation
PII and NtrB are components of the NTR system in R. leguminosarm and
are involved in mediating the cells response to nitrogen availability 5171,2815.
The glutamine/ -ketoglutarate ratio in the cell is monitored via the UR/URtase
system and PII and when the ratio of glutamine to -ketoglutarate is low it
allows the activation (phosphorylation) of NtrB. NtrB transmits this signal to
NtrC by phosphorylation, which in conjunction with other factors induce an
appropriate response. Since this system is active under nitrogen limitation the
following possibilities exist where DctB or DctD may respond to the signals
generated by these components of the NTR system:
(1) PII could transduce its signal directly to DctB in an analogous
fashion to NtrB,
(2) NtrB could phosphorylate DctB or DctD.
The role of PII in transmitting a nitrogen limitation signal to directly to
DctB is unlikely for a number of reasons. Under nitrogen excess conditions PII
is uridylylated and is in its active form 5171. In this mode it interacts with
NtrB converting it into a phosphatase with respect to NtrC. Under nitrogen
limiting conditions PII is deuridylylated and inactive 5171. In this state it
191
does not interact with NtrB so that NtrB acts as a kinase on NtrC. The process
by which PII activates NtrB is passive. Therefore it is difficult to envisage how
DctB would be activated by inactive PII which is the mode it would be in when
expression from the dctAp under nitrogen limitation is evident.
The second possibility considered above is that NtrB~Pi may directly
transfer a phosphate group to DctB or more likely to DctD. Transcription from
the dctAp would therefore be activated in response to nitrogen limitation due to
phosphorylated DctB phosphorylating DctD or by direct phosphorylation of
DctD by NtrB~Pi. As mentioned NtrB is a histidine protein kinase which
responds to nitrogen limiting conditions by dissociating from PII and transferring
a phosphate group to its cognate response regulator NtrC 5226,2684. Since
the NtrB/NtrC and DctB/DctD two-component sensor pairs share homology in
their histidine transfer and aspartate receiver domains 5226, the possibility
exists that crosstalk between NtrB and DctB or more likely NtrB and DctD may
occur. A variety of reports have shown that crosstalk involving activation of a
response regulator by a system other than its cognate sensor can occur (Wanner,
B., 1992 and refs. therein) although no evidence exists for lateral transfer of a
signal by one sensor to a different sensor protein. The transfer of a phosphate
group from NtrB~Pi to DctD is a more conventional model of cross-regulation.
The possibility that NtrB~Pi can transfer its phosphate group to either
DctB or DctD can be examined by using the unique phenotype displayed by an
ntrC strain due to disruption of its NTR regulatory circuit. An intact NtrC
protein is an absolute prerequisite for transcription from the dctAp in response to
nitrogen limitation (Table 4.4). Two major effects can be predicted in an ntrC
strain of 3841:
(1) The transcription of glnB encoding PII is positively regulated by
NtrC and so mutations in this would be expected to reduce its expression
2815,
192
(2) Transcription of orf1/ntrB/ntrC, the operon encoding NtrB/NtrC, is
autogenously repressed by NtrC 2587. Therefore, by removing NtrC,
NtrB would not be subject to repression and so should be present in higher
than normal amounts.
In an ntrC strain, PII is either not made or is at reduced levels. It has been
reported that in the absence of PII (or presumably when present at reduced
levels) NtrB is in its active form and behaves as a kinase 2815. Moreover,
even if a significant amount of PII were being made this would not affect NtrB
since it would be in its inactive deuridylylated form (under nitrogen limitation)
and so would be incapable of preventing NtrB functioning as a kinase.
Consequently, in an ntrC strain, NtrB should be present at normal levels
and in its active form. The potential for crosstalk to occur under these
circumstances is considered significant. In the absence of NtrC, NtrB is
present, phosphorylated and missing its cognate response regulator NtrC and so
conceivably could transfer its phosphate group to another non-cognate response
regulator such as DctD or even a another sensor such as DctB. However, as
demonstrated in a ntrC strain, expression from the dctAp does not occur in
response to nitrogen limitation. This largely excludes the possibility that
NtrB~Pi acts as a kinase on DctB or DctD.
4.3.3 Role of DctB in phosphorylating DctD under nitrogen
limitation.
As DctB is probably not a direct sensor of nitrogen limitation and
moreover, based on the above evidence that it does not receive a signal from PII
or NtrB, it is considered likely that under ammonia limitation, DctB is inactive
(i.e. not phosphorylated). As a result DctD would not be phosphorylated above
the normal background level of DctD~Pi thought to be present under non-
inducing conditions.
193
The necessity for DctB to be present, to allow expression from the dctAp
in response to nitrogen limitation can be questioned. As demonstrated in
Chapter Three, transcription of dctD is driven predominantly by the dctB
promoter. However in a dctD strain, the possibility exists that it is not the
absence of DctB but the reduced amount of DctD that prevents transcription
from the dctAp. If DctD binds to the UAS’s of DctA and in doing so play a role
in the induction of the promoter in response to nitrogen limitation (discussed
later), it is possible that this will only occur when high levels of DctD are
present.
To summarise, when considering the role for DctB and DctD in activating
transcription from the dctAp in response to nitrogen limitation, either DctB is
not required and as a consequence almost all the DctD molecules present would
be unphosphorylated or DctB is required and a mixed population of DctD and
DctD~Pi exists, with DctD~Pi present in a relatively small amount. It is likely
that the latter condition exists where a small amount of DctD~Pi and a relatively
large amount of DctD would be in circulation.
4.3.4 Potential role of DctD or DctD~Pi in mediating
transcription from the dctAp in response to nitrogen limitation.
It has been proposed that DctD~Pi binds to the upstream activator sites
(UAS’s) of dctA, and by a process of co-operative protein-protein interaction, a
higher order oligomeric complex forms, which hydrolyses Mg~ATP initiating
open complex formation 3229. In R. leguminosarum biovar viciae the two
UAS’s of the dctAp have been reported to have different binding affinities for
DctD. DctD binds to the promoter proximal site with a 100-fold greater affinity
than to the promoter distal site, and it has been suggested that the promoter
proximal site is occupied much of the time by DctD in uninduced cells. Upon
induction by C4-dicarboxylates, DctD bound at this site is thought to be replaced
by DctD~Pi and also to encourage binding of DctD~Pi to the promoter distal site,
194
by a process of co-operative recruitment 1815. When DctD is bound to the
promoter distal site it is suggested to be optimally positioned for activation of
transcription from the dctAp by looping of the intervening DNA between the
UAS’s and the promoter. DctD bound to the proximal site could be involved in
promoting looping of the DNA between the 54 promoter and the UAS’s 1815.
Thus, the presence of DctD (or DctD~Pi) bound to the UAS’s is most likely a
prerequisite for the formation of a normal σ54 dependent promoter complex and
transcription initiation.
One model to explain the requirement for both DctD and NtrC in activating
transcription from the dctAp is that DctD may bind to one of the UAS’s in order
to orientate the promoter DNA and allow expression from the dctAp to occur by
binding activated NtrC~Pi to the promoter distal site. It has been reported that
the response regulator NtrC (which is similar to DctD) has a higher affinity for
its UAS’s when phosphorylated 5172.
However even though the amount of DctD~Pi present would be small it
could be important for activation to occur. The small amount of DctD~Pi could
be necessary to bind to the promoter proximal UAS and cause looping of the
DNA in a fashion which DctD is unable to achieve. This specific conformation
could be necessary to allow another phosphorylated response regulator, usually
DctD~Pi but in this case NtrC~Pi, to occupy the optimal (distal) site for
interacting with the 54 RNA polymerase and hence allow transcription.
In conclusion, as DctB is probably inactive in cells grown on glucose with
limiting ammonia, most of DctD would be unphosphorylated. DctD, with a
small amount of DctD~Pi, formed due to background phosphorylation by DctB,
probably interacts with the dctAp UAS’s and allows activation of transcription
from the dctAp in response to nitrogen limitation.
4.3.5 Role of the NTR system in transcription from the
dctAp in response to nitrogen limitation.
195
Since an ntrC strain does not allow expression from the dctAp in response
to nitrogen limitation, NtrC, as suggested, may be directly involved. In an
ntrC strain, the phenotype is potentially complex making it is difficult to prove
that it is NtrC~Pi that is directly involved rather than an indirect affect.
However, as it is the NtrB/NtrC system that responds to nitrogen limitation, this
implicates NtrC~Pi (activated by NtrB) as playing a direct role in this cross-
regulation.
4.3.5.1 Potential role of NtrC~Pi in expression from the
dctAp in response to nitrogen limitation.
The concept that NtrC~Pi could play a direct role in activation of 54
encoded promoter is not unprecedented and has been previously reported for
expression from the dctAp. A mutated allele of ntrC which alleviates its
autogenous repression and is also constitutively active is capable of suppressing
a dctD phenotype and activates a variety of σ54 dependent promoters including
the dctAp in R. leguminosarum as well as NifA and NtrC dependent promoters
2447, 2448. In these reports it was suggested that activation occurs at the σ54
dependent promoter due to the presence of NtrC~Pi in large amounts and does so
probably by direct interaction of it with σ54 RNA polymerase. This was
postulated due to the fact that activation of transcription from the dctAp was
evident in the absence of its UAS’s. However, in the presence of the UAS’s
expression from the dctAp was significantly enhanced (~ 7-10 fold higher again
than the level reported in their absence). This suggests that this mutated NtrC
allele may have altered DNA binding specificity and so can now recognise other
non-cognate UAS’s, perhaps at low affinity. In R. meliloti, it has been reported
that some cross-activation of the dctAp by a response regulator other than DctD
may occur. Cells grown under nitrogen limitation showed a three-fold increase
in transcription from a dctA-LacZ reporter probe and it is suggested that this
could be due to NtrC activating the dctAp (B. Gu and B.T. Nixon unpublished
196
results in 1815). Moreover, again in R. meliloti, native NtrC has also been
implicated in activation of a NifA dependent operon 2237,2304. This was
observed by growing nitrogen limited cells under aerobic or microaerobic
conditions and monitoring -galactosidase activity from a fixABCX promoter
probe. Transcription from this operon is controlled by the nifA gene product
NifA, but NtrC was able to replace it to some extent.
Additionally, results presented in Chapter Three support the possibility
that the NTR system could play a role in allowing expression of the dctAp.
Transcription from the dctAp after growth on succinate/aspartate, which should
be nitrogen limiting, showed an additive effect with a ~50% increase in
expression in comparison to cells grown on succinate/ammonia. When grown
on succinate/aspartate/ammonia, which is a nitrogen excess condition,
expression from the dctAp was similar to that observed on succinate/ammonia
grown cells. This suggests that the extra increase in transcription evident on
cells grown on succinate/aspartate is due to the nitrogen limited status of the cell
and some nitrogen regulated regulator, such as NtrC~Pi making a contribution to
transcription from the dctAp.
NtrC~Pi could operate in a comparable fashion to that of the mutated NtrC
allele mentioned above 2447,2448, either directly interacting with the 54
holoenzyme or binding to the upstream activator sequences of the dctAp and then
interacting with 54 RNA polymerase, promoting transcription.
Since DctD and probably DctD~Pi are required for expression from the
dctAp under conditions of nitrogen limitation, any suggestion for how this may
occur must accommodate how these in conjunction with NtrB/C can activate
transcription. This differs from the activation of the dctAp by a mutated NtrC
allele 2447 as NtrC activation was not dependent on DctD in this report. This
is probably due to the fact that the crosstalk they observed was based on a
mutated allele of NtrC which could have different properties to normal NtrC.
Two possibilities exist which can integrate these facts:
197
(1) DctD or DctD~Pi binds to at least one of the upstream activator
sequences, and in conjunction with NtrC~Pi binding to the other site,
allow the formation of a suitable 54 complex,
(2) DctD or DctD~Pi binds one or both of the upstream activator sites,
but NtrC~Pi now causes activation by direct interaction with the 54 RNA
polymerase.
In consideration of the first possibility, NtrC binding to the DctD UAS’s
has previously been suggested 2447. In the presence of the UAS’s, the
mutated ntrC allele caused a substantial increase in transcription from the dctAp.
It has been suggested that DctD bound to the distal site is optimally positioned
for activation of transcription while DctD bound to the proximal site could be
important for the orientation of the intervening DNA 1815. In the following
model, under nitrogen limitation, a large amount of DctD and a small relative
amount of Dct~Pi may be present that are able to bind to the high affinity
promoter proximal site possibly promoting DNA looping. NtrC~Pi might be
capable of replacing the role of DctD~Pi at the optimal (distal) site and so
interact productively with the 54 RNA polymerase. The necessity for DctD or a
small relative amount of DctD~Pi would be to correctly orientate and bend the
DNA at the promoter to allow NtrC~Pi to contact the 54 RNA polymerase (Fig.
4.3). In addition it is possible that DctD bound to an upstream activator site may
actually aid the binding of NtrC~Pi. In the absence of DctD, it is postulated
that NtrC~Pi would be unable to gain access to the 54 dependent promoter.
198
Fig. 4.3 Digram of proposed model of how DctD or DctD~Pi in
conjunction with NtrC~Pi may promote transcription from the dctAp in
response to nitrogen limitation.
The second possibility involves DctD or DctD~Pi again binding to the
UAS’s, but NtrC~Pi now causing activation of the dctAp by direct interaction
with the RNA polymerase. This is a plausible mechanism and was favoured
by #2447 in explaining how their mutated NtrC allele, in the absence of the
UAS’s could activate transcription from the dctAp. However, as mentioned in
the presence of the UAS’s, a much higher level of transcription was observed.
NtrC~Pi may replace the role of DctD~Pi in promoting transcription
Role of DctD or DctD~Pi may be to correctly orientate the DNA.
Promoter distal UAS (optimal?)
Promoter distal UAS
54RNA polymerase
54 RNA polymerase
Transcription
199
4.3.7 Conclusion
These models encompassing a role for NtrC~Pi in initiating transcription
from the dctAp under N2 limitation include an obvious route by which nitrogen
limitation signals can communicate with the dctAp. NtrC, which is
phosphorylated in response to nitrogen limitation acts directly on the dctAp,
presumably replacing DctD~Pi, as the activator molecule.
It is difficult to prove these models and further work is necessary to
elucidate the mechanism by which expression from the dctAp occurs in response
to nitrogen limitation. For example it should be possible to address the
requirement for inactive DctD (not phosphorylated by DctB) by investigating if
the effect is present in a dctBD strain, where dctD is expressed off a plasmid
promoter at similar levels to the wildtype. In addition, the generation of
mutants in PII and NtrB should enable the role of the NTR system in this cross-
talk to be further assessed
4.3.8 Expression from the dctAp in response to osmotic
stress.
Results presented in section 4.2.4 show that a strain mutated in dctA can
induce transcription from the dctAp in response to osmotic stress but this does
not occur in the wildtype. It is also apparent that this expression from the dctAp
requires at least DctD and probably DctD~Pi phosphorylated by DctB is DctB/D
as mutations in either gene prevents transcription from it in a dctA strain. This
expression of the dctAp is similar to that reported previously (Batista et al.,
1992), where in R. meliloti a dctA-LacZ transcriptionl fusion integrated into the
chromosome displayed induction due to osmotic stress. However induction of
transcription from the dctAp in a wildtype or in dctB or dctD backgrounds was
not examined in this report.
200
It is possible to suggest three possibilities that could account for this
expression from the dctAp in response to osmotic stress:
(1) DctB may respond directly to an osmotic signal;
(2) A two-component sensor-regulator involved in osmotic regulation
could cross activate transcription from the dctAp,
(3) Changes in DNA supercoiling brought about by osmotic stress may
affect expression from certain promoters such as the dctAp.
Expression of transcription from the dctAp is only evident in a dctA strain
and it is possible that in the absence of DctA, DctB is capable of responding to
an osmotic signal. As reported in Chapter Three, removal of DctA is known to
increase the number of substrates to which DctB can respond. The absence of
DctA could have a similar effect, either allowing DctB to respond directly to an
osmotic signal or perhaps allowing it to interact with another inner membrane
protein analogous to DctA, but one that responds to osmotic stress.
Little is known about the cellular apparatus which responds to osmotic
stress in R. leguminosarum, either how it senses a change in osmolarity or which
operons are induced to cope with these changes. In E. coli several systems are
involved in mediating the cells response to changes in osmolarity. The best
understood is the EnvZ/OmpR two-component sensor-regulator system
2684,5226. EnvZ is an inner membrane protein which is thought to sense
changes in osmolarity and transmit this signal to OmpR, which is a
cytoplasmically-located response regulator protein. Depending on the level of
OmpR~Pi, this either promotes or represses transcription of two genes encoding
porins of different size; OmpF (large) and OmpC (small) 5226.
It is possible that a similar two-component system may exist in R.
leguminosarum and that this system could play a role in the regulation of
expression from the dctAp in response to osmotic stress, possibly by
201
communicating with the DctB/D signalling pathway. If this is possible, it may
only occur in the absence of dctA which would normally play a role in
preventing this crosstalk. This is suggested by the results presented in Chapter
Three which indicate that DctA plays a role in restricting what DctB can respond
to. This could occur by other osmotically induced regulatory systems cross-
talking to DctB or DctD and hence causing transcription from the dctAp. The
possibility that other regulatory systems could cross-regulate expression from the
dctAp is akin to the induction of the dctAp in response to nitrogen limitation
where NtrC is speculated to play a role. However induction in response to
osmotic stress differs from expression from the dctAp under nitrogen limitation
in that it only occurs in the absence of DctA.
It has been reported that environmental stress such as changes in
osmolarity alter the topology of DNA in several bacterial species and also affect
the level of transcription from many promoters 5365. DNA supercoiling is
determined primarily by the balance maintained between DNA gyrase and DNA
topoisomerase I 5365. Moreover in the report by Batista et al., (1992) it was
shown that in R. meliloti expression from the dctAp due to osmotic stress is
substantially reduced in the presence of specific inhibitors of DNA gyrase. This
was thought to indicate that the responsiveness of the dctAp to various
environmental stimuli may involve changes in DNA supercoiling. The role of
DctB/D in mediating this effect was not examined and these results clearly show
that they are required for transcription from the dctAp in response to osmotic
stress. Therefore it is possible that an analogous situation may occur in R.
leguminosarum where expression from the dctAp may be subject to changes in
DNA super supercoiling induced by osmotic stress and this may be mediated by
DctB/D.
The effect of phosphate and calcium limitation on transcription from the
dctAp was also ivestigated as calcium limiattion was shown to be able to cause
transcription from the dctAp in R. meliloti 1536. However neither of these
202
showed an increase in transcription from the dctAp. The inability of calcium
limitation to induce transcription from the dctAp indicates that differences exist
between the dctAp’s responsiveness to environmental stimuli in R. meliloti and
R. leguminosarum.
204
Chapter Five
5.1 Introduction
In the previous two Chapters, genes involved in regulation of transcription
from the dctAp in response to normal inducers such as C4-dicarboxylic acids as
well as nitrogen limitation and osmotic stress were described. The role of the
DCT system itself in mediating regulatory effects at other promoters is also of
interest and the work in this Chapter describes such an effect.
R. leguminosarum biovar viciae strain 3841 pocesses a general amino acid
permease (AAP) which transports most amino acids including aspartate,
glutamate and alanine 1026. The operon encoding this transporter has
recently been cloned and comprises four genes aapJ, aapQ, aapM and aapP
(Walshaw et al., 1994). which are thought to encode an ABC type transport
protein complex. The NTR system is thought to play a role in regulating
transcription from this operon and this is reflected in actual transport rates
measured in cells after growth under different nitrogen conditions. When cells
are grown on glucose/ammonia, which is a nitrogen excess condition, a low rate
of amino acid transport is evident. Under conditions of nitrogen limitation,
such as when cells are grown on glucose/glutamate, uptake of amino acids by
this system is increased by approximately six fold indicating control in response
ro nitrogen availability. However, unusually when cells are grown on
glucose/aspartate which should be a nitrogen limiting condition, uptake of
amino acids by the AAP is repressed to levels below that seen on
glucose/ammonia grown cultures 1026 (Walshaw et al., 1993). This effect
appears to be specific to cells grown on aspartate in the absence of C4-
dicarboxylic acids. When cells are grown on succinate/aspartate, amino acid
transport via the AAP is derepressed, with rates of uptake similar to that seen in
glucose/glutamate grown cells. This is the expected response to a nitrogen
205
limited condition. When uptake by the AAP is measured in succinate/ammonia
grown cells, a repressed level of amino acid transport is evident, similar to that
observed on glucose/ammonia grown cells, due to the nitrogen excess status of
the culture. Uptake of amino acids by the AAP is also elevated in cells grown
on succinate/glutamate and is comparable to that of cells grown on
glucose/glutamate, again presumably due to the nitrogen limited condition of the
cells. These results suggest that succinate can relieve the repression caused by
aspartate evident on cells grown on glucose/aspartate.
Aspartate is a very efficient inducer of the DCT system 2559 and
transcription of dctA in cells grown on glucose/aspartate is comparable to that of
cells grown on succinate/ammonia. Therefore, as the DCT system is active
under the conditions where the repression of the AAP is evident (i.e. cells grown
on glucose/aspartate), it was considered possible that the DCT system could
play a role in mediating this repression. Moreover, as other response regulators
such as NtrC may cause transcription from the dctAp (Chapter Four), it is
possible that DctD may regulate transcription from other operons in a similar
fashion. Therefore to investigate the potential role of the DCT system in
mediating this repression effect, aspartate transport was measured in a series of
dct mutants grown on glucose/aspartate and other combinations of growth
substrates.
5.2 Results
5.2.1 The role of the DCT system in mediating repression of
the AAP.
Aspartate uptake in strains RU727 (dctA), RU730(dctB), RU711(dctD),
RU865(dctBD) and RU714(dctABD) strains was measured after growth on
glucose as the carbon source and ammonia, aspartate or glutamate as the
206
nitrogen source. Strains mutated in the dct genes are unable to grow on
succinate as a sole carbon source so it was not possible to measure aspartate
uptake under such conditions. Aspartate uptake was also measured as a control
in strain 3841 (wildtype) on the above substrates and also with succinate as a
carbon source.
In strain 3841, as expected, aspartate uptake was repressed in cells grown
on glucose/ammonia which is a nitrogen excess condition (Table 5.1), while in
cells grown on glucose/glutamate, it was derepressed due to nitrogen limitation.
As previously reported, aspartate uptake by the AAP was repressed on cells
grown on glucose/aspartate to a level below that seen after growth on
glucose/ammonia. In addition uptake of aspartate via the AAP in strain 3841
was also measured in cells grown on succinate in conjunction with ammonia,
aspartate or glutamate. Again as previously reported, the AAP was repressed
for aspartate uptake on cells grown on succinate/ammonia and was derepressed
for cells grown on succinate/aspartate or succinate/glutamate confirming that the
effect is alleviated by the presence of succinate (Table 5.1).
Aspartate uptake was also measured in strains mutated in components of
the DCT system (Table 5.1). Cells of all dct strains grown on glucose/ammonia
showed normal repressed levels of uptake by the AAP due to the nitrogen excess
status of the culture. Similar to strain 3841, uptake of aspartate by the AAP was
derepressed in all strains after growth on glucose/glutamate indicating that they
still respond to nitrogen limitation. However, cells of all strains grown on
glucose/aspartate no longer displayed repression of aspartate uptake by the AAP.
This suggests that mutation of any component of the DCT system alleviates the
repression of the AAP evident in cells grown on glucose/aspartate and implicates
the DCT system in playing a central role in mediating this repression.
Table 5.1 Aspartate transport in strain 3841 and various dct strains.
Strain Genotype
G/N G/ASP G/GLU S/N S/ASP S/GLU
3841 w.t. 2.8±0.4 1.4±0.2 11.8±0.4 2.1±0.4 15.2±0.3 10.1±1.5
RU 727 dctA :: 3.6±0.1 8.2±0.4 9.1±0.4RU 730 dctB :: 2.6±0.5 7.9±1.9 11.2±0.6RU 711 dctD :: 4.4±0.9 11.6±0.4 11.6±1.0 RU 865 dctBD :: 3.3±0.7 17.6±0.9 18.1±0.8RU 714 dctABD :: 3.9±1.2 15.0±4.0 11.2±1.0
Growth conditions
Rates of aspartate transport (25 M)are shown as nmol.(min)-1.(mg protein)-1±S.E.M and are based on at least three independent cultures each assayed in duplicate.
Aspartate transport
5.2.2 Regulation of transcription from the glnII promoter
(glnIIp) in response to aspartate.
The AAP is repressed for uptake of amino acids in cells grown on
glucose/aspartate and the nitrogen regulated transcriptional activator NtrC is
thought to play a role in regulating transcription from the operon encoding the
AAP (Walshaw et al., 1994). Therefore, the possibility exists that other
operons regulated by NtrC could display a similar pattern of regulation when
grown on glucose/aspartate. Another gene in R. leguminosarum whose
transcription is NtrC dependent is glnII 1749,2685. Transcription from the
glnIIp was therefore assayed using a glnII-lacZ fusion. Plasmid pAR36A
contains such a fusion 1749 and this was conjugated into strain 3841
generating strain RU622. This was grown under identical conditions as before
and production of -galactosidase measured.
Strain RU622 displayed a similar regulatory pattern of transcription from
the glnIIp similar to that as for amino acid uptake by the AAP (Table 5.2).
Transcription from the glnIIp was repressed on glucose/ammonia and
succinate/ammonia, which are nitrogen limiting conditions. When strain
RU622 was grown on glucose/glutamate, succinate/aspartate or
succinate/glutamate which are nitrogen limiting conditions, transcription from
the glnIIp was derepressed indicating that it responds to the nitrogen status of the
cell. However, when grown on glucose/aspartate which should be nitrogen
limiting, repression of transcription from the glnIIp was evident. This level of
transcription was similar to that of cells grown on glucose/ammonia. Expression
from the glnIIp in the wildtype therefore shows a comparable pattern of
regulation to that for uptake of amino acids by the AAP. Once again, succinate
appeared to be capable of alleviating the repression caused by aspartate.
Cells were next grown on combinations of substrates to further investigate
how succinate alleviates the aspartate dependent repression. When strain
RU622 was grown on glucose/succinate /aspartate, transcription from the glnIIp
209
was derepressed indicating that succinate relieves the repression and not that it is
casused by glucose (Table 5.2). Cells grown on glucose/succinate/ammonia
displayed a low level of transcription which was expected since nitrogen is not
limiting under these conditions. When strain RU622 was grown on
glucose/succinate/glutamate derepressed levels of transcription from the glnIIp
were evident presumably because nitrogen is limiting under these conditions.
Finally when strain RU622 was grown on glucose/aspartate/ammonia,
transcription from the glnIIp was repressed because both excess nitrogen and
aspartate are present.
In summary, transcription from the glnIIp is subject to the same repression
as for uptake of amino acids by the general AAP when cells are grown on
glucose/aspartate. Moreover, succinate is again capable of alleviating this
repression either when supplied as a sole carbon source (succinate/aspartate) or
in conjunction with glucose/aspartate. This indicates that succinate is dominant
over glucose/aspartate in its ability to relieve this repression.
Table 5.2 -galactosidase activity from the glnIIp in strain 3841 after growth under various conditions.
ParentStrain
Parent Genotype Strain
G/N G/ASP G/GLU S/N S/ASP S/GLU G/S/N G/S/ASP G/S/GLU G/ASP/N
3841 w.t. RU 622 288±26 362±52 1126±31 474±100 1582±157 1400±80 441±9 1616±158 1587±93 349±39
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
5.2.3 Regulation of transcription from the glnIIp in various
dct strains in response to nitrogen source.
Mutation of any component of the DCT system alleviated the aspartate
dependent repression of uptake of amino acids by the general AAP after growth
on glucose/aspartate. Therefore, expression from the glnIIp in dct strains was
examined to determine if a comparable derepression occurs in cells grown on
glucose/aspartate.
Plasmid pAR36A (glnIIp reporter probe) was conjugated into strains
RU727 (dctA), RU730 (dctB), RU711 (dctD), RU865 (dctBD) and RU714
(dctABD) generating respectively strains RU782, RU788, RU793, RU948 and
RU802. These strains were grown under identical conditions as before except
that as they are unable to use succinate as a sole carbon source, succinate was
supplied in conjunction with another metabolizable carbon source such as
glucose.
When grown on glucose/ammonia all of these strains showed repressed
levels of transcription from the glnIIp, which is normal under nitrogen excess
conditions (Table 5.3). When grown on glucose/aspartate, transcription from
the glnIIp was derepressed which is comparable to result obtained for uptake of
amino acids by the AAP in dct strains. When these strains were grown on
glucose/glutamate, which is nitrogen limiting, transcription from the glnIIp was
derepressed (Table 5.3). This is comparable to results for transcription from the
glnIIp and amino acid uptake by the AAP in the wildtype. Transcription from
the glnIIp was also examined on combinations of growth substrates. Strains
grown on glucose/succinate/aspartate had derepressed levels of transcription
similar to strain RU622 due to the nitrogen-limiting status of the culture. When
strains were grown on glucose/aspartate/ammonia, transcription from the glnIIp
was repressed to similar levels evident after growth on glucose/ammonia. This
repression is probably due to the nitrogen excess conditions alone, since any
contribution by aspartate requires a functional DCT system. This suggests that
212
the regulatory pathway mediating the cells response to nitrogen availability is
different from the pathway(s) involved in transducing the aspartate repression to
the AAP and glnII and that this latter pathway requires a functional DCT system.
All the dct strains, when grown on glucose/succinate/ammonia, displayed
repression of transcription from the glnIIp agan similar to strain RU622
(wildtype) which is presumably due to the nitrogen-excess growth conditions
(Table 5.3). Cells grown on glucose/succinate/glutamate showed derepressed
levels of transcription from the glnIIp again due to nitrogen limitation of the
growth culture.
In summary these results implicate the DCT system in playing a central
role in mediating the aspartate repression of glnII transcription and that this is
similar to its role in the repression of the AAP evident in cells grown on
glucose/aspartate. Any models to explain this aspartate dependent repression
evident on cells grown on glucose/aspartate must explain a role for the DCT
system in mediating it and also how it can be alleviated by succinate.
Table 5.3 -galactosidase activity from the glnIIp in various dct strains after growth under various conditions.
Parent Strain
Parent Genotype Strain
G/N G/ASP G/GLU G/S/N G/S/ASP G/S/GLU G/ASP/N
3841 w.t. RU 622 288±26 362±52 1126±31 441±9 1616±158 1587±93 349±39
RU 727 dctA :: RU 782 379±16 1293±77 1407±46 502±23 1860±102 1777±135 445±16
RU 730 dctB :: RU 788 365±34 1383±110 1329±60 475±5 1549±94 1667±37 466±13
RU 711 dctD :: RU 793 424±28 1516±144 1370±55 459±15 1453±111 1481±149 445±26
RU 865 dctBD :: RU 948 419±4 1234±94 1293±82 363±10 1603±46 1580±31 429±11
RU 714 dctABD :: RU 802 403±46 1252±51 1263±36 484±49 1955±50 1716±145 458±37
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
214
5.2.4 Relief of the the aspartate dependent repression by 2-
methyl succinate.
Cells grown on succinate/aspartate or succinate/glucose/ aspartate are
capable of alleviating the aspartate repression effect. To investigate both how
this occurs and whether metabolism of succinate is necessary, an analogue of
succinate which is non-metabolizable was used to see if this could alleviate the
aspartate dependent repression.
2-Methyl succinate is an analogue of succinate which cannot support
growth of R. leguminosarum biovar viciae strain 3841 when supplied as the
carbon source (Chapter Three). However, it can compete with succinate for
transport via DctA indicating it must bind to and is probably transported by DctA
2073. As succinate is capable of alleviating the repression effect evident on
cells grown on glucose/aspartate, it was decided to investigate if 2-methyl
succinate could function in a similar fashion. This should indicate whether it is
succinate out-competing aspartate for transport by DctA that alleviates the effect
or if subsequent metabolism of succinate plays a role in this relief.
Transcription from the glnIIp was measured in cells grown on
glucose/aspartate (repressive conditions) with different amounts of 2-methyl
succinate added. In strain RU622, a derepressed level of transcription from the
glnIIp was evident in the presence of 5 and 10mM 2-methyl succinate but was
repressed in the presence of 0.5mM 2-methyl succinate (Table 5.4). This
indicates that 2-methyl succinate can alleviate this repression and that its
concentration is important. This derepressed level of transcription was in
contrast to the control (strain RU622 grown on glucose/aspartate alone) and was
comparable to the levels of transcription observed in the wildtype (strain RU622)
grown on glucose/glutamate (nitrogen limiting conditions). The affect of 10mM
and 0.5mM 2-methyl succinate on transcription from the glnIIp was also
investigated in cells grown on succinate/aspartate (Table 5.4). Under these
215
conditions 2-methyl succinate had no effect on transcription, the levels being
similar to that present in strain RU622 (wildtype) grown on succinate/aspartate.
Uptake of aspartate by the general AAP in strain 3841 (wildtype) was also
measured in cells grown on glucose/aspartate in conjunction with 10mM 2-
methyl succinate. The level of transport in the presence of 10mM 2-methyl
succinate was derepressed (11.0±2.0 (nmol.(min)-1.(mg protein)-1±S.E.M.)), in
contrast to the wildtype grown on glucose/aspartate alone (1.4±2.0 (nmol.(min)-
1.(mg protein)-1±S.E.M.)), and was similar to that observed on glucose/glutamate
(nitrogen limiting conditions). This again indicates that 2-methyl succinate can
alleviate the aspartate repression of amino acid transport by the AAP.
In summary, 2-methyl succinate is capable of alleviating the repressive
effect evident in cells grown on glucose/aspartate on both the uptake of amino
acids by the AAP and transcription from the glnIIp. This suggests that
metabolism of succinate is not required for relief of the aspartate dependent
repression and that succinate and 2-methyl succinate accomplish this by out-
competing aspartate for transport or binding to DctA. It further indicates that
aspartate either bound to or accumulated by DctA may play a role in mediating
the repression of the AAP and glnII.
216
Table 5.4 Effect of 2-methyl succinate on transcription from the
glnIIp in cells grown with aspartate.
Parent Strain
Parent Genotype Strain
G/ASP G/ASP 10mM
2-methyl succinate
G/ASP 5mM
2-methyl succinate
G/ASP 0.5mM
2-methyl succinate
3841 w.t. RU 622 288±26 1237±33 1316±65 348±42
S/ASP S/ASP 10mM
2-methyl succinate
S/ASP 0.5mM
2-methyl succinate
3841 w.t. RU 622 1582±157 1415±253 1746±355
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
Growth conditions
217
5.3 Discussion
5.3.1 Role of the DCT system in mediating the aspartate
repression effect.
It is evident that transport by the AAP and transcription from the glnIIp is
repressed when the wildtype is grown in the presence of aspartate and a non C4
dicarboxylate carbon source such as glucose. This repression can be relieved in
two ways:
(1) By the inclusion of succinate or a non-metabolizable analogue of it
in the growth medium,
(2) Mutation of any components of the DCT system.
A common factor linking dct strains is that they all lack DctA suggesting
that it mediates the aspartate repression. There are two ways in which DctA
could accomplish this:
(1) Transport of aspartate by the DctA permease could lead to high
levels of intracellular aspartate which might cause repression of
transcription from certain operons such as aapJQMP and glnII,
(2) Aspartate could convert DctA into a specific conformation which
would act directly as a repressor of other operons.
5.3.2 Role of high levels of intracellular aspartate in
mediating the aspartate dependent repression.
Aspartate transport in R. leguminosarum biovar viciae strain 3841 is
mediated by at least three systems, the AAP, the DCT system and a low affinity
amino acid carrier 1026,2559 (Poole, 1994).
218
The AAP has a high affinity for aspartate with a Km in the m range
1026 (The Km for glutamate transport by this system is 0.081 m and the
apparent Ki of aspartate for this glutamate uptake is 0.164 m). In cells grown
on glucose/glutamate, aspartate is transported at a rate of ~12 nmols.(min)-1.(mg
protein)-1 when measured at 25 m. This is in accord with its proposed role as a
scavenger of amino acids in the soil when the cell experiences nitrogen limitation
1026. As mentioned, transport by the AAP is dependent on nitrogen source
and is repressed under conditions of nitrogen excess and derepressed when
nitrogen is limiting.
The second aspartate transport system known to operate in R.
leguminosarum is the low affinity amino acid carrier which has a Km for
aspartate transport of 11mM (P.S.Poole, personal comm.). This system is
constitutive; when measured at 10mM in cells grown on glucose/ammonia or
glucose/glutamate aspartate transport occurs at a rate of ~10 nmols.(min)-1.(mg
protein)-1 (P.S.Poole, personal comm.). When cells are grown on
succinate/ammonia (inducing conditions for the DCT system) and measured at
10mM a rate of 22 nmols.(min)-1.(mg protein)-1is evident and this increase is
thought to be due to the DCT system. As this system is constitutive, cells
grown on glucose/glutamate have an aspatate transport measured at 10mM of
~22 nmols.(min)-1.(mg protein)-1 which is the low affinity amino acid carrier 10
nmols.(min)-1.(mg protein)-1 plus the AAP 12 nmols.(min)-1.(mg protein)-1
(P.S.Poole, personal comm.).
The DCT system has a much lower affinity for aspartate transport than the
AAP. The Km for succinate transport via the DCT system (on cells grown on
succinate/ammonia or glucose/asparate, inducing conditions) is 5 m and the Ki
of aspartate for this succinate transport is 4.8mM (P.S.Poole, personal comm.).
This indicates that the DCT systems affinity for aspartate is ~1000 fold less than
for succinate. When meaured at 25 m in cells grown on glucose/aspartate a
rate of aspartate transport of 2 nmols.(min)-1.(mg protein)-1 is evident. This rate
219
is thought to be mostly due to DCT system as the AAP is repressed under these
conditions and the low affinity amino acid carrier has a very low affinity for
aspartate (Km 11mM). Aspartate uptake via the DCT system has also been
measured at 10mM (P.S.Poole, personal comm.). This was possible by
measuring uptake in an aap strain (RU543/aapJ::Tn5) in which the AAP is
mutated and so does not contribute to aspartate transport. Cells of strain RU543
grown on glucose/ammonia transported aspartate at 10 nmols.(min)-1.(mg
protein)-1 when measured at 10mM. When grown on succinate/ammonia
(inducing conditions for the DCT system) an aspartate transport rate of 22
nmols.(min)-1.(mg protein)-1 is evident at 10mM. This indicates that at 10mM
aspartate the DCT system makes a net contribution to aspartate transport of 12
nmols.(min)-1.(mg protein)-1 (P.S.Poole, personal comm.)
Therefore, when the wildtype is grown on glucose/aspartate (present at
10mM), while the AAP is repressed, the DCT sytem which is induced under
these growth conditions in conjunction with the low affinity amino acid carrier
transports aspartate at a rate of ~24 nmols.(min)-1.(mg protein)-1 (Table 5.5).
This rate is composed of ~12 nmols.(min)-1.(mg protein)-1 due to the DCT
system, ~10 nmols.(min)-1.(mg protein)-1 due to the low affinity amino acid
carrier and 2 nmols.(min)-1.(mg protein)-1 due to the AAP. This rate is estimated
to be higher than the net amount of aspartate transport which occurs in cells
grown on glucose/glutamate when measured at 10mM ~22 nmols.(min)-1.(mg
protein)-1 which would be due to the AAP (12 nmols.(min)-1.(mg protein)-1) and
the low affinity amino acid carrier (10. nmols.(min)-1.(mg protein)-1.
220
Table 5.5 Contributions of various tranport systems to aspartate
transport rates in the wildtype.
G/N G/A G/GLU
AAP 3 2 12
Low affinity amino acid carrier 10 10 10
DCT system 12
Net rate 13 24 22
Aspartate transport(nmoles.(min-1).mg (protein-1))
Accumulation of aspartate by the DCT system in cells grown on
glucose/aspartate would be unregulated as expression of dctA is not subject to
nitrogen mediated regulation by the NTR system. It is suggested that this un-
regulated accumulation of aspartate via DctA could lead to a high intra-cellular
concentration of it which might repress transcription of other nitrogen regulated
operons such as aapJQMP and glnII resulting in among other things repression
of aspartate tranport via the AAP.
Nitrogen levels in R. leguminosarum are thought to be sensed by a similar
mechanism to E. coli. In E. coli the ratio of glutamine to ketoglutarate as
sensed by the UR/URtase sytem and PII mediates the cells response to nitrogen
availability. When this ratio falls NtrB/C induce the transcription of appropriate
nitrogen transport and assimilation operons 2815,2587. In R. leguminosarum
221
biovar viciae strain 3841 transport of amino acids by the AAP is derepressed and
transcription of glnII is induced 1749.
As the level of glutamine within the cell appears to be critical and is
synthesisied directly from glutamate by glutamine synthetase, a role for
aspartate in affecting this regulation is possible. Aspartate is readily converted
to glutamate by aspartate aminotransferase and this increase in glutamate could
lead to an increase in the level of glutamine present. Therefore high levels of
aspartate could result in high levels of glutamine which would increase the
glutamine: ketoglutartate ratio indicative of nitrogen excess. As a
consequence this could lead to repression of certain NTR regulated operons such
as aapJQMP and glnII.
Alternatively, aspartate could be important in its own right and changes in
its intracellular concentrations could signal directly to the NTR system or to
another system in the cell which reflects amino acid availability and hence cause
repression of certain operons under conditions where high levels of aspartate are
present. This might explain why aspartate alone of the many aminoacids tested
is toxic to Rhizobium leguminosarum a high concentrations (Walsahaw et al.,
1995).
In a strain mutated in any component of the dct operon the DctA permease
would either not be transcribed or not be functional. Therefore the levels of
intracellular aspartate would not be augmented by transport via DctA. As a
consequence, cells grown on glucose/aspartate could have moderate levels of
intracellular aspartate and hence allow derepression of the AAP and promote
transcription from the glnIIp (Fig. 5.1).
222
Fig. 5.1 Diagram of effect of mutation of the DCT sytem on the
aspartate dependent repression affect.
223
5.3.3 Ability of succinate and 2-methyl succinate to alleviate
the aspartate dependent repression.
Derepression of amino acid uptake by the AAP and transcription of glnII is
evident when succinate or 2-methyl succinate is present in the growth medium in
conjunction with aspartate. The ability of these substrates to alleviate the
repression caused by aspartate is compatible with the above model where
unregulated accumulation leads to repression of certain operons.
Fig 5.2 Role of 2-methyl succinate in alleviating the aspartate
dependent repression effect.
DctA has a Km for succinate transport of 5.0 m while aspartate has a Ki
for inhibition of this succinate transport of 4.8mM (P.S. Poole, personal comm.).
When present in equal concentrations, succinate would prevent transport of
aspartate by DctA and prevent the build up of its intracellular concentration. 2-
Methyl succinate could operate in a similar fashion to succinate in out-competing
aspartate for transport via DctA.
224
5.3.4 Role of a specific conformation of DctA induced by
aspartate in mediating the aspartate repression effect.
As suggested, another possibility that could account for the aspartate
dependent repression of uptake of amino acids by the AAP and transcription
from the glnIIp is that aspartate could convert DctA into a specific conformation
which would either directly or via other regulatory pathways mediate the
aspartate repression. While this model is unlikely it is still worth considering as
the results presented in this Chapter are compatible with it. In this model,
aspartate would bind to DctA, and convert it into a repressor conformation. In
this specific conformation DctA would act as a repressor of transcription from
other operons within the cell. Mutations in any component of the DCT system
prevent transcription of a functional DctA preventing formation of the
DctA/aspartate complex. Succinate and 2-methyl succinate would bind to DctA
and prevent aspartate binding; succinate has a higher affinity for binding to
DctA than aspartate (Poole, 1994).
5.3.5 Conclusion.
The intracellular concentration of aspartate could be a key factor in
mediating the cells response to nitrogen availability. This requires further
investigation to elucidate the precise role of aspartate or a product of its
metabolism within the cell. For example, it would be informative to measure
the intracellular aspartate concentrations in cells grown with various nitrogen
sources in a steady state environment. This would allow the determination of
the intracellular aspartate levels and what impact these levels have on nitrogen
regulation within the cell.
As the work presented in this thesis is concerned specifically with the
regulatory aspects of the DCT system, it was considered beyond the scope of
this report to further pursue how this aspartate dependent repression is actually
mediated within the cell.
228
Chapter Six
6.1 Introduction. The work in Chapters Three and Four investigated transcription from the
dctA promoter (dctAp) indicating that; DctB is a sensor for C4-dicarboxylates,
DctA plays a role in determining what DctB responds to and that transcription
from the dctAp can occur in response to nitrogen limitation and osmotic stress.
In Chapter Five, it was shown that the DCT system plays a direct role in
mediating repression of uptake of amino acids by AAP and transcription from the
glnIIp in response to the presence of aspartate.
The work in this and the next Chapter describe the isolation and
characterisation of a dct::Tn5 mutant of strain 3841 (wild type) which has a
pleitrophic phenotype. Analysis of the phenotype of this mutant contributes to
the understanding of how DctA and DctB interact and how DctB/D may cross-
regulate other two component sensor regulators.
229
6.2 Results
6.2.1 Isolation and initial characterisation of RU150.
Random Tn5 mutagenesis was carried out on strain 3841, as described in
Chapter Two, to obtain mutants which were affected in C4-dicarboxylate
utilisation. One mutant obtained, designated strain RU150, displayed an
unusual phenotype in that it grew very poorly on succinate/ammonia (generation
time of ~30hrs) but grew well on succinate/aspartate. Moreover it grew
normally when glucose was supplied as the carbon source in conjunction with
ammonia. Strain RU150, in contrast to the to the wildtype, was able to use
aspartate as a sole carbon/nitrogen source for growth albeit very poorly
(generation time of ~30hrs). Therefore it was concluded that strain RU150 was
unable to utilise succinate as a carbon source with ammonia as nitrogen source
but was rescued for growth on succinate by aspartate (Table 6.1).
As aspartate was capable of allowing normal growth of strain RU150 in
conjunction with succinate, other amino acids were tested for the ability to
rescue growth with succinate. As a control, strain RU150 was also tested for
growth on these amino acids with glucose and also as the sole carbon/nitrogen
source. Strain 3841 was also tested for growth under all these conditions.
Strain RU150 grew normally when glutamate, glutamine, asparagine, serine,
alanine, proline or histidine were supplied as the nitrogen source in conjunction
with succinate and this was similar to the growth observed for strain RU150 on
succinate/aspartate (Table 6.2a and b). In addition, strain 3841 (wildtype)
showed identical growth characteristics to strain RU150 on these substrates.
Strains RU150 and 3841 also grew normally when glucose was supplied as the
carbon source. Finally, glutamate, proline and histidine were capable of
supporting growth of strains 3841 and RU150 when supplied as the sole
carbon/nitrogen source (Table 6.3). This indicates that strain RU150 can be
rescued for growth on succinate by a large number of amino acids and that this is
230
not specific to aspartate. Moreover, this suggests that strain RU150 is affected
specifically in its ability to utilise ammonia when succinate is supplied as the
carbon source for growth.
To further examine the inability of strain RU150 to grow on succinate with
ammonia as the nitrogen source, it and strain 3841 were tested for growth on
succinate and glucose with varying amounts of ammonia (Table 6.4). Strain
RU150 was unable to grow on succinate when ammonia was supplied in the
range 0.5mM to 100mM indicating again that it cannot grow on succinate in
conjunction with ammonia and this is not dependent on the concentration of
ammonia present. Strain 3841 showed normal growth on all concentrations of
ammonia except 100mM which is considered to be toxic. Moreover, both
strains RU150 and 3841 grew normally on 0.5mM to 50mM ammonia in
conjunction with glucose.
Table 6.1 Growth of strains 3841 and RU150 on glucose or succinate
in conjunction with various nitrogen sources.
Strain Genotype
G/N G/ASP S/N S/ASP ASP
3841 w.t. +++ +++ +++ +++
RU150 dctIR ::Tn5 +++ +++ +++
Growth conditions
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
Growth
231
232
Table 6.2a Growth of strains 3841 and RU150 on glucose with various amino acids.
Strain Genotype
G/ASP G/ASN G/GLU G/GLN G/SER G/ALA G/PRO G/HIS
3841 w.t. +++ +++ +++ +++ +++ +++ +++ +++
RU150 dctIR ::Tn5 +++ +++ +++ +++ +++ +++ +++ +++
Growth conditions (amino acid)
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
233
Table 6.2b Growth of strains 3841 and RU150 on succinate with various amino acids.
Strain Genotype
S/ASP S/ASN S/GLU S/GLN S/SER S/ALA S/PRO S/HIS
3841 w.t. +++ +++ +++ +++ +++ +++ +++ +++
RU150 dctIR ::Tn5 +++ +++ +++ +++ +++ +++ +++ +++
Growth conditions (amino acid)
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
234
Table 6.3 Growth of strains 3841 and RU150 on various amino acids as the sole carbon/nitrogen source.
Strain Genotype
ASP ASN GLU GLN SER ALA PRO HIS
3841 w.t. ++ ++
RU150 dctIR ::Tn5 ++ ++
Growth condition (amino acid)
Growth
* mean generation time of ~ 30hrs in liquid culture.Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ normal growth. ++ moderate growth . + poor growth. ± very poor growth. no growth.
235
Table 6.4a Growth of strains 3841 and RU150 on glucose with various concentrations of ammonia.
Strain Genotype
0.5mM 1.0mM 2.0mM 5.0mM 10mM 20mM 50mM 100mM
3841 w.t. +++ +++ +++ +++ +++ +++ +++
RU150 dctIR ::Tn5 +++ +++ +++ +++ +++ +++ +++
Ammonia concentration
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
236
Table 6.4b Growth of strains 3841 and RU150 on succinate with various concentrations of ammonia.
Strain Genotype
0.5mM 1.0mM 2.0mM 5.0mM 10mM 20mM 50mM 100mM
3841 w.t. +++ +++ +++ +++ +++ +++ +++
RU150 dctIR ::Tn5
Ammonia concentration
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
237
6.2.2 Characterisation of amino acid transport by the AAP
and transcription from the glnIIp in strain RU150.
To further investigate the phenotype of strain RU150, uptake of amino
acids and specifically aspartate by the AAP and regulation of transcription from
the glnIIp was examined.
Strain RU150, when grown on glucose/ammonia, showed normal
repression of aspartate uptake by the AAP while uptake measured on
glucose/glutamate grown cells displayed derepressed levels of transport similar
to the values obtained in the wildtype (Table 6.5). This indicates that strain
RU150 is still subject to normal control by the NTR system in response to excess
nitrogen. However, when strain RU150 was grown on glucose/aspartate,
aspartate uptake by the AAP was derepressed. The level of derepression was
comparable to that described in Chapter Five for both the wildtype when grown
on succinate/aspartate or in a dct strain.
Since in the wildtype, aspartate represses uptake of amino acids by the
AAP and also transcription from the glnIIp, the latter was also measured in
strain RU150. The glnIIp promoter probe (pAR36A) was conjugated into strain
RU150 yielding strain RU624. This was grown on glucose/ammonia,
glucose/aspartate, glucose /glutamate and succinate/aspartate and -
galactosidase activity measured. When grown on glucose/ammonia
transcription from the glnIIp was as expected repressed (Table 6.6), due to the
nitrogen excess condition of the culture. However, when grown on
glucose/aspartate (which causes repression of glnII transcription in the wildtype),
transcription was derepressed. This was similar to the level of transcription
from the glnIIp in strain RU150 measured in cells grown on glucose/glutamate or
succinate/aspartate, both of which are nitrogen-limiting conditions. These
results are also comparable to those obtained for the regulation of amino acid
transport by the AAP in dct mutants.
238
Table 6.5 Aspartate uptake by the AAP in strains 3841 and RU150.
Strain Genotype
G/N G/ASP G/GLU
3841 w.t. 2.8±0.4 1.4±0.2 11.8±0.4
RU 150 dctIR:: Tn5 3.7±0.5 11.4±1.3 11.4±1.5
Growth conditions
Rates of aspartate transport are shown as nmol.(min)-1.(mg protein)-1±S.E.M and are based on at least three independent cultures each assayed in duplicate.
Aspartate transport
Table 6.6 -galactosidase activity from the glnIIp in strains 3841 and
RU150.
Parent Parent StrainStrain Genotype
G/N G/ASP G/GLU S/ASP
3841 w.t. RU 622 288±26 362±52 1126±31 1582±157
RU 150 dctIR:: Tn5 RU 624 379±32 1350±37 1374±62 1048±89
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
239
6.2.3 Characterisation of succinate transport in strain
RU150.
As strain RU150 grows normally on succinate/aspartate and very poorly on
aspartate alone, it indicated that strain RU150 can utilise succinate as a carbon
source. This suggested that DctA was active and to confirm this, succinate
uptake was measured in strain RU150.
Strain RU150 was grown on glucose/ammonia which does not induce
transcription of dctA and also on glucose/aspartate which does. Cells of strain
RU150 grown on glucose/aspartate transported succinate at comparable levels to
strain 3841 (Table 6.7). However, the regulation of the DCT system was
altered in strain RU150. When grown on glucose/ammonia, strain RU150
transported succinate at a similar level to when it was grown on
glucose/aspartate. This suggests that succinate transport is constitutive in strain
RU150.
Even though it is constitutive for succinate transport, strain RU150 is
unable to grow on succinate in conjunction with ammonia, suggesting that other
regulatory effects occur. As strain RU150 showed altered regulation of the DCT
system, but probably has intact DctA, the mutation in strain RU150 may alter
the expression of DctA. To examine whether Tn5 was responsible for the
phenotype of strain RU150, Southern blotting, transductional analysis and
cloning of the Tn5 from strain RU150 was carried out.
240
Table 6.7 Succinate transport in strains 3841 and RU150.
Strain Genotype
G/N G/ASP*
3841 w.t. 6±1 50±5
RU 150 dctIR::Tn5 42±3 44±4
Growth conditions
* inducing conditions for transcription of dctA.Rates of succinate transport are shown as nmol.(min)-1.(mg protein)-1±S.E.M and are based on at least three independent cultures each assayed in duplicate.
Succinate transport
6.2.4 Southern blotting of strains 3841 and RU150.
Chromosomal DNA from strains 3841 and RU150 was digested with
EcoRI (which does not cut in Tn5), Southern blotted and probed with the
plasmid pSUP202::Tn5 and the dct containing cosmid, pIJ1848.
EcoRI digested chromosomal DNA from strain RU150 hybridised with
pSUP202::Tn5 having one band of ~6.7kb, while none was present in strain
3841 (Fig. 6.1). This suggested Tn5 inserted once in strain RU150.
When hybridised with pIJ1848, a 0.9kb EcoRI fragment present in strain
3841 chromosomal DNA was absent in DNA from strain RU150 and was
replaced by another at 6.7kb (data not shown). Since EcoRI does not cut Tn5,
this 6.7kb fragment was thought to contain Tn5 (5.8kb) and 0.9kb of flanking
chromosomal DNA. It also indicates that, as pIJ1848 contains the dct region,
the Tn5 insertion is either within or close to the dct genes.
241
Fig. 6.1 Southern blotting of chromosomal DNA from strains 3841
and RU150.
Lane A. 3841 EcoRI. Lane B. RU150 EcoRI. Hybridised with pSUP202::Tn5.
Lane A. 3841 EcoRI. Lane B. RU150 EcoRI. Hybridised with EcoRI insert from pRU103 dctAB-IR.
242
Aftr cloning and sequencing of the Tn5 containing EcoRI fragment from
strain RU150 (section 6.7), the flanking DNA was identified as the dctAB-
intergenic region. This was confirmed by hybridising EcoRI digested
chromosomal DNA from strains 3841 and RU150 with pRU103 (dctAB-IR),
obtaining the same pattern of hybridisation as probing with pIJ1848 (Fig 6.1).
6.2.5 Transductional analysis of strain RU150.
RL38, is a generalised transducing phage of R. leguminosarum 2053
was used to transduce Tn5 from strain RU150 into strain 3841 by selection for
kanamycin resistance. One hundred kanamycin resistant colonies were tested
for retention of the phenotype of strain RU150 i.e. very poor growth on
succinate/ammonia and normal growth on glucose/ammonia, glucose/aspartate
and succinate/aspartate. All displayed the same growth phenotype as strain
RU150 indicating 100% co-transduction of the mutation and the transposon
demonstrating that they are linked (data not shown). This strongly suggests that
the Tn5 insertion is responsible for the phenotype of strain RU150.
6.2.6 Complementation analysis of strain RU150.
Since the Southern blotting indicated that Tn5 had inserted in either the dct
genes or in their vicinity, the dct containing cosmid, pIJ1848 was conjugated
into strains 3841 and RU150 generating strains RU279 and RU278 respectively.
These strains were tested for growth on various media including
succinate/ammonia and both grew normally (Table 6.8). This indicates that
pIJ1848 complements strain RU150 for growth on succinate/ammonia and
confirms that the mutation in strain RU150 is in or close to the dct genes.
Strain RU150 was further analysed by testing for complementation for
growth on succinate/ammonia by two cosmids, pIJ1969 and pIJ1970 which
contain Tn5 mutations in dctB and dctA respectively. These were conjugated
into strain RU150 generating strains RU280 and RU281 and also into the strain
243
3841 generating strains RU282 and RU283 respectively. Strain RU280
(RU150/pIJ1969), which contains a dctB::Tn5 insertion but still maintains an
intact copy of dctA was able to complement strain RU150 for growth on
succinate/ammonia while strain RU281 (RU150/pIJ1970) which contains a
mutated copy of dctA was not (Table 6.8). This suggests that the site of
insertion of Tn5 in strain RU150, is not actually in dctA, since it grows on
succinate/aspartate and also transports succinate. Instead it may affect the level
of transcription of dctA which can be complemented by the addition of extra
dctA.
This was further examined by conjugating pRU108, which contains dctA
alone with its complete intergenic region (for construction see Fig. 6.2) into
strains 3841 and RU150 generating strains RU465 and RU471. When plated on
succinate/ammonia, strain RU471 was capable of growth similar to the wildtype
(Table 6.9). This indicates that the mutation in strain RU150 is specific to dctA
and suggests that DctB and DctD are functioning normally and capable of
promoting transcription of dctA in trans. These results suggest that by
increasing the level of dctA, strain RU150 regains the ability to grow on
succinate/ammonia.
244
Table 6.8 Complementation analysis of strain RU150.
Parent Parent Plasmid StrainStrain Genotype
G/N G/ASP S/N S/ASP
3841 w.t. +++ +++ +++ +++
RU150 dctIR ::Tn5 +++ +++ +++
3841 w.t. pIJ1848 RU278 +++ +++ +++ +++
RU150 dctIR ::Tn5 pIJ1848 RU279 +++ +++ +++ +++
3841 w.t. pIJ1969 RU282 +++ +++ +++ +++
RU150 dctIR ::Tn5 pIJ1969 RU280 +++ +++ +++ +++
3841 w.t. pIJ1970 RU283 +++ +++ +++ +++
RU150 dctIR ::Tn5 pIJ1970 RU281 +++ +++ +++
3841 w.t. pRU108 RU465 +++ +++ +++ +++
RU150 dctIR ::Tn5 pRU108 RU471 +++ +++ +++ +++
Growth conditions
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ normal growth. ± very poor growth. no growth.
Growth
245
Fig. 6.2 Construction of pRU108; a plasmid containing dctA and the
dctA-B intergenic region.
The 3.0kb fragment containing dctA from pRU47 was ligated into EcoRI digested pMP220.
246
6.2.7 Cloning and sequencing of the 6.7kb EcoRI Tn5
containing fragment from strain RU150.
Chromosomal DNA from strain RU150 was digested with EcoRI and the
resulting fragments cloned into Bluescript II SK+ selecting for kanamycin
resistance. One clone obtained, was designated pRU10 and after subcloning,
the DNA flanking Tn5 in this fragment was sequenced using a primer (PI)
designed to the ends of the inverted repeats of Tn5 and also using primers
designed to Bluescript II SK+ (SK and KS primers). In order to use a primer
designed to the inverted repeats of IS50 it was necessary first to subclone the
insert DNA into two fragments each containing only one inverted repeat.
Plasmid pRU10 was digested with HindIII and religated forming pRU7 which
contained one IS and pRU10 was also digested with BamHI and religated
forming pRU8 which contained the other IS of Tn5. Both clones were
sequenced on both strands as indicated using PI out from the ends of the IS’s and
SK and KS primers in from the plasmid (Fig. 6.3). This DNA sequence was
checked against the EMBL database and was found to have ~95% identity at the
nucleotide level to the dctA-B intergenic region of R. leguminosarum 2173.
Moreover it was evident that the transposon had inserted 9 base pairs upstream
from the ribosome binding site of dctA, in an AccIII site. The 9 base pair
repeats, indicative of a Tn5 insertion, were present on either side of the Tn5
each containing a duplicated AccIII site (Fig. 6.4). In combination with
sequencing and mapping of pRU10, the orientation of Tn5 in this fragment was
determined. The IS50R insertion sequence of Tn5 was adjacent to dctB while
the IS50L was adjacent to dctA (Fig.6.4) and the direction of transcription of the
genes encoding kanamycin and streptomycin resistance is towards dctB.
Fig. 6.3 Subcloning and sequencing of pRU10.
247
248
Fig. 6.4 Location of the Tn5 insertion in the dctA-B intergenic region of strain RU150.
249
6.2.8 Construction of dctAp, dctBp and dctDp reporter
probes of strain RU150.
As both succinate uptake is constitutive in strain RU150 and Tn5 has
inserted in a regulatory region, the levels of transcription of dctA, dctB and
dctD were examined. A series of reporter probes to the dctAp, dctBp and
dctBDp from strain RU150 with the Tn5 in situ were constructed (Figs. 6.6 and
6.7) and -galactosidase activity was used as a measure of transcriptional
activity from these promoters. These were called pRU105, pRU106 and
pRU352 respectively. These plasmids were conjugated into strain RU150
yielding strains RU390, RU391 and RU776 respectively and as a control into
strain 3841 yielding strains RU366, RU367 and RU769. To test expression
from the wildtype dctAp, dctBp and dctBDp in strain RU150 the previously
constructed dctAp (pRU103), dctBp (pRU104) and dctBDp (pRU354) reporter
probes were conjugated into strain RU150 generating strains RU388, RU389
and RU775. Finally the basic replicon of these reporter probes, pMP220, was
conjugated into strain RU150 yielding strain RU392.
250
Fig. 6.5 Construction of pRU105 and pRU106; strain RU150 dctAp
and dctBp reporter probes.
The EcoRI insert from pRU10 was cloned in both orientations into the
reporter plasmid pMP220 generating pRU105 (RU150 dctAp reporter) and
pRU106 (RU150 dctBp reporter).
* indicates a truncated site or gene.
251
Fig. 6.6 Construction of pRU352; RU150 dctBDp reporter probe.
It was evident from both the sequencing and Southern blot analysis that the
EcoRI site located in dctB was conserved in both strain 3841 and the dct cosmid
pIJ1848. Plasmid pRU348 had previously been made during the construction of
the DctBD reporter probe pRU392 using pIJ1848 DNA. This contains the
conserved EcoR1 site located in DctB. This was digested with EcoR1 and the
entire EcoR1 insert of pRU10 was cloned in selecting for kanamycin resistance.
The orientation of the insert was checked and one clone was designated pRU350.
This whole insert was directionally cloned as a partial EcoR1/Xba1 fragment into
pMP220 generating pRU352. Thus pRU352 is designed to measure expression
of dctD from the dctBp with the Tn5 insertion from strain RU150 present in the
intergenic region.
252
* indicates a truncated site or gene.
253
6.2.9 Analysis of transcription from the native and RU150
dctAp in strains 3841 and RU150.
-galactosidase activity was measured in all these strains after growth on
glucose/ammonia, glucose/aspartate, succinate/aspartate and where possible
succinate/ammonia. Strain RU388 containing the native dctAp reporter probe
from strain 3841 (pRU103) in strain RU150, displayed normal regulation of
transcription from the dctAp in response to suitable inducers, similar to strain
RU364 (3841/pRU103) (Table 6.9a). When strain RU388 was grown on
glucose/ammonia, basal levels of transcription from the dctAp were evident,
again similar to strain RU364 grown on glucose/ammonia. This indicates that
the sensor circuit via DctB and DctD, which detects the presence of C4-
dicarboxylates and causes transcription of dctA, is functioning normally in strain
RU150.
Expression from the RU150 dctAp reporter probe was also measured in
strains 3841 and RU150, RU366 and RU390 respectively, after growth under
the same conditions as above (Table 6.9a). Expression from the RU150 dctAp
in strains RU366 and RU390 was constitutive under all growth conditions and
showed no increase in the presence of succinate or aspartate (inducers of dctA
transcription in the wildtype). The RU150 dctAp was transcribed at ~ double the
level of the native dctAp under non-inducing conditions and this level was ~ 1/8
the level of transcription from the native dctAp (pRU103) when grown in the
presence of succinate or aspartate (inducing conditions). Thus transcription
from the RU150 dctAp is constitutive at a low level, consistent with the ability
of strain RU150 to transport succinate constitutively.
254
6.2.11 Analysis of transcription from the native and RU150
dctBp in strains 3841 and RU150.
Expression of dctB from its native and RU150 promoter was measured in
strains 3841 and RU150 under the same growth conditions as above. In strain
RU389 (RU150/pRU104) the native dctBp was expressed constitutively under all
growth conditions (Table 6.9) and this was at lower levels than in strain RU365
(3841/pRU104). Transcription from the RU150 dctBp reporter probe was also
measured under the same conditions. Strains RU367 (3841/pRU106) and
RU391 (RU150/pRU106) displayed similar levels of transcription from the
RU150 dctBp on all growth substrates (Table 6.9). These levels were
approximately 2 fold elevated in comparison to levels of transcription from the
native dctBp in strain RU389 and also RU365 with the exception of growth on
glucose/aspartate where the levels of transcription were similar. This indicates
that the level of dctB transcription in strain RU150 is increased in comparison to
strain 3841.
6.2.11 Analysis of transcription from the native and RU150
dctBDp in strains 3841 and RU150.
Levels of dctD transcription from the native and RU150 dctBDp were
measured in strains 3841 and RU150 grown under the same conditions as above
(Table 6.9b). The native dctBDp reporter was expressed constitutively in strain
RU775 (RU150/pRU354) and at comparable levels in strain RU768
(3841/pRU354) with the exception of growth on glucose/aspartate where it was
lower in strain RU775. This pattern of transcription is comparable to that seen
for expression from the native dctBp in these strains. The RU150 dctBDp was
transcribed at a similar level in strains RU971 (RU150/pRU352) and RU970
(3841/pRU352). The level of expression in strain RU150 was elevated in
comparison to that seen from the native dctBDp after growth on all substrates
255
and was also similar to strain 3841 with the exception of growth on
glucose/aspartate where a similar level was evident.
In summary, these results indicate that the Tn5 insertion in the RU150
dctA-B IR has caused a ~ 2 fold increase in transcription of dctB and a slight
increase in transcription of dctD. However, in strain RU150 the DctB/D
signalling pathway functions normally in promoting transcription from the dctAp
in a substrate dependent manner.
256
Table 6.9a -galactosidase activity from various reporter probes in strains 3841 and RU150.
Parent Parent Plasmid Reporter StrainStrain Genotype description
G/N G/ASP S/N S/ASP
3841 w.t. pRU103 dctA p RU 364 266±61 1533±356 2067±267 3433±101
RU150 dct IR ::Tn5 pRU103 dctA p RU388 148±28 2223±120 n.a. 2751±173
3841 w.t. pRU105 RU150 dctA p RU366 406±60 406±69 450±52 649±117
RU150 dct IR ::Tn5 pRU105 RU150 dctA p RU390 347±30 348±25 n.a. 350±34
3841 w.t. pRU104 dctBp RU365 778±90 1318±403 1211±40 743±116
RU150 dct IR ::Tn5 pRU104 dctBp RU389 596±48 630±48 n.a. 470±47
3841 w.t. pRU106 RU150 dctB p RU367 1054±66 1149±119 1531±40 1137±127
RU150 dct IR ::Tn5 pRU106 RU150 dctB p RU391 1025±45 1173±91 n.a. 896±90
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.n.a. = not applicable
-galactosidase activity
257
Table 6.9b -galactosidase activity from various reporter probes in strains 3841 and RU150.
Parent Parent Plasmid Reporter StrainStrain Genotype description
G/N G/ASP S/N S/ASP
3841 w.t. pRU354 dctBD p RU768 788±18 1180±88 1454±56 749±50
RU150 dct IR ::Tn5 pRU354 dctBD p RU775 701±35 777±43 N.A. 741±13
3841 w.t. pRU352 RU150 dctBD p RU769 975±58 1179±58 1459±66 1123±16
RU150 dct IR ::Tn5 pRU352 RU150 dctBD p RU776 906±75 1198±25 N.A. 1037±76
3841 w.t. pMP220 basic replicon RU368 184±6 229±11 210±21 196±22
RU150 dct IR ::Tn5 pMP220 basic replicon RU393 142±22 153±33 N.A. 245±5
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.n.a = not applicable.
-galactosidase activity
258
6.2.12 Role for DctB and DctD in promoting transcription
from the RU150 dctAp.
To further investigate any role for DctB and DctD in promoting
transcription of dctA in strain RU150, expression from the RU150 dctAp was
measured in a series of dct mutants. The RU150 dctAp (pRU105) was
conjugated into strains RU730 (3841 dctB:: ) and RU711 (3841 dctD:: )
generating strains RU1200 and RU1201 respectively. These were grown on
glucose/ammonia (non-inducing conditions for dctA transcription), and
glucose/aspartate (inducing conditions for dctA transcription) (Table 6.10). The
RU150 dctAp was expressed constitutively in both strains and at a similar level
to that observed in both strains RU150 and 3841. This demonstrates that
expression from the RU150 dctAp is independent of DctB and DctD.
Table 6.10 -galactosidase activity from the RU150 dctAp in dctB
and dctD strains.
Parent Parent Reporter StrainStrain genotype probe
G/N G/ASP
3841 w.t. pRU105 RU366 406±60 406±69
RU 150 dctIR::Tn5 pRU105 RU 390 347±30 348±25
RU730 dctB:: pRU105 RU1200 405±26 362±52
RU711 dctD:: pRU105 RU1201 379±32 442±37
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
259
6.3 Discussion
6.3.1 Introduction.
Strain RU150 is a Tn5 mutant isolated due to its inability to grow on
succinate/ammonia. This strain is rescued for growth on succinate when
aspartate or a number of other amino acids are supplied as the nitrogen source.
Strain RU150 was tested for aspartate uptake by the AAP and transcription from
the glnIIp after growth on glucose/aspartate and in contrast to strain 3841, shows
derepressed levels of both. Moreover succinate transport was found to be
constitutive suggesting that dctA is not mutated. Subsequent analysis revealed
that Tn5 had inserted in the dctA-B intergenic region, nine basepairs upstream
from the dctA ribosome binding site. Reporter probe analysis of transcription
from the dctAp and dctBp demonstrated that expression of dctB is elevated ~ 2
fold and dctD expression is slightly increased when compared to strain 3841.
However the DctB/D signalling circuit functions normally in promoting
transcription from the wildtype dctAp in response to C4-dicarboxylates.
Transcription from the RU150 dctAp was also measured and shown to be
expressed constitutively at a low level concurring with the constitutive uptake of
succinate evident in strain RU150. As dctA in strain RU150 is expressed at a
constitutive low level it is unlikely that this is due to transcription via DctB and
DctD since this regulatory circuit showed normal induction of transcription from
the native dctAp in strain RU150. No transcription was evident from the
wildtype dctAp in strain RU150 when grown on glucose/ammonia, (non-
inducing conditions for dctA transcription), while transcription from the RU150
dctAp in strain RU150 was evident. More over constitutive transcription from
the RU150 dctAp was evident in dctB and dctD strains of the wildtype grown on
glucose/ammonia indicating that DctB and DctD are not necessary. It is
unlikely that DctD could promote transcription from the dctAp as the 54
dependent dctA promoter and its UAS’s are separated from the dctA start site by
260
5.8kb of Tn5 DNA. For similar reasons it is unlikely that another response
regulator besides DctD could cause this constitutive expression. It is considered
most likely that Tn5 causes this low level of constitutive expression of dctA in
strain RU150 due to promoter out activity from Tn5 reading into the RU150
dctAp.
The primary alteration in strain RU150, when compared to strain 3841, is
that the level of dctA transcription is at a constitutive low level. The levels of
transcription of dctB and dctD are at near normal levels and their products DctB
and DctD still function correctly in promoting inducible transcription from the
native dctAp. Therefore, an imbalance is present in the levels of DctA to DctB
and DctD. This alteration in the level of DctA to DctB and DctD is probably a
key factor in allowing relief of the aspartate repression of the AAP and glnII and
also preventing strain RU150 from growing on succinate/ammonia.
6.3.2 Alleviation of the aspartate repression of the AAP and
glnII in strain RU150.
In Chapter Five, it is suggested that the repression of uptake of amino
acids by the AAP and transcription of glnII, evident in cells grown on
glucose/aspartate, is a function of the intracellular aspartate concentration. This
is thought to be mediated by DctA transport or due to a specific conformation of
DctA itself.
Strain RU150 transcribes dctA at 1/8 the level of the wildtype when grown
on glucose/aspartate, so this reduction in dctA transcription could lead to a
reduced level of DctA which could cause reduced aspartate uptake when grown
on glucose/aspartate. This would lower the amount of aspartate entering the cell
by a transport system unregulated by the internal amino acid pool and would
function in a similar fashion to actually mutating the dct genes.
It is interesting to note that a large reduction in the transcription level of
dctA is not reflected in a corresponding reduction in the rate of succinate
261
transport by DctA. Cells of strain RU150, when grown on glucose/aspartate
have 1/8 the level of dctA transcription compared to the wildtype. However,
when strains 3841 and RU150 are grown on glucose/aspartate, only a small
reduction (~2%) in the initial uptake rate of succinate transport is evident. If it
is assumed that a higher rate of transcription of dctA leads to increased amounts
of DctA, then the succinate transport rate is not directly proportional to the level
of dctA transcription. It has already been shown that over expression of dctA
from a trp promoter does not lead to higher levels of succinate transport in the
wildtype 1697. Together these observations suggest that the rate of succinate
transport saturates at quite low levels of DctA. It is possible to speculate that
higher levels of DctA may be produced to allow regulation of DctB.
While the initial uptake rate for succinate transport in strain RU150 is not
significantly reduced it is likely that under steady state conditions aspartate
transport by DctA in strain RU150 may be lowered in comparison to strain 3841
due to the lower affinity of DctA for aspartate. The rate of transport measured
under steady state growth is important as this will affect the intra-cellular
aspartate concentration. This rate was not measured in strains 3841 and RU150
as it is technically difficult.
Alternatively, the second model described in Chapter Five to explain the
aspartate repression effect in which a specific aspartate dependent conformation
of DctA acts as a repressor, is still applicable in strain RU150. As this strain
probably produces substantially less DctA than strain 3841, it would lead to a
reduced concentration of DctA in its proposed repressor conformation.
6.3.3 The inability of strain RU150 to utilise ammonia in
the presence of succinate for growth.
As judged by lack of growth, strain RU150 is unable to utilise succinate as
a carbon source in conjunction with ammonia as the sole nitrogen source.
However, when an amino acid such as aspartate or glutamate is supplied as a
262
nitrogen source, strain RU150 uses succinate as a carbon source. Since strain
RU150 transports succinate constitutively and is capable of using it as a carbon
source, it is unlikely that its assimilation is a problem and its metabolism should
be unaltered. These results show that it is a problem with ammonia
assimilation/metabolism in the presence of succinate that prevents growth of
strain RU150 on succinate/ammonia.
As previously mentioned, the ratio of DctA to DctB and DctD is reduced
in strain RU150 by at least 8-fold (when compared to inducing conditions) while
the DctB/D signalling circuit is still functional. Therefore, in strain RU150 in
the presence of succinate/ammonia, DctB/D should be highly phosphorylated.
DctB~Pi or DctD~Pi are not required for transcription from the dctAp in strain
RU150 and may be prevented from binding to the dctA-B intergenic region by
Tn5. As previously mentioned, DctB/D comprise a two component sensor-
regulator pair and it has been shown that two component sensor-regulator pairs
can cross regulate each other 2684,5226. In strain RU150 where DctB~Pi or
DctD~Pi are prevented from binding to and regulating DctA transport, they may
interfere with the correct regulation of sensor-regulator pairs involved in
ammonia assimilation. In strain RU150 this repression would not occur when
grown on glucose/ammonia as DctB/D would not be phosphorylated. Moreover,
when strain RU150 is grown on succinate and an amino acid, while DctB/D
would be phosphorylated, ammonia assimilation would not be required.
263
Chapter Seven
7.1 Introduction Strain RU150 is a dctA-B IR::Tn5 mutant that transcribes dctA
constitutively at a low level and this is uncoupled from the DctB/D signalling
pathway which functions normally. This mutation is thought to result in strain
RU150 being impaired for growth on succinate/ammonia due to phosphorylated
DctB and DctD interfering with operons specifically involved in ammonia
assimilation /metabolism. It is also relieved for aspartate-dependent repression
of the AAP and glnII when grown on glucose/aspartate and this is thought to be
due to the reduction in transcription of dctA in comparison to DctB/D. To
further understand how these phenotypes are mediated and to investigate the role
of DctA and DctB/D in mediating them, two approaches were taken:
(1) Isolation of second site suppressor mutants of strain RU150 which
have regained the ability to grow on succinate/ammonia,
(2) Generation of directed dctA, dctB, dctD and dctBD double mutants
of strain RU150.
This Chapter describes the isolation and construction of such mutants and
their subsequent characterisation.
264
7.2 Results
7.2.1 Isolation of second site suppressor mutations of strain
RU150.
As strain RU150 is unable to grow on ammonia in conjunction with
succinate as a carbon source, second site suppressor mutations were isolated on
succinate/ammonia.
Strain RU150 was plated on succinate/ammonia agar plates in the absence
of kanamycin selection and after 3-5 days spontaneous mutants were obtained
which grew as well as strain 3841. These were subsequently screened for
retention of kanamycin resistance which is indicative of a mutation occurring at a
site outside of Tn5. On the basis of this, these mutants were divided into
primary revertants and secondary suppressor mutants. Those which grew on
succinate/ammonia and were kanamycin sensitive were classed as primary
revertants, probably due to excision or deletion of Tn5. Mutants which grew on
succinate/ammonia and retained kanamycin resistance have mutated elsewhere in
the chromosome besides Tn5 and so contain a second site mutation. Five
second site suppressor mutants were chosen for further examination. These
were designated strains RU152-1, RU152-5, RU152-14, RU152-16 and
RU152-22. In order to test whether the secondary mutations in these strains are
located at loci distinct from Tn5 in strain RU150, they were subjected to
transductional analysis.
7.2.2 Transductional analysis of the second site suppressor
mutants of strain RU150.
Transductional analysis was carried out on strains RU152-1, RU152-5,
RU152-14, RU152-16 and RU152-22 by transducing Tn5 from these into strain
3841 (wildtype) and selecting for kanamycin resistance encoded by Tn5. Up to
forty transductants of each were double purified and tested for growth on
265
succinate/ammonia and glucose/ammonia. Growth on succinate /ammonia is
indicative of a second site suppressor mutation being closely linked to the
original Tn5 insertion in strain RU150 leading to co-transduction. Loss of the
ability to grow on succinate/ammonia shows that the second site mutation is not
closely linked to the original Tn5 insertion in strain RU150. Transductants of
strains RU152-5, RU152-16 and RU152-22 all retained the ability to grow on
succinate/ammonia, and grew normally on glucose/ammonia, suggesting that
their second site suppressor mutations are closely linked with the DCT region
(Table 7.1). The transductants of strains RU152-1 and RU152-14 were unable
to grow on succinate/ammonia, while they grew normally on glucose/ammonia,
indicating that their second site mutation(s) which allows growth on
succinate/ammonia is distinct from the DCT region.
266
Table 7.1 Transductional analysis of second site suppressor mutants.
Second site suppressor
Total No. of transductants
tested
No. that grew on G/N
and S/N
No. that did not grow on
S/N
% Co-transduction of S/N minus
phenotype
RU152-1 31 1 30 3%
RU152-5 27 25 2 92%
RU152-14 35 2 33 5%
RU152-16 40 40 0 100%
RU152-22 31 31 0 100%
Growth conditions
Growth
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C.
267
7.2.3 Southern blotting of the second site suppressor
mutations of strain RU150.
The five second site suppressor mutants were Southern blotted to
investigate if the Tn5 was intact. Chromosomal DNA from all five suppressor
strains was digested with EcoR1 and Southern blotted. These were then
hybridised with IS50L from Tn5 (pRU75). Strains RU152-1, RU152-5,
RU152-14 and RU152-16 all contained a 6.7kb EcoRI band similar to that
present in strain RU150 which was absent in strain 3841 (Fig. 7.1). This is the
fragment containing Tn5 and indicates that no gross mutation in these strains had
occurred in Tn5. Strain RU152-22 had a smaller band of approximately 6.3kb
suggesting that a deletion had occurred within the 6.7kb EcoRI fragment
containing Tn5, but outside of the Npt gene in Tn5 as it was still kanamycin
resistant. In addition to the 6.7kb fragment, Strains RU152-1 and RU152-14
each contained a smaller band which was homologous to IS50L. These were
approximately 2.5kb and 1.8kb in size respectively. These may have been
caused by IS50 transposing elsewhere within the chromosome and disrupting
genes which give rise to the second site supressor phenotype.
To investigate this, the same Southern blot was hybridised with a probe
containing just the internal region of Tn5 and not the insertion sequences. The
construction of this probe (pRU80) is outlined in Fig. 7.2. It is evident from this
Southern blot (Fig. 7.3), that only one band is present in the second site
suppressor mutants and this is the same 6.7kb EcoRI Tn5 containing band as in
strain RU150. This indicates that the extra band present in strains RU152-1 and
RU152-14, contains DNA homologous to IS50 but not the central region of Tn5.
In summary, of the five second site supressors strains examined,
mutations causing three of them appeared to have identifiable genotypes. Strain
RU152-22 contains a deletion in the 6.7kb EcoRI fragment containing Tn5 while
strains RU152-1 and RU152-14 have gained an insertion sequence outside of
Tn5.
268
Fig. 7.1 Southern blot of strain RU150 second site suppressors
hybridised with an IS50 probe.
Lane A. RU150 EcoRI Lane B. RU152-1 EcoRI Lane C. RU152-14 EcoRI Lane D. RU152-22 EcoRI Lane E. RU150 EcoRI Hybridised with a IS50 specific probe (pRU75).
269
Fig. 7.2 Construction of pRU80.
Tn5 in pRU10 was digested at the two BglII sites located adjacent to its
insertion sequences. This internal BglII fragment of Tn5 (excluding the
insertion sequences) was cloned into Bluescript II pBC+ at the BamHI site.
270
Fig. 7.3 Southern blot of second site suppressor strains hybridised with
a probe to the central region of Tn5.
Lane A. RU150 EcoRI Lane B. RU152-1 EcoRI Lane C. RU152-14 EcoRI Lane D. RU152-22 EcoRI Lane E. RU150 EcoRI Hybridised with a internal Tn5 specific probe (pRU80).
271
7.2.4 Cloning and mapping of the 6.2kb EcoRI fragment
containing Tn5 from strain RU152-22.
In order to map the location of the mutation in strain RU152-22, the 6.2kb
EcoR1 fragment containing Tn5 was cloned in Bluescript II SK+ by selecting for
kanamycin resistance. One clone obtained (pRU93) was subjected to extensive
mapping in concert with pRU10, which contains the intact 6.7kb fragment
containing Tn5 from strain RU150. The differences in these two clones allowed
the extent of the deletion in strain RU152-22 to be mapped (Fig. 7.4). Plasmid
pRU93 is missing the SalI site located in the dctA-B intergenic region, but still
retains the AccIII site immediately flanking the Tn5. This indicates that the
deletion did not occur in Tn5 in strain RU152-22 but in the intergenic region on
the dctB side of Tn5. Measuring the size of the fragment from the EcoRI site in
dctB to the AccIII site adjacent to Tn5 indicated that the deletion in strain
RU152-22 spanned the intergenic region and the 5’ end of dctB and was 0.5kb in
length. Therefore the region between the intergenic SalI site (on the DctB side)
~200bp and ~ the first 300bp of dctB are deleted.
Therefore, in strain RU152-22, part of the dctA-B intergenic region, the
promoter of dctB and the entire 5’ end of dctB is deleted. Moreover, as shown
in Chapter Three, dctD transcription is driven predominately by the dctB
promoter, so the level of dctD transcription in this mutant should be severely
reduced. Therefore, by deleting DctB, strain RU150 regains the ability to grow
on succinate/ammonia. This suggests that DctB and DctD play a key role in
preventing strain RU150 from using ammonia as a nitrogen source when
succinate is the sole carbon source for growth.
272
Fig. 7.4 Diagram of pRU93 and pRU10 indicating the deletion evident
in pRU93.
* indicates a truncated site or gene.
273
7.2.5 Mapping of the second site suppressor strain RU152-
14, by inverse PCR.
The second copy of IS50 present in strains RU152-1 and RU152-14 may
allow suppression of the strain RU150 phenotype by disrupting an important
gene. Since IS50 does not carry any phenotypically identifiable marker, the
fragment that contained IS50 was cloned by using inverse PCR. This was
possible because the sequence of IS50 is known and primers (P2 and P3) were
designed to bind to either end of IS50 and allowing amplification outwards. The
EcoRI fragment containing IS50 was circularised by ligation and subjected to
PCR amplification using these primers (Fig. 7.5).
Fig. 7.5 Rationale for inverse PCR.
274
The 1.8kb EcoRI fragment from strain RU152-14 containing the IS50 was
chosen first for analysis. Southern blotting indicated that this was the smallest
EcoR1 fragment of the two and so is easier to PCR amplify. Chromosomal
DNA from strain RU152-14 was digested with EcoR1 and electroporeised on an
agarose gel. The relevant sized bands (1-2kb) were excised and purified,
ensuring that the Tn5 containing fragment was not present. These were ligated
to form circles of DNA and the insert DNA was amplified by inverse PCR. As
expected a 0.4kb band was obtained which is the size of the flanking DNA when
the size of the insertion sequence (1.4kb) is subtracted. The presence of an
EcoR1 site in this fragment was confirmed, indicating strongly that it contains
the flanking DNA from the IS50 in strain RU152-14. This fragment was
purified and cloned into pGEM-T, a vector designed for the cloning of PCR
products. The resulting clone (pRU110) was sequenced on both strands as far as
the central EcoR1 site using primers P2 and P3 as well as sequencing and reverse
primers which bind to pGEM-T (Fig. 7.6). This sequence was compared with
the EMBL database. One half of the flanking DNA which was adjacent to the
outside end of IS50 has ~95% identity at the nucleotide level over its entire
length to the sequence of dctA. The sequence of the other flanking-half of
pRU110 revealed no significant homology to any published sequences including
DNA internal to the insertion sequences in Tn5.
This demonstrates, as indicated by Southern blotting, that only IS50L
transposed without internal Tn5 DNA. Moreover, it indicates that IS50L has
duplicated at least the 5’ end of dctA up to its EcoRI. This suggested that it may
have transposed a complete copy of dctA and a similar event may have occurred
in strain RU152-1. Southern blotting was used to determine how much of dctA
had been duplicated in strains RU152-1 and RU152-14.
275
Fig. 7.6 Diagram of the cloning and sequencing of the PCR product
from strain RU152-14.
276
7.2.6 Southern blotting of strains RU152-1 and RU152-14
The aim of this experiment was to determine how much flanking dctA
DNA had transposed along with IS50L in strains RU152-1 and RU152-14.
Moreover, since as shown in Chapter Six, strain RU150 was complemented for
growth on succinate/ammonia by extra copies of dctA on a plasmid, it is possible
that these second site suppressors may contain a complete copy of dctA. A
second copy of dctA could be shown to be present in these strains by Southern
blotting and hybridising with dctA. If present, two copies of dctA should be on
distinct restriction fragments. Probing with DNA immediately downstream of
the 3’ end of dctA and showing that they hybridise to the same fragment as dctA
would confirm that a complete copy is present.. This rationale is represented in
Fig. 7.7.
It was necessary to select a restriction enzyme which would not cut
internally in dctA or IS50L so that dctA and IS50L would be present on the same
fragment. Since it was not known if a complete copy of dctA had transposed or
if DNA downstream of dctA had transposed a second criterion was that the
enzyme selected should cut in Tn5. This would yield two hybridising fragments
with dctA and IS50L which should differ in size due to one having a complete
Tn5 located upstream of dctA. SmaI was chosen since it does not have a site in
dctA or IS50 but cuts Tn5 internally (Fig. 7.7).
Chromosomal DNA from strains RU152-1 and RU152-14 was digested
with SmaI, Southern blotted and hybridised with dctA (pRU123), IS50L
(pRU75) and a DNA fragment located immediately downstream of dctA in strain
3841 (pRU402). This last probe and the construction of the dctA probe are
outlined in Figs. 7.8 and 7.9.
277
Fig. 7.7 Southern blotting rationale to determine if strains RU152-1
and RU152-14 contain a duplicate copy of dctA.
278
Fig. 7.8 Construction of pRU402.
The plasmid pRU69 is the 3kb HindIII/EcoRI fragment from pRU150
which contains a complete copy of dctA and a further 0.8kb of flanking DNA on
the dctA 3’ end. This was digested with PstI which cuts just past the 3’ end of
dctA and religated forming plasmid pRU402. Therefore this plasmid contains
the 0.8kb fragment immediately downstream of dctA on a HindIII/PstI fragment.
This was excised and used as a specific probe for the DNA immediately down
stream of dctA.
279
Fig. 7.9 Construction of the dctA probe, pRU123.
The dctA probe was constructed as follows: two primers P6 and P7 were
designed to the 3’ end of dctA and the dctA intergenic region respectively.
These were used for PCR amplification of dctA and the resulting 1.6kb fragment
was cloned into pGEM-T and called pRU123. The insert was excised by
digesting with AccIII and ApaI leaving behind the intergenic region as AccIII
cuts just past the 5’ end of dctA. This fragment was used as a specific dctA
probe in strain RU150.
280
These Southern blots are shown in Fig. 7.10a-c. When hybridised with
IS50, chromosomal DNA from both strains RU152-1 and RU152-14 contained
an extra band in comparison to strain RU150 and when hybridised with dctA
these extra bands were also present and identical in size. Therefore, this
indicates that IS50L and at least part of dctA are on the same EcoRI fragment in
strains RU152-1 and RU152-14. Moreover, these bands are distinct from the
native copy of dctA in strain RU150 with complete Tn5 adjacent to it.
To test whether this second band contained a complete copy of dctA, the
downstream DNA of dctA (pRU402) was used as a probe. This hybridised to
the same two fragments as did pRU123 and pRU75, indicating that DNA
downstream of dctA is also present. This demonstrates that a complete copy of
dctA has transposed with IS50L. Therefore, both strains RU152-1 and RU152-
14 contain a second copy of dctA.
281
Fig. 10a-c Southern blots of strains RU152-1 and RU152-14
hybridised with pRU123, pRU75 and pRU402.
All three probes, dctA, dctA C terminus and IS50 hybridise to the same
fragments from strains RU152-1 and RU152-14 indicating that a duplicated copy
of dctA is located downstream of the IS50.
Blot A Lane A. 1-kb ladder Lane B. 3841 SmaI Lane C. RU150 SmaI Lane D. RU152-1 SmaI Lane E. RU152-14 SmaI Hybridised with dctA probe (pRU123).
Lane A. RU150 SmaI Lane B. RU152-1 SmaI Lane C. RU152-14 SmaI Hybridised with IS50 probe (pRU75).
Blot B
282
Lane A. 1-kb ladder Lane B. 3841 SmaI Lane C. RU150 SmaI Lane D. RU152-1 SmaI Lane E. RU152-14 SmaI Hybridised with dctA C terminus probe (pRU402).
Blot C
283
7.2.7 Quantification of the dctA mRNA levels in the second
site suppressor strains RU152-1 and RU152-14.
Southern blot analysis shows that strains RU152-1 and RU152-14 contain
distinct duplicate copies of dctA. To investigate if these extra copies resulted in
an increase in the transcription of dctA in these strains, the levels of dctA mRNA
from each were measured. The levels of dctA mRNA from strains 3841 and
RU150 were also measured as controls. All strains were grown on
glucose/ammonia, glucose/aspartate, succinate/ammonia and
succinate/aspartate (strain RU150 was not grown on succinate/ammonia). Total
mRNA was isolated and 20 g of each was Northern blotted and probed with a
dctA DNA probe (pRU123 prepared as for Southern blots but labelled with 32P).
As expected strain 3841, after growth on glucose/ammonia, did not
produce a significant amount of dctA mRNA, because transcription is not
induced (Fig. 7.11). Upon induction with aspartate or succinate a large increase
in dctA mRNA was evident (~20-fold). Moreover, the wildtype grown on
succinate/aspartate produced the highest levels of dctA mRNA and this
concurred with the results obtained from the reporter probe analysis of the
transcription from the dctAp (Chapter Three).
In strain RU150 a small amount of dctA mRNA was evident on all growth
substrates (Fig. 7.11). This was more than strain 3841 grown on
glucose/ammonia (non-inducing conditions), but was low in comparison to the
wildtype when grown on succinate or aspartate (1/8 the level). This agrees with
the results of the reporter probe analysis of dctA transcription in strain RU150
(Chapter Six).
Strains RU152-1 and RU152-14 also produced dctA mRNA constitutively,
as the same amount of dctA mRNA was evident under all growth conditions
including glucose/ammonia (Fig. 7.11). The level was significantly elevated in
comparison to strain RU150 indicating that extra dctA mRNA is being made in
these suppressor strain. The levels of dctA mRNA produced in strains RU152-1
284
and RU152-14 varied slightly in comparison to each other and were ~ 25-50% of
that observed in strain 3841 grown on succinate/ammonia or glucose/aspartate.
It is evident that the second site suppressors strains RU152-1 and RU152-
14 produce significantly more dctA mRNA than strain RU150 and again this is
constitutive and due to their duplicate copies of dctA. It is probable that these
mutants also produce an increased level of DctA protein. Therefore, strain
RU150 is complemented for growth on succinate/ammonia both by dctA on a
plasmid and by increasing the level of dctA transcription in strains RU152-1 and
RU152-14.
In summary, of the five second site suppressor mutants of strain RU150
isolated due to their ability to grow on succinate/ammonia, three had defined
genetic re-arrangements and were chosen for further analysis. Strain RU152-22
was shown to contain a deletion spanning the dctB promoter and the amino
terminus of DctB, while strains RU152-1 and RU152-14 contained duplicate
copies of dctA leading to a significant increase in the level of dctA transcription.
Both of these mutations allow growth on succinate/ammonia. It was also
decided to examine if the derepression of aspartate uptake by the general AAP,
was also affected in these second site suppressor mutants.
285
Fig. 7.11a dctA mRNA levels in strains 3841, RU150, RU152-1 and
RU152-14.
Lane A. Strain 3841 G/N Lane H. RU152-1 G/A Lane B. Strain 3841 G/ASP Lane I. RU152-1 S/N Lane C. Strain 3841 S/A Lane J. RU152-1 S/A Lane D. RU150 G/N Lane K. RU152-14 G/N Lane E. RU150 G/A Lane L. RU152-14 G/A Lane F. RU150S/A Lane M. RU152-14 S/N Lane G. RU152-1 G/N Lane N. RU152-14 S/A
20ug of total RNA was loaded per lane and hybridised with a dctA specific probe (pRU123).
286
Fig. 7.11b Densitometry scan of Northern blot in Fig 7.11a indicating
relative amounts of dctA mRNA produced.
0102030405060708090
100
A B C D E F G H I J K L M N
Sample name
% o
f val
ue o
f str
ain
3841
dct
A m
RN
A
afte
r gr
owth
on
S/N
Lane A. Strain 3841 G/N Lane H. RU152-1 G/A Lane B. Strain 3841 G/ASP Lane I. RU152-1 S/N Lane C. Strain 3841 S/A Lane J. RU152-1 S/A Lane D. RU150 G/N Lane K. RU152-14 G/N Lane E. RU150 G/A Lane L. RU152-14 G/A Lane F. RU150S/A Lane M. RU152-14 S/N Lane G. RU152-1 G/N Lane N. RU152-14 S/A
Results are expressed as a percentage of the total obtained from scanning lane C (Strain 3841 S/N).
287
7.2.8 Investigation of aspartate uptake via the AAP in
strains RU152-1, RU152-14 and RU152-22.
In parallel to the mapping of the second site suppressors, uptake of
aspartate by the AAP was also examined. Strains RU152-1, RU152-14 and
RU152-22 were grown on glucose/ammonia and glucose/aspartate to test if they
regained the ability to repress amino acid uptake (Table 7.2). All three strains
showed repression of aspartate uptake via the AAP to different extents when
grown on glucose/aspartate in a comparable fashion to strain 3841. Aspartate
transport by the AAP, when grown on glucose/ammonia, was as expected
repressed due to the nitrogen excess conditions.
Table 7.2 Aspartate transport by the AAP in strains RU152-1,
RU152-14 and RU152-22.
Parent Strain GenotypeStrain
G/N G/ASP
3841 w.t. 2.8±0.4 1.4±0.2
3841 RU 150 dctIR:: Tn5 3.7±0.5 11.4±1.3
RU150 RU152-1 2° site RU150 2.2 2.95
RU150 RU152-14 2° site RU150 1.6 5.8
RU150 RU152-22 2° site RU150 3.0±0.5 3.3±0.4
Growth conditions
Rates of aspartate transport are shown as nmol.(min)-1.(mg protein)-1 ±S.E.M and are based on at least three independent cultures each assayed in duplicate except where no errors are indicated which were based on two independent cultures assayed in duplicate.
Aspartate transport
288
In conclusion strain RU150 produces a low level of dctA (in comparison to
strain 3841 when induced) and loses its ability to repress the uptake of amino
acids by the AAP when grown on glucose/aspartate. Strains RU152-1 and
RU152-14 regain the ability to repress the AAP when grown on
glucose/aspartate by increasing the level of dctA transcription. This implicates
the actual amount of DctA present in mediating this effect and suggests that this
level has to be above a certain minimum. When the level of dctA transcription
in comparison to strain RU150 is approximately doubled, sufficient DctA is
present to allow repression of amino acid uptake by the AAP when grown on
glucose/aspartate and also to allow growth on succinate/ammonia.
Strain RU152-22 is deleted in the promoter and 3’ end of dctB but retains a
fully intact Tn5. The level of dctA transcription in strain RU152-22 is probably
unchanged in comparison to strain RU150 as the Tn5 is not mutated and it can
use succinate as a carbon source. Therefore, by deleting the amino terminus of
DctB and its promoter, strain RU152-22 is able to grow on succinate/ammonia
and can repress aspartate uptake by the AAP when grown on glucose/aspartate.
This implicates DctB and DctD in mediating the inability of strain RU150 to
grow on succinate/ammonia and also suggests that their presence in strain
RU150 plays a key role in allowing the alleviation of the aspartate repression
effect on amino acid transport by the AAP.
289
7.2.9 Investigation of the roles of dctA, dctB and dctD in
mediating the phenotype of strain RU150.
Analysis of the second site suppressor mutants of strain RU150 indicated
that they regained the ability to grow on succinate/ammonia and repress amino
acid uptake by the AAP by either deleting the amino terminus of DctB or
increasing the transcription level of dctA. Two approaches were taken to further
investigate the roles of dctA, dctB and dctD in mediating these two phenotypes:
(1) A series of site directed double mutants of dctA, dctB, dctD and
dctBD in strain RU150 were constructed to further investigate how the
deletion of dctB in strain RU152-22 restores the aforementioned
phenotypes,
(2) The level of dctA in strain RU150 was increased in trans to
investigate if the ability to repress aspartate uptake by the AAP when
grown on glucose/aspartate could be regained in an analogous fashion to
strains RU152-1 and RU152-14.
7.2.10 Investigation of the role of dctA, dctB and dctD in
preventing strain RU150 from growing on succinate/ammonia.
To further investigate the role of DctB in a more precise manner than in
strain RU152-22 and also to examine any potential roles for DctA and DctB in
allowing alleviation of these two phenotypes, a series of directed double mutants
in dctA, dctB, dctD and dctBD were constructed in strain RU150.
7.2.10.1 Construction of strain RU150 dct double mutants.
All the RU150 dct double mutants were constructed by a common scheme,
as described in Chapter Two, using the interposon encoding spectinomycin
290
resistance (Figs. 7.12-7.14). An RU150/ dctD:: strain was constructed using
the same plasmid (pRU158) used for making strain RU711 (3841/ dctD:: ) as
described in Chapter Three.
These four plasmids, pRU305 (dctA:: dctA-B IR::Tn5), pRU304
(dctB:: dctA-B IR::Tn5), pRU158 ( dctD:: ) and pRU303 ( dctBD:: ,
dctA-B IR::Tn5) were conjugated in to strain RU150, a gene replacement event
selected for and generated respectively strains RU938 (dctA-B IR::Tn5, dctA:: ),
RU875 (dctA-B IR::Tn5, dctB:: ), RU720 (dctA-B IR::Tn5, dctD:: ) and
RU873 (dctA-B IR::Tn5, dctBD:: ). These were all confirmed as having the
correct genotypes by Southern blotting (Fig. 7.15).
Fig. 7.12 Construction of pRU305; RU150 dctA:: suicide vector.
Plasmid pRU155 containing the interposon cloned into the BamH1 site
of dctA was used to make strain RU727 (strain 3841 dctA). In order for this
construct to be utilised it was necessary to replace the DNA at the 5’ end of dctA
with the corresponding DNA from strain RU150. This was possible by cloning
in the RU150 DNA from pRU10 at the AccIII site just outside the dctA coding
region (5’ end). Thus the identical DNA upstream from dctA in strain RU150 is
present upstream from dctA in this clone. Plasmid pRU155 was digested with
AccIII and the appropriate fragment of pRU10 was cloned in yielding pRU345.
This was cloned as a NotI/ApaI fragment into pJQ200KS, generating pRU305.
(The NotI site used was located in IS50L of the Tn5). Therefore this construct
consists of a mutated copy of dctA flanked by 894 bp on the 5’ end of dctA and
947 bp on the 3’ end and is identical to the flanking DNA in strain RU150.
291
292
Fig. 7.13 Construction of pRU304; RU150 dctB:: suicide vector.
pRU147 was digested with EcoRI and the resultant 5kb fragment
containing a truncated dctB and all of dctD was cloned into Bluescript II SK+
forming pRU139. The plasmid was digested with EcoRV and the 1.2kb
fragment containing two thirds of dctB was cloned into EcoRV-digested
Bluescript II SK+ yielding pRU154. This was digested with NruI which cuts
dctB 949 bp from its start site and a SmaI digested interposon was ligated in,
generating pRU158. This was then digested with EcoRI and the EcoRI insert
from pRU10 was ligated in, its orientation checked and designated pRU347.
This therefore contains dctB with an interposon located at nucleotide position
949 (residue 316), flanked on its 5’ end by 1.7kb and 0.85kb on its 3’ end, all
identical to the flanking DNA of strain RU150. This was cloned as NotI/ApaI
fragment into pJQ200KS, yielding pRU304.
293
294
Fig. 7.14 Construction of pRU303; RU150 dctBD:: suicide vector.
The construction of plasmid pRU152 has previously been described
(Chapter Three) and contains a truncated dctB at its EcoRI site and the whole of
dctD cloned in Bluescript II SK+. This was digested at the two NruI sites, one
located 949 bp from the dctB start site and the other 1018 bp past the dctD start
site, excising the 3’ end of dctB and the 5’ end of dctD, creating a 1.9kb
deletion in which an interposon, SmaI digested, was inserted. Thus DctB
was truncated from residue 316. The DNA at the 5’ end of dctB was increased,
to increase the frequency of a double crossover, by cloning the EcoRI fragment
from pRU10 in the correct orientation into the EcoRI site located in dctB
generating pRU156. This was cloned as a NotI (located in IS50R of Tn5)/ApaI
fragment into pJQ200KS, yielding pRU303.
295
296
Fig. 7.15a Southern blotting of strains RU938, RU875, RU720 and
RU873 and hybridisation with specific probes to confirm gene replacement.
Lane A. RU150 HindIII Lane B. RU938 HindIII Hybridised with dctA specific probe pRU365.
Blot 1
Blot 2 Lane A. RU150 HindIII Lane B. RU875 HindIII Lane C. RU720 HindIII Lane D. RU873 HindIII Lane E. RU150 HindIII Hybridised with dctA specific probe(pRU365).
Lane A. RU150 HindIII Lane B. RU938 HindIII Hybridised with dctB specific probe (pRU327).
Blot 3
297
Lane A. RU150 HindIII Lane B. RU875 HindIII Lane C. RU720 HindIII Lane D. RU873 HindIII Lane E. RU150 HindIII Hybridised with dctB specific probe (pRU327).
Blot 4
Lane A. RU150 HindIII Lane B. RU938 HindIII Hybridised with dctD specific probe (pRU326).
Blot 5
Lane A. RU150 HindIII Lane B. RU875 HindIII Lane C. RU720 HindIII Lane D. RU873 HindIII Lane E. RU150 HindIII Hybridised with dctD specific probe (pRU326).
Blot 6
298
Fig. 7.15b HindIII restriction map of dct region in gene replacement
strains showing predicted sizes when hybridised with dctA, dctB and dctD
probes.
299
Fig. 7.15c Table of expected HindIII restriction fragment sizes (kb) of
gene replacement strains hybridised with dctA, dctB and dctD probes which
concur with those obtained in the Southern blots.
Strain RU938 RU875 RU720 RU873 RU150Genotype dct IR ::Tn5
dctA::dct IR::Tn5
dctB::dct IR::Tn5
dctD::dct IR::Tn5
dctBD::dct IR::Tn5
dctA probe 1.8, 1.6 3.4 3.4 3.4 3.5
dctB probe 9.3,1.8,1.6 7.0, 2.3,3.5 3.4,4.1 3.4, 2.3 9.3,3.5
dctD probe 9.3 7.3,2.3 5.0,4.3 5.0,2.0 9.3
300
7.2.10.2 Growth phenotypes of the RU150 dct double
mutants strains RU938, RU875, RU720 and RU 873.
The four RU150 dct double mutants were tested for growth on
glucose/ammonia, glucose/aspartate, succinate/ammonia and
succinate/aspartate (Table 7.3).
Strain RU938 (RU150/dctA) grew normally on glucose/ammonia and
glucose/aspartate and, as expected, was unable to grow on succinate/ammonia
or succinate/aspartate due to mutation of the C4 dicarboxylate transport
permease, DctA (Table 7.3).
Strains RU875 (RU150/dctB), RU720(RU150/dctD) and RU938
(RU150/dctBD) all grew normally on glucose/ammonia and glucose/aspartate
(Table 7.3) and similar to strain RU150, also on succinate/aspartate. In contrast
to strain RU150, these three strains also grew on succinate/ammonia. This
indicates that mutation or deletion of dctB or dctD in strain RU150 allows
growth on succinate/ammonia. This concurs with the result from strain RU152-
22, the second site suppressor of strain RU150 deleted in the amino terminus of
DctB, which also grew on succinate/ammonia. As suggested in Chapter Six,
the inability of strain RU150 to use ammonia in the presence of succinate was
thought to be due to phosphorylated DctB and DctD cross regulating an operon
(s) specifically involved in ammonia assimilation/metabolism. These results
support this, indicating that disruption of the DctB/D signalling circuit in strain
RU150 allows it to use ammonia in conjunction with succinate as the carbon
source. As strain RU720 (RU150/dctD) grew on succinate/ammonia, this
indicates that phosphorylated DctB alone is not capable of preventing strain
RU150 from growing on succinate/ammonia. In addition, strain RU150 is able
to use ammonia in conjunction with glucose; conditions where the DctB would
not be phosphorylated (Chapter Six). These results suggest that DctD~Pi
prevents ammonia utilisation in strain RU150. It is possible that under
circumstances where DctD~Pi is not required for transcription of dctA, that it
301
may interfere with another promoter(s) which is controlled by an analogous
response regulator to DctD, and whose gene(s) is involved in ammonia
assimilation, causing repression.
Table 7.3 Growth phenotypes of the RU150 dct double mutants
strains RU938, RU875, RU720 and RU873.
Parent Parent Strain Genotype
G/N G/ASP S/N S/ASP
3841 w.t. +++ +++ +++ +++
RU150 dctIR ::Tn5 +++ +++ +++
RU 938 dct IR::Tn5 dctA :: +++ +++
RU 875 dct IR::Tn5 dctB :: +++ +++ +++ +++
RU 720 dct IR::Tn5 dctD :: +++ +++ +++ +++
RU 873 dct IR::Tn5 dctBD :: +++ +++ +++ +++
Growth conditions
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ± indicates very poor growth. indicates no growth.
Growth
302
7.2.11 Investigation of amino acid transport by the AAP
and the regulation of glnII transcription in the four RU150 dct
strains.
Aspartate transport via the AAP and transcription from the glnIIp in the
four RU150 dct strains, strains RU938 (RU150 dctA), RU875 (RU150 dctB),
RU720 (RU150 dctD) and RU873 (RU150 dctBD) was tested after growth on
glucose/ammonia, glucose/aspartate and glucose/glutamate.
7.2.11.1 Aspartate transport by the AAP in the RU150 dct
strains.
All strains showed normal regulation in response to nitrogen source (Table
7.4). The AAP was repressed for aspartate uptake when cells were grown on
glucose/ammonia (nitrogen excess conditions) and derepressed when grown on
glucose/glutamate (nitrogen limiting conditions). However, when these strains
were grown on glucose/aspartate (which causes repression in strain 3841 and
RU152-22 (RU150/dctB) no repression of uptake of aspartate by the AAP was
evident (Table 7.4). These rates were similar to those in dct mutants of strain
3841 and also to strain RU150. This was expected for strain RU938
(RU150/dctA), as a functional DctA is considered essential for any repression
effect to occur. However, strains RU875, RU720 and RU873 were expected to
repress aspartate uptake by the AAP based on the results obtained from RU152-
22. This suggests that there is some significant difference between the deletion
of dctB in strain RU152-22 and the directed mutants of dctB, dctD and dctBD in
strain RU150.
303
Table 7.4 Aspartate transport via the AAP in the RU150 dct strains.
Strain Genotype
G/N G/ASP G/GLU
3841 w.t. 2.8±0.4 1.4±0.2 11.8±0.4
RU 150 dctIR:: Tn5 3.7±0.5 11.4±1.3 11.4±1.5
RU 938 dctIR ::Tn5 dctA :: 2.37±0.1 16.5±2.3 17.7±0.9
RU 875 dctIR ::Tn5 dctB :: 4.9±0.4 14.8±0.6 17.2±0.4
RU 720 dctIR ::Tn5 dctD :: 5.6±0.9 9.2±.4 13.9±.6
RU 873 dctIR ::Tn5 dctBD :: 3.0±0.0 13.1±3.3 18.5±0.1
Growth conditions
Rates of aspartate transport are shown as nmol.(min)-1.(mg protein)-1±S.E.M and are based on at least three independent cultures each assayed in duplicate.
Aspartate transport
7.2.11.2 Transcription from the glnIIp in the RU150 dct
strains.
The regulation of transcription from the glnIIp was also examined in the
RU150 dct strains. The glnIIp promoter probe (pAR36A) was conjugated into
strains RU938, RU875, RU720 and RU873 generating respectively strains
RU964, RU949, RU808 and RU950 and -galactosidase activity was
measured in these after growth on glucose/ammonia, glucose/aspartate and
glucose/glutamate (Table 7.5).
All displayed a similar pattern of regulation of transcription from the glnIIp
when compared to uptake of aspartate by the AAP. When cells were grown on
glucose/ammonia, all showed repressed levels of transcription from the glnIIp
due to the nitrogen excess growth conditions. When grown under nitrogen
304
limitation (glucose/glutamate), glnIIp transcription was de-repressed similar to
strain 3841. When grown on glucose/aspartate, these strains showed
derepressed levels of glnIIp transcription. This is similar to the regulation of
both the AAP and glnII transcription in strain RU150 but contrasts to that in
strains 3841 and RU152-22 (RU150/dctB). This was expected for strain RU964
(RU150/dctA), as a functional DctA is not present. However, based on the
evidence of aspartate transport by the AAP in strain RU152-22 (RU150/dctB),
strains RU949 (RU150/dctB), RU808 (RU150/dctD) and RU950
(RU150/dctBD) were expected to be repressed for transcription from the glnIIp.
This shows that, similar to the regulation of the AAP, there is a significant
difference between the deletion in dctB in strain RU152-22 and the directed dctB,
dctD and dctBD mutants of strain RU150 on regulation of transcription from the
glnIIp.
305
Table 7.5 -galactosidase activity from the glnIIp in the RU150 dct
strains.
Parent Parent StrainStrain Genotype
G/N G/ASP G/GLU
3841 w.t. RU 622 288±26 362±52 1126±31
RU 150 dctIR:: Tn5 RU 624 379±32 1350±37 1374±62
RU 150 dctIR ::Tn5 dctA :: RU 964 474±68 1766±187 1665±257
RU 150 dctIR ::Tn5 dctB :: RU 949 392±22 1467±149 1494±196
RU 150 dctIR ::Tn5 dctD :: RU 808 383±14 1229±59 1291±26
RU 150dctIR ::Tn5 dctBD :: RU 950 375±42 1532±152 1599±102
Growth conditions
Results are shown as ONPG hyrolysed (nmol.min-1.(mg protein)-1)±S.E.M. and are based on at least three independent cultures each assayed in triplicate.
-galactosidase activity
306
7.2.12 Effect of multiple copies of dctA in strain RU150.
Extra copies of dctA complement strain RU150 for growth on
succinate/ammonia (Chapter Six). Strain RU150 also regains the ability to grow
on succinate/ammonia and repress amino acid uptake by the AAP when grown
on glucose/aspartate by duplicating dctA and hence increasing its level of
DctB/D independent transcription. To examine this in a more precise manner,
extra copies of dctA, under the control of DctB/D were conjugated into a variety
of strains including strain RU150 and tested for the ability to repress aspartate
uptake by the AAP.
The dctA gene was expressed from two plasmids with different copy
numbers, allowing the effect of different levels of dctA to be assessed in
mediating the aspartate repression effect. Transcription of dctA from these
plasmids is DctB/D dependent, so the level of DctD~Pi present should
determine the maximum amount of transcription from the dctA promoters
imposing an upper limit.
The construction of the lower copy number plasmid, pRU108, was
described previously and is an Inc.P based replicon (RK2) which has a copy
number of 5-8 in E. coli 2232,5146 and is thought to have a copy number of
~10 in R. leguminosarum. The higher copy number plasmid, pRU357, based
on the Inc. Q replicon, RSF1010, with a copy number of ~45 in R.
leguminosarum 5216 should cause higher levels of dctA transcription than
pRU108. The construction of this plasmid is detailed in Fig. 7.16.
307
Fig. 7.16 Construction of pRU357.
pRU322 has previously been described and was used to make a directed
dctB mutant in 3841. This plasmid contains a complete copy of dctA and its
intergenic region (on a 3kb HindIII fragment) flanked by two HindIII sites. The
3kb fragment was excised and cloned directly into HindIII-digested pRU330
(construction detailed previously), yielding pRU357.
308
Plasmid pRU108 had previously been conjugated into strains 3841 and
RU150 generating strains RU465 and RU471 and was also conjugated into
strains RU727 (strain 3841/dctA) and RU714 (strain 3841/ dctABD) generating
strains RU1202 and RU1203. Plasmid pRU357 was also conjugated into strains
3841, RU150, RU727 and RU714, yielding strains RU820, RU828, RU836
and RU845.
7.2.12.1 Growth phenotypes of various strains carrying
pRU108 and pRU357.
All of the strains carrying pRU108 and pRU357 were tested for growth on
glucose/ammonia, glucose/aspartate, succinate/ammonia and
succinate/aspartate (Table 7.6).
As previously described for strains RU465 and RU471, pRU108 allowed
normal growth on glucose/ammonia, glucose/aspartate, succinate/ammonia and
succinate/aspartate indicating that it complements strain RU150 for growth on
succinate/ammonia and that it does not effect the wildtype for growth on these
substrates. As indicated by transcriptional analysis (Chapter Six), the DctB/D
regulatory circuit in strain RU150 functions normally (Table 7.6). This
complementation for growth on succinate/ammonia is presumably due to DctB/D
dependent transcription from the dctAp. In addition, strain RU1202
(RU727(dctA)/pRU108)grew normally on glucose/ammonia, glucose/aspartate,
succinate/ammonia and succinate /aspartate (Table 7.6). Strain RU1203
(RU714(dctABD)/pRU108) grew normally on glucose/ammonia and
glucose/aspartate but was unable to grow on succinate/ammonia or
succinate/aspartate (Table 7.6) demonstrating that transcription of dctA from this
plasmid is DctB/D dependent. The strains carrying pRU357 were also tested for
growth on glucose/ammonia, glucose/aspartate, succinate/ammonia and
succinate/aspartate Table (7.6).
309
Table 7.6 Growth phenotypes of various strains carrying pRU108 and
pRU357.
Parent Parent Plasmid StrainStrain Genotype
G/N G/ASP S/N S/ASP
w.t. 3841 +++ +++ +++ +++3841 dctIR ::Tn5 RU150 +++ +++ +++3841 dctA :: RU727 +++ +++3841 dctABD :: RU714 +++ +++
3841 w.t. pRU108 RU465 +++ +++ +++ +++RU150 dctIR ::Tn5 pRU108 RU471 +++ +++ +++ +++
RU727 dctA :: pRU108 RU1202 +++ +++ +++ +++RU714 dctABD :: pRU108 RU1203 +++ +++
3841 w.t. pRU357 RU820 +++ * +++ +++RU150 dctIR ::Tn5 pRU357 RU828 +++ *
RU727 dctA :: pRU357 RU836 +++ * +++ +++RU714 dctABD :: pRU357 RU845 +++ *
Growth conditions
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ++ indicates moderate growth. ± indicates very poor growth. indicates no growth. * indicates reversion/mutation.
Growth
All grew normally on glucose/ammonia. Strain RU820 (3841/pRU357)
grew normally on succinate/ammonia and succinate/aspartate indicating that the
level of dctA produced by this plasmid does not impair growth of the wildtype.
Strain RU828 (RU150/pRU357) grew on succinate/ ammonia and
310
succinate/aspartate (Table 7.6) indicating that a functional copy of dctA is
present on this plasmid. Moreover strain RU845 (RU714(dctABD) /pRU357)
was not complemented for growth on succinate/ammonia and succinate/aspartate
indicating that transcription of dctA from this plasmid requires DctB/D.
However, when strains RU820, RU828 and RU836 were plated on
glucose/aspartate they were unable to grow and a high rate of reversion was
evident (Table 7.6). This effect appears to be mediated by dctA expression from
pRU357 as strain RU845 which is deleted in dctABD and therefore unable to
express dctA grew normally on glucose/aspartate. This toxicity is not due to the
amount of dctA transcription since it had previously been shown that cells grown
on succinate/aspartate have higher levels of dctA transcription than on
glucose/aspartate grown cells yet they grew normally (Chapter Three). The
toxic effect is specific for growth on glucose/aspartate and is mediated by the
high level of dctA. This is comparable to the repression of amino acid transport
and glnII transcription by aspartate previously observed in the wildtype.
However, when the level of transcription of dctA is further increased, the
transport of aspartate is presumably increased and the intracellular aspartate
concentration not only represses certain operons but leads to the accumulation of
toxic levels of aspartate.
Since 2-methyl succinate is capable of alleviating the aspartate dependent
repression of the AAP and glnII, it was tested to see if it would allow strains
RU820, RU828 and RU836 to grow on glucose/aspartate. 2-Methyl succinate
at levels of 1.0mM to 10mM permitted normal growth of strains RU820, RU828
and RU856 on glucose/aspartate (Table 7.7.). Moreover, it did not effect these
strains for growth on glucose/ammonia. 2-Methyl succinate appears to have a
higher affinity than aspartate for binding (and transport) by DctA (Dave
Walshaw, personal comm.) and so this is probably inhibiting or preventing
aspartate transport by DctA. This would lower the intracellular aspartate
concentration preventing toxicity.
Table 7.7 Effect of 2-Methyl succinate on strains carrying pRU357 for growth on glucose/aspartate.
Parent Parent Plasmid StrainStrain Genotype
G/N G/N G/N G/ASP G/ASP G/ASP1mM 10mM 1mM 10mM
2-methyl 2-methyl 2-methyl 2-methylsuccinate succinate succinate succinate
w.t. 3841 +++ +++ +++ +++ +++ +++
3841 w.t. pRU357 RU820 +++ +++ +++ * +++ +++RU150 dctIR ::Tn5 pRU357 RU828 +++ +++ +++ * +++ +++RU727 dctA :: pRU357 RU836 +++ +++ +++ * +++ +++
Growth conditions
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. ++ indicates moderate growth. ± indicates very poor growth. indicates no growth. * indicates reversion/mutation.
Growth
312
7.2.12.2 Effect of over expression of dctA independent of
DctB/D.
It was evident from the results obtained with the second site the second site
suppressors, strains RU152-1 and RU152-14, that the expression of dctA at a
moderate level allows strain RU150 to regain the ability to repress amino acid
uptake by the AAP and to grow on succinate/ammonia. This aspartate
repression effect in the wildtype is dependent on dctA (Chapter Five) and
DctB/D are not required for this effect to occur other than in their role of
activating transcription of dctA. The second site suppressor mutant, strain
RU152-22, which has lost the dctB promoter and the amino-terminus of DctB
but still transcribes dctA constitutively is able to repress the AAP when grown on
glucose/aspartate. This suggests that the absence of DctB in strain RU152-22
allows DctA alone to repress the AAP when grown on glucose/aspartate.
Moreover, growth on glucose/aspartate of strains carrying a plasmid which
express dctA at a high level is toxic.
To further address the roles of DctB and DctD in mediating the effects,
plasmids constitutively expressing dctA at different levels was constructed to test
if they would cause the aspartate repression effect independent of DctB/D.
Three expression plasmids giving a low, intermediate and high level of dctA
expression independent of DctB and DctD, pRU359. pRU299 and pRU296
respectively, were constructed (Fig. 7.17).
313
Fig 7.17 Construction of pRU296, pRU299 and pRU359.
The plasmids pML122, pML130 and pML140 are a series of
transcriptional expression vectors using respectively the neomycin phospho-
transferase promoter from the nptII gene in Tn5, the lac promoter from pUC8
and the promoter of the SI gene from R. meliloti 5216. Plasmids pML122,
pML130 and pML140 give a high, intermediate and low level of transcription
respectively, as judged by -galactosidase activity measured in R.
leguminosarum 5216.
The dctA gene including its ribosome binding site but excluding its
promoter (the dctAB intergenic region) was cloned into these vectors as outlined
below. Plasmid pRU69 is the 3kb EcoR1 fragment from pRU47 containing all
of dctA and dctB up to its EcoR1 site cloned in Bluescript II SK+. An Apo1 site
is present just past the 3’ end of dctA and as Apo1 cuts at the same sequence as
EcoR1, pRU69 was digested with this and a 1.6kb Apo1 fragment containing
dctA and its intergenic region was cloned into EcoR1 digested Bluescript II KS+
yielding pRU363. This was digested with EcoRV (site in Bluescript II KS+
MCS) and AccIII (site located 9 base pairs upstream from the ribosome binding
site of dctA), the 5’ overhang of the AccIII site filled in, and this fragment was
blunt end ligated into Bluescript II KS+, EcoRV digested, yielding pRU365.
As this fragment was filled in at the AccIII site and blunt ligated into Bluescript
II KS+, this was tested for the presence of the AccIII site upstream of dctA,
(which should be recreated when an AccIII site is filled in and blunt end ligated
to an EcoRV site), and was shown to be present. This indicated that the fill in
reaction had not resulted in chew back of the DNA past the AccIII site
confirming that the dctA RBS was intact. This plasmid contains a complete
copy of dctA lacking its own promoter but retaining its ribosome binding site.
This was cloned as an ApoI fragment into pML122 and pML130 generating
pRU296 and pRU299 respectively. In addition it was directionally cloned as an
Xba1/KpnI fragment into pML140 yielding pRU359.
314
315
The three plasmids, pRU359, pRU299 and pRU296 were conjugated into
strains 3841, RU150, RU727 (dctA) and RU714 (dctABD) generating the strains
as listed in Table 7.8. During the conjugation and subsequent purification of
these strains, it was noticed that they were unable to grow on the standard TY
agar and showed a high rate of reversion/mutation. They were subsequently
conjugated and purified on glucose/ammonia minimal medium. All maintained
the plasmid resistance marker (GmR) and that of any chromosome mutation;
RU150 KmR, RU727 and RU714 SpR.
Table 7.8 List of strains carrying pRU359, pRU299 and pRU296.
Parent Parent Parent Plasmid Strain DescriptionGenotype Strain plasmid
w.t. 3841 pML140 pRU359 RU818dctIR ::Tn5 RU150 pML140 pRU359 RU826
dctA :: RU727 pML140 pRU359 RU834dctABD :: RU714 pML140 pRU359 RU843
w.t. 3841 pML130 pRU299 RU816dctIR ::Tn5 RU150 pML130 pRU299 RU824
dctA :: RU727 pML130 pRU299 RU832dctABD :: RU714 pML130 pRU299 RU841
w.t. 3841 pML122 pRU296 RU814dctIR ::Tn5 RU150 pML122 pRU296 RU822
dctA :: RU727 pML122 pRU296 RU830dctABD :: RU714 pML122 pRU296 RU838
Low level of dctA
transcription
Intermediate level of dctA transcription
High level of dctA
trancription
316
7.2.13 Growth phenotypes of strains carrying pRU359,
pRU299 and pRU296.
All strains were tested for growth on glucose/aspartate, succinate/ammonia
and succinate/aspartate (Table 7.9). The strains carrying the plasmids
expressing dctA at low and intermediate levels (pRU359 (low level) and pRU299
(intermediate level)) had the same phenotype as their parent strains. Strains
RU818 and RU816, (strain 3841/pRU359 and pRU299 respectively), grew
normally on all substrates. Strains RU826 and RU824, (strain RU150/pRU359
and pRU299 respectively), grew normally on glucose/ammonia,
glucose/aspartate or succinate/aspartate but were not complemented for growth
on succinate/ammonia identical growth to strain RU150. Strains RU834 and
RU832, (RU727(dctA)/pRU359 and pRU299 respectively), grew normally on
glucose/ammonia and glucose/aspartate but were not complemented for growth
on succinate/ammonia or succinate/aspartate. Similarly, strains RU843 and
RU841 (RU714(dctABD)/pRU359 and pRU299 respectively), grew on
glucose/ammonia and glucose/aspartate but were not complemented for growth
on succinate/ammonia or succinate/aspartate.
The four strains carrying plamid pRU296 (high level) showed alterations in
their growth phenotypes in comparison to their parent strains when tested on
glucose/aspartate, succinate/ammonia and succinate/aspartate. All these strains
grew normally on glucose/ammonia. However they were unable to grow on
glucose/aspartate and all showed a high rate of reversion/mutation. This is
similar to the over expression of dctA at a high level under the control of DctB/D
(section 7.2.12) which also displayed a aspartate toxicity effect. Strain RU814
(strain 3841/pRU296) grew poorly on succinate/ammonia, while strains RU830
(RU727(dctA)/pRU296) and RU839 (RU714(dctABD) /pRU296) also showed
poor growth on succinate/ammonia indicating however that some
complementation via the plasmid encoded dctA occurred. Strain RU822
(RU150/pRU296) also grew poorly on succinate/ammonia, indicating that this
317
plasmid was partially complementing. Finally all these strains showed poor
growth on succinate/aspartate.
Table 7.9 Growth phenotypes of strains carrying pRU359, pRU299
and pRU296.
Parent Parent Plasmid StrainStrain Genotype
G/N G/ASP S/N S/ASP
3841 w.t. pRU359 RU818 +++ +++ +++ +++RU150 dctIR ::Tn5 pRU359 RU826 +++ +++ +++RU727 dctA :: pRU359 RU834 +++ +++
RU714 dctABD :: pRU359 RU843 +++ +++
3841 w.t. pRU299 RU816 +++ +++ +++ +++RU150 dctIR ::Tn5 pRU299 RU824 +++ +++ +++RU727 dctA :: pRU299 RU832 +++ +++
RU714 dctABD :: pRU299 RU841 +++ +++
3841 w.t. pRU296 RU814 +++ * + +RU150 dctIR ::Tn5 pRU296 RU822 +++ * + +RU727 dctA :: pRU296 RU830 +++ * + +RU714 dctABD :: pRU296 RU838 +++ * + +
Results are from agar streak plates (minimal medium) with all carbon and nitrogen sources at 10mM and scored after incubation for 5 days at 25°C. +++ indicates normal growth. + indicates poor growth. indicates no growth. * indicates reversion.
Growth
Growth conditions
318
As judged by the reported promoter strengths in R. leguminosarum 5216,
all three plasmids should have expressed dctA at a higher level than the native
dctAp in the wildtype under inducing conditions (succinate/ammonia). Strains
carrying plasmids expressing dctA at low and intermediate levels probably
accumulated deletions in dctA during the conjugation and purification process
due to the level of dctA expression being toxic. This would account for them
still being GmR (indicative of the plasmid) but not showing any complementation
for growth on succinate. Moreover, they showed high levels of
reversion/mutation when plated on TY agar. TY agar contains a large amount of
amino acids including aspartate and this probably accentuated the problem of
over expressing dctA (in the presence of aspartate) in a comparable fashion to
over-expression of dctA at high level in a DctB/D dependent fashion (Section
7.13).
Strains carrying pRU296 show partial complementation of a dctA and
dctABD strain for growth on succinate/ammonia and succinate/aspartate
suggesting that they managed to maintain an intact copy of dctA. This possibly
occurred by a mutation in the promoter of dctA leading to a reduction in its
transcription. This would account for them still displaying GmR (indicative of
the plasmid) and, indicative of an intact dctA. However, it is evident that this
plasmid prevented strain 3841 from growing normally on succinate/ammonia and
succinate/aspartate, suggesting it is still deleterious. This poor growth on these
substrates could be due to the cell being flooded by succinate via the un-
regulated over-expressed dctA and hence being toxic to the cell. None of the
strains grew on glucose/aspartate showing a high rate of reversion. This is
probably due to a high level of aspartate accumulation via dctA leading to
concentrations which are toxic. The revertants evident are most likely due to
deletions of the plasmid preventing this influx of aspartate via dctA.
In summary, it is evident that over expression of dctA constitutively
independent of DctB/D is extremely toxic to the cell. It can respond by
319
presumably mutating dctA or possibly mutating the promoter over expressing
dctA leading to a reduced level of dctA expression. If an intact copy is
maintained and expressed at a high level, the cell is severely affected in its
ability to utilise succinate or aspartate as growth substrates. Obviously, it was
not possible to test these strains for aspartate uptake via the AAP.
320
7.3 Discussion
7.3.1 Introduction.
Results presented in this Chapter describe the isolation of second site
suppressor mutants of strain RU150, the construction of directed RU150 dct
double mutants and strains carrying over-expressed dctA. Their subsequent
analysis revealed that:
(1) Strain RU150 regained the ability to grow on succinate/ammonia by
deleting DctB or DctD, or by increasing the level of dctA transcription.
(2) By deleting the amino-terminus of DctB or increasing the level of
dctA transcription strain RU150 regains the ability to repress uptake of
aspartate by the AAP and glnII transcription after growth on
glucose/aspartate.
7.3.2 Role of DctB and DctD in preventing strain RU150
from growing on succinate/ammonia.
Analysis of the second site suppressor mutant (strain RU152-22) and the
RU150 dct directed mutants showed that mutating dctB or dctD or deleting both
allows strain RU150 to grow on succinate/ammonia. As suggested in Chapter
Six, the inability of strain RU150 to grow on succinate/ammonia is because it
cannot use ammonia in the presence of succinate. In strain RU150 transcription
of dctA is not dependent on DctB/D. However, DctB and DctD are still
produced constitutively at rates similar to the wildtype and they respond
normally to C4-dicarboxylates and aspartate. Upon induction of the DCT system
by succinate, DctB is activated and phosphorylates DctD. DctD~Pi which is
not required for transcription of dctA, appears to be capable of repressing
transcription from heterologous operons including one specifically involved in
ammonia assimilation/metabolism.
321
The results presented in this Chapter support this model, as mutating any
component of the DctB/D signalling pathway would prevent production of
DctD~Pi, when grown on succinate/ammonia. An RU150 dctD mutant (strain
RU720), in which the transcription of dctB is unaffected, grew normally on
succinate/ammonia, conditions where DctB is phosphorylated. This suggests
that phosphorylated DctB alone cannot prevent strain RU150 from growing on
succinate/ammonia and indicates that DctD is absolutely required. Moreover,
as shown in Chapter Six, strain RU150 is capable of utilising ammonia in
conjunction with glucose, conditions where DctB is not activated and hence no
DctD~Pi is produced. This suggests that the loss of growth on
succinate/ammonia only occurs in the presence of DctD~Pi which interferes with
heterologous operons (Fig. 7.18).
322
Fig. 7.18 Diagram of role of DctB and DctD in preventing growth of
RU150 on sucinate/ammonia.
323
7.3.3 Role of dctA in affecting strain RU150 for growth on
succinate/ammonia.
Increasing the copy number of dctA in strain RU150 either by
chromosomal duplication as in strains RU152-1 and RU152-14, or by
introducing it on a plasmid at a moderate level under the control of DctB/D,
complements it for growth on succinate/ammonia. As strain RU150 transports
succinate constitutively and is capable of growth on succinate/aspartate, it is
unlikely that this complementation is due to an increased rate of succinate
transport. Instead by increasing the level of dctA transcription, it prevents the
proposed interference with ammonia assimilation/metabolism thought to be
mediated by DctB/D. DctA plays a role in determining what DctB can respond
to and probably interacts with it (Chapter Three). The above data suggest that
DctA also directly regulates DctB, possibly by affecting its ability to act as
kinase/phosphatase on DctD (Fig 7.19). In strain RU150, the level of dctA
transcription relative to that of dctB and dctD is low, suggesting that it is unable
to properly regulate DctB. It is this excess DctB that is essentially ‘free’ from
any control by DctA leading to over production of DctD~Pi when cells are
grown on succinate/ammonia.
324
Fig. 7.19 Diagram of role of DctA in complementing strain RU150 for
growth on succinate/ammonia.
When the balance of DctA to DctB is redressed, by increasing the level of
dctA transcription as in strains RU152-1 and RU152-14 or in strains carrying
dctA over-expressed at a moderate level (pRU108), this increased level of DctA
regains the ability to control DctB. This leads to a reduction in the amount of
DctD~Pi in circulation. This would function as a feedback loop whereby the
increased level of DctA would interact with DctB at greater frequency, causing
it to reduce its phosphorylation of DctD. This reduction in DctD~Pi should
prevent improper cross-regulation. In addition to this, in strains carrying
pRU108, the level of DctD~Pi would be further reduced by binding to the
UAS’s of the dctAp carried on the plasmid.
These results also suggest a simple model of regulation of dctA
transcription in the wildtype where DctA plays a role in regulating DctB and
possibly determines whether DctB can act as a kinase/phosphatase on DctD. It
is postulated that this constitutes a feed back loop controlling the expression of
dctA. In the absence of C4-dicarboxylates, the level of DctA to DctB is low.
The presence of a C4-dicarboxylate is sensed by DctB which is activated and
Extra dctA transcription
325
produces DctD~Pi promoting transcription of dctA. As the level of DctA
increases, it interacts with DctB more frequently, and controls DctB’s ability to
act as a kinase/phosphatase on DctD. This would regulate the production of
DctD~Pi and control transcription from the dctAp (Fig. 7.20).
The level of DctA is critical in mediating this proposed feedback loop in
the wildtype. In strain RU150, DctB and DctD are activated in response to
succinate or aspartate but the level of dctA transcription is at a constitutive low
level. Therefore, in strain RU150, the feedback loop where DctA controls
DctB would not function properly. DctB~Pi or DctD~Pi would be artificially
high leading to improper regulation of other operons.
326
Fig 7.20 Model of proposed role of DctA in regulating its
transcription via DctB and DctD.
Wildtpe: non-inducing conditions
Wildtype: Upon induction by C4-dicarboxylates or aspartate
Wildtype: After induction by C4-dicarboxylates or aspartate
DctB alters phosphorylation/ dephosphorylation of DctD.
327
7.3.4 Role of DctB and DctD in mediating repression of
aspartate uptake and glnII transcription in strain RU150.
Strain RU151-22 regains the ability to repress uptake of amino acids by the
AAP by deleting the promoter and amino-terminus of DctB in strain RU150.
However, directed mutants of strain RU150 in dctB and dctD do regain this
ability. This indicates that some difference exists between the mutation in
strain RU152-22 and the directed dctB, dctD and dctBD mutants of strain
RU150. One possible difference is that all the RU150 dct mutants produce
either an intact or truncated DctB while strain RU152-22 does not produce any
DctB as its promoter and amino-terminus are deleted (Fig. 7.21).
328
Fig 7.21 Diagram indicating roles of DctB in mediating the aspartate
repression effect in strain RU150.
Both the directed RU150 dctB and dctBD mutants are mutated midway
through DctB at residue 316, and importantly the region of DctB which encodes
the first of two postulated membrane spanning domains (residues 25-42 2173)
is intact. The periplasmic loop bounded on the amino terminus by this is
essentially complete, missing only its last five residues. In the wildtype DctB,
this periplasmic loop is also bounded by a second membrane spanning domain
(residues 321-338), which is missing in the RU150 dctB and dctBD directed
mutants. The promoter of dctB is unaffected in these RU150 dct mutants and
329
the mutation is bounded by an interposon which encodes translational stop
signals in all three reading frames. Therefore, a truncated DctB should be made
in these strains which still retains its first membrane spanning domain and
periplasmic loop but lacks its second membrane spanning domain and
cytoplasmic C terminus. This C-terminus is thought to be responsible for
phosphorylating DctD 5226. The truncated DctB should be able to insert into
the inner membrane, as it is generally accepted that proteins fold into the inner
membrane via their N terminus first. It is possible that the truncated DctB could
still interact with DctA in a similar fashion to the full length protein. This
postulated interaction of DctA with either the full length or truncated DctB
would be dynamic so that the amount of DctA associated with DctB at any time
would be a function of the level of DctA in circulation. When DctA is
associated with DctB, the ability of DctA to transport aspartate may be lowered
so the intracellular concentration of aspartate would not rise as rapidly. This
might relieve the aspartate dependent repression of the AAP.
In strain RU152-22, the promoter and amino-terminus of dctB are deleted,
and so no protein would be made. Therefore DctA would be free to transport
aspartate at the maximum possible rate. It is significant that the level of
repression of the AAP observed in strain RU152-22 is not as great as in strain
3841. This could be due to the level of DctA produced in strain RU152-22
being less than in strain 3841 resulting in an aspartate transport rate intermediate
between strains RU150 and 3841.
These results unequivocally demonstrate that the aspartate repression effect
is different from the inability of strain RU150 to grow on succinate/ammonia.
This latter effect is mediated by DctB/D cross regulating other operons, while
the aspartate repression effect is a direct function of DctA’s ability to transport
aspartate. In strain 3841, this is only dependent on DctB/D because they are
required for transcription of dctA.
330
7.3.5 Role of DctA in mediating repression of aspartate
transport via the AAP in strain RU150.
It is evident from analysis of the two second site suppressors, strains
RU152-1 and RU152-14, that their duplication of dctA, causes the repression of
aspartate uptake via the AAP. In addition, when dctA is over expressed at a
high level, either under the control of DctB/D or constitutively, both strains
RU150 and 3841 are severely impaired for growth on glucose/aspartate.
In strains RU152-1 and RU152-14 the extra DctA being transcribed in
comparison to strain RU150 is thought to lead to an increased production of
DctA. This DctA as is it produced constitutively and indepenent of DctB/D is
not subject to any control. Therefore it is postulated that this extra DctA leads
to an increased level of aspartate accumulation which generates a nitrogen excess
signal causing repression of AAP transport (Fig. 7.22).
331
Fig. 7.22 Diagram of duplication of dctA in strains RU152-1 and
RU152-14 causing aspartate dependent repression.
When dctA is over-expressed in a DctB/D dependent fashion in strains
3841, RU150 or a dctA strain (strain RU727), aspartate is toxic to the cell when
glucose is provided as the carbon source. This is probably an extension of the
aspartate repression effect on the AAP. When dctA is transcribed at high levels,
the extra DctA should lead to an increase in aspartate transport. This is thought
332
to not only repress (possibly more severely) transport of amino acids by the
AAP and transcription from the glnIIp, but would interfere with the function of
the TCA cycle (Walshaw, 1994 personal comm.). Alternatively, the
unregulated accumulation of aspartate via DctA could result in a concentration of
aspartate which is intrinsically toxic to the cell.
The inclusion of 2-Methyl succinate with glucose/aspartate allowed these
strains to grow normally. As 2-Methyl succinate cannot support growth
(Chapter Three), this is analogous to its role in allowing derepression of
aspartate uptake via the AAP and glnII transcription in the wildtype when grown
on glucose/aspartate (Chapter Five). 2-Methyl succinate has a higher affinity
than aspartate for transport by DctA Walshaw, personal comm. and therefore
would out-compete it for transport via DctA. This would lower the rate of
aspartate transport via DctA.
Strains expressing dctA constitutively at a high level also show an aspartate
toxicity effect when grown on glucose/aspartate. The level of dctA transcription
in these strains should be higher than those expressing dctA in a DctB/D
dependent fashion and indeed the former are affected in their ability to grow on
succinate. Moreover, in strains expressing dctA at a high level in a DctB/D
dependent fashion, a maximum level of dctA transcription might be imposed due
to the level of DctD~Pi available. In strains expressing dctA independent of
DctB/D, this regulatory control would be absent. The poor growth on succinate
is probably due to the un-regulated dctA transcription leading to unregulated
succinate transport.
When grown on glucose/aspartate, revertants were evident in all the
strains expressing dctA at a high level either in a DctB/D dependent fashion or
constitutively. This is probably due to mutations in dctA or its promoter
occurring, leading to a reduction in the level aspartate transport.
333
7.3.6 Conclusion
Extrapolation of the results from the analysis of strain RU150 to the
wildtype have allowed the role of DctA in controlling DctB, as described in
Chapter Three, to be further elucidated. This indicates that DctA plays a direct
role in controlling DctB possibly by determining DctB’s ability to act as a
kinase/phosphatase on DctD. This is thought to occur by an interaction of DctA
with the amino-terminus of DctB and this association is considered to be a
function of the level of DctA in circulation. It is postulated that as the level of
DctA increases, mediated by a suitable inducer and DctB/D, that it interacts
with DctB at a greater frequency causing it to reduce the amount of DctD~Pi.
This in turn leads to a reduction in dctA transcription. Thus this constitutes a
feedback loop whereby DctA controls its own synthesis. This model is
integrated with the results in the preceding Chapters in Chapter Eight.
335
Chapter Eight
Conclusion
8.1 Regulation of the DCT system.
The results presented in this thesis allow a model to be proposed of how
transcription from the dctAp is regulated. As shown in Chapter Three,
induction of transcription from the dctAp in reposnse to C4-dicarboxyic acids
and asparate can occur in the absence of DctA, strongly suggesting that DctB is
the sensor and that DctA is not essential for propper induction. Moreover, this
sensing of C4-dicarboxylates via DctB is thought occur external to the cell.
These results suggest that DctB plays anactive role (via DctD) in
promoting transcription from the dctAp; it is only activated and capable of
phosphoryulating DctD in the presence of suitable inducers. This differs from
previously proposed models 2173,275,1876 where the role of DctB was
considered to be passive and due to the state of DctA. When dctA was mutated,
DctB was thought to be automatically activated in the absence of DctA 275.
The results presented in this report clearly indicate that the primary level of
control of transcription from ther dctAp is mediated by DctB alone responding to
the presence of C4-dicarboxylates or aspartate and causing tthe activation of
DctD resulting in dctA transcription.
Evidence also suggests that a second control mechanism operates in which
DctA plays arole in regulating its own synthesis. This is thought to invole DctA
interacting with DctB and controlling DctB’s ability to
phosphorylate/dephosphorylate DctD.
As shown in Chapter Three, DctA and DctB are considered to associate in
the inner membraneas as the presence of DctA restricts the spectrum of
molecules to which DctB responds to causing induction of transcription from
336
ther dctAp. In Chapters Six and Seven, evidence suggests that , DctA not only
interacts with DctB but can also modulate the production of DctD|Pi via DctB.
Strain RU150 which produces DctA constitutively at a low level , while DctB/D
still function normally, is unable to grow on succinate/ammonia. This is
thought to be due to DctB/D cross regulating operons involved in ammonia
assimilation/metabolism. However when the level of DctA is increasedor dctB
or dctD are mutated, this proposed cross-regulation is alleviated . This suggests
that, increasing the level of DctA relative to DctB, modulates this DctB/D
mediated cross-regulation. Strain RU150 is also derepressed for amino acid
transport via the AAP and transcription of glnII when grown on
glucose/aspartate. As indicated in Chapter Five, this is thought to be due to
DctA transporting asparatte leading to its accumulation and subsequent
repression of the AAP and glnII transcription. when the level of DctA is
increased in strain RU150,, amino acid transport via the AAP is repressed again ,
suggestig that the level of DctA is important. When DctB is completely deleted
a repressed level is observed. This proposed interaction of DctA with DctB is
thought to occur via the amino-terminus of DctB. This is evident as strains
mutated in DctB but still retaing this amino-terminus are unable to repress the
AAP or transcription of glnII when grown on glucose/aspartate while a strain
lacking all of DctB is. This is thought to be due to DctA being completely free
from DctB in the strain lacking it while in strains making a truncated DctB, this
is still able to interact with and control DctA.This proposed ability of DctA to
interact with DctB and modulate its ability yo control the phoisphorylation of
DctD is considered to function as a feed back loop controlling the transcription
of dctA. Upon addition of C4-dicarboxylates or aspartate to the wildtype, DctB
is activated and phosphorylates DctD. DctD|Pi promotes transcription from the
dctAp causing the level of DctA to increase. According as the level of DctA
increases, it is proposed that it interacts with DctB at a greater frequency. This
337
is thought to control the ability of DctB to phosphorylate/de-phosphorylate
DctD, which results in a reduction in transcription of dctA and hence DctA.
The precise mechanism by which DctA and DctB interact resulting in a
modulation of dctA transcription via DctA is unknown. One possibility is that
when DctA is associated with DctB in the absence of substrate, that this leads to
a reduction DctD|Pi. This would be expected to occur when the level DctA
increases rapidly and the substrate would be limiting. This would result in DctA
associated with DctB in the absence of C4-dicarboxylic acids. It is possible that
under these circumstances, DctA can reduce DctBs ability to produce DctD|Pi
and hence DctA. Another possibility is that over production of DctD|Pi could
result in a negative feedback loop. It has been suggested that s54 dependent
transcriptional activators have an optimal transcriptional activity when present in
a 50:50 ratio of the phosphorylated and unphosphorylated form; one of each
type binding to the UASs 5172. When this ratio is altered it is possible that
continued phosphorylation of the transcriptional activator would lead to both
sites being occupied by it leading to transcriptional down regulation. It is
possible that DctD could function in a similar fashion. When DctA is actively
transporting C4-dicarboxylates this could allow DctB to phosphorylate DctD.
Continued trasnport via dctA could lead to DctB continually phosphorylating
DctD leading to poccupation of both of the UASs by DctD|Pi leading to down
regulation.
8.2 Cross-regulation of transcription from the dctAp.
Results presented in Chapter Four indicate that the dctAp is subject to
cross-regulation under conditions of nitrogen limitation and osmotic stress.
Expression from the dctAp was evident in cells grown under nitrogen
limiting conditions. This cross talk is dependent on DctD and possibly on DctB
phosphorylating DctD and in addition, the presence of a functional NtrC is
338
necessary. It is therefore considered likely that DctD or a small relative amount
of DctD|Pi (or a combination of both) in conjunction with NtrC|Pi cause
transcription from the dctAp under nitrogen limiting conditions. Under these
conditions NtrC is envisaged as actually replacing the role of DctD|Pi in
initiating transcription.
Osmotic stress is also capable of causing transcription from the dctAp but
differs from nitrogen limitation in that while it still reqiures DctB/D only occurs
in a strain lacking DctA. A variety of reasons can be suggested to account for
this including DctB responding to an osmotic signal in the absence of DctA,
cross regulation by another two component sensor-regulator system directly to
DctD or the dctAp being sensitive to DNA supercoiling induced by osmotic
stress. However all of these possibilities must accomodate a role for DctA in
preventing this cross talk.