239

Tissue Engineering and Regenerative Medicine, Vol. 11, No. 3, pp 239-246 (2014)

DOI 10.1007/s13770-014-0015-x

｜Original Article｜

The Responses of Human Adipose-derived Mesenchymal Stem Cells

on Polycaprolactone-based Scaffolds: an In Vitro Study

Thanaphum Osathanon1, 2,†,*, Boontharika Chuenjitkuntaworn3, Nunthawan Nowwarote2, Pitt Supaphol4,

Panunn Sastravaha5, Keskunya Subbalekha

5, and Prasit Pavasant

1,2

1Department of Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330 THAILAND

2Mineralized Tissue Research Unit, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330 THAILAND

3Department of Oral Biology, Faculty of Dentistry, Naresuan University, Phitsanulok 65000 THAILAND4The Petroleum and Petrochemical College, Chulalongkorn University, Bangkok, 10330 THAILAND

5Department of Oral and Maxillofacial Surgery, Faculty of Dentistry, Chulalongkorn University, Bangkok, 10330 THAILAND

(Received: March 18th, 2014; Revision: April 23th, 2014; Accepted: May 12th, 2014)

Abstract : Polycaprolactone (PCL) has been investigated as an alternative synthetic polymeric scaffold for tissue

engineering application. In this study, the biological responses of human adipose-derived mesenchymal stem cells

(hADSCs) on PCL-based scaffolds were investigated in vitro. The hADSCs were isolated and characterized. Solvent

casting and particulate leaching method was employed as the fabrication method for PCL-based scaffolds. Here, we

illustrated that the isolated hADSCs exhibited fibroblast-like morphology, formed colonies in culture, and expressed

several stem cell markers. Moreover, the differentiation potency toward adipogenic, neurogenic and osteogenic lin-

eage was noted when cultured in the specific conditions. Polycaprolactone/hydroxyapatite composite scaffold (PCL/

HA) supported hADSCs attachment better than PCL scaffolds. Moreover, the alkaline phosphatase enzymatic activ-

ity and mineral deposition were greater on PCL/HA than PCL. Together, this present study illustrates the potential

utilization of PCL/HA and hADSC for bone tissue engineering.

Key words: Polycaprolactone, Hydroxyapatite, Mesenchymal stem cells, Adipose tissues

1. Introduction

Adult stem cells are able to be isolated from various kinds of

tissues, including bone marrow, dental-related tissues, and

adipose tissues.1,2 These isolated cells contain the mesenchymal

stem cells characteristics. Among these, bone marrow-derived

mesenchymal stem cells (BMSCs) have been profoundly

investigated and have significant potential application in

clinical treatment. Currently, BMSCs have been investigated

for many applications such as myocardial infarction, neuronal

disease, stroke and bone regeneration.3 The numerous clinical

trials using BMSCs in bone tissue engineering have been

reported 4,5 and showed the excellent potential of BMSCs for

bone defect repair. However, the disadvantages of BMSCs,

which are invasive harvesting technique and low number of

stem cell obtained from tissue samples, are limited their clinical

uses.6 Adipose-derived mesenchymal stem cells (ADSCs) have

been introduced as a possible stem cell source. The major

advantages of ADSCs are easy access of tissue sources, less

invasive to obtain samples, and give comparable amount of

mesenchymal stem cells to bone marrow.6 It has been shown

that these cells are able to differentiate into several specific cell

lineages such as osteogenic, chrondrogenic, adipogenic,

cardiomyogenic, neurogenic and endothelial lineages.7-11

Synthetic polymer has been employed as a candidate material

for tissue engineering application due to the controllable

fabricating and physical properties. Polycaprolactone (PCL) is

one of synthetic polymer used for bone tissue engineering.12 PCL

can be degraded by hydrolysis of ester bond in physiological

condition.13 Moreover, United State Food and Drug Administra-

tion (US-FDA) approved several medical applications of PCL,

such as suture materials14 and subdermal contraceptive implants.15

We previously reported the production and characterization of

PCL-based scaffolds for bone tissue engineering application.16

Upon cultured primary human bone cells on polycarprolactone/

hydroxyapatite composite scaffolds (PCL/HA), cells were

*Corresponding author

Tel: +66-2-218-8872

e-mail: thanaphum.o@chula.ac.th (Thanaphum Osathanon)

Thanaphum Osathanon et al.

240

increase type I collagen (COL I) and osteocalcin (OCN) mRNA

expressions. Moreover, the significant increase of mineral

deposition was noted. Furthermore, PCL/HA promoted bone

regeneration in rat calvarial defect model, suggesting that PCL/

HA could be a candidate material for bone defect repair.16

To enhance bone formation, the combination of mesenchymal

stem cells and three-dimensional scaffolds has been introduced

and shown to promote bone regeneration in critical size

defects.17-20 Therefore, the present study aimed to investigate

biological response of human ADSCs (hADSCs) on PCL-based

scaffolds in vitro.

2. Materials and methods

2.1 Fabrication of PCL-based Scaffolds

The scaffold fabrication was performed using protocol

previously reported.16 Briefly, PCL (Aldrich, USA; Mw =

80,000 g/mol) was dissolved in chloroform and mixed with

sucrose (Fluka Chemika, Switzerland), particle size 400-500 µm.

The porogens were dissolved in distilled water. Subsequently, the

scaffolds were saturated in 1 M sodium hydroxide (NaOH; Ajax

Finechem, Australia) solution and rinsed with distilled water. The

scaffolds were then immersed in ethanol (70% v/v) for 30 min

and subsequently rinsed with sterilized de-ionized water. For

PCL/HA, hydroxyapatite powder (HA), size 234 ± 68 nm was

mixed with PCL solution and processed through the procedures

described above.

2.2 Cell Isolation and Characterization

The human cell isolation protocol was approved by the Human

Ethical Committee, Faculty of Dentistry, Chulalongkorn

University. Inform consent was obtained. Briefly, the adipose

tissues, acquiring from resecting subcutaneous tissue during

craniofacial reconstructive surgery, were gently rinsed with

sterile phosphate buffer saline (PBS), minced into small pieces

and digested with collagenase (Sigma, USA). Harvested cells

were cultured in Dulbecco’s modified Eagle’s medium (DMEM;

Gibco, USA), containing 10% fetal bovine serum (FBS; Gibco,

USA), 2 mM L-glutamine, 100 units/mL penicillin, 100 µg/mL

streptomycin and 5 µg/mL amphotericin B (Gibco, USA) at

37oC in a humidified atmosphere of 5% CO2.

2.3 Doubling Time

Cells were seeded into six-well plates at density 12,500 cells/

well and further maintained for 96 h. Cells were then

trypsinized, and counted using a hemocytometer (Bright-

LineTM Hemacytometer; Sigma, USA). Doubling time was

calculated using the equation formerly reported.21

2.4 Colony Forming Unit Assay

Single cell suspension (500 cells) were plated into 35-mm-

diameter culture dishes and maintained in growth medium. At

day 14, the cells were fixed in 10% buffered formalin for 10 min,

washed twice with PBS and stained with coomassie blue. The

colonies were counted under phase contrast microscope.

2.5 Adipogenic Differentiation

Cells (25,000 cells) were seeded in 24-well-plate and cultured in

adipogenic medium [growth medium containing insulin (0.1 mg/

mL), dexamethasone (1 µM), 3-isobutyl-1-methylxanthine

(1 mM), and indomethacin (0.2 mM)] for 14 days.22 Subsequently,

cells were fixed in 10% buffered formalin, rinsed twice with PBS

and stained with 0.2 % Oil Red O in propanol for 5 min. The

intracellular lipid droplets were evaluated using invert phase

contrast microscope.

2.6 Neurogenic Differentiation

Single cell suspension (500,000 cells) were seeded in 60-mm-

petri dishes and maintained in neurobasal medium supplemented

with B27 (2%), b-FGF (20 ng/mL), EGF (20 ng/mL), L-

glutamine (2 mM), penicillin (100 units/mL), streptomycin

(100 µg/mL) and amphotericin B (5 µg/mL) (Gibco, USA) for 7

days.23 Neurosphere formation was observed under phase

contrast microscope at day 7.

2.7 Osteogenic Differentiation

Cells were seeded at a density of 25,000 cells/well on 24-well-

plate. To induce osteogenic differentiation, cells were cultured in

an osteogenic medium (growth medium supplemented with

ascorbic acid (50 µg/mL), dexamethasone (100 nM) and sodium

phosphate (2 mM) or beta-glyceraphosphate (10 mM)).22

2.8 Polymerase Chain Reaction (PCR)

RNA was extracted with Trizol reagent (Roche Diagnostics,

USA) according to the manufacturer’s instructions. RNA sample

(1 µg) was converted to cDNA by reverse transcriptase enzyme

(Promega, USA). The primer sequences were in Table 1. For

semi-quantitative PCR, the reactions were performed using Taq

polymerase in the thermocycling machine. The products were run

in 1.8% agarose gel and stained with ethidium bromide. For a

quantitative PCR, the reactions were performed using FastStart®

Essential DNA Green Master® (Roche Diagnostics, USA) in Real-

time PCR detection system (Biorad, USA).

2.9 Cell Attachment Assay

MTT assay was employed to evaluate the viable cell attaching

on the scaffolds. In brief, cells were seeded onto the scaffolds at

Response of hADSC on PCL scaffolds in vitro

241

a density of 50,000 cells/scaffolds. At designated time point, the

cell-seeded scaffolds were incubated with MTT solution for 30

min at 37oC and the formation of formazan crystal was evaluated

by dissolving in dimethylsulfoxide (DMSO, Sigma, USA). The

optical density was evaluated at 570 nm.

For morphology observation, the samples were fixed with

2.5% glutaraldehyde (Sigma, USA) for 30 min. All specimens

were subsequently dehydrated in ethanol, processed for critical

point drying (CPD 7501, FISONS Instrument, UK) and sputter-

coated with Au. Scaffolds and cellular morphology was examined

using a scanning electron microscope (JSM 5401LV, JEOL,

Japan).

2.10 Alkaline Phosphatase Activity Assay

Cells seeded scaffolds were rinsed twice with PBS and lysed

in alkaline lysis buffer. The supernatant solution was incubated at

37oC in solution containing 2 mg/mL p-nitrophenol phosphate,

0.1 M aminopropanol and 2 mM MgCl2. To stop reaction,

NaOH solution (50 mM) was added to the mixture. The

absorbance at 410 nm was measured. The BCA assay (Pierce

Biotechnology, USA) was employed to determine the total cellular

protein. The ALP enzyme activity was further normalized to total

cellular protein.

2.11 Mineralization Assay

The cells were seeded at density 50,000 cells/scaffolds and

incubated in osteogenic medium described above. At 14 and 21

days, cold methanol was utilized for cell fixation for 10 min. The

cell-seeded scaffolds was subsequently washed with deionized

water and immersed in 1% Alizarin Red S solution (Sigma,

USA) for 3 min with gently agitation. The quantification was

performed by comparing the destaining solution absorbance at

570 nm (10% cetylpyridinium chloride monohydrate (Sigma,

USA) in 10 mM sodium phosphate). The absorbance was further

subtracted from those of scaffolds without cells.

2.12 Statistical Analyses

The results were illustrated as mean ± standard deviation.

Statistical significance was analyzed using independent t-test for

two groups comparison and a one-way analysis of variance

(ANOVA), followed by Tukey HSD test for multiple group

comparison. Differences at p < 0.05 were considered to be

statistically significant.

3. Results

3.1 Characterization of hADSCs

hADSCs exhibited spindle shape, fibroblast-like morphology

(Fig 1a). Doubling time (at passage 4) and numbers of colonies

(at passage 4 and 10) were shown in Table 2. Numbers of

colonies were counted at day 14. However, the colony formation

of hADSCs was noted as early as day 7 in culture. At passage 10,

Table 1. Primer sequences.

Gene Forward sequence Reverse sequence

OCT4 5’ AGACCCAGCAGCCTCAAAATC 3’ 5’ GCAACCTGGAGAATTTGTTCCT 3’

NANOG 5’ GGAAGAGTAGAGGCTGGGGT 3’ 5’ TCTCTCCTCTTCCTTCTCCA 3’

REX-1 5’ AGAATTCGCTTGAGTATTCTGA 3’ 5’ GGCTTTCAGGTTATTTGACTGA 3’

NESTIN 5’ CTGCGGGCTACTGAAAAGTT 3’ 5’ AGGCTGAGGGACATCTTGAG 3’

CD44 5’ GCAAGTTTTGGTGGCACGCA 3’ 5’ CAATCTTCTTCAGGTGGAGC 3’

CD73 5’ ACACTTGGCCAGTAAAATAGGG 3’ 5’ ATTGCAAAGTGGTTCAAAGTCA 3’

CD105 5’ CATCACCTTTGGTGCCTTCC 3’ 5’ CTATGCCATGCTGCTGGTGGA 3’

SOX9 5’ GAACGCACATCAAGACGGAG 3’ 5’ TCTCGTTGATTTCGGTGCTC 3’

NMD 5’ CACTGATAACTCGCCGTCCT 3’ 5’ CTCTTCAGCTTGGCTGCTCT 3’

GAPDH 5’ TGAAGGTCGGAGTCAACGGAT 3’ 5’ TCACACCCATGACGAACATGG 3’

For quantitative PCR

ALP 5’ CGAGATACAAGCACTCCCACTTC 3’ 5’ CTGTTCAGCTCGTACTGCATGTC 3’

OCN 5’ CTTTGTGTCCAAGCAGGAGG 3' 5' CTGAAAGCCGATGTGGTCAG 3'

OSX 5' GCCAGAAGCTGTGAAACCTC 3' 5' GCTGCAAGCTCTCCATAACC 3’

CBFA1 5’ ATGATGACACTGCCACCTCTGA 3’ 5' GGCTGGATAGTGCATTCGGTG 3'

COL1 5’ GTGCTAAAGGTGCCAATGGT 3’ 5’ ACCAGGTTCACCGCTGTTAC 3’

BMP2 5’ GCGTGAAAAGAGAGACTGC 3’ 5’ CCATTGAAAGAGCGTCCAC 3’

GAPDH 5’ TGAAGGTCGGAGTCAACGGAT 3’ 5’ TCACACCCATGACGAACATGG 3’

Thanaphum Osathanon et al.

242

hADSCs still exhibited high colony number and no statistical

difference was observed, compared to those of cells at passage 4.

STRO-1 positive cells were observed in isolated hADSCs

population (Fig 1b). The mRNA expressions of stem cells

markers were shown compared to human dental pulp stem cells

(DPSC) and human periodontal ligament stem cells (PDLSC)

(Fig 1c).23,24 The hADSCs expressed pluripotent stem cell

markers; OCT4, NANOG, and REX-1. The expression of neural

crest cell marker, NESTIN, was significantly lower compared to

those of DPSC and PDLSC. Moreover, hADSCs also expressed

CD44, CD73 and CD 105.

Upon cultured hADSCs in adipogenic medium for 14 days,

the intracellular lipid accumulation was markedly increased

compared to those cultured in normal growth medium (Fig 2a-

b). For osteoblast differentiation, the significant upregulation of

ALP activity was noted in those hADSCs cultured in osteogenic

medium at day 7 (Fig 2c). Moreover, the mineral deposition

was significantly enhanced in those cells cultured in osteogenic

medium for 14 days as evaluated by Alizarin Red S staining

(Fig 2d). Further, the potential neurogenic differentiation was

evaluated using neurosphere formation assay. The neurosphere

formation was found in cultured when hADSCs were cultured

in neurogenic medium (Fig 2e and f). The neurospheres were

increase in size and cellular density at 7 days compared to 1 day.

Moreover, these neurospheres were expressed higher SOX9 and

neuromodulin (NMD), neurogenic markers, mRNA levels

when compared to the control (Fig 2g).

Figure 1. Characterization of human adipose derived mesenchymal

stem cells (hADSCs). Morphological observation of hADSCs using

phase contrast microscope (a) and immunocytochemistry illustrating

STRO-1 positive cells (b) were illustrated. Expression of embryonic,

neural crest and mesenchymal stem cell markers was determined

using reverse transcriptase polymerase chain reaction (c); DPSC:

human dental pulp stem cells, PDL: human periodontal ligament

stem cells, hADSC: human adipose-derived mesenchymal stem

cells.

Table 2. Doubling time and colony forming unit of human adi-

pose-derived mesenchymal stem cells.

DonorDoubling times

(hours)

Colony forming unit (Colony count)

Passage 4 Passage 10

1 48.00 ± 5.76 99.25 ± 12.14 105.00 ± 17.03

2 53.50 ± 8.81 64.00 ± 6.37 64.00 ± 3.00

3 38.00 ± 2.02 107.75 ± 10.21 79.00 ± 20.22

Figure 2. Multipotential differentiation of human adipose derived

mesenchymal stem cells (hADSCs). Adipogenic differentiation

of human adipose-derived mesenchymal stem cells (hADSCs) in

vitro. The intracellular lipid accumulation was evaluated in hAD-

SCs cultured in growth medium (a) and adipogenic medium

(AM) (b) for 14 days. For osteogenic differentiation of hADSCs

in vitro, the alkaline phosphatase enzymatic activity of hADSCs

cutured in osteogenic medium (OM) for 7 days was analyzed (c).

The alizarin red staining of hADSCs cultured in growth medium

and osteogenic medium for 14 days was shown and the absor-

bance measurement of alizarin red accumulation was measured

(d). For neurogenic differentiation, Neurosphere formation of

hADSCs cultured in neurogenic medium for 1 days (e) and 7

days (f) were evaluated using phase contrast microscope. The

mRNA expression of neurogenic differentiation markers (SOX9

and NMD) was measured using reverse transcriptase polmerase

chain reaction (g). The asterisk indicated the statistical significant

difference at p<0.05.

Response of hADSC on PCL scaffolds in vitro

243

3.2 In Vitro Evaluation of hADSCs on PCL-Based

Scaffolds

PCL and PCL/HA scaffolds exhibited highly porous and

interconnected structure (Fig 3a). The hADSCs were able to

attach on scaffolds as evaluated by MTT assay. Higher number

of hADSCs was attached on PCL/HA compared to PCL at 1 and

3 h (Fig 3b). From SEM observation, hADSCs attached as early

as 1h after seeding. Filopodia and lamellopodia were noted at 1

and 3 h (Fig 3c). At 1 d, cells were flattened and able to spread on

both types of the scaffolds. Monolayer was observed at 7 d after

seeding. Multilayer formation of hADSCs was observed in both

PCL and PCL/HA at 14 and 21 d. Together, these data implied

that both PCL and PCL/HA supported cell attachment and

growth in vitro, however, PCL/HA showed superior property

regarding supporting cell attachment.

To determine supportive property of PCL-based scaffolds for

Figure 3. Human adipose-derived mesenchymal stem cell (hADSCs) attachment and spreading on PCL-based scaffolds. SEM micro-

graphs represented the architecture of PCL and PCL/HA (a). The hADSCs attachment of PCL and PCL/HA at 1 and 3 h using MTT

assay was illustrated (b). The representative pictures for hADSC morphology on PCL and PCL/HA scaffolds at 1 and 3 h as well as 1, 7,

14 and 21 days were shown (c). The bars indicated the statistical significant difference at p<0.05.

Figure 4. Osteogenic differentiation of human adipose-derived mesenchymal stem cells (hADSCs) on PCL-based scaffolds in vitro. The

graphs represented the osteogenic mRNA expression (a), alkaline phosphatase enzymatic activity (b), and mineral deposition (c). The

mRNA expression was determined using quantitative polymerase chain reaction at day 7 (a). The alkaline phosphatase enzymatic activ-

ity and mineral deposition of hADSCs cultured on PCL-based scaffolds in normal growth medium and osteogenic medium were shown

(b and c, respectively). The asterisk and bars indicated the statistical significant difference compared to the control (p<0.05).

Thanaphum Osathanon et al.

244

hADSCs’ osteogenic differentiation, the mRNA expression of

osteogenic marker genes was evaluated using quantitative PCR

after seeding cells on the scaffolds and maintained in osteogenic

medium for 7 days (Fig 4a). The mRNA expression was slightly

higher in those cells seeded on PCL/HA. However, the statistical

significance was noted only for the OSX mRNA expression. In

addition, ALP activity was evaluated at 7, 14 and 21 days after

cultured hADSCs in osteogenic medium (Fig 4b). A trend of

ALP activity was increased at 14 days and, subsequently,

decreased at 21 days on both types of scaffolds. The significant

increase of ALP activity was observed in hADSCs seeded on

PCL/HA groups at 14 days compared to 7 days. Furthermore, the

increase of calcium deposition on cells seeded scaffolds was noted

(Fig 4c). For both PCL and PCL/HA, the calcium deposition at 21

days was slightly higher compared to 14 days. In addition, the

significant higher mineral deposition was noted on PCL/HA

compared to those of PCL alone at 14 days.

4. Discussion

In this study, we described the isolation and characterization

of hADSCs as well as the application of these cells with PCL-

based scaffolds for bone tissue engineering. Isolated adipose

tissue-derived cells were able to form colonies and differentiate

into several cell lineages. The hADSCs were also able to attach

and differentiate into osteoblast on PCL-based scaffolds. These

observations might support the potential strategy for hADSCs

and biocompatible scaffolds to promote bone repair and

regeneration.

Cells isolated from adipose tissues expressed several

embryonic stem cell marker genes such as OCT4, NANOG and

SOX2.25 However, it was noted that these pluripotent marker

gene expressions were much lower compared to those of

embryonic stem cells.26 The adipose derived cells were also

able to differentiate into osteoblast, chondroblast and

adipocyte.25,27 It has also been reported that a combination of

adipose derived cells and scaffolds enhanced bone regeneration

in calvarial defect models.17,28 Moreover, injection of these

cells into myocardial infarction sites was able to improve

cardiac function in rats.29 Interestingly, it has been shown that

STRO-1 positive subpopulation of ADSC exhibited high

osteogenic potential.30 Further, the previous study demonstrated

that the isolated ADSC may or may not express STRO-1 in

culture.31 Although, we did not quantitate the amount of STRO-

1 positive cells in our isolated cell population, the STRO-1

expression was noted in culture. Together, these results suggest

that the adipose tissues contain stem cells population and could

be used as an alternative source of stem cells in regenerative

medicine. Correspondingly, we showed in the present study

that heterogeneous cells isolated from human adipose tissues

had stem cell-like properties regarding stem cell marker gene

expressions and their differentiation abilities. In addition, we

further characterized single cell clone isolated from

heterogeneous population of adipose derived cells and found

that fourteen single cells clones were expressed stem cell

marker gene and able to differentiate into osteogenic and

adipogenic lineage 22,confirming the present of stem cells in

isolated cell population from adipose tissues.

Many studies have been employed PCL as a scaffold’s

component in various tissue engineering applications such as

ophthalmic implants, ligament, bone, cartilage, vessel and

cardiac tissue engineering.32-39 PCL also has slower degradation

rate compared to other synthetic polymers, i.e. poly-lactide-co-

glycolide (PLGA) and polylactic acid (PLA), led to its

application in control drug delivery system.13 In addition, PCL

could be easily modified its surface to improve biological

properties. In this regard, immobilization of Arg-Gly-Asp-

containing proteins on PCL electrospun fibrous scaffolds showed

the improvement of cell attachment and proliferation.40,41

Previously, our group demonstrated that the incorporation of

hydroxyapatite particles in PCL scaffolds improved the

mechanical properties, enhanced osteoblast differentiation in

vitro as well as supported bone regeneration in vivo.16

Pore

dimension was range between 478 and 502 µm,16 which has

been reported as optimal pore size for bone regeneration. In the

present study, we further demonstrated that PCL/HA enhanced

the differentiation of hADSCs toward osteogenic lineage

compared to PCL alone as shown by the increasing trend of

ALP activity and mineral deposition. The mechanism of PCL/

HA promoting osteoblast differentiation is yet unclear.

However, there are several explanations. First, the dissolution

of calcium and phosphate ions released from hydroxyapatite

crystals could directly induce the differentiation of osteoblasts.42

Second, the incorporation of hydroxyapatite particle in PCL

scaffolds may alter the surface topography of scaffold’s wall,

which leads to the increase of the surface roughness. The change

in surface roughness might promote osteoblast differentia-

tion.43,44 Third, it has been shown that biphasic calcium

phosphate scaffolds coated with PCL/nHA enhanced early

osteogenic differentiation of ADSC via the integrin-α2 and

MAPK/ERK signaling pathway.45 Moreover, it has been shown

that mesenchymal stem cells on PCL/collagen I/HA scaffolds

exhibited higher focal adhesion kinase phosphorylation levels

compared to the control,46 confirming the role of integrin in the

PCL/HA induced osteogenic differentiation. Lastly, it has also

shown that the HA shape influences the osteogenic differentia-

Response of hADSC on PCL scaffolds in vitro

245

tion. The rod shape PCL/nHA film markedly promoted

osteogenic differentiation of human osteoblast cells compared

to the spherical shape PCL/nHA film.47 Cells on rod shape

PCL/nHA film upregulated BMP-2 expression and could

further stimulate osteogenic differentiation of other cells. 47

Together, there are several potential mechanism (s) that relates

to PCL/HA regulating osteogenic differentiation. Thus, further

studies should be performed to identify the mechanism of PCL/

HA promoting osteogenic differentiation, particularly in

hADSCs.

5. Conclusion

The hADSCs have been proposed as an alternative cell source

for bone defect repair. The PCL-based scaffolds, described in this

study, support ADSCs attachment, spreading and differentiation

toward osteogenic lineage in vitro. Further animal studies should

be performed to archive more beneficial evidences regarding

ADSCs and PCL-based scaffolds for bone tissue engineering.

Acknowledgements: This work was supported by the

Ratchadapiseksomphot Endowment Fund of Chulalongkorn

University (RES560530156-HR) and the Research Chair Grant

2012, the National Science and Technology Development

Agency (NSTDA), Thailand.

Conflict of interest: The authors declared no conflict of

interest.

References

1. GT Huang, S Gronthos, S Shi, Mesenchymal stem cells derived

from dental tissues vs. those from other sources: their biology

and role in regenerative medicine, J Dent Res, 88, 792 (2009).

2. H Mizuno, Adipose-derived stem cells for tissue repair and

regeneration: ten years of research and a literature review, J

Nippon Med Sch, 76, 56 (2009).

3. EM Horwitz, M Dominici, How do mesenchymal stromal cells

exert their therapeutic benefit?, Cytotherapy, 10, 771 (2008).

4. J Lee, HM Sung, JD Jang, et al., Successful reconstruction of

15-cm segmental defects by bone marrow stem cells and

resected autogenous bone graft in central hemangioma, J Oral

Maxillofac Surg, 68, 188 (2010).

5. M Tadokoro, R Kanai, T Taketani, et al., New bone formation

by allogeneic mesenchymal stem cell transplantation in a

patient with perinatal hypophosphatasia, J Pediatr, 154, 924

(2009).

6. M Locke, J Windsor, PR Dunbar, Human adipose-derived

stem cells: isolation, characterization and applications in

surgery, ANZ J Surg, 79, 235 (2009).

7. LJ Fischer, S McIlhenny, T Tulenko, et al., Endothelial

differentiation of adipose-derived stem cells: effects of

endothelial cell growth supplement and shear force, J Surg

Res, 152, 157 (2009).

8. LE Flynn, The use of decellularized adipose tissue to provide an

inductive microenvironment for the adipogenic differentiation of

human adipose-derived stem cells, Biomaterials, 31, 4715 (2010).

9. T Rada, RL Reis, ME Gomes, Distinct Stem Cells

Subpopulations Isolated from Human Adipose Tissue Exhibit

Different Chondrogenic and Osteogenic Differentiation

Potential, Stem Cell Rev, 7, 64(2011).

10. YS Choi, GJ Dusting, S Stubbs, et al., Differentiation of human

adipose-derived stem cells into beating cardiomyocytes, J Cell

Mol Med, 14, 878 (2010).

11. S Jang, HH Cho, YB Cho, et al., Functional neural

differentiation of human adipose tissue-derived stem cells using

bFGF and forskolin, BMC Cell Biol, 11, 25(2010).

12. LS Nair, CT Laurencin, Biodegradable polymers as biomaterials,

Progress in Polymer Science, 32, 762 (2007).

13. A Kumari, SK Yadav, SC Yadav, Biodegradable polymeric

nanoparticles based drug delivery systems, Colloids Surf B

Biointerfaces, 75, 1 (2010).

14. RS Bezwada, DD Jamiolkowski, IY Lee, et al., Monocryl

suture, a new ultra-pliable absorbable monofilament suture,

Biomaterials, 16, 1141(1995).

15. PD Darney, SE Monroe, CM Klaisle et al., Clinical evaluation

of the Capronor contraceptive implant: preliminary report, Am J

Obstet Gynecol, 160, 1292 (1989).

16. B Chuenjitkuntaworn, W Inrung, D Damrongsri, et al.,

Polycaprolactone/hydroxyapatite composite scaffolds: Preparation,

characterization, and in vitro and in vivo biological responses of

human primary bone cells, J Biomed Mater Res A, 94, 241 (2010).

17. E Yoon, S Dhar, DE Chun, et al., In vivo osteogenic potential of

human adipose-derived stem cells/poly lactide-co-glycolic acid

constructs for bone regeneration in a rat critical-sized calvarial

defect model, Tissue Eng, 13, 619(2007).

18. PJ Taub, J Yau, M Spangler, et al., Bioengineering of calvaria

with adult stem cells, Plast Reconstr Surg, 123, 1178 (2009).

19. BM Seo, W Sonoyama, T Yamaza, et al., SHED repair critical-

size calvarial defects in mice, Oral Dis, 14, 428(2008).

20. Z Zhao, Z Wang, C Ge, et al., Healing cranial defects with

AdRunx2-transduced marrow stromal cells, J Dent Res, 86,

1207 (2007).

21. W Singhatanadgit, N Donos, I Olsen, Isolation and

characterization of stem cell clones from adult human ligament,

Tissue Eng Part A, 15, 2625(2009).

22. T Osathanon, K Subbalekha, P Sastravaha, et al., Notch

signalling inhibits the adipogenic differentiation of single-cell-

derived mesenchymal stem cell clones isolated from human

adipose tissue, Cell Biol Int, 36, 1161 (2012).

23. T Osathanon, N Nowwarote, P Pavasant, Basic fibroblast

growth factor inhibits mineralization but induces neuronal

differentiation by human dental pulp stem cells through a FGFR

and PLCgamma signaling pathway, J Cell Biochem, 112, 1807

(2011).

24. T Osathanon, P Ritprajak, N Nowwarote, et al., Surface-bound

orientated Jagged-1 enhances osteogenic differentiation of

human periodontal ligament-derived mesenchymal stem cells, J

Biomed Mater Res A, 101, 358(2013).

Thanaphum Osathanon et al.

246

25. M Neupane, CC Chang, M Kiupel, et al., Isolation and

characterization of canine adipose-derived mesenchymal stem

cells, Tissue Eng Part A, 14, 1007 (2008).

26. JJ Mao, DJ Prockop, Stem cells in the face: tooth regeneration

and beyond, Cell Stem Cell, 11, 291 (2012).

27. C Csaki, U Matis, A Mobasheri, et al., Chondrogenesis,

osteogenesis and adipogenesis of canine mesenchymal stem

cells: a biochemical, morphological and ultrastructural study,

Histochem Cell Biol, 128, 507 (2007).

28. L Cui, B Liu, G Liu, et al., Repair of cranial bone defects with

adipose derived stem cells and coral scaffold in a canine model,

Biomaterials, 28, 5477 (2007).

29. L Wang, J Deng, W Tian, et al., Adipose-derived stem cells are

an effective cell candidate for treatment of heart failure: an MR

imaging study of rat hearts, Am J Physiol Heart Circ Physiol,

297, H1020 (2009).

30. T Rada, RL Reis, ME Gomes, Distinct stem cells subpopulations

isolated from human adipose tissue exhibit different

chondrogenic and oteogenic differentiation potential, Stem Cell

Rev, 7, 64 (2011).

31. CS Lin, ZC Xin, CH Deng, et al., Defining adipose tissue-

derived stem cells in tissue and in culture, Histol Histopathol,

25, 807 (2010).

32. WY Yeong, N Sudarmadji, HY Yu, et al., Porous polycaprolactone

scaffold for cardiac tissue engineering fabricated by selective laser

sintering, Acta Biomater, 6, 2028 (2010).

33. S Kashanian, F Harding, Y Irani, et al., Evaluation of

mesoporous silicon/polycaprolactone composites as ophthalmic

implants, Acta Biomater, 6, 3566 (2010).

34. HJ Shao, YT Lee, CS Chen, et al., Modulation of gene

expression and collagen production of anterior cruciate ligament

cells through cell shape changes on polycaprolactone/chitosan

blends, Biomaterials, 31, 4695 (2010).

35. PM Lopez-Perez, RM da Silva, RA Sousa, et al., Plasma-

induced polymerization as a tool for surface functionalization of

polymer scaffolds for bone tissue engineering: An in vitro study,

Acta Biomater, 6, 3704 (2010).

36. D Lahiri, F Rouzaud, T Richard, et al., Boron nitride nanotube

reinforced polylactide-polycaprolactone copolymer composite:

Mechanical properties and cytocompatibility with osteoblasts

and macrophages in vitro, Acta Biomater, 6, 3524 (2010).

37. CG Jeong, SJ Hollister, A comparison of the influence of

material on in vitro cartilage tissue engineering with PCL, PGS,

and POC 3D scaffold architecture seeded with chondrocytes,

Biomaterials, 31, 4304 (2010).

38. S Fuchs, X Jiang, I Gotman, et al., Influence of polymer content

in Ca-deficient hydroxyapatite-polycaprolactone nanocomposites

on the formation of microvessel-like structures, Acta Biomater, 6,

3169 (2010).

39. X Zhang, V Thomas, Y Xu, et al., An in vitro regenerated

functional human endothelium on a nanofibrous electrospun

scaffold, Biomaterials, 31, 4376 (2010).

40. W Mattanavee, O Suwantong, S Puthong, et al., Immobilization

of biomolecules on the surface of electrospun polycaprolactone

fibrous scaffolds for tissue engineering, ACS Appl Mater

Interfaces, 1, 1076 (2009).

41. FJ Xu, ZH Wang, WT Yang, Surface functionalization of

polycaprolactone films via surface-initiated atom transfer

radical polymerization for covalently coupling cell- adhesive

biomolecules, Biomaterials, 31, 3139(2010).

42. Y Usui, T Uematsu, T Uchihashi, et al., Inorganic

polyphosphate induces osteoblastic differentiation. J Dent Res,

89, 504 (2010).

43. S Balloni, EM Calvi, F Damiani, et al., Effects of titanium

surface roughness on mesenchymal stem cell commitment and

differentiation signaling, Int J Oral Maxillofac. Implants, 24,

627 (2009).

44. TS Silva, DC Machado, C Viezzer, et al., Effect of titanium

surface roughness on human bone marrow cell proliferation and

differentiation: an experimental study, Acta Cir Bras, 24, 200

(2009).

45. Z Lu, SI Roohani-Esfahni, G Wang, et al., Bone biomimetic

microenvironment induces osteogenic differentiation of adipose

tissue-derived mesenchymal stem cells, Nanomedicine, 8, 507

(2012).

46. MC Phipps, WC Clem, SA Catledge, et al., Mesenchymal stem

cell response to bone-mimetic electrospun matrices composed of

polycaprolactone, collagen I and nanoparticulate hydroxyapatite,

PLoS One, 6, e16813 (2011).

47. Z Lu, SI Roohani-Esfahni, PC Kwok, et al., Osteoblasts on rod

shaped hydroxyapatite nanoparticles incorporated PCL film

provide an optimal osteogenic niche for stem cell differentiation,

Tissue Eng Part A, 17, 1651 (2011).