The Role Of miRNAs In CD8 T Cell Differentation · In CD8+ T Cell Differentation ... A citocina com...

The Role Of miRNAs In CD8+ T Cell Differentation

Ana de Oliveira Rodrigues Amorim Mestrado em Biologia Celular e Molecular Departamento de Biologia 2013-2014 Orientador Bruno Silva-Santos, Ph.D, Professor Associado, FMUL

Todas as correções determinadas pelo júri, e só essas, foram efetuadas.

O Presidente do Júri, Porto, ______/______/_________

Dissertação de candidatura ao grau de Mestre em Biologia Celular e Molecular submetida à Faculdade de Ciências da Universidade do Porto. O presente trabalho foi desenvolvido sob a orientação científica do Professor Doutor Bruno Silva-Santos, no Institituto de Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa. Dissertation for applying to a Master’s Degree in Cell and Molecular Biology, submitted to the Faculty of Sciences of the University of Porto. The present work was developed under the scientific supervision of Professor Bruno Silva-Santos and was done at the Institute of Molecular Medicine, Faculty of Medicine, University of Lisbon.

!

FCUP The Role Of miRNAs In CD8+ T Cell Differentiation

III

!

Acknowledgements I couldn’t miss the chance to thank to everyone who contributed for another step in

my education and in my personal development.

First of all I would like to thank Professor Bruno Silva-Santos for the opportunity

given to me, for integrated me in his team and in this project. And especially for

always pushing me into giving my best and perfect myself, I have learned a lot.

I thank Anita Gomes for all her help, teaching and her caring!

To the person that contributed the most to my growth, not only scientifically, but

personal as well, Nina Schmolka. Since the first day you received me with a wide-

open smile! It was a joy to have you with me in the lab, I couldn’t have asked for

better! You made my stay in Lisbon and final year really especial; I thank you for all

the knowledge you passed on to me, for your support and for your friendship!

To Miguel, for your help with the FlowJo, for the coffee breaks, and our tours with

Joana at the weekends through the museums! You also contributed for a special

year in Lisbon.

Julie, for being available and helping me when I needed and Natacha, for helping me

to loose my fear with the 384 well plates and for all your advices!

I thank the rest of the Silva-Santos group, Ana Pamplona, Margarida, Sofia, Sergio,

Haakan, Joana, Tiago, Francisco and Daniel for the company at the diner time in the

hospital.

Many thanks to all the team of the flow cytometry facility, especially Ana Vieira; you

made flow cytometry easier for me!

I thank my best friend Maria, we survived, you helped me going for all this process

and you never rejected any of my long, long phone calls. Thank you for the boost of

confidence, wise words, and the nights in Lisbon.

To my parents and sister, without you this journey would not have been possible.

You supported me in all the possible ways, were always present for me, and always

rooted for me. You are the best parents and sister and I will always have you close to

my heart.

Finally to you, Diogo, you have been my best friend, my support. Always made me

go after what I wanted and helped me in the darkest hours. Even with the Atlantic

Ocean between us you were presented everyday, to support me and give me love.

You are an amazing person, and I am glad to have you in my life.

!


V

!

Resumo Os linfócitos T CD8+ desempenham um papel fundamental na defesa do hospedeiro

contra patogénios intracelulares e tumores. A citocina com maior relevância

produzida pelas células T CD8+ é o interferão-gama (IFN-γ), caracterizada por

possuir efeitos pleiotrópicos sobre uma vasta gama de células do sistema

imunológico e por ser essencial tanto na imunidade inata como na adaptativa. Em

2003 foi identificada a Eomesodermina, considerada como um factor de transcrição

principal, necessário e suficiente para regular a transcrição e a produção de IFN-γ

em células T CD8+.

Para além da regulação a nível transcricional, a diferenciação de sub-populações de

células T efetoras encontra-se também sujeita a mecanismos de regulação pós-

transcrição, mediados por microRNAs (miRNAs). Apesar desta função estar

claramente demonstrada para células T CD4+ helper, os miRNAs que controlam a

diferenciação de células CD8+ T produtoras de IFN-γ são ainda em grande parte

desconhecidos.

Os miRNAs são moléculas de RNA não-codificantes de pequenas dimensões, que

inibem pós-transcricionalmente a expressão genética através da diminuição da

estabilidade e/ou bloqueio da tradução de um dado mRNA, o que lhes permite

desempenhar um papel relevante na diferenciação e proliferação celular.

A análise de ratinhos deficientes para a produção de miRNAs especificamente em

linfócitos T (ratinhos LckCre Dicer), demonstrou que os miRNAs possuem um papel

global na diferenciação de células T CD8+ e na produção de IFN-γ. Verificou-se um

aumento da frequência de células T CD8+ produtoras de IFN-γ, tanto na periferia

(nódulos linfáticos e baço) como no timo, em ratinhos deficientes para a produção de

miRNAs quando comparados com ratinhos controlo.

Com o objectivo de identificar os miRNAs implicados na diferenciação das células T

CD8+, realizaram-se microarrays que permitiram a identificação de 22 miRNAs

diferencialmente expressos entre timócitos CD8+ YFP+ e CD8+YFP- de ratinhos

repórter para o IFN-γ (IFN-γ-YFP). Focamos a nossa análise sobre os 3 miRNAs

mais expressos nas células T CD8+ YFP+, miR-139, miR-200a, miR-451a, e os 3

miRNAs mais expressos em células T CD8+ YFP-γ-, miR-132, miR-181a e miR-322.

Curiosamente, a expressão destes miRNAs não se encontra restrita às células T

CD8+, sendo os mesmos também expressos noutras populações de células T,


VI

!sugerindo que possam ter funções pleiotrópicas nas células T. A sua expressão foi

influenciada pela ativação do receptor das células T e pela presença de citocinas. É

importante salientar que a expressão de dois dos nossos candidatos - miR-132 e

miR-451 - foi mais elevada em condições indutoras da produção de IFN-γ, sugerindo

que estes miRNAs poderão ser induzidos no decorrer da diferenciação de células T

CD8+ em células efetoras produtoras de IFN-γ. Por último, efetuaram-se ensaios

funcionais dos nossos candidatos com recurso a vectores retrovirais e verificou-se

para um miRNA em particular, o miR-132, uma redução significativa da produção de

IFN-γ em células T CD8+ que sobre-expressem este miRNA quando comparadas

com as células controlo. No seu conjunto,, estes dados sugerem que o miR-132 é

um possível regulador da expressão de IFN-γ em células T CD8+. Como tal e para

compreender os mecanismos moleculares pelos quais o miR-132 regula a produção

de IFN-γ nas células T CD8+, recorreu-se a ferramentas bioinformáticas e pesquisa

bibliográfica para encontrar possíveis mRNAs alvo. Foram encontrados vários

candidatos promissores envolvidos na regulação do IFN-γ, incluindo Stat4, TWIST1

e RUNX3. A expressão destes candidatos está atualmente a ser analisada em

estudos funcionais realizados em células T CD8+. Estes e outros candidatos serão

futuramente caracterizados em experiências que elucidarão as redes moleculares de

mRNAs controladas pelo miR-132 em células T CD8+ produtoras de IFN-γ. No seu

conjunto, Os resultados obtidos neste estudo abrem perspectivas de novos

mecanismos de regulação da diferenciação de células T CD8+ produtoras de IFN-γ.

A sua consolidação em estudos subsequentes dará uma contribuição essencial para

a compreensão de respostas imunes contra infecções e tumores mediadas por

células T CD8+.

Palavras-chave: Diferenciação de células T, células T CD8+, interferão-gama,

microRNAs, regulação pos-transcricional.


VII

!

Abstract CD8+ T lymphocytes play a crucial role in host defense against intracellular

pathogens and tumors. The key effector cytokine produced by CD8+ T cells is

Interferon-gamma (IFN-γ) which has pleiotropic effects on a wide range of immune

cells and is essential for both innate and adaptive immunity. In 2003 the “master”

regulatory transcription factor Eomesodermin (Eomes) was identified, which is

sufficient and necessary to drive IFN-γ production in CD8+ T cells.

Besides transcriptional regulation, also post-transcriptional mechanisms mediated by

microRNAs (miRNA) impact on the differentiation of effector T cell subsets, as clearly

demonstrated for CD4+ T helper cells. However, the miRNAs controlling the

differentiation of IFN-γ-producing CD8+ T cells are largely unknown.

miRNAs are small non-coding RNA molecules that regulate gene expression at the

post-transcriptional level, repressing gene expression by targeting mRNA stability

and/or blocking translation, which enables them to play key roles in cell differentiation

and proliferation. Our analysis of T cell-specific miRNA-deficient mice (LckCre Dicer -

/- mice) revealed a global role of the miRNA network in the differentiation of IFN-γ

producing CD8+ T cells. We observed an increase frequency of IFN-γ-producing

CD8+ T cells in both the thymus and periphery (lymph nodes and spleen) of Dicer-

deficient mice compared to control mice. To identify individual miRNAs implicated in

CD8+ T cell differentiation, we undertook a transcriptome-wide analysis of miRNA

expression in YFP+ versus YFP- CD8+ thymocytes from an Ifng-YFP reporter mouse.

We identified 22 miRNA differentially expressed between the two cell populations

and focused our analysis on the top 3 miRNAs up-regulated in CD8+ IFN-γ+ T cells,

i.e. miR-139, miR-200a, miR-451a, and the top 3 miRNAs up-regulated in CD8+ IFN-

γ- T cells, miR-132, miR-181a and miR-322.

Interestingly, our candidate miRNAs were expressed in T cell populations other than

CD8+ T cells, suggesting that they might have pleiotropic functions in T cells, and

their expression was influenced by T cell receptor and cytokine activation.

Importantly, the expression levels of two of our candidates – miR-132 and miR-451 -

were up-regulated in the presence of IFN-γ driving conditions suggesting that these

miRNAs are induced in the course of CD8+ T cell differentiation towards IFN-γ

producing effector cells. Finally, when employing a retroviral mediated over-

expression strategy to investigate the impact of the candidate miRNAs on IFN-γ

production by naïve CD8+ T cells, we detected a significant reduction of IFN-γ


VIII

!production in CD8+ T cells over-expressing miR-132 compared to control cells.

Collectively, our data suggest that miR-132 is a possible negative regulator of IFN-γ

expression in CD8+ T cells. To address the molecular mechanisms by which miR-132

regulates IFN-γ production by CD8+ T cells we have initiated a miR-132 target search

based on published evidence and bioinformatics analysis. Several promising mRNA

candidates involved in IFN-γ regulation, including Stat4, Twist1 and Runx3, are

currently being analyzed at the expression level in functional studies on CD8+ T cells.

These and other candidates will be further characterized in future experiments that

will elucidate the molecular mRNA networks controlled by miR-132 regulating the

differentiation of IFN-γ-producing CD8+ T cells. Ultimately the results will contribute to

a better understanding of CD8+ T cell differentiation into IFN-γ producing effector

cells that make key contributions to immune responses against infections and

tumors.

Key-words: T cell differentiation, CD8+ T cells, interferon-gamma, microRNAs, post-

transcriptional regulation.

!


XI

!

Table of Contents Resumo……………………………………………………………………………….. V Abstract …………………..……………………………………………………………VII List of Tables and Figures.…….....………………………………………………….XII List of Abbreviations.…...…………………………………………………………….XIII

1 Introduction .......................................................................................................... 15

1.1 CD8+ T Lymphocytes Major Players in Immunity .......................................... 15

1.1.1 Adaptive immune system ....................................................................... 15

1.2 CD8+ T cells .................................................................................................. 16

1.2.1 CD8+ T cell Effector Mechanisms .......................................................... 16

1.2.2 CD8+ T cell Response to Virus infection ................................................. 18

1.2.3 CD8+ T cell Response to Intracellular Bacteria ...................................... 19

1.2.4 CD8+ T cell Response against Tumours ................................................ 20

1.2.5 CD8+ T cells in autoimmunity ................................................................. 20

1.3 CD8+ T cell development and differentiation ................................................. 21

1.3.1 Thymus .................................................................................................. 21

1.3.2 Periphery ................................................................................................ 24

1.3.3 Memory CD8+ T cells ............................................................................. 26

1.4 microRNAs as Gene Regulators ................................................................... 27

1.5 MicroRNA Biogenesis ................................................................................... 28

1.5.1 miRNA Transcription .............................................................................. 28

1.5.2 miRNA Maturation .................................................................................. 29

1.5.3 RISC Assembly ...................................................................................... 29

1.6 MicroRNA Mechanisms of Action ................................................................. 31

1.6.1 Target regulation by miRNAs ................................................................. 31

1.6.2 miRNA-mediated regulation of T cell Differentiation .............................. 31

1.6.3 miRNA-mediated regulation of T cell effector function ........................... 33

2 Aims of this thesis .................................................................................................. 36

3 Material and Methods .......................................................................................... 38

3.1 Mice .............................................................................................................. 38

3.2 Cell preparations ........................................................................................... 38

3.2.1 Spleen, lymph nodes and thymus .......................................................... 38

3.2.2 Cell Sorting by Flow-Cytometry .............................................................. 38


XI

!3.3 In vitro cell stimulation and polarisation ........................................................ 39

3.4 Restimulation and FACS staining ................................................................. 40

3.5 Quantitaive RT-PCR ..................................................................................... 40

3.6 Retroviral transduction for miRNA overexpression ....................................... 41

3.7 Redirected cytotoxicity assay ........................................................................ 43

3.8 Statistical analysis ......................................................................................... 43

4 Results ................................................................................................................. 45

4.1 Increased differentiation of IFN-γ producing CD8+ T cells in pLck-Cre

DICERfl/fl mice ........................................................................................................ 45

4.2 YFP expression encompasses intracellular IFN-γ production in Yeti mice ... 46

4.3 YFP+ (IFN-γ+) CD8+ T cells display increased cytotoxicity ............................ 47

4.4 YFP+ versus YFP- CD8+ T cells from Ifng-YFP mice have different miRNA

repertoires .............................................................................................................. 49

4.5 RT-qPCR validation of miRNA expression in thymic YFP+ versus YFP- CD8+

T cells from Ifng-YFP mice ..................................................................................... 49

4.6 RT-qPCR analysis of peripheral YFP+ versus YFP- CD8+ T cells from Ifng-

YFP mice ............................................................................................................... 51

4.7 Candidate miRNAs expression in T cells subsets ........................................ 52

4.8 Candidate miRNAs expression under IFN-γ promoting conditions in vitro .... 53

4.9 Overexpression of candidate miRNAs in the 3T3 cell line ............................ 55

4.10 miRNA-132-3p over-expression down-regulates IFN-γ production in

peripheral CD8+ T cells .......................................................................................... 56

4.11 mRNA targets of miR-132 .......................................................................... 58

5 Discussion ............................................................................................................ 61

6 Bibliography ......................................................................................................... 69

!


XII

!

List of Tables and Figures Table 1 - Function of miRNAs in T cells. .................................................................... 34

Table 2 - Validated targets for the miR-132. .............................................................. 58

Table 3 - miR-132 bioinformatic predicted targets. .................................................... 58

Fig. 1 - Effector functions of CD8+ T cells. ................................................................ 18

Fig. 2 - Overview of T cell development in the thymus. ............................................ 23

Fig. 3 - Antigen-driven activation of naïve CD8 T cells. ............................................ 26

Fig. 4 - miRNA biogenesis. ....................................................................................... 30

Fig. 5 - Cell Sorting by Flow-cytometry strategy. ...................................................... 39

Fig. 6 - miRNA overexpression in CD8+ T cells. ....................................................... 42

Fig. 7 - DICER deficiency in T cells results in increased frequency of INF-γ producing

CD8+ T cells. ...................................................................................................... 47

Fig. 8 - eYFP expression associates with intracellular expression of IFN-γ in Yeti

mice, upon IFN-γ inducing conditions. ............................................................... 47

Fig. 9 - YFP+ CD8+ T cells display higher cytotoxic potential than YFP- CD8+ T cells.

........................................................................................................................... 48

Fig. 10 - YFP+ versus YFP- CD8+ T cells from Ifng-YFP mice have different miRNAs

profiles.. ............................................................................................................. 49

Fig. 11 - RT-qPCR validation of thymic miRNA candidates. ..................................... 50

Fig. 12 - RT-qPCR analysis of miRNA candidates in peripheral YFP+ versus YFP-

CD8+ T cells from Ifng-YFP mice. ...................................................................... 51

Fig. 13 - Candidate miRNAs expression in T cells subsets. ..................................... 52

Fig. 14 - Candidate miRNAs expression under IFN-γ promoting conditions. ............ 54

Fig. 15 - Validation of candidate miRNA overexpression upon retroviral transduction.

........................................................................................................................... 55

Fig. 16 - miRNA-132 overexpression down-regulates IFN-γ production in CD8+ T

cells. ................................................................................................................... 57


XIII

!

List of Abbreviations

APC Antigen presenting cell

CTL Cytotoxic T lymphocyte

DN Double negative

DP Double positive

Eomes Eomesodermin

FACS Fluorescence activated cell sorting

IFN Interferon

IL Interleukin

LN Lymph node

mAb Monoclonal antibody

MHC Major histocompatibility complex

miR microRNA

miRNA microRNA

NK Natural Killer

PCR Polymerase chain reaction

qPCR Quantitative Polymerase chain reaction

RNA Ribonucleic acid

RT Reverse transcriptase

SP Single positive

Spl Spleen

TCR T cell receptor

Th T helper cell

TNF Tumor necrosis factor

Treg Regulatory T cell

YFP Yellow Fluorescent Protein

WT Wild type

Note: List of all abbreviations used at least two times on different paragraphs

throughout the manuscript. Additional abbreviations are defined in the text once they

are first introduced to the reader.

!

!!!!!!!!

Introduction !

FCUP The Role Of miRNAs In CD8+ T Cells Differentiation

15

!

1 Introduction !

1.1 CD8+ T Lymphocytes Major Players in Immunity !

1.1.1 Adaptive immune system !The adaptive immune system provides specific protection against pathogens, has the

ability to form ‘memory’ (the basis of vaccination), that enables a rapid response to

previously encountered pathogens, fights nascent cancers and mediates tumor

destruction 1,2.

The major mediators of the adaptive immunity, responsible for providing efficient,

specific and long-lasting immunity, are lymphocytes 3. Lymphocytes can be

subdivided into two separate lineages: thymic-derived (T) lymphocytes (T cells) and

bone marrow-derived (B) lymphocytes (B cells) that further differentiate into plasma

cells to secrete antibodies 4.

T cells are involved in cell-mediated immunity, provide help for B cells to produce

antibodies (humoral immunity) and regulate immune responses 4. T cells are further

classified according to the co-receptor (either CD4 or CD8) that they express at the

cell surface, thus marking CD4+ T cells or CD8+ T cells. These markers are important

for T cell function, because they help to determine the interactions between the T cell

and its T cell receptor (TCR) and other cells expressing major histocompatibility

complex (MHC) molecules. The TCR complex of conventional T cells is a

transmembrane heterodimer composed of two polypeptide chains α and β chains,

which associate with co-receptor CD3 molecules. Each TCR chain consists of a

constant (C) and a variable (V) region, and is formed by a process termed somatic

recombination which joins variable (V), joining (J), and diversity (D) gene segments

to generate combinatorial diversity 4. Additionally, the addition or removal of

nucleotides at the joining sites increases the repertoire of TCRs.

The TCR recognizes specific peptides presented by MHC molecules: CD4+ T cells

recognize MHC class II and CD8+ T cells recognize MHC class I 5. After activation

upon its first encounter with an antigen, T cells proliferate and differentiate into

functional effector T lymphocytes. These include CD8+ cytotoxic T cells, which

secrete pro-inflammatory cytokines and kill cells that are infected with viruses or

other intracellular pathogens; CD4+ helper T cells, which provide essential additional


16

!signals that influence the behavior and activity of B cells and innate immune cells;

and CD4+ regulatory T cells that suppress the activity of other lymphocytes and help

to control immune responses 4.

1.2 CD8+ T cells !Activated CD8+ T cells differentiate into cytotoxic T cells and secrete high amount of

pro-inflammatory cytokines. They are crucial to fight against intracellular pathogens

but also to eliminate tumor cells. On the other hand, they are also involved in the

rejection of transplants and in the pathogenesis of a number of autoimmune diseases 6–11. CD8+ T cells recognize peptides derived from proteins present in infected or

transformed cells, bound to MHC class I molecules (pMHC). The direct lysis of target

cells mediated by CD8+ T cells is one of the most powerful actions of T cells and is

therefore tightly regulated, for example CD8+ T cells require more co-stimulation for

their activation compared to CD4+ T cells 12. Additionally CD8+ T cells can form

memory T cells, contributing to a long-lived immunological protection 13. As CD8+ T

cells are the focus of this thesis, different aspects of CD8+ T cell biology will be

discussed in detail in the following sections.

1.2.1 CD8+ T cell Effector Mechanisms !Naïve CD8+ T cells acquire two critical effector functions after antigen activation:

secretion of cytokines and direct contact-mediated cytotoxicity 14. Concurrent with the

initiation of proliferation is the establishment of gene expression that arms the CD8+

T cell with effector mechanisms to combat infection, such as increased expression of

the master transcription factors Eomesodermin and T-bet, encoded by Tbx21 15,16

(that promotes IFN-γ expression), elevated levels of mTOR and CD25 17, the high

affinity IL-2Rα chain, thereby potentiating IL-2 signals which further support effector

differentiation 18.

The CD8+ T cell effector mechanisms include: a) contact-mediated cytotoxicity which

proceeds through the release of preformed cytolytic molecules into the synaptic cleft

between the CD8+ T cell and its target cell; b) triggering of the TNFR family member

CD95 (Fas) and c) secretion of effector cytokines which contribute to a broad range

of immunological effects and contribute to local inflammatory responses 19.

CD8+ T cells are able to induce cytolysis of infected or abnormal cells by two distinct

molecular pathways 20: the granule exocytosis pathway, dependent on the pore-

forming molecules, or the upregulation of FasL (CD95L), which can initiate

programmed cell death by binding to Fas receptors (CD95) on target cells. Both


17

!pathways, activated in response to signals from the TCR, stimulate the caspase

cascade in the target cell, leading to apoptotic death 21. Efficient lysis by the granule

exocytosis pathway requires the coordinated delivery of perforin and granule

enzymes, such as granzymes A and B, into the target cell 22,23. CD8+ T cells also

release the cytokines interferon-gamma (IFN-γ), tumor necrosis factor-a (TNF-α) and

lymphotoxin-α (LT-α), as well as chemokines that function to recruit and/or activate

the microbicidal activities of effector cells such as macrophages and neutrophils 24

which contribute to host defense. Of note, CD8+ T cells rapidly produce IFN-γ and

TNF-α when their TCR is engaged by the pMHC complex of the target cell but will

immediately cease IFN-γ production when antigenic contact is broken, presumably

until they encounter the next target cell 25,26. TNF-α production is even more strictly

regulated and stops after a short period even when antigen contact is sustained 25.

Effector cytokines produced by antigen-specific CD8+ T cells are likely to be strictly

regulated to minimize the damage to the host 19. Cytokines may also directly interfere

with pathogen attachment or pathogen gene expression, or they may restrict

intracellular replication 27.

In contrast with the on/off cycling of cytokines, expression of the pore-forming

cytotoxic protein perforin is constitutively maintained 26. Another important capacity

that effector and subsets of memory CD8+ T cells acquire is the ability to migrate to

virtually any extra-lymphoid tissues after both localized and systemic infections 28.

1.2.1.1 The function of IFN-γ !Activated CD8+ T cells are crucial providers of the pro-inflammatory cytokine IFN-γ.

IFN-γ was discovered around five decades ago 29 and is critical for the regulation of

the host immune response against viral and intracellular bacterial pathogens.

Based on the type of receptor through which they signal, interferons have been

classified into three major types, and IFN-γ is the sole type II IFN. It is structurally

unrelated to type I IFNs, binds to a different receptor, is encoded by a separate

chromosomal locus and it is produced by T cells, Natural killer (NK) cells,

macrophages and macrophage-derived dendritic cells (mDCs).

The fundamental role of IFN-γ is clearly demonstrated by the study of IFN-γ or IFN-γ

receptor 1- (IFNGR1) deficient mice, which failed to appropriately clear mycobacterial

and other bacterial, parasitic, and viral infections 30–34. Furthermore, IFN-γ is

implicated in tumour surveillance 35,36 and is an important anti-tumoral mediator 37.


18

!Already in 1986, early clinical trials on IFN-γ began to evaluate the therapeutic

potential of its anti-infectious and anti-tumoral functions and until today it has been

used in a wide variety of clinical indications (reviewed in 38).

This notwithstanding, the excessive release of IFN-γ has been associated with the

pathogenesis of chronic inflammatory and autoimmune sclerosis, and plays a pivotal

role in the development and severity of autoimmune diseases such as hashimoto

thyroiditis, type I diabetes, lupus, arthritis and colitis 39–42.

The mechanism whereby IFN-γ leads to systemic autoimmunity remains unclear;

however, the importance of IFN-γ to T cell differentiation and immunoglobulin class

switching in B cells underlines a substantial contribution to adaptive immune

responses in autoimmunity.

!Fig. 1 - Effector functions of CD8+ T cells. Naïve CD8+ T cells acquired their critical effector functions after antigen

activation, and produce cytokines, chemokines and activate the direct contact-mediated cytotoxicity program14.

1.2.2 CD8+ T cell Response to Virus infection !Cytotoxic T cells (CTL) are the main effector T cells that act against cells infected

with viruses. Antigens derived from the virus multiplying inside the infected cell are

displayed on the cells surface, where they are recognized by the antigen receptors of

cytotoxic T cells. Hence, MHC class I surface expression is essential for antiviral

immunity. During virus infection, viral gene products expressed in the cytosol may be

targeted for degradation and presented by class I molecules 43. In this manner, CTL

can act early to eliminate the infected cell before viral replication is complete and

new viruses are released 44.

After antigenic stimulation, CTL up-regulate the expression of cytotoxic granule


19

!proteins, such as granzymes and perforin, and become cytolytic, and gain the ability

to enter non-lymphoid tissues 45–51. They also acquire antiviral effector functions,

including the ability to rapidly produce cytokines, such as IFN-γ, which inhibits viral

replication and is an important inducer of MHC class I molecule expression,

macrophage activation, and drives TNF-α expression. Also CD8+ T cell Fas-

dependent–mediated cytolysis, is critical for resistance against some non-lytic, such

as lymphocytic choriomeningitis virus (LCMV)52 and at least some lytic viruses such

as vesicular stomatitis virus (VSV), influenza virus, Herpes Simplex Virus Type

1(HSV-1) 53–55. In addition to changes in the expression of these effector molecules,

the overall pattern of gene expression is dramatically altered during this activation

phase, and a complex pattern of genetic regulation accompanies T-cell activation

and expansion 48.

Cytotoxic T cells kill infected targets with great precision, sparing adjacent normal

cells. This precision is crucial in minimizing tissue damage while allowing the

eradication of infected cells.

1.2.3 CD8+ T cell Response to Intracellular Bacteria !Whereas CD8+ T cells are principally associated with defence against viral infections,

they also combat intracellular bacterial infections 56.

All intracellular bacteria enter eukaryotic cells in a membrane-bound structure.

Organisms such as Mycobacteria, Salmonella, and Chlamydia survive within a

membrane-bound structure, whereas Listeria and Shigella escape from the vesicle

into the cytosol of the infected cell. As with most pathogens, the immune response to

bacterial infection is complex, and CD8+ T cells are frequently but not always major

effectors in this process 57.

While bacterial entry into the cytosol provides direct access to the MHC class I

antigen-processing pathway, allowing direct priming of CD8+T cells, vacuolar

pathogens such as Mycobacteria and Salmonella, although not directly, also induce

CD8+ T cell protective responses 27.

CD8+ T cells contribute to resistance against intracellular infections with bacterial

pathogens through perforin dependent cytolysis in the case of L. monocytogenes

infection, and its action appears to be most potent in the spleen and dispensable in

the liver. In contrast, no evidence for perforin dependent immunity against Chlamydia

or M. tuberculosis has been reported. In fact, CD8+ T cell-derived production of IFN-γ

is an important mediator of resistance to Chlamydia infection, and this issue remains

to be addressed in MTB infection 58–60.


20

!Although limited, there is evidence suggesting the possibility that the subcellular

location of the bacterial pathogen may impact on the relevance of specific CD8+ T

cell effector mechanisms 27.

1.2.4 CD8+ T cell Response against Tumours !The immune system has three primary roles in the prevention of tumors. First, it

protects the host from virus-induced tumors through elimination or suppression of

viral infections. Second, the timely elimination of pathogens and rapid resolution of

inflammation prevents the establishment of an inflammatory environment conducive

to tumorigenesis. Third, the immune system can specifically identify and eliminate

tumor cells in certain tissues on the basis of their expression of tumor-specific

antigens (TSAs). This third process, referred to as cancer immunosurveillance,

occurs when immune cells like CD8+ CTLs identify (upon recognition of pMHC class I

complexes) transformed cells that have escaped cell-intrinsic tumor-suppressor

mechanisms 61. These transformed cells are directly lysed by CTLs before they can

establish malignancy. Much attention has been given to the role of CD8+ CTLs

because most tumors are MHC class I positive, but negative for MHC class II.

1.2.5 CD8+ T cells in autoimmunity !Although the principal purpose of CD8+ T cells is to protect the host from “non-self”

(i.e. pathogens) and “altered self” (i.e. tumours), there has been an growing evidence

implicating CD8+ T cells in the pathogenesis of several autoimmune disorders, such

as type 1 diabetes, systemic lupus erythematosus, multiple sclerosis (MS),

rheumatoid arthritis (RA), inflammatory bowel disease (IBD) and Psoriasis vulgaris 7,11,62–65.

Much of what is currently known has been provided by employing animal models of

human type 1 diabetes (T1D), such as non-obese diabetic (NOD) mice. In these

mice T1D results from selective destruction of the insulin-producing pancreatic β

cells by autoreactive CD4+ and CD8+ T cells 62. This happens due to the cross-

presentation of autoantigens by dendritic cells to naïve autoreactive CD8+ T cells in

the pancreatic lymph nodes. The quality and quantity of this cross-presentation event

is determinant for whether the cognate CD8+ T cells undergo productive (and

potentially pathogenic) or non-productive activation (leading to antigenic

unresponsiveness or cell death) 66.

Other factors that also influence the outcome of cross-presentation includes the

activation state of the DCs, the cytokines present during the cross-presentation, the


21

!total number of autoantigenic peptide–MHC complexes that are presented on the DC

surface 8, and the affinity of the TCR for peptide–MHC complexes 67,68. In transgenic

models of spontaneous 67 and virus-induced diabetes 68, for example, the incidence

of diabetes clearly correlates with the avidity of the T cell–DC interaction.

CD8+ T cell-mediated killing of target cells might also foster autoimmune disease

progression, since it might facilitate the access of autoantigens to the cross-

presentation pathway.

Upon activation, CD8+ T cells secrete TNF-α and IFN-γ, among other cytokines, and

these cytokines have a role in autoimmune disease. TNF-α and IFN-γ can contribute

to disease progression by ligating TNF receptor 1 on DCs and promoting the

presentation of autoantigens,62. TNF-α also plays important roles in EAE/MS,

inflammatory bowel disease (IBD), experimental myasthenia gravis and rheumatoid

arthritis (RA) 69. CTL-mediated lysis of chondrocytes has been reported d to require

the upregulation of MHC class I molecules by IFN-γ 70.

1.3 CD8+ T cell development and differentiation

1.3.1 Thymus !T cell development is unique relative to other hematopoietic lineages, as T cells

complete the majority of their development in the thymus instead of the bone marrow

(BM) 71. The differentiation in the thymus is a complex and tightly controlled process

that begins with the immigration of bone marrow-derived progenitor cells, and ends

with the generation of self-tolerant, lineage committed T cells capable of performing

an array of immune functions upon recognition of their antigen 72.

Progenitor T cells begin to migrate to the thymus from the early sites of

hematopoiesis at about day 11 of gestation in mice and ninth week of gestation in

humans. Upon thymic settling, progenitors undergo a series of differentiation events

accompanied by migration through the thymic microenvironment where they receive

various inductive signals 73. Progenitors settle the thymus with the potential to

generate multiple blood lineages 74,75. However, as they differentiate and mature in

the thymus, their potential for alternative lineages is constrained, and then

irreversibly lost as the cells ultimately become restricted to the T lineage 71.

The thymus can be divided anatomically into an outer cortex, where most of the

differentiation takes place, and an inner medulla, where the newly formed cells

undergo final maturation before exiting and seeding peripheral lymphoid organs 76.


22

!Early intrathymic progenitor cells lack CD4 and CD8 expression and are referred to

as double negative (DN) cells 77. The precursors that first enter the thymus do not

express the antigen recognition machinery, lacking both the co-receptors CD4 and

CD8 that direct MHC recognition by T cells and the T cell receptors for antigen

recognition, TCRαβ or TCRγδ 72. DN progenitors enter the thymus at the cortico-

medullary junction (CMJ) and subsequently migrate to the subcapsular zone (SCZ) 78–80. This migration is accompanied by a progressive differentiation of these

progenitors indicating that differentiation-inducing signals locate to distinct cortical

regions 81.

Fig. 2 - Overview of T cell development in the thymus. The thymus is organized into cortical and medullary areas,

each of which is characterized by the presence of particular stromal cell types, as well as thymocyte precursors at

different maturation steps. Thymocyte differentiation is characterized by the expression of well-defined cell-surface

markers, including CD4, CD8, CD44 (or CD117) and CD25, as well as the status of the T-cell receptor (TCR).

Interactions between Notch receptor-expressing thymocytes and thymic stromal cells that express Notch ligands are

responsible for the induction of T cell maturation in the thymus, which results in the generation CD4+ T cells and CD8+

T cells, which emigrate from the thymus to establish the peripheral T-cell pool. Image adapted from Zúñiga-Pflücker,

J. et al. 200491.

Based on the expression of the surface molecules CD25 and CD44 on lineage-

negative cells, four early differentiation stages have been defined, double negative 1

to 4 (DN1-4), 82. Differentiation to the DN1 stage (CD25- CD44 high) proceeds in

proximity to the site of thymic entry 83, whereas the consecutive differentiation of


23

!stages DN2 (CD25+ CD44 high) and DN3 (CD25+ CD44 low) occur while cells

migrate outwards of this region into the mid and outer cortex, respectively. DN3 cells

accumulate in the SCZ where they differentiate to DN4 (CD25- CD44-), the pre–

double positive (DP; CD4+ CD8+) stage of development. Transition from the DN3 to

the DN4 stage is accompanied by a reversion of the migration polarity, which finally

guides the DP thymocytes across the cortex toward the medulla, although only

positive selected cells will actually enter the medulla, where the functional maturation

is completed 81 (Fig. 2).

The genes encoding the highly diverse TCRs undergo a carefully programmed series

of DNA rearrangements triggered within the thymus in a stepwise fashion, beginning

in DN stage thymocytes 72. For conventional TCRαβ T cells that recognize peptide

antigens presented by classical MHC molecules, commitment to the T cell lineage is

sealed by rearrangement of the TCRβ gene. The process of β selection tests the

accuracy of this rearrangement event, and drives the proliferation and CD4 and CD8

co-receptor expression by those cells expressing a functional TCRβ chain defined as

one that pairs with the product of the unrearranged pre-Tα gene 84. The result is a

large population of CD4+CD8+ double positive (DP) thymocytes that initiate TCRα

rearrangement. Accurate TCRα rearrangement, along with successful TCRαβ chain

pairing and surface expression is required for positive selection, the second critical

checkpoint for maturing T cells. Positive selection is driven by the successful, low

affinity interaction between the expressed TCRαβ receptor on a DP thymocyte and

self-peptide in the context of self-MHC 84,85. Positive selection rescues DP

thymocytes from the alternative destiny of programmed cell “death by neglect”, and

drives the accurate alignment between co-receptor expression and lineage

commitment 84–86. This process results in a population of CD4+CD8− single positive

(SP) thymocytes that can differentiate into helper T cells upon further recognition of

peptide presented by MHC class II molecules, and CD4−CD8+ SP thymocytes that

can differentiate into cytotoxic T cells upon encounter with antigen presenting cells

whose MHC class I molecules carry the appropriate peptides. At the DP or SP

stages, thymocytes are subjected to negative selection, the third checkpoint that

regulates T cell development. During this process, central to the establishment of

self-tolerance among developing T cells, TCRαβ+ thymocytes that react with high

avidity to self-peptide/MHC complexes are deleted 87–89. The remaining 1% of

thymocytes that successfully transit β selection, positive selection, and negative

selection undergo additional maturation that promotes their regulated exit from the

thymus 72. The naïve T cell population that exits the thymus after this selection

expresses a broad array of unique TCRs that are able to detect a wide range of


24

!foreign antigens. In steady state, the survival of naïve peripheral CD8+ T-cell pools

depends on interleukin-7 (IL-7) and interaction with MHC class I molecules 90.

1.3.2 Periphery !Upon exiting the thymus, mature naïve CD8+ T cells circulate in the blood and

lymphoid organs and signals from the interleukin-7 (IL-7) and IL-15 receptors

promote their survival. These cells lack most of the effector functions characteristic of

activated cytotoxic T lymphocytes (CTLs) 92.

Once in the periphery, naïve T cells constantly survey and sample antigen presenting

cells (APCs) in secondary lymphoid tissues in search of cognate pMHC molecules 90.

The professional APCs, in particular dendritic cells (DC), collect antigen in the

periphery and undergo a maturation process, then travel to secondary lymphoid

organs, including the spleen, lymph nodes (LN), Peyer’s patches (PP), tonsils and

appendix. Naïve T cells, which have yet to encounter their cognate antigen, are

programmed to recirculate continuously between the blood and these organs. If

naïve T cells encounter a cognate antigen presented by MHC molecules the

response is initiated in the immunologic synapse (IS). The outcome is antigenic

stimulation upon engagement of the TCR and CD8, as a co-receptor, that binds to

cognate pMHC complexes presented by APCs 90,93. TCR-mediated signalling induces

phosphorylation of several residues in the CD3 coreceptor chain and activation of ζ-

associated protein of 70 kDa (ZAP-70) and the src-family kinases Lck and Fyn,

thereby initiating downstream signalling pathways that lead to proliferation and

differentiation (35). Costimulatory signals augment TCR signals and prevent

induction of anergy or apoptosis by TCR signalling alone 94,95. The main

costimulatory receptor for T cells is the immunoglobulin (Ig) superfamily member

CD28, which is constitutively expressed on all naive T cells. If the appropriate signals

are present, naïve T cells are programmed to undergo clonal expansion, develop

effector functions, and establish a long-lived memory population following clearance

of antigen 92,96,97. There is now considerable evidence demonstrating that naïve cells

can be stimulated by antigen, referred to as signal 1, and CD28-dependent co-

stimulation, signal 2, to undergo several rounds of cell division. However,

programming for survival, effector function, and memory requires a third signal that

can be provided by either interleukin 12 (IL-12) or type I interferons (IFNs). IL-12

helps to develop a strong clonal expansion and cytolytic activity by the naive cells 90,92. In the absence of this signal, in the case of steady-state presentation of antigen

by immature DCs, the antigen-stimulated cells fail to develop effector functions, and

those that survive long term are tolerant by default 92. Other cytokines (such as TNF


25

!and IL-4) are not secreted in a directional preference and thus can potentially also

act on bystander cells 90.

For both CD4+ and CD8+ T cells, transient exposure to antigen is sufficient to induce

an antigen-dependent program of proliferation and differentiation (2–5), although the

kinetics and efficiency of CD8+T cell proliferation differ substantially from those of

CD4+T cell proliferation. The time of antigen exposure required to launch the

proliferative program for naive CD8+ T cells seems to be less than that required for

naive CD4+ T cells (3,4,8,9). CD8+ T cells also divide sooner and have a faster rate

of cell division than do CD4+ T cells 98–101.

Antigen-driven activation of naïve CD8 T cells is a crucial first step in the

differentiation process which generates heterogeneous subsets of cells, that vary in

their phenotypic attributes, functional capacity, anatomical location, and ability to

persist over time 13 (Fig. 3). Following exposure to antigens in an appropriate

inflammatory environment, these cells undergo a period of massive expansion,

dividing as many as 15–20 times and increasing up to 50,000-fold in number 52,102,103.

After receiving all of the signals necessary to program a response, the resulting CTL

population is limited in its capacity to continue to expand, due to the development of

an anergic state. This anergy can be rapidly reversed by IL-2, and possibly by other

proliferative signals, to allow continued expansion of the CTL population 96. IL-2 was

initially characterized as a potent T-cell growth factor in vitro, but the function during

primary expansion of CD8+ T cells in vivo is dispensable in lymphoid organs and to

some extent required in non-lymphoid tissues 104–106. IL-2 signals during priming,

nonetheless, do contribute to secondary clonal expansion of memory CD8+ T cells,

but it is thus far unknown whether CD4 or DC-derived IL-2 are essential for this

phenomenon or if autocrine IL-2 production is sufficient 105,106. When a CD8+ T cell

response has occurred and antigen is cleared from the system, either because the

initial CTL expansion was sufficient or because IL-2-dependent help was available to

maintain and expand the CTL population until clearance was achieved, the effector

CTLs decline in number as the cells undergo apoptosis, leaving behind a long-lived

population of memory cells 96.


26

!

!Fig. 3 - Antigen-driven activation of naïve CD8 T cells. After the encounter with an antigen presenting cell, CD8+ T

cells go into the differentiation process which generates heterogeneous subsets of cells, that vary in their phenotypic

attributes, functional capacity, anatomical location, and ability to persist over time 13.

!

1.3.3 Memory CD8+ T cells !The cytokines required for programming and maintaining a CD8+ T cell response that

leads to memory are provided, either directly or indirectly, by CD4+ T cells, or by

alternative ways. The CD4+ T cell-mediated help during the primary response or

thereafter and during recall is essential for the generation and maintenance of

functional memory CD8+ T cells to both non-inflammatory and inflammatory agents 107–110.

The maintenance of the memory population is a dynamic process that requires slow

proliferation of the cells in response to endogenous IL-15 and/or IL-7. In terms of the

cell-intrinsic factors required for CD8+ memory T cell generation, it is reported that T-

bet deficiency, particularly coupled with Eomesodermin deficiency impairs memory T

cells development 96.

Memory CD8+ T cells have higher frequencies than naïve T cells and can be

maintained for long periods of time without antigenic stimulation. This increment in

size, the ability to rapidly reactivate and kill upon antigenic stimulation and the varied

tissue distribution makes the memory CD8+ T-cell compartment able to protect its

host in a better and faster way to recurrent infections when compared to naïve T-cell

pools. Depending on the subtype of memory T cell, most but not all cell-surface

markers are gradually reversing to baseline during the ensuing development of

effector cells into memory T cells. Commonly, memory T cells are subdivided into


27

!two main subsets: first, effector memory cells (TEM) are found in non-lymphoid

tissues, and are CD62Llo, CCR7−; and second central memory cells (TCM) that

reside in lymphoid organs, and are CD62Lhi, CCR7+. Additionally, other memory

subsets defined by markers like CD27, CD28, CD43 exist as well as memory CD8+ T

cells with mixed phenotypes, such as CD62Llo, CCR7+ 111. TEM are preferentially

localized in non-lymphoid tissues and mucosal sites and have more rapid cytotoxic

potential, whereas TCM are mainly present in secondary lymphoid organs and

possess superior expansion potential. Thus, protection is essentially linked to the

anatomical location of memory T cell subsets and to the route of infection.

Memory CD8+ T cells in tissues such as the liver and lung are not a sessile, tissue-

resident population, and studies have shown that memory cells continuously enter

non-lymphoid organs from the bloodstream. In contrast, memory CD8+ T cells

present in the brain and lamina propria equilibrated very slowly with blood-borne

memory cells 112.

Interestingly, recent studies correlate the protection of vaccines with multifunctional T

cells (i.e. simultaneous production of the cytokines IFN-γ, TNF, and IL-2) 113, implying

that not only location and quantity of memory CD8+ T cells but also ‘fitness’ should be

considered important for protection. The three phases towards memory cell formation

(expansion, contraction, and memory development) are found in response to many

different types of acute infection and for different epitopes within the same pathogen,

indicating a common pathway for memory T cell formation. At the moment, it is still

controversial how naïve CD8+ T cells differentiate into effector and central memory T

cells and several models have been suggested that regulate this differentiation

process 114. Contrary to the dominant linear model of differentiation, a very recent

study based on single-cell PCR suggested pre-commitment of CD8+ T cells to either

the effector or memory lineages as early as in the first division after activation 115.

1.4 microRNAs as Gene Regulators

MicroRNAs (miRNAs) are critical post-transcriptional regulators of gene expression.

miRNAs are an abundant class of evolutionarily conserved small non-coding RNAs

of approximately ~21-25 nucleotides in length that can regulate gene expression by

binding to the 3´UTR of specific mRNAs leading to the degradation or translational

block of one or more target mRNAs 116.

In mammals, miRNAs are predicted to control the activity of ~50% of all protein-

coding genes 117 setting this post-transcriptional control pathway within nearly every

major gene cascade 118,119. Functional studies indicate that miRNAs participate in the


28

!regulation of diverse aspects of biology, including developmental timing,

differentiation, proliferation, cell death and metabolism 120–122. Changes in their

expression levels are associated with several human pathologies, including cancer,

heart ailments and neurological dysfunctions 123.

Since their discovery in Caenorhabditis elegans in 1993, thousands of miRNAs have

been identified in plants, animals, and viruses by molecular cloning and

bioinformatics approaches 121. Furthermore miRNAs and their accessory proteins

have been shown to be conserved throughout phylogeny 124.

Interestingly miRNAs are now being used as both targets and therapeutics for a

growing industry hoping to tackle the power of RNA-guided gene regulation to

combat disease and infection 119, highlighting the importance of microRNAs in the

gene regulation and therapeutic field.

1.5 MicroRNA Biogenesis

1.5.1 miRNA Transcription

miRNAs are encoded in regions of the genome including both protein coding and

non-coding transcription units. It is estimate that 50% of miRNAs are derived from

non-coding RNA transcripts, while approximately ~40% are located within the introns

of protein coding genes 125,126.

miRNAs are transcribed by RNA polymerase II and bear a 7-methyl guanylate cap at

the 5' end and a poly (A) tail at the 3' end, similar to mRNAs 124,127,128. The nascent

transcripts are referred to as primary (pri-) miRNAs. The pri-miRNAs can be long,

typically over 1kb and contain one or more secondary structures primarily consisting

of extended stem-loop structures 124,129. The pri-miRNA is then processed within the

nucleus by a multiprotein complex called the microprocessor, of which the core

components are the RNase III enzyme Drosha and the double-stranded RNA-binding

domain (dsRBD) protein DGCR8/Pasha 121,130–132.

A special subset of miRNA, mirtrons, bypass the Drosha cleavage step 122, as the

spliced intron itself corresponds exactly to a single, processed miRNA precursor 133 .

After being processed by Drosha or the being excise as a mirtron, the resulting ~70

nucleotide long RNAs, now precursor (pre-)miRNAs, folds into mini-helical structures,

allowing for recognition by Exportin 5 (Exp5), the nuclear export factor responsible

for trafficking pre-miRNAs from the nucleus to the cytoplasm 124,134,135 (Fig. 4).


29

!1.5.2 miRNA Maturation

After the translocation to the cytoplasm, the pre-miRNA is cleaved near the terminal

loop by the RNaseIII enzyme Dicer and generates a ~22-nt double- stranded miRNA 122,136,137 (Fig. 4).

Dicer is highly conserved throughout evolution and it is present in nearly all-

eukaryotic organisms; 122. The cleavage by Dicer takes place in a complex, that

includes the human immunodeficiency virus trans-activating response RNA-binding

protein (TRBP or TARBP2, known as loquacious in Drosophila), which contains three

dsRNA-binding domains and stabilizes the interaction of Dicer with the pre-miRNA 138–140. The resulting 19-24mers double-stranded RNA duplexes contain the mature

miRNAs, also known as guide strand, and its antisense strand, also known as the

passenger strand or miRNA* strand 141.

The antisense miRNA strand can also be found in libraries of cloned miRNAs

although in a much lower frequency than the guide strands 142,143.

1.5.3 RISC Assembly

The final step in miRNA biogenesis is the subsequent incorporation of the miRNA

duplex into the RNA-induced silencing complex (RISC), the effector complex whose

diverse functions can include mRNA cleavage, translation suppression,

transcriptional silencing and heterochromatin formation 124,144 (Fig.4).

The primary component of the RISC complex and the effectors of miRNA-mediated

repression are the Argonaute (Ago) proteins 145. While all of the Ago proteins have

the ability to interact with small RNAs, Ago2 is the only one with RNA cleavage

activity and is thought to play a prominent role in miRNA-mediated silencing.

In vivo, Ago2 associates with Dicer and the double-stranded RNA binding proteins

(TRBP) and also with protein kinase R-activating protein (PACT) to form the RISC

Loading Complex (RLC). This allows the tight coupling of Dicer cleavage to the

incorporation of miRNA into the RISC complex 140. In vitro reconstituted RLC

composed of recombinant Dicer, TRBP, and Ago2 efficiently catalyses pre-miRNA

cleavage 146,147. An important role of the RLC is the unwinding of the double-stranded

miRNA, which is followed by incorporation of the guide strand into the miRNA-

containing ribonucleoprotein (miRNP) complex and degradation of the passenger

strand 148.


30

!

!Fig. 4 - miRNA biogenesis. miRNAs are processed by RNA polymerase II as precursors (pri-miRNA) from intronic,

intergenic or polycistronic gene regions. In the canonical pathway the primary precursor (pri-miRNA) processing

occurs in a two steps cleavage by Drosha together with DGCR8 into 70-nucleotide stem loop known as pre-miRNA,

and then by Dicer. In contrast in the non-canonical miRNA pathway mirtrons are processed by the spliceosome.

Exportin 5 transports the pre-miRNAs to the cytosol, where they are further processed by Dicer together with TRBP

to mature miRNA. The mature miRNA, indicated in red, is incorporated into the RNA-induced silencing complex

(RISC) whose core components are the Argonaute family proteins (Ago1-4). The RISC complex either mediates

mRNA degradation or translational repression (from154)

Usually, the strand with the 5’ terminus located at the thermodynamically less-stable

end of the duplex is the one selected to function as a mature miRNA, and the other

strand is degraded 149–152.

The assembly of RNA into the RISC complex is driven by thermodynamic properties,

though may be also subject to additional regulation as the ratio of miRNA:miRNA*

can vary dramatically, depending on the specific properties of the miRNA duplex, on

the tissue itself and on the developmental stages 142,153. These findings suggest that


31

!differential strand selection could represent a yet unappreciated mechanism of

miRNA regulation. After the assembly of the miRNAs into the miRNPs or miRNA-

induced silencing complexes (miRISCs) the effector complex is ready for targeting

the mRNAs.

1.6 MicroRNA Mechanisms of Action

1.6.1 Target regulation by miRNAs

miRNAs interact with their mRNA targets via sequence-specific base-pairing. With

few exceptions, miRNAs base pair with their targets imperfectly, following a

combination of rules, that have been formulated, based on experimental and

bioinformatics analyses 118. It is known that an individual miRNA is able to control the

expression of more than one target mRNA and that each mRNA may be regulated by

multiple miRNAs.

The 5’ region, termed the “seed” sequence, of the miRNA is used to recognize

complementary regions mainly in the 3’ UTRs of mRNAs leading to deadenylation or

inhibition of translation, ultimately resulting in mRNA decapping and decay 123,155,156.

Recent studies based on ribosome profiling have shown that, although there are

some contribution of translational inhibition, for most of the proteins (>84 %)

regulated by miRNAs 157, the inhibition was accounted by destabilization of the target

mRNA158,159 .

Perfect pairing of a miRNA with its target sites supports direct endonucleolitic

cleavage of the mRNA by Argonaute, both in plants and animals. This is a common

mechanism in plants but is very rare in animals.

1.6.2 miRNA-mediated regulation of T cell Differentiation

The initial studies that established the role of miRNAs in T cells were based on the

generation of mice in which global miRNA maturation was blocked. Several T cell-

specific miRNA-deficient mice were generated through targeting of essential

components of the miRNA biogenesis, namely Dicer, Drosha or Dgcr8. Interestingly,

early elimination of Dicer in the T cell lineage, mediated by lckCre expression,

caused a dramatic (~10-fold) reduction of total thymocyte numbers, most probably

due to increased cell death 160. The relative numbers at the various developmental

stages remained intact and only a 4-fold reduction of peripheral CD8+ T cells was

detected 160. In general it was shown, by using a conditional gene ablation approach,

that Dicer-sufficient cells outgrow Dicer-deficient cells, implicating miRNA in the


32

!general T cell fitness 161. Furthermore, Dicer and Dgcr8-deficient T cells have

decreased T cell proliferation capacity after activation 162,163. Importantly, a striking

effect on T cell differentiation was observed in all T cell-specific miRNA (entire

miRnome) knockout lines. This data clearly demonstrated that miRNAs are involved

in the establishment and/or maintenance of specific T cell identities 163–165. Dicer-

deficient CD4+ T cells were strongly biased towards IFN-γ-producing (Th1) cells,

suggesting a specific role of miRNAs to repress the Th1 program 161,162,165. Other T

cell subsets were also affected, as miRNAs are essential for the homeostasis and

suppressive function of FoxP3+ regulatory T cells. Dicer and Drosha-deficient mice

displayed a scurfy-like disease and their fatal autoimmunity could not be

distinguished from FoxP3-deficient mice 165–167. Consistent with this, Dicer-deficient

Tregs lose the expression of FoxP3 167. In another mouse model using depletion of

AGO2, which is the key AGO protein in haematopoietic cells and crucial for the

maintenance of physiological miRNA levels, an increased proportion of IFN-γ and IL-

4 double producing CD4+ T cells were detected 168,169.

In summary, even if miRNA-deficient T cells are still able to function, the approaches

using T cell-specific miRNA-deficient mice, clearly demonstrated that miRNAs are

implicated in various aspects of T cell biology, namely proliferation, survival and

differentiation. However, the interpretation of the resulting phenotypes is complex, as

the question remains which miRNAs are important for the detected dysfunctions.

Deletion of two counteracting miRNAs can mask their role and prevent them from

establishing a phenotype. Therefore the “second” generation of miRNA research is

focusing on the role of individual miRNAs. The starting point is usually the profiling of

miRNAs in multiple T cell types. Unlike miR-122 or miR-1 which are exclusively

expressed in the liver and the heart, respectively, no individual miRNAs were found,

that are uniquely expressed in lymphocytes 170,171.

miR-181a was identified as an important regulator of positive selection, which may

constitute up to half of the total microRNA content of DP cells 172. It is specifically

enriched at the CD4+ CD8+ DP stage of thymocyte development and suppresses the

expression of Bcl-2, CD69, and T cell receptor (TCR), all of which are important in

positive selection 173. miR-181a has also been shown to increase sensitivity to

peptide antigens by down-regulating multiple phosphatases 174. These findings have

indicated that miR-181a functions as an intrinsic “rheostat” in TCR signalling, which

is very important in T cell development 175. In addition to miR-181a, miR-150 is

important in T cell development as its up-regulation inhibits the expression of the

target gene NOTCH 3 176.


33

!Interestingly, the expression of miRNAs changes during activation and differentiation

of individual T cell subsets. Most miRNAs expressed in resting T cells are down-

regulated after T cell activation, with a few exceptions, such as miR-155 and miR-17-

92, that are selectively up-regulated, suggesting a role for these miRNAs in the

transition of naïve T cells to specialized effector cells 168,177–181.

1.6.3 miRNA-mediated regulation of T cell effector function

Until now several miRNAs have been identified for regulating the differentiation of the

T cells effector function. These are summarized in Table 1.

miRNAs expression rapidly change after activation in CD8+ T cells as well in CD4+ T

cells 170,181, and miR-155 is an example of those miRNAs. It is induced in CD8+ T

cells during activation and rapidly declines to regulate CD8+ memory T cell

differentiation 187. It is also known that miR-155 is required for normal CD8+ T cell

responses to lymphocytic choriomeningitis virus (LCMV) and Listeria monocytes

infections 188.

The miR-17-92 cluster, is also induced in viral infections 189 and promotes

proliferation. The down-regulation of this cluster after the initial expansion phases is

needed for the normal memory CD8+ T cell formation 189. Therefore miR-17-92

cluster appears to be also involved in T cell differentiation.

Another important role of this cluster, is that in its absence the production of many

cytokines including IFN-γ, IL-2, IL-4, IL-5 and TNF-α, was impaired, suggesting that

multiple Th subsets and possibly CD8+ T cells were affected 190.

A microRNA with an important role in cytokine production, especially in the

production of IFN-γ is the miR-29. miR-29 suppresses IFN-γ production by indirectly

targeting two mRNAs coding for transcription factors that promote Th1 differentiation,

Tbx21 (T-bet), and Eomes 162,190 or by directly targeting IFN-γ 190. Interestingly mice

infected with Listeria monocytogenes or Mycobacterium bovis bacillus Calmette-

Guérin (BCG) exhibit a down-regulated miR-29 expression in IFN-γ-producing natural

killer cells, CD4+ T cells, and CD8+ T cells 191.

Also miR-146a, one of the best studied miRNAs in immune cells, mediates immune

suppression in all cell types analyzed so far, namely by inhibiting the production of

IFN-γ and IL-17 in CD4+ and CD8+ T cells 192–195.

Additionally, numerous miRNAs, including miR-150, miR-155, and the let-7 family

were shown to be associated with the development of effector and central memory

CD8+T cells using an in vitro system where CD8+ T cells activity was driven by IL-2 or


34

!IL-15 cytokines. In particular, miR-150 regulates the protein expression of Kv channel

interacting protein 1 (KChiP1) in mouse central memory T cells 196.

In sum, until today several miRNAs were identified as critical regulators of T cell

differentiation. In this thesis we will address the role of miRNAs in the differentiation

of IFN-γ-producing CD8 T cells (see section: 2), as the role of miRNAs in this

differentiation process is poorly understood.

Table 1 - Function of miRNAs in T cells. Adapted from Kroesen et al. 2014 197.

!

Aims of The Thesis


36

!

2 Aims of the thesis !The published observations that CD8+ T cell survival, activation and migration are

compromised in the genetic absence of Dicer, clearly implicate miRNAs in CD8+ T

cell physiology. This notwithstanding, it remains unknown which specific miRNAs

control the development and activation of CD8+ T cells, and how they may regulate

the production of IFN-γ and the cytotoxic function of CD8+ T cells. Such

understanding may pave the way to novel clinical interventions in settings of infection

and cancer where CD8+ T cells are pivotal effectors in immune responses.

In this thesis we set out to investigate the role of miRNAs in the post-transcriptional

regulation of IFN-γ producing CD8+ T cell differentiation. Preliminary data from the

host lab detected increased IFN-γ production in CD8+ T cells from miRNA-deficient

mice, both in the thymus and in the periphery compared to control mice. Building on

these interesting findings we proposed to identify, in this study, specific miRNAs that

might control IFN-γ expression in CD8+ T cells. We used Ifng-YFP reporter mice to

isolate YFP+ and YFP- thymic CD8+ T cell populations for miRnome profiling.

Additionally we proposed to analyze candidate miRNA regulation under TCR and

cytokine stimulation, and finally to conduct functional over-expression experiments.

The final goal would be to identify and characterize specific miRNAs implicated in

IFN-γ−producing CD8+ T cell differentiation.

!!

!

Material and Methods


38

!

3 Material and Methods !

3.1 Mice !For all experiments adult mice (6 – 12 weeks old) were used. C57BL/6J mice (6 – 12

weeks old) were from Jackson Laboratories (Bar Harbor, ME). lckCre-DicerΔ/Δ mice

were kindly provided by Dr. M. Merkenschlager (London, UK). IFNγ-IRES-YFP-

BGHpolyA knockin (YETI) mice were from Jackson Laboratories (Bar Harbor, ME).

Both female and male mice were used, however, individual experiments were

conducted with either females or males. Mice were maintained within the specific-

pathogen-free animal facilities at the Instituto de Medicina Molecular (Lisbon,

Portugal). All experiments involving animals were done in compliance with the

relevant laws and institutional guidelines and were approved by local and European

ethic committees.

!

3.2 Cell preparations

For all in vitro analyses, cells were obtained from spleen, thymus and lymph nodes

(axillary, brachial, inguinal, mesenteric and lumbar).

3.2.1 Spleen, lymph nodes and thymus

The lymph nodes and spleen, or thymus, were strained using BD Falcon Cell strainer

70 µM. Red blood cells (RBC) were lysed with RBC Lysis Buffer from Biolegend

(#420301) and spun for 5 minutes (min) at 1500 rotations per minute (rpm). The

supernatant was discarded and the pellet resuspended in approximately 3 ml of

complete RPMI medium (RPMI media 1640, containing 1mM sodium pyruvate

#11360-039, 1x non-essential acids amines #11140-050, 10 mM hepes #15630-056,

penicillin-streptomycin #15140-122, 50µg/ml gentamycin, 50 µM βmercaptoethanol

and 10% fetal calf serum (FCS) al from Gibco®).

3.2.2 Cell Sorting by Flow-Cytometry

Respective staining antibodies were added to the cells and incubated for at least 15

min at 4ºC in complete RPMI medium. For sorting of T cells subsets the following


39

!antibodies were used: anti-CD3e PerCP-Cy5.5 (145-2C11 e-Bioscience), anti-CD8

APC-eFluor 780 (53-6.7 e-Bioscience), anti-TCRγδ PE (GL3 e-Bioscience), anti-

CD27 PE-Cy7 (LG.7F9 e-Bioscience), anti-CD4 eFluor-450 (RM4-5 e-Bioscience)

and anti-CD25 APC (PC61 BD Pharmingen) (Fig. 5).

For sorting of CD8+ T cells the following antibodies were used: anti-CD3e PerCP-

Cy5.5 (145-2C11 e-Bioscience), and anti-CD4 eFluor-450 (RM4-5 e-Bioscience) and

anti-CD8 APC-eFluor 780 (53-6.7 e-Bioscience). Cells were washed by adding an

excess of medium to the suspension followed by centrifugation for 5 min at 1500

rpm, after which pellets were resuspended in complete RPMI medium and

transferred to 96 well U bottom plates from TPP (#92097) with 200,000 cells in 100µl

per well and kept in an incubator at 37°C and 5% CO2. Cell sort was performed with

either BD FACSAria I or BD FACSAria III cell sorter.

!Fig. 5 - Cell Sorting by Flow-cytometry strategy. CD4+ T cells, CD8+ T cells and gd T cells were sorted within the

gate of CD3+ cells. Within CD4+ gate, Tregs were sorted in CD25+ gate, and within the γδ TCR, CD27+ and CD27-

cells were sorted.

3.3 In vitro cell stimulation and polarisation

CD8+ T cells were sorted by flow cytometry and subjected to various stimulation

conditions for 48h for functional studies or 12h for miRNA expression analysis. Cells

were incubated with various cytokines including IL-12 (5 ng/ml PeproTech), IL-4 (10

ng/ml eBiosciences), IL-7 (10 ng/ml; eBiosciences), IL-18 (10 ng/m PeproTech), IL-2

(10 ng/m PeproTech), IL-15 (10 ng/m PeproTech) and or activated with plate-bound

monoclonal antibody (mAb) anti-CD3 (5 µg/ml; 145.2C11; eBiosciences) and mAb


40

!anti-CD28 (5 mµg/ml; 37.51; eBiosciences).

!

3.4 Restimulation and FACS staining

To measure cytokine secretion, cells were restimulated with PMA (50 ng/ml, Sigma;

P-8139) and Ionomycin (1 µg/ml, Sigma; I-0634) for 4h at 37°C, with the addition of

Brefeldin A (10 µg/ml, Sigma; B-7651). Cells were transferred into Nunc® 96 well V

bottom plates and washed once in FACS buffer (PBS, 0.5% FCS, 2 mM EDTA) (5

min, 1500 rpm). For extracellular cell staining, cells were resuspended in 50µl FACS

buffer with the respective antibodies and incubated for 30 min at 4ºC. For intracellular

cell staining the cells were resuspended in 100µl of fixation/permeabilization (BD

Cytofix/CytopermTM Fixation/Permeabilization kit; # 554714) and incubated for 30

min at 4°C. Cells were washed twice in Perm/wash (BD Cytofix/CytopermTM

Fixation/Permeabilization kit; # 554714) (5 min, 2000 rpm). Cells were resuspended

in 40µl of Perm/wash containing Anti-mouse anti-FcR (2.4G2; BD Pharmingen) and

incubated for 15 min at RT. Cells were then stained without washing with respective

antibodies in an additional 10 µl of the same Perm/wash buffer and incubated for 30

min at RT. For cytokine expression analysis with FACS the following antibodies were

used: anti-IL-17A Alexa Fluor 488 (17B7; eBiosciences), anti-IFN-γ APC (XMG1.2

BD Pharmingen) and anti-TNF-α PE (MP6-XT22 BD Pharmingen).

Cells were washed once in Perm/wash and once in FACS buffer (5 min, 20000 rpm).

Cells were finally resuspended in FACS buffer and FACS acquisition was performed

on BD LSRFortessa cell analyser.

All the data were analysed using FlowJo v.9.3.3 software.

3.5 Quantitaive RT-PCR

All quantitative RT-PCRs were performed in MicroAmp® Optical 384-Well

Reaction Plate (Applied Biosystems® #4343370) using Applied Biosystems

ViiATM 7 Real-Time PCR system. Data was analysed using ViiATM 7

software v1.2.1.

For miRNA expression analysis: RNA was isolated from sorted cell

populations by flow cytometry using miRNeasy Mini Kit (Qiagen). For cDNA

synthesis and real-time PCR amplification the miRCURY LNATM Universal RT

microRNA PCR protocol (Exiqon) was performed. LNATM PCR primer sets

(Exiqon) were used and relative quantification of specific miRNAs to small


41

!RNA reference miR-423-3p was carried out using SYBR on ABI ViiA7 cycler

(Applied Biosystems).

3.6 Retroviral transduction for miRNA overexpression

The native precursor stem loop of our miRNAs candidates were cloned into the

retroviral vector MSCV-IRES-GFP (pMIG) (Fig. 6) using genomic DNA as a template

and the following primers:

miR-451a-F– CGTTTCTGCCTGTAACTCTGG

miR-451a-R – CTCACAAAGGTCCTCCCATC

miR-132-F– GCCGCCTTCAGTAACAGTCT

miR-132-R – AGGACTCCTGATCCCATCG

miR-200a-F – CCTAGTGGGGCTACTCAAGC

miR-200a-R – GCATCCTCACTAACCCTCACA

miR-322-F – CCGGGGACAATAAATGAGAC

miR-322-R –TGCCACCTTGCTATTCACAC

miR-181a-F – CCCAGCATGTGTTATGGTCTT

miR-181a-R – CCGCAGTAACTGAAACTGGA

miR-139-F – AGAGGACTAACAACCCCTGC

miR-139-R – GGAGAGGAGGCATAAGGGTG

Viral supernatant was produced by transfecting the plasmids pMIG, pCMV-VSV-G

and pCL-Eco with Opti-MEM® (Life Technologies) and X-tremeGENE DNA

Transfection Reagent (Roche) in 293T/17 [HEK 293T/17] (ATCC® CRL-11268™)

packaging cell line cultured in TPP 100mm cell culture dishes. The efficiency of the

viral particles was tested by transducing 200.000 NIH/3T3 (ATCC® CRL-1658™)

cells per well, in a Nunc™ 6 well plate, with 8µg/ml of polybrene during a 60 min

centrifugation at 37ºC, 2200 rpm. After 24h the media was changed for fresh media.

And after 120h the cells were washed with FACS buffer (1500 rpm 5 min), and

resuspended in FACS buffer for FACS acquisition.

For viral transduction of peripheral and thymic CD8+ T cells, the cells were cultured in

a TPP 96 well U bottom plate ,with 200.000 sorted CD8+ T cells per well. The cells

were activated for 48h with plate-bound anti-CD3ε mAb (1µg/ml; 145.2C11;

eBiosciences) and anti-CD28 mAb (1µg/ml; 37.51; eBiosciences) in presence with IL-

2 (10 ng/m PeproTech) for peripheral CD8+ T cells and IL-7 (10 ng/ml; eBiosciences)

for thymic CD8+ T cells. Per well 200.000 CD8+ T cells were transduced with miR-


42

!181a-pMIG, miR-200a-pMIG, miR-132-pMIG, miR-139-pMIG or empty-pMIG vector

using 50µl of concentrated viral supernatant. The transduction was performed with

8µg/ml of polybrene during a 60 min centrifugation at 37ºC, 2200 rpm. After 120h

GFP+ (transduced) CD8+ T cells were sorted and restimulated for intracellular

cytokine staining for IFN-γ and TNF-α.

!Fig. 6 - miRNA overexpression in CD8+ T cells. Workflow of the miRNA overexpression in CD8+ T cells using

retroviral transduction. miRNAs were cloned into the retroviral plasmid pMIG, using the precursor stem loop and

genomic DNA as template. Viral particles were produced in 293T/17 [HEK 293T/17] (ATCC® CRL-11268™)

packaging cell line and their efficiency tested in the NIH/3T3 (ATCC® CRL-1658™) cell line. CD8+ T cells were then

transduced with the viral particles for 120h and afterwards sorted for GFP+. Later GFP+ (transduced) CD8+ T cells

were restimulated and analyzed for intracellular cytokine staining for IFN-γ and TNF-α.

!


43

!3.7 Redirected cytotoxicity assay

YFP+ and YFP- CD8+ T cells were sorted and were either cultured in complete RPMI

for 72h in a TPP 96 well U bottom plate, with plate-bound anti-CD3ε mAb (1µg/ml;

145.2C11; eBiosciences) and anti-CD28 mAb (1µg/ml; 37.51; eBiosciences), or the

cells were incubated directly after sorting in a 96 well U bottom plate for 4h at 37ºC

with P815 (ATCC® TIB-64™) mouse mastocytoma cell line, label with DDAOse

(1µM), with soluble anti-CD3e mAb (1µg/ml; 145.2C11; eBiosciences).

After 4h of incubation with P815 (ATCC® TIB-64™) mouse mastocytoma cell line,

cells were transferred to a 96 well V bottom plate, and washed with FACS buffer

(1500 rpm 5 min).

For Annexin V/Dead Cell Apoptosis staining Alexa Fluor® 488 Annexin V/Dead Cell

Apoptosis Kit (V13241; Life Technologies) was used. Cells were ressuspended in

100ul per well in 5x annexin-binding buffer (Component C), and stained with Alexa

Fluor® 488 annexin V (Component A) for 15 min at room temperature.

Cells were resuspended in 5x annexin-binding buffer (Component C) for FACS

acquisition on BD LSRFortessa cell analyser.

3.8 Statistical analysis

A two-tailed non-parametric Mann-Whitney test was used for statistical analysis. P

values of <0.05 were considered significant and are indicated on the figures.

!

Result


45

!

4 Results !

4.1 Increased differentiation of IFN-γ producing CD8+ T cells in pLck-Cre DICERfl/fl mice

To address the overall role of miRNAs in the regulation of IFN-γ producing CD8+ cells

we analyzed T cell-specific miRNA-deficient mice (kindly provided by Dr. M.

Merkenschlager, Imperial Colege, London). Dicer, a crucial enzyme in the miRNA

biogenesis pathway, is essential for the generation of mature miRNAs. As Dicer

mutation in mice or mouse embryonic stem (ES) cells results in developmental failure 198,199, we used T-cell specific conditional Dicer deletion in mice using the Cre-lox

system. The Cre recombinase was expressed under the lck proximal promotor, which

is active from the earliest stages of T cell development 200.Therefore in lckCre-Dicer∆/∆

mice, Dicer is deleted from the CD44-CD25+ (DN3) stage onwards, while -importantly

for our work- does not prevent CD8+ T cell development in the thymus 164.

Fig. 7 - DICER deficiency in T cells results in increased frequency of INF-γ producing CD8+ T cells. Frequency of IFN-

γ+ CD8+ T cells isolated from lckCre-Dicerlox/lox (wild-type control) and lckCre-Dicer∆/∆ mice (left). Representative

intracellular staining of IFN-γ and IL-17 in (A) thymic and (B) peripheral CD8+ T cells isolated from those mice (right).

Each symbol (in A, B, left panels) represents an individual mouse. * P ≤ 0.05 (Mann-Whitney two-tailed test).


46

!

Interestingly, we observed a ~8-fold higher frequency of IFN-γ producing CD8+ T cells

in the thymus (Fig.7 A) of Dicer∆/∆ compared to Dicerlox/lox mice and a ~3-fold higher

frequency of IFN-γ producing CD8+ T cells in the lymph nodes. We additionally

analyzed the frequency of another pro-inflammatory cytokine, IL-17A, that is

expressed in activated CD8+ T cells after differentiation in a specific cytokine milieu

including TGF-β and IL-6. We did not detect any expression of IL-17A in ex vivo

isolated CD8+ T cells in Dicer∆/∆ mice in the thymus (Fig. 7 A) and in the periphery

(Fig. 7 B). These data suggested an important role of miRNAs in selectively regulating

the differentiation of IFN-γ producing CD8+ T cells.

4.2 YFP expression encompasses intracellular IFN-γ production in Yeti mice

!On the basis of the previous data we hypothesized that mature miRNAs, play a role in

the differentiation of IFN-γ producing CD8+ T cells in the thymus and periphery. To

examine the role of specific miRNAs in the differentiation of IFN-γ producing CD8+ T

cells we relied on a bicistronic reporter mouse strain Ifng-YFP (termed ‘‘Yeti’’ mice), in

which transcription of the Ifng gene also results in enhanced yellow fluorescent protein

(eYFP) reporter expression 201. Therefore, immune cells producing IFN-γ mRNA will

also be YFP+ 202 .

To ensure that the expression of YFP fluorescence associated with intracellular IFN-γ

production we stimulated CD8+ T cells of the Ifng-YFP reporter mice with diverse

cytokines cocktails capable of triggering IFN-γ production.

Thymic CD8+ T cells were cultured for four days with plate bound anti-CD3 and anti-

CD28 mAb in the presence of IL-7; IL-7 plus IL-2; IL-7 plus IL-12; IL-7 plus IL-18; and

IL-7, IL-12 plus IL-18. The combination of IL-7 plus IL-12 was the most potent cytokine

cocktail to induce IFN-γ production in thymic CD8+ T cells and resulted in ~ 40% of

IFN-γ producing CD8+ T cells and ~ 90% YFP positive cells (Fig. 8 B).

The peripheral CD8+ T cells were cultured for four days with plate bound anti-CD3 and

anti-CD28 in the presence of IL-2; IL-2 plusIL-4, IL-2 plus IL-18; and IL2, IL-12 plus IL-

18. The combination of IL-2, IL-12 plus IL-18 was the most potent cytokine cocktail to

induce IFN-γ production in peripheral CD8+ T cells and resulted in ~ 60% of IFN-γ

producing CD8+ T cells and ~ 90% YFP positive cells (Fig. 8 B).

YFP expression encompassed intracellular IFN-γ production (Fig. 8 A and B). There

are at least two possible reasons with YFP expression is more frequent than the


47

!actual cytokine: faster translation rates; or increased mRNA or protein stability.

Importantly, they follow similar tendency in the different conditions tested in thymic

and in peripheral CD8+ T cells, as increased frequency of IFN-γ+ CD8+ T cells

associated with increased expression of YFP.

These data suggests that Yeti mice can be a reliable tool to study and characterize

IFN-γ producing CD8+ T cells, without the need of intracellular staining for IFN-γ, since

the expression of YFP encompasses IFN-γ production.

Fig. 8 - eYFP expression associates with intracellular expression of IFN-γ in Yeti mice, upon IFN-γ inducing

conditions. Representative intracellular staining for IFN-γ and IL-17A in (A) thymic and (B) peripheral CD8+ T cells of

Ifng-YFP mice stimulated in vitro for four days with plate bound anti-CD3 and anti-CD28 and in the presence of

different cytokines (IL-7, IL-2, IL-4, IL-12 and IL-18) (left, top). Representative histograms indicating the eYFP

expression in the same conditions (left, bottom). Frequency of IFN-γ+ and YFP+ (A) thymic and (B) peripheral CD8+ T

cells (right).

4.3 YFP+ (IFN-γ+) CD8+ T cells display increased cytotoxicity !CD8+ T cells are known to mediate protection against infection through the secretion

of cytokines, such as IFN-γ and tumor necrosis factor (TNF), and through CTL activity


48

!via the release of cytotoxic granules containing granzymes, granulysins and perforin

(Pfn)203. Interestingly, previous studies have shown a strong relationship of IFN-γ or

perforin expression and the cytotoxic ability of virus-specific CD8+ T cells and CD8-

mediated cytotoxicity against tumors 204–207.

!!

!!Fig. 9 - YFP+ CD8+ T cells display higher cytotoxic potential than YFP- CD8+ T cells. Representative FACS plots of

Annexin-V staining (right) and % of specific lysis (left) of the redirected lysis assay with (DDAO-SE-labelled)

mastocytoma P815 target cell line by CD8+ YFP+ cells and CD8+ YFP- at (A) day 0 and (B) day three.

We confirmed the association of the cytotoxic potential and IFN-γ production in CD8+

T cells isolated from Ifng-YFP reporter mice. We performed a redirected lysis assay

against P815 mastocytoma cell line comparing the cytotoxic responses of YFP+

versus YFP- CD8+ T cells. Interestingly, we observed an increased killing capacity of

freshly isolated YFP+ CD8+ T cells (IFN-γ+) cells, when compared with the YFP- CD8+

T (IFN-γ-) cells at an 1:10 target:effector ratio (40% of lysed cells versus 20% of lysed

cells) (Fig. 9 A). This enhanced cyotoxicity of YFP+ CD8+ T cells diminished in long

term cultures, (60% of lysed cells versus 50% of lysed cells) (Fig. 9 B). This is most

possibly due to the induction of differentiation in YFP- CD8+ T cells. Of note, we

observed the highest percentage of lysis by both YFP+ and YFP- CD8+ T cells at day 3

(Fig. 9 B).


49

!These data confirmed an increased CTL activity of IFN-γ producing CD8+ T cells

compared to IFN-γ non-producing CD8+ T cells in our redirected lysis assay, pointing

to a polyfunctionality of CD8+ T cells.

4.4 YFP+ versus YFP- CD8+ T cells from Ifng-YFP mice have different miRNA repertoires

!We next aimed at identifying individual miRNAs that regulate the differentiation of IFN-

γ+ CD8+ T cells and could mediate the increased frequency of IFN-γ+ CD8+ T cells in

Dicer∆/∆ mice. Following the observations made in sections 2 and 3, we used Yeti

reporter mice to profile the individual miRNAs present in YFP+ versus YFP- CD8+ T

cells. For this purpose we stimulated CD8+ thymocytes from Yeti mice, for two hours

with PMA and Ionomycin, and sorted YFP+ and YFP- cells (Fig.10 A). We then profiled

the microRNAs using ready-to-use PCR panels from Exiqon which analyzes the

expression of 372 miRNAs. We identified 22 microRNAs differentially expressed in

YFP+ versus YFP- CD8+ T cells (Fig.10 B), 12 of which were higher expressed in YFP+

cells, and 10 were higher expressed in YFP- CD8+ cells.

Fig. 10 - YFP+ versus YFP- CD8+ T cells from Ifng-YFP mice have different miRNAs profiles. Representative FACS

staining of YFP expression in thymic CD8+ T cells stimulated for two hours with PMA and Ionomycin (A). Differential

miRNA expression level in thymic YFP+ versus YFP- CD8+ T cells. The expression levels are represented relative to

YFP+CD8+ T cells and converted to LOG2 fold changes (B). !

4.5 RT-qPCR validation of miRNA expression in thymic YFP+

versus YFP- CD8+ T cells from Ifng-YFP mice !We chose to concentrate on the six miRNA candidates based on the highest

differential expression in thymic YFP+ versus YFP- CD8+ T cells. miR-139, miR-451a


50

!and miR-200a were higher expressed and miR-132, miR-322 and miR-181a were

lower expressed in YFP+ compared to YFP- CD8+ T cells. We validated their

differential expression by independent miRNA expression analysis using specific

primers for each miRNA (Exiqon).

Fig. 11 - RT-qPCR validation of thymic miRNA candidates. Quantitaive RT-PCR analysis of (A) miR-139-5p, (B) miR-

451, (C), miR-200a, (D) miR-132, (E) miR-181a-5p, (F) miR-322-5p expression in thymic CD8+ YFP+ (IFN-γ+) and

CD8+ YFP- (IFN-γ-) T cells. Expression levels are relative to the reference miRNA, miR-423-3p. The graphs show the

geometric mean of the miRNA expression from four independent experiments. –The differences were statistically not

significant (n=3-4).

!The RT-qPCR results confirmed the array data for miR-139, miR-451a, and miR-322

(Fig. 11 A, B, E, F). Although the differences are not significant between samples

(due to low sample numbers), the trend observed in the qPCR array is maintained.

miR-139 and miR-451a are higher expressed in YFP+ (Fig. 11 A and B) and miR-322

is higher expressed in YFP- CD8+ T cells (Fig. 11 E and F).

The differentially expression of miR-181a and miR-200a was not confirmed (Fig. 11 C

and E). While miR-132 seemed to be more expressed in YFP+ cells (Fig. 11 D), in

contradiction to the initial screening data (Fig.10 B).

In sum, we could validate the expression pattern of 3 out of our 6 miRNA candidates,

and miR-132 showed an interesting differential expression in YFP+ compared to YFP-

CD8+ T cells which was not detected in the initial screening.


51

!!

4.6 RT-qPCR analysis of peripheral YFP+ versus YFP- CD8+ T cells from Ifng-YFP mice

!We further analyzed the expression of the six miRNA candidates in peripheral eYFP+

versus YFP- CD8+ T cells isolated from pooled LNs and spleen and investigated if the

differential expression detected in the thymus of the candidate miRNAs was

maintained in peripheral CD8+ T cell subsets.

!

Fig. 12 - RT-qPCR analysis of miRNA candidates in peripheral YFP+ versus YFP- CD8+ T cells from Ifng-YFP mice.

Quantitative RT-PCR analysis of (A) miR-139-5p, (B) miR-451, (C), miR-200a, (D) miR-132, (E) miR-181a-5p, (F) miR-

322-5p expression in peripheral CD8+ YFP+ and CD8+ YFP- T cells isolated from Ifng-YFP mice. Expression levels are

relative to the reference miRNA, miR-423-3p. The graphs show the geometric mean of the miRNA expression from

four independent experiments. *P < 0.05 and **P < 0.0021. ns – not significantly different.

!miR-139 was significantly higher expressed in YFP+ CD8+ T cells, P < 0.05, (Fig. 12 A)

when compared with their YFP- counterparts, in accordance with the thymic

expression pattern. By contrast, miR-451a and miR-200a were similarly expressed in

the two subsets (Fig.12 B and C).

miR-132 was significantly higher expressed in YFP+ CD8+ T cells (Fig.12 D), P <

0.0021, in accordance with the previous RT-qPCR profiling in thymic CD8+ T cells.

miR-181a showed a non-significant trend to be higher expressed in YFP- CD8+ T cells

(Fig.12 E). miR-322 was significantly higher expressed in the YFP- CD8+ T cells, P <

0.05 (Fig. 12 F), in accordance with the previous results in thymic CD8+ T cells. In


52

!conclusion, our expression analysis showed various expression patterns in our

miRNA candidates. miR-139 and miR-132 are consistently higher expressed in CD8+

YFP+ CD8+ T cells, and miR-322 is consistently higher expressed in YFP- CD8+ T cells

in both thymus and periphery, whereas another miRNA, e.g miR-451, only showed a

differential expression in the thymus. Additionally we could not confirm a significant

differential expression in miR-200a and miR-181a in neither the thymus nor the

periphery. !

4.7 Candidate miRNAs expression in T cells subsets !We further analysed the expression of our miRNAs candidates in other T cell subsets

such as CD4+ T cells, Tregs (CD4+ CD25+), γδ CD27+ and γδ CD27- T cells.

All of the miRNAs candidates were expressed in the different T cell subsets (Fig.13).

miR-139 was the most abundant miRNA in all subsets (Fig. 13 A), on the other hand

the least expressed miRNA in the majority of the subsets was miR-451a, being only

slightly more abundant in γδ CD27- T cells (Fig. 13 B).

miR-200a was highest expressed in CD8+ T cells and in γδ CD27+ T cells (Fig. 13 C),

two populations prone to produce IFN-γ. Interestingly, miR-132 displayed the opposite

expression pattern and was lowest expressed in naïve CD8+ T cells and in CD27+ γδ T

cells. As for miR-132, miR-322, and miR-181a, they were highest expressed in CD4+

T cells (Fig. 13 D, F and E).

The data shows that our six candidates are expressed in other T cell subsets rather

than being exclusive to CD8+ T cells and we detected distinct expression levels

ranging from low abundant e.g. miR-451, to highly abundant e.g. miR-181a.

Interestingly, some of the miRNAs seemed to be less expressed in subsets linked to

the production of IFN-γ, e.g. miR-132 and miR-322; whereas miR-200a was highly

expressed in those T cell subsets.


53

!

Fig. 13 - Candidate miRNAs expression in T cells subsets. Quantitative RT-PCR analysis of (A) miR-139, (B) miR-

451, (C) miR-200a, (D) miR-132, (E) miR-181a, (F) miR-322 expression in peripheral T cell subsets. Expression levels

are relative to the reference microRNA, miR-423-3p. The graphs show the geometric mean of the miRNA expression

from four independent experiments.

!

4.8 Candidate miRNAs expression under IFN-γ promoting conditions in vitro

!To address potential mechanisms that regulate the miRNA expression of our

candidates, we analysed their expression patterns under different IFN-γ promoting

conditions. We isolated peripheral CD8+ T cells and polarized them overnight in

different conditions and subsequently analysed the miRNA expression levels by RT-

qPCR. We either activated the CD8+ T cells just via TCR stimulation using plate-

bound anti-CD3 and anti-CD28 mAb, or activated the cells via TCR plus cytokines.

The cells were cultured in the presence of either IL- 12 plus IL-18 (a rapid IFN-γ

inducing cytokine cocktail208), or in the presence of IL-15 plus IL-2. IL-15 induces both

IFN-γ production in CD8+ T cells and the proliferation of memory-phenotype CD8+ T

cells. IL-2 supports the growth and survival of naïve T cells. Moreover we showed in

section 2 that in vitro stimulation with only IL-2 induces IFN-γ production in CD8+ T

cells.


54

!

!Fig. 14 - Candidate miRNAs expression under IFN-γ promoting conditions. Quantitative RT-PCR analysis of (A) miR-

139, (B) miR-451, (C) miR-200a, (D) miR-132, (E) miR-181a, (F) miR-322 expression in peripheral CD8+ T cells under

different culture conditions. Peripheral CD8+ T cells were stimulated over night with IL-12 plus IL-18 or IL-2 plus IL-15

with or without TCR activation (plate bound anti-CD3 and anti-CD28). The conditions are indicated below each graph.

Expression levels are relative to the reference microRNA, miR-423-3p. The graphs show the geometric mean of the

miRNA expression from four independent experiments.*P < 0.05.

!miR-139 was the miRNA with the highest expression levels and it was significantly

upregulated in the presence of IL-2 plus lL-15 (*P < 0.05) (Fig. 14 A). Of note, TCR/

CD28 stimulation plus IL-2 and IL-15 did not induce the expression of miR-139 (Fig.

14 A). miR-322 displayed a similar expression pattern (Fig. 14 F). The combination of

the two stimuli (TCR and cytokines) mostly caused a down regulation of the miRNA

expression compared to cytokines alone. miR-451a was the only miRNA upregulated

in all tested cytokine combinations, including in combination with TCR/ CD28

activation (*P < 0.05) (Fig. 14 B). On the contrary, miR-200a and miR-181a

expression levels exhibited no significant differences between the control and the

different stimuli, although both have the tendency to be higher expressed in the

condition of IL-2 plus IL-15 (Fig. 14 C and E).


55

!Interestingly, the expression of miR-132 was induced in conditions that trigger a rapid

production of IFN-γ by CD8+ T cells (Fig. 14 D). miR-132 was upregulated upon

incubation with IL-12 and IL-18 and, on contrary to the previous described miRNAs,

the TCR/ CD28 stimulus further increased miR-132 expression, suggesting a

synergetic effect of TCR/ CD28 plus cytokines (Fig. 14 D). The expression levels were

also upregulated in the presence of IL-2 plus IL-15 and TCR stimulation, *P < 0.05

(Fig. 14 D).

In sum, the expression of our six miRNAs candidates was influenced by the tested

stimuli. With the exception of two miRNAs, miR-200a and miR-181a, the expression of

the other miRNAs was upregulated in response to different stimuli. Of note, only miR-

132 and miR-451 were significantly upregulated in the condition that leads to rapid

IFN-γ production (IL-12 plus IL-18). Interestingly the expression levels of miR-132

were further upregulated upon cytokines plus TCR activation. The expression levels of

the others miRNAs were downregulated when TCR stimulation was added to the

cytokine cocktails.

4.9 - Overexpression of candidate miRNAs in the 3T3 cell line !To investigate the function of our candidate miRNAs in the differentiation of IFN-γ

producing CD8 T+ cells we chose an over-expression screening strategy. We used

retroviral vectors encoding the native precursor stem-loop to transduce activated

CD8+ T cells. The precursor stem loop has to be processed by the cellular miRNA

machinery, which avoids uncontrolled overexpression levels usually observed upon

transfection of mature miR mimics.

The retroviral vectors encoding the precursor stem loops were tested in the easy-to-

transduce 3T3 cell line to confirm that the transduction leads to an overexpression of

the respective miRNA. Furthermore with this test transduction we could evaluate the

produced viral titers. The RT-qPCR analysis of miRNA expression confirmed that

transduction with the cloned precursor stem loops induced a substantial increase in

the miRNAs expression levels of all our candidate miRNAs, ranging from 5 fold to

~5000 fold when compared to control cells (Fig. 15 A-F).


56

!

!Fig. 15 - Validation of candidate miRNA overexpression upon retroviral transduction. Quantitative RT-PCR analysis of

(A) miR-139, (B) miR-451, (C) miR-200a, (D) miR-132, (E) miR-181a, (F) miR-322 expression in 3T3 cells.

Expression levels are relative to the reference microRNA, miR-423-3p. Untransduced – mock-transduced cells. Ctrl -

scrambled sequence control.

!

4.10 miRNA-132-3p over-expression down-regulates IFN-γ production in peripheral CD8+ T cells

!To identify whether the candidate miRNAs had an impact on the differentiation of IFN-

γ producing CD8+ T cells we conducted an over-expressing screening with retroviral

vectors containing the precursor stem loop of miR-181a, miR-139, miR-200a or miR-

132. Total CD8+ T cells were sorted from C57BL/6 mice and activated for 48h,

followed by retroviral transduction with either a control vector expressing GFP or a

miRNA overexpressing vector, containing the native precursor stem loop of the

candidate miRNAs and an IRES-GFP site. 3 days after the retroviral transduction,

GFP+ (transduced) CD8+ T cells were sorted and stained for IFN-γ. Additionally we

analysed the expression of TNF-α, another cytokine produced by activated CD8+ T

cells, to investigate if potential effects on cytokine production are IFN-γ specific (Fig.

16 A).


57

!


58

!

!Fig. 16 - miRNA-132 overexpression down-regulates IFN-γ production in CD8+ T cells. Workflow of miRNAs over-

expression strategy in sorted peripheral naïve CD8+ T cells (A). Representative intracellular staining of peripheral

CD8+ T cells expressing either the retroviral GFP-control vector (Ctrl), or the retroviral vector containing the native

stem loop of miR-200a, miR-132, miR-181a or miR-139 (B). Histograms and graphs indicate the frequency of IFN-γ

and TNF-α producing CD8+ T cells. Validation of miR-132 overexpression experiment in CD8+ T cells (C). The graphs

indicate the frequency of IFN-γ and TNF-α producing CD8+ T cells.

We detected no difference in the frequency of IFN-γ and TNF-α producing CD8+ T

cells when overexpressing miR-200a, miR-181a and miR-139 (Fig.16 B). By contrast,

the overexpression of miR-132 reduced the frequency of IFN-γ-producing CD8+ T cells

(~ 20% reduction), whereas the frequency of TNF-α-producing CD8+ was unchanged,

thus confirming a specific role of miR-132 in the differentiation of IFN-γ-producing

CD8+ T cells (Fig.16 B). As validation we repeated the experiments 4 times and

confirmed that miR-132 overexpression significantly decreases the IFN-γ production in

peripheral CD8+ T cells (P < 0.05) (Fig. 16 C).

The results obtained so far indicate that miR-132 is implicated in the differentiation of

IFN-γ-producing CD8+ T cells, whereas the overexpression of the other miRNA

candidates did not influence IFN-γ production by peripheral CD8+ T cells.

!

4.11 mRNA targets of miR-132 !miRNAs mediate their functions by repressing sequence-specific target mRNAs. To

further explore how miR-132 is implicated in CD8+ T cell differentiation, we have

enquired its mRNA targets based on previous experimental evidence (validated

targets) (Table 2), or bioinformatics prediction tools (predicted targets) (Table 3). One

interesting validated target is STAT4 which is a critical transcription factor know to

drive the differentiation of Th1 (IFN-γ-producing ) CD4+ T cells. Additionally, Twist1

and Runx3 (predicted targets), are involved in the differentiation of IFN-γ producing T


59

!cells. Whereas Twist 1 is a negative regulator of IFN-γ differentiation, Runx3 is a

positive regulator of the effector CTL program in CD8+ T cells and drives IFN-γ

expression in CD8+ T cells by inducing Eomes 209. Future experiments, including RT-

qPCR analysis (in control CD8+ T cells versus miR-132-overexpressing CD8+ T cells)

will be performed to clarify which targets are important for the role of miR-132 in the

differentiation of IFN-γ producing CD8+ T cells.!!

Table 2 - Validated targets for the miR-132. List made from targets previously validated experimentally by reporter

assays, western blot or qPCR.

!

Table 3 - miR-132 bioinformatic predicted targets. Putative targets were chosen with a score of 3 out of 5 in the

bioinformatics programs. The Bioinformatic programs used were MIRanda, MirTarget2, PicTar, PITA and RNAhybrid

!!

Targets Reporter+Assays Western+Blot qPCREp300 x x xAChE xJarid1a xSTAT4 xIRAK4 x

Strong+EvidenceValidation+Methods

Gene MIRanda MirTarget2 PicTar PITA RNAhybrid6 SumTwist1 1 0 0 1 1 3IRF4 1 0 0 1 1 3Runx3 1 0 0 1 1 3

Predicted6targets6mmuBmiRB132

!

!

!!!!!!!!!

Discussion


61

!!

5 Discussion !miRNAs are key regulators of mammalian genome and add another layer of

complexity to the regulation of gene expression. During the last several years,

mounting evidence has shown that miRNAs are critical not only for the development

of immune cells, but also to regulate the function of both the innate and adaptive

arms of the immune system185,210,211. In this study we investigated the role of miRNAs

in the differentiation of IFN-γ−producing CD8+ T cells.

Others have previously shown that miRNA-deficient T cells exhibit defects in

proliferation and in the regulation of cytokine production164,165,212,213. Regarding CD8+

T cells it was also shown that in Dicer-deficient mice there is a decrease in the

numbers of CD8+ mature cells and a failure in CD8+ effector T cell expansion in

response to an infectious challenge in vivo 214. Notwithstanding, the ability of miRNA-

deficient CD8+ T cells to secrete IFN-γ had not been addressed.

In this study we used CD8+ T cells from pLck-Cre DICERfl/fl mice, as a source of

miRNA-deficient CD8+ T cells. In these mice miRNAs are absent from early T cell

development onwards. We showed that pLck-Cre DICERfl/fl mice have a significantly

increased frequency of IFN-γ producing CD8+ T cells (upon short restimulation in

vitro), both in the periphery and in the thymus when compared to wt controls. This

ability of rapid production of IFN-γ by naïve CD8+ T cells in pLck-Cre DICERfl/fl mice

suggests an important role for DICER/miRNAs in the post-transcriptional regulation

of IFN-γ expression and resembles the behavior of innate T cells, which rapidly

secrete cytokines after activation.

Conventional naïve CD8+ T cells require activation, expansion, and effector cell

differentiation before producing IFN-γ and participating in a protective immune

response. Memory CD8+ T cells are, in turn, major direct producers of IFN-γ 215.

Interestingly, a population of CD8+ T cells with “innate-like” function has been

described recently, that expresses a memory-like phenotype and can rapidly secrete

IFN-γ216. These innate-like CD8+ T cells have been identified in the thymus of several

gene-deficient mouse strains, including Itk, KLF2, CBP and Id3 knock-out mice 216,

have the CD44hiCD122+ phenotype and function of memory CD8+ T cells, without

previous exposure to antigens 216–218. These CD8+ T cells can rapidly secrete IFN-γ

upon stimulation with IL-12 and IL-18, and play important roles in the innate

response against infections such as Listeria monocytogenes, or chronic infections


62

!with viruses such as Herpes virus 208,215,219,220. Also interestingly, BALB/c but not

C57BL/6 mice have CD8 SP thymocytes that contain a distinct sub-population of

EomeshiT-betloCD44hiCD122hi innate phenotype CD8+ T cells that produce IFN-γ 221.

The detection of an increased frequency of IFN-γ producing CD8+ T cells in the

thymus of miRNA-deficient mice raises the possibility that miRNAs are important

negative regulators of the differentiation of innate-like CD8+ T cells. This specific

question will be addressed in future experiments where the expression of surface

markers of miRNA-deficient thymic CD8+T cells will be analysed (further discussed

below).

In this work we focused on deciphering which individual miRNA regulate the

differentiation of IFN-γ-producing CD8+ T cells. We performed a miRNA profiling in

thymic IFN-γ-expressing CD8+ T cells versus IFN-γ negative CD8+ T cells using Ifng-

YFP reporter (Yeti) mice. We reasoned that miRNAs with distinct abundance in YFP+

versus YFP- CD8+ T cells could be important mediators of IFN-γ differentiation in

CD8+ T cells. In total we identified 22 differentially expressed miRNAs.

For practical reasons, we narrowed down our initial list to the six microRNA

candidates that showed the highest differential expression in YFP+ versus YFP- CD8+

T cells. miR-139, miR-451a and miR-200a were significantly higher expressed in

YFP+ CD8+ thymocytes whereas miR-132, miR-322 and miR-181a were significantly

lower expressed in this cell population when compared to their YFP- counterparts.

We further validated the results of the qPCR profiling in peripheral CD8+ T cells as

well as in CD8+ thymocytes. The candidates showed a similar pattern of expression

in peripheral CD8+ T cells as in CD8+ thymocytes.

Our six miRNAs candidates were not exclusively expressed in CD8+ T cells, as they

were found in other T cells subsets. They had different levels of expression in each

subset, reinforcing the idea that miRNAs tend to be highly pleiotropic, with a given

miRNA having several functions and most likely different mRNA targets. Of note,

miR-200a was the only miRNA significantly higher expressed in CD8+ T cells.

We further investigated the role of IFN-γ driving-cytokines and TCR signalling on the

expression of our candidate miRNAs in CD8+ T cells. Based on previous knowledge

that activated murine T cells 222 and a subset of human CD8+ T cells express more

IL-12 and IL-18 receptors 223, and these activated CD8+ T cells are prone to produce

IFN-γ, we decided to analyze the influence of these cytokines in the production of our

candidate miRNAs. In addition we tested IL-15 and IL-2 conditions, which were

previously shown to induce IFNγ production224225. Moreover, IL-15 promotes the

proliferation of memory-phenotype CD8+ T cells 224 and IL-2 is known to support the


63

!growth and survival of naïve T cells 226. Our results showed that miR-139 and miR-

322 were the only miRNAs with higher expression with IL-2 plus IL-15, suggesting

that these miRNAs may be involved in memory CD8+ T cell development. This

possibility should be investigated in the future.

miR-132 was the most responsive of our miRNA candidates to the cytokines

promoting IFN-γ production and TCR signalling. Thus, the highest expression of miR-

132 was obtained with the combination of anti-CD3/anti-CD28 plus IL-12 and IL-18.

This cytokine combination has been shown to induce a rapid IFN-γ secretion by

CD8+ T cells and provide innate protection in a non–antigen-specific manner 208. In

addition Listeria monocytogenes infected macrophages secrete IL-12 and IL-18,

which act upon NK cells and primed T cells to induce the production of IFN-γ 223,227.

Thus our results suggest that miR-132 might be involved in a setting where IFN-γ is

rapidly produced and needed.

It was also curious to observe that only when the cells received TCR/ CD28 signals

there was a significant increase in the miR-132 expression by the IL-2 and IL-15,

suggesting that for these cytokines to have a significant impact in the miR-132

expression the cells may have to be previously activated. Since these cytokines

promote the differentiation of CD8+ T cells into memory CD8+ T cells, maybe miR-

132 is also important in memory CD8+ T cells.

The functional relevance of the all miRNA candidates could not be tested by an over-

expression screening due to technical limitations of the viral production. We were not

able to produce high viral titers for the overexpression constructs of miR-451 and

miR-322. Additionally, we performed our functional screening in peripheral CD8+ T

cells but not in CD8+ thymocytes as these cells are more difficult to transduce. We

could not obtain a level of transduced thymocytes to allow conclusive results.

Most retroviral vectors (RVs) are based on the molony murine leukemia virus

(MoMLV), which has a simple genome encoding the gag, pol, and env, flanked by

long terminal repeats (LTR) 228. Upon cell entry, the RNA is copied by the reverse

transcriptase enzyme into double-stranded DNA, which becomes stably integrated

into one of the host chromosomes, thus allowing long-term expression of inserted

genes 229. Using a stable transduction with the original stem loop of our miRNA

contributes to a more physiological result avoiding false positive results introduced by

supra-physiological increase in miRNA levels generally achieved after transient

transfection 230.

Despite the fact that the transgene is integrated into the host cell genome, by the

retroviral vectors, persistent gene expression is not guaranteed as silencing of


64

!transcriptional units may occur over time 231. Another major limitation of RVs is their

inability to infect non-dividing cells. This is due to the fact that the pre-integration

complex cannot cross the intact nuclear membrane, which is only disassembled

during mitosis 229. To over-come this obstacle we had to culture the cells always with

plate-bound anti-CD3 and anti-CD28 mAb.

The production of the retroviral vectors is a crucial step for the success of the

experiments, and there are some factors that influence the vector production and

titers, such as the construction of the vector backbone232 and the transgene to

transfer229, extracellular factors, culture conditions of the packaging cells and

harvesting the virus. In general, a bigger vector size leads to a lower efficiency of

viral particles, which can be neglected in our case as the miRNA cassettes were very

small ~400bp. In addition, the expression of the transgene can be toxic for the

producer cells or can significantly reduce vector production (e.g. GFP or miRNA

itself). This could have influenced the titers and the production of some vectors, such

as miR-451 and miR-322.

Our viral vectors were produced in mammalian adherent cell line, HEK 293T (Human

embryonic kidney 293 cells with large T antigen) cell line. These cells produce

variable quantities of extracellular matrix proteins partially consisting of

proteoglycans. These macromolecules are negatively charged, of variable size, and

act as inhibitors during cell transduction, thus eventually reducing significantly the

transduction efficiency despite high vector titers 233,234. To avoid this problem, a

suspension cell line could be used to produce the virus.

The replacement of glucose by fructose in the culture medium has also been

described as having potential for improving vector production rates and titers 235, but

this would need to be tested in our cultures.

In sum, future experiments are needed to optimize the viral transduction efficiency in

CD8+ thymocytes and peripheral T cells. If these technical limitations are solved,

retroviral-mediated over-expression or knock-down strategies of individual miRNAs

are a powerful tool to study the role of miRNAs in cell differentiation.

The over expression of miR-139, miR-181a and miR-200a had no significant impact

on IFN-γ production by CD8+ T cells , but the over-expression of miR-132 resulted in

decreased production of IFN-γ in peripheral CD8+ T cells. In line with this is the

observation that in human NK cells both the miR-132/miR-212 cluster and miR-200a

are negative feedback regulator of IL-12 signalling through targeting of STAT4, an

inducer of IFN-γ production 236. It is possible, thus, that miR-132 may also target

STAT4 in CD8+ T cells. Of note is the fact that, in our experiments, the expression of


65

!miR-200a in CD8+ T cells was not influenced by the cytokines IL-12 and IL-18 as

shown for human NK cells237. This suggests that the role of miR-200a might be

dissociated from the control of IFN-γ in CD8+ T cells.

In vivo, cytokine-mediated T cell activation is in many ways a double-edged sword. In

some cases, bystander T cell activation can be beneficial as is the case when CD8+

T cells produce IFN-γ in response to cytokines triggered by infection with Listeria

monocytogenes and provide innate protection. On the other hand, endotoxic shock

associated with Gram-negative bacteria can be exacerbated by a cytokine storm that

includes IFN-γ-mediated immunopathology due to CD8+ T cells and NK cells 238.

Therefore the miR-132-based regulation may constitute an important negative

feedback mechanism to prevent the IFN-γ mediated immunopathology in bacterial

infection or in autoimmune pathology.

The most striking evidence, so far, for the effect of miR-132 in the immune system

comes from a mouse model deficient in the miR-212/132 cluster (where miR-132 and

miR-212, which are tandem miRNAs at the same chromosomal location and sharing

close sequences, are simultaneously removed). These mice have higher resistance

to the development of experimental autoimmune encephalomyelitis (EAE), a

prototype for T-cell-mediated autoimmune disease in general, and lower frequencies

of Th1 T cells, responsible for IFN-γ production 239. These results do not go along

with our overexpression phenotype in which excess of miR132 instead causes a

decrease in IFN-γ production. As the loss of function phenotype comes from a double

knockout mouse, we cannot discard the possibility that the role of miR-212 is distinct

from that of miR-132. It will be important to clarify these issues in future experiments,

where the outcome of overexpression studies with miR-212 alone or both miR-212

and miR-132 should be analyzed.

Finally, we investigated miR-132 potential mRNA targets based on literature search

and bioinformatic analyses. Several of the validated targets for miR-132 found in the

literature are known players involved in the inflammatory and IFN-γ response,

including Stat4 AChE, HB-EGF, p300, MeCP2 and SirT1.

Stat4 is a critical Th1 driving transcription factor and acts together with STAT1 to

induce T-bet. It still remains to be established if Stat4 is also implicated in the

differentiation of IFN-γ-producing CD8+ cells.

Runx3 is one of the predicted targets that came out of our bioinformatics analysis.

Runx3 is present in naive CD8+ T cells before activation and has a positive role in the

induction of Eomesodermin (Eomes), granzyme B, perforin, and IFN-γ 240 and it is

also involved in CD8+ effector T cell differentiation 241. This is an interesting


66

!candidate that being targeted by miR-132 could down-regulate the production of IFN-

γ, as it directly impacts on the master transcription factor Eomes.

Another predicted target is the transcription factor Twist1. In Th1 cells, NF-kB, NFAT,

and IL-12/STAT4 signalling can induce Twist1 expression, and Twist1 limits

inflammation by suppressing IFN-γ and TNF-α production by decreasing expression

and function of transcription factors, including T-bet, Stat4, and Runx3 242. The

precise role of this transcription factor remains to be established in CD8+ T cells but

the fact that miR-132 overexpression decreases IFN-γ+ CD8+ T cell frequency does

not go along with the observation that Twist1 represses IFN-γ production in CD4+ T

cells.28. The targeting of this transcription factor may be an example where the

miRNA activates the expression rather than represses it, as it has been reported

during the last years by several groups 243–246 247. If that were the case, then the over-

expression of miR-132 would activate the expression of Twist1, which would

decrease T-bet, STAT4 and Runx3, decreasing as well the IFN-γ production.

In addition to analyzing already validated or bioinformatics-predicted mRNA targets,

further experimental studies will be needed to identify novel targets that could explain

the IFN-γ phenotype in miR-132 overexpressing CD8+T cells. One method to use

could be differential! high-throughput sequencing of RNA isolated by crosslinking

immunoprecipitation (HITS-CLIP) analysis. This technique uses ultraviolet irradiation

to covalently crosslink RNA–protein (Ago-RNA) complexes that are in direct contact

and partial RNA digestion to reduce bound RNA to fragments that can be sequenced

by high-throughput methods. Ago HITS-CLIP can simultaneously identify Ago-bound

miRNAs and the nearby mRNA sites 248. This should be complemented by luciferase

reporter assay as a final confirmation that a given mRNA is targeted by a specific

miRNA.

To characterize a possible role of our candidate miRNAs in IFN-γ producing CD8+ T

cells differentiation, it would be interesting to perform in vitro experiments, such as

reaggregate thymic organ cultures (RTOC), where our miRNA of interest would be

over-expressed in CD8+ thymocytes during their development. With this tool we could

characterize the development of CD8+ T cells, and check for surface markers that

could indicate if there was a bias towards the development of memory like phenotype

CD8+ T cells, the so called “innate-like CD8+T cells”.

In summary, we identified miR-132 as a negative feedback regulator of IFN-γ

production in CD8+ T cells. We additionally showed, that miR-132 expression is

modulated by cytokines promoting IFN-γ production. Several promising mRNA

targets of miR-132 include the known STAT4 and the novel predicted Twist1 and


67

!Runx3. Future experiments will address if these targets are responsible for the

observed phenotype. Collectively, miR-132 is likely to play an important role in the

differentiation of IFN-γ producing CD8+ T cells, which are crucial in immune

responses against intracellular pathogens and tumours.

!

Bibliography


69

!

6 Bibliography !

1. Flajnik, M. F. & Kasahara, M. Origin and evolution of the adaptive immune system: genetic events and selective pressures. Nat. Rev. Genet. 11, 47–59 (2010).

2. Ostrand-Rosenberg, S. Immune surveillance: a balance between protumor and antitumor immunity. Curr. Opin. Genet. Dev. 18, 11–8 (2008).

3. Pancer, Z. & Cooper, M. D. The evolution of adaptive immunity. Annu. Rev. Immunol. 24, 497–518 (2006).

4. Murphy, K. M., Mowat, A. & Weaver, C. T. Garland Science - Janeway’s Immunobiology, Eighth Edition Resources. (Garland Science, Taylor & Francis Group, LLC, 2012).

5. Smith-Garvin, J. E., Koretzky, G. A. & Jordan, M. S. T cell activation. Annu. Rev. Immunol. 27, 591–619 (2009).

6. Martin, P. J., Akatsuka, Y., Hahne, M. & Sale, G. Involvement of donor T-cell cytotoxic effector mechanisms in preventing allogeneic marrow graft rejection. Blood 92, 2177–81 (1998).

7. Gudjonsson, J. E., Johnston, A., Sigmundsdottir, H. & Valdimarsson, H. Immunopathogenic mechanisms in psoriasis. Clin. Exp. Immunol. 135, 1–8 (2004).

8. Kurts, C. et al. CD8 T cell ignorance or tolerance to islet antigens depends on antigen dose. Proc. Natl. Acad. Sci. U. S. A. 96, 12703–7 (1999).

9. Kägi, D. et al. Reduced incidence and delayed onset of diabetes in perforin-deficient nonobese diabetic mice. J. Exp. Med. 186, 989–97 (1997).

10. Huseby, E. S. et al. A pathogenic role for myelin-specific CD8(+) T cells in a model for multiple sclerosis. J. Exp. Med. 194, 669–76 (2001).

11. Kang, Y. M. et al. CD8 T cells are required for the formation of ectopic germinal centers in rheumatoid synovitis. J. Exp. Med. 195, 1325–36 (2002).

12. Seder, R. a & Ahmed, R. Similarities and differences in CD4+ and CD8+ effector and memory T cell generation. Nat. Immunol. 4, 835–42 (2003).

13. Cox, M., Kahan, S. & Zajac, A. Anti-viral CD8 T cells and the cytokines that they love. Virology 435, 157–169 (2013).

14. Chowdhury, D. & Lieberman, J. Death by a thousand cuts: granzyme pathways of programmed cell death. Annu. Rev. Immunol. 26, 389–420 (2008).


70

!15. Pearce, E. L. et al. Control of effector CD8+ T cell function by the transcription

factor Eomesodermin. Science 302, 1041–3 (2003).

16. Intlekofer, A. M. et al. Effector and memory CD8+ T cell fate coupled by T-bet and eomesodermin. Nat. Immunol. 6, 1236–44 (2005).

17. Valenzuela, J., Schmidt, C. & Mescher, M. The roles of IL-12 in providing a third signal for clonal expansion of naive CD8 T cells. J. Immunol. 169, 6842–9 (2002).

18. Cox, M., Harrington, L. & Zajac, A. Cytokines and the Inception of CD8 T Cell Responses. Trends Immunol. 32, 180–186 (2011).

19. Slifka, M. K. & Whitton, J. L. Antigen-Specific Regulation of T Cell–Mediated Cytokine Production. Immunity 12, 451–457 (2000).

20. Berke, G. The CTL’s kiss of death. Cell 81, 9–12 (1995).

21. Shresta, S., Pham, C. T., Thomas, D. A., Graubert, T. A. & Ley, T. J. How do cytotoxic lymphocytes kill their targets? Curr. Opin. Immunol. 10, 581–7 (1998).

22. Ebnet, K. et al. Granzyme A-deficient mice retain potent cell-mediated cytotoxicity. EMBO J. 14, 4230–9 (1995).

23. Heusel, J. W., Wesselschmidt, R. L., Shresta, S., Russell, J. H. & Ley, T. J. Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA fragmentation and apoptosis in allogeneic target cells. Cell 76, 977–87 (1994).

24. Harty, J. T. & Bevan, M. J. Responses of CD8(+) T cells to intracellular bacteria. Curr. Opin. Immunol. 11, 89–93 (1999).

25. Badovinac, V. P., Corbin, G. A. & Harty, J. T. Cutting edge: OFF cycling of TNF production by antigen-specific CD8+ T cells is antigen independent. J. Immunol. 165, 5387–91 (2000).

26. Slifka, M. K., Rodriguez, F. & Whitton, J. L. Rapid on/off cycling of cytokine production by virus-specific CD8+ T cells. Nature 401, 76–9 (1999).

27. Harty, J. T., Tvinnereim, a R. & White, D. W. CD8+ T cell effector mechanisms in resistance to infection. Annu. Rev. Immunol. 18, 275–308 (2000).

28. Masopust, D., Vezys, V., Marzo, A. L. & Lefrançois, L. Preferential localization of effector memory cells in nonlymphoid tissue. Science 291, 2413–7 (2001).

29. Green, J. A., Cooperband, S. R. & Kibrick, S. Immune specific induction of interferon production in cultures of human blood lymphocytes. Science 164, 1415–7 (1969).

30. Huang, S. et al. Immune response in mice that lack the interferon-gamma receptor. Science 259, 1742–5 (1993).


71

!31. Pearl, J. E., Saunders, B., Ehlers, S., Orme, I. M. & Cooper, A. M.

Inflammation and lymphocyte activation during mycobacterial infection in the interferon-gamma-deficient mouse. Cell. Immunol. 211, 43–50 (2001).

32. Van den Broek, M. F., Müller, U., Huang, S., Aguet, M. & Zinkernagel, R. M. Antiviral defense in mice lacking both alpha/beta and gamma interferon receptors. J. Virol. 69, 4792–6 (1995).

33. Buchmeier, N. A. & Schreiber, R. D. Requirement of endogenous interferon-gamma production for resolution of Listeria monocytogenes infection. Proc. Natl. Acad. Sci. 82, 7404–7408 (1985).

34. Kamijo, R. et al. Generation of nitric oxide and induction of major histocompatibility complex class II antigen in macrophages from mice lacking the interferon gamma receptor. Proc. Natl. Acad. Sci. U. S. A. 90, 6626–30 (1993).

35. Street, S. E. A., Trapani, J. A., MacGregor, D. & Smyth, M. J. Suppression of lymphoma and epithelial malignancies effected by interferon gamma. J. Exp. Med. 196, 129–34 (2002).

36. Kaplan, D. H. et al. Demonstration of an interferon gamma-dependent tumor surveillance system in immunocompetent mice. Proc. Natl. Acad. Sci. U. S. A. 95, 7556–61 (1998).

37. Zaidi, M. R. & Merlino, G. The two faces of interferon-γ in cancer. Clin. Cancer Res. 17, 6118–24 (2011).

38. Miller, C. H. T., Maher, S. G. & Young, H. A. Clinical Use of Interferon-gamma. Ann. N. Y. Acad. Sci. 1182, 69–79 (2009).

39. Lawson, B. R. et al. Treatment of murine lupus with cDNA encoding IFN-gammaR/Fc. J. Clin. Invest. 106, 207–15 (2000).

40. Masutani, K. et al. Predominance of Th1 immune response in diffuse proliferative lupus nephritis. Arthritis Rheum. 44, 2097–106 (2001).

41. Nicoletti, F. et al. The effects of a nonimmunogenic form of murine soluble interferon-gamma receptor on the development of autoimmune diabetes in the NOD mouse. Endocrinology 137, 5567–75 (1996).

42. Alimi, E., Huang, S., Brazillet, M. P. & Charreire, J. Experimental autoimmune thyroiditis (EAT) in mice lacking the IFN-gamma receptor gene. Eur. J. Immunol. 28, 201–8 (1998).

43. Spriggs, M. K. One step ahead of the game: viral immunomodulatory molecules. Annu. Rev. Immunol. 14, 101–30 (1996).

44. Tortorella, D. & Gewurz, B. Viral subversion of the immune system. Annu. Rev. 861–926 (2000).

45. Wherry, E. J. et al. Lineage relationship and protective immunity of memory CD8 T cell subsets. Nat. Immunol. 4, 225–34 (2003).


72

!46. Bachmann, M. F., Barner, M., Viola, A. & Kopf, M. Distinct kinetics of cytokine

production and cytolysis in effector and memory T cells after viral infection. Eur. J. Immunol. 29, 291–9 (1999).

47. Cerwenka, A., Morgan, T. M. & Dutton, R. W. Naive, effector, and memory CD8 T cells in protection against pulmonary influenza virus infection: homing properties rather than initial frequencies are crucial. J. Immunol. 163, 5535–43 (1999).

48. Kaech, S. M., Hemby, S., Kersh, E. & Ahmed, R. Molecular and functional profiling of memory CD8 T cell differentiation. Cell 111, 837–51 (2002).

49. Hamann, A., Klugewitz, K., Austrup, F. & Jablonski-Westrich, D. Activation induces rapid and profound alterations in the trafficking of T cells. Eur. J. Immunol. 30, 3207–18 (2000).

50. Kaech, S. M., Wherry, E. J. & Ahmed, R. Effector and memory T-cell differentiation: implications for vaccine development. Nat. Rev. Immunol. 2, 251–62 (2002).

51. Oehen, S. & Brduscha-Riem, K. Differentiation of naive CTL to effector and memory CTL: correlation of effector function with phenotype and cell division. J. Immunol. 161, 5338–46 (1998).

52. Murali-Krishna, K. et al. Counting antigen-specific CD8 T cells: a reevaluation of bystander activation during viral infection. Immunity 8, 177–87 (1998).

53. York, I. A. et al. A cytosolic herpes simplex virus protein inhibits antigen presentation to CD8+ T lymphocytes. Cell 77, 525–535 (1994).

54. Topham, D. J., Tripp, R. A. & Doherty, P. C. CD8+ T cells clear influenza virus by perforin or Fas-dependent processes. J. Immunol. 159, 5197–200 (1997).

55. Bi, Z., Barna, M., Komatsu, T. & Reiss, C. Vesicular stomatitis virus infection of the central nervous system activates both innate and acquired immunity. J. Virol. 69, 6466–6472 (1995).

56. Kerksiek, K. M. & Pamer, E. G. T cell responses to bacterial infection. Curr. Opin. Immunol. 11, 400–5 (1999).

57. White, D. W., Wilson, R. L. & Harty, J. T. CD8+ T cells in intracellular bacterial infections of mice. Res. Immunol. 147, 519–24

58. Flynn, J. L. et al. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J. Exp. Med. 178, 2249–54 (1993).

59. Flynn, J. L. et al. Tumor necrosis factor-alpha is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 2, 561–72 (1995).

60. Starnbach, M. N., Bevan, M. J. & Lampe, M. F. Protective cytotoxic T lymphocytes are induced during murine infection with Chlamydia trachomatis. J. Immunol. 153, 5183–9 (1994).


73

!61. Swann, J. & Smyth, M. Immune surveillance of tumors. J. Clin. Invest. 117,

1137–1146 (2007).

62. Santamaria, P. Effector lymphocytes in islet cell autoimmunity. Rev. Endocr. Metab. Disord. 4, 271–80 (2003).

63. Steinhoff, U. et al. Autoimmune intestinal pathology induced by hsp60-specific CD8 T cells. Immunity 11, 349–58 (1999).

64. Brimnes, J. et al. Defects in CD8+ regulatory T cells in the lamina propria of patients with inflammatory bowel disease. J. Immunol. 174, 5814–22 (2005).

65. Babbe, H. et al. Clonal expansions of CD8(+) T cells dominate the T cell infiltrate in active multiple sclerosis lesions as shown by micromanipulation and single cell polymerase chain reaction. J. Exp. Med. 192, 393–404 (2000).

66. Walter, U. & Santamaria, P. CD8+ T cells in autoimmunity. Curr. Opin. Immunol. 17, 624–31 (2005).

67. Han, B. et al. Prevention of diabetes by manipulation of anti-IGRP autoimmunity: high efficiency of a low-affinity peptide. Nat. Med. 11, 645–52 (2005).

68. Gronski, M. A. et al. TCR affinity and negative regulation limit autoimmunity. Nat. Med. 10, 1234–9 (2004).

69. Santamaria, P. Effector lymphocytes in autoimmunity. Curr. Opin. Immunol. 13, 663–9 (2001).

70. Cohen, E. S. & Bodmer, H. C. Cytotoxic T lymphocytes recognize and lyse chondrocytes under inflammatory, but not non-inflammatory conditions. Immunology 109, 8–14 (2003).

71. Sambandam, A. et al. Progenitor migration to the thymus and T cell lineage commitment. Immunol. Res. 42, 65–74 (2008).

72. Hale, J. & Fink, P. Back to the Thymus: Peripheral T Cells Come Home. Immunol. Cell Biol. 87, 58–64 (2008).

73. Petrie, H. T. & Zúñiga-Pflücker, J. C. Zoned out: functional mapping of stromal signaling microenvironments in the thymus. Annu. Rev. Immunol. 25, 649–79 (2007).

74. Schwarz, B. A. & Bhandoola, A. Circulating hematopoietic progenitors with T lineage potential. Nat. Immunol. 5, 953–60 (2004).

75. Bell, J. J. & Bhandoola, A. The earliest thymic progenitors for T cells possess myeloid lineage potential. Nature 452, 764–7 (2008).

76. Scollay, R. & Godfrey, D. I. Thymic emigration: conveyor belts or lucky dips? Immunol. Today 16, 268–73; discussion 273–4 (1995).


74

!77. Misslitz, A. et al. Thymic T cell development and progenitor localization

depend on CCR7. J. Exp. Med. 200, 481–91 (2004).

78. Porritt, H. E., Gordon, K. & Petrie, H. T. Kinetics of steady-state differentiation and mapping of intrathymic-signaling environments by stem cell transplantation in nonirradiated mice. J. Exp. Med. 198, 957–62 (2003).

79. Lind, E. F., Prockop, S. E., Porritt, H. E. & Petrie, H. T. Mapping precursor movement through the postnatal thymus reveals specific microenvironments supporting defined stages of early lymphoid development. J. Exp. Med. 194, 127–34 (2001).

80. Ceredig, R. & Schreyer, M. Immunohistochemical localization of host and donor-derived cells in the regenerating thymus of radiation bone marrow chimeras. Thymus 6, 15–26 (1984).

81. Petrie, H. T. Cell migration and the control of post-natal T-cell lymphopoiesis in the thymus. Nat. Rev. Immunol. 3, 859–66 (2003).

82. Godfrey, D. I., Kennedy, J., Suda, T. & Zlotnik, A. A developmental pathway involving four phenotypically and functionally distinct subsets of CD3-CD4-CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25 expression. J. Immunol. 150, 4244–52 (1993).

83. Dunon, D. et al. Ontogeny of the immune system: gamma/delta and alpha/beta T cells migrate from thymus to the periphery in alternating waves. J. Exp. Med. 186, 977–88 (1997).

84. Von Boehmer, H. Selection of the T-cell repertoire: receptor-controlled checkpoints in T-cell development. Adv. Immunol. 84, 201–38 (2004).

85. Jameson, S. C., Hogquist, K. A. & Bevan, M. J. Positive selection of thymocytes. Annu. Rev. Immunol. 13, 93–126 (1995).

86. Singer, A., Adoro, S. & Park, J. Lineage fate and intense debate: myths, models and mechanisms of CD4/CD8 lineage choice. Nat. Rev. Immunol. 8, 788–801 (2008).

87. Kyewski, B. & Klein, L. A central role for central tolerance. Annu. Rev. Immunol. 24, 571–606 (2006).

88. Gallegos, A. M. & Bevan, M. J. Central tolerance: good but imperfect. Immunol. Rev. 209, 290–6 (2006).

89. Mathis, D. & Benoist, C. Back to central tolerance. Immunity 20, 509–16 (2004).

90. Arens, R. & Schoenberger, S. P. Plasticity in programming of effector and memory CD8 T cells formation. 235, 190–205cu (2010).

91. Zúñiga-Pflücker, J. C. T-cell development made simple. Nat. Rev. Immunol. 4, 67–72 (2004).


75

!92. Mescher, M. F. et al. Signals required for programming effector and memory

development by CD8+ T cells. Immunol. Rev. 211, 81–92 (2006).

93. Jung, S. et al. In vivo depletion of CD11c+ dendritic cells abrogates priming of CD8+ T cells by exogenous cell-associated antigens. Immunity 17, 211–20 (2002).

94. Viola, A. & Lanzavecchia, A. T cell activation determined by T cell receptor number and tunable thresholds. Science 273, 104–6 (1996).

95. Bandyopadhyay, S., Soto-Nieves, N. & Macián, F. Transcriptional regulation of T cell tolerance. Semin. Immunol. 19, 180–7 (2007).

96. Williams, M. a & Bevan, M. J. Effector and memory CTL differentiation. Annu. Rev. Immunol. 25, 171–92 (2007).

97. Weninger, W. & Andrian, U. H. Von. Migration and differentiation of CD8 π T cells. 221–233

98. Wong, P. & Pamer, E. G. Cutting edge: antigen-independent CD8 T cell proliferation. J. Immunol. 166, 5864–8 (2001).

99. Lee, W. T., Pasos, G., Cecchini, L. & Mittler, J. N. Continued antigen stimulation is not required during CD4(+) T cell clonal expansion. J. Immunol. 168, 1682–9 (2002).

100. Gudmundsdottir, H., Wells, A. D. & Turka, L. A. Dynamics and requirements of T cell clonal expansion in vivo at the single-cell level: effector function is linked to proliferative capacity. J. Immunol. 162, 5212–23 (1999).

101. Jelley-Gibbs, D. M., Lepak, N. M., Yen, M. & Swain, S. L. Two distinct stages in the transition from naive CD4 T cells to effectors, early antigen-dependent and late cytokine-driven expansion and differentiation. J. Immunol. 165, 5017–26 (2000).

102. Butz, E. A. & Bevan, M. J. Massive expansion of antigen-specific CD8+ T cells during an acute virus infection. Immunity 8, 167–75 (1998).

103. Doherty, P. C. The numbers game for virus-specific CD8+ T cells. Science 280, 227 (1998).

104. D’Souza, W. N. & Lefrançois, L. IL-2 is not required for the initiation of CD8 T cell cycling but sustains expansion. J. Immunol. 171, 5727–35 (2003).

105. D’Souza, W. N., Schluns, K. S., Masopust, D. & Lefrançois, L. Essential role for IL-2 in the regulation of antiviral extralymphoid CD8 T cell responses. J. Immunol. 168, 5566–72 (2002).

106. Williams, M. A., Tyznik, A. J. & Bevan, M. J. Interleukin-2 signals during priming are required for secondary expansion of CD8+ memory T cells. Nature 441, 890–3 (2006).


76

!107. Janssen, E. M. et al. CD4+ T cells are required for secondary expansion and

memory in CD8+ T lymphocytes. Nature 421, 852–6 (2003).

108. Sun, J. C. & Bevan, M. J. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 300, 339–42 (2003).

109. Shedlock, D. J. & Shen, H. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science 300, 337–9 (2003).

110. Sun, J. C., Williams, M. A. & Bevan, M. J. CD4+ T cells are required for the maintenance, not programming, of memory CD8+ T cells after acute infection. Nat. Immunol. 5, 927–33 (2004).

111. Hikono, H. et al. Activation phenotype, rather than central- or effector-memory phenotype, predicts the recall efficacy of memory CD8+ T cells. J. Exp. Med. 204, 1625–36 (2007).

112. Klonowski, K. D. et al. Dynamics of Blood-Borne CD8 Memory T Cell Migration In Vivo. Immunity 20, 551–562 (2004).

113. Seder, R. A., Darrah, P. A. & Roederer, M. T-cell quality in memory and protection: implications for vaccine design. Nat. Rev. Immunol. 8, 247–58 (2008).

114. Kaech, S. M. & Wherry, E. J. Heterogeneity and cell-fate decisions in effector and memory CD8+ T cell differentiation during viral infection. Immunity 27, 393–405 (2007).

115. Arsenio, J. et al. Early specification of CD8+ T lymphocyte fates during adaptive immunity revealed by single-cell gene-expression analyses. Nat. Immunol. 15, 365–72 (2014).

116. Lodish, H. F., Zhou, B., Liu, G. & Chen, C.-Z. Micromanagement of the immune system by microRNAs. Nat. Rev. Immunol. 8, 120–30 (2008).

117. Friedman, R. C., Farh, K. K.-H., Burge, C. B. & Bartel, D. P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 19, 92–105 (2009).

118. Bartel, D. P. MicroRNAs: target recognition and regulatory functions. Cell 136, 215–33 (2009).

119. Pasquinelli, A. E. MicroRNAs and their targets: recognition, regulation and an emerging reciprocal relationship. Nat. Rev. Genet. 13, 271–82 (2012).

120. Gangaraju, V. K. & Lin, H. MicroRNAs: key regulators of stem cells. Nat. Rev. Mol. Cell Biol. 10, 116–25 (2009).

121. Bushati, N. & Cohen, S. M. microRNA functions. Annu. Rev. Cell Dev. Biol. 23, 175–205 (2007).

122. Davis, B. N. & Hata, A. Regulation of MicroRNA Biogenesis: A miRiad of mechanisms. Cell Commun. Signal. 7, 18 (2009).


77

!123. Krol, J., Loedige, I. & Filipowicz, W. The widespread regulation of microRNA

biogenesis, function and decay. Nat. Rev. Genet. 11, 597–610 (2010).

124. Olena, A. F. & Patton, J. G. Genomic organization of microRNAs. J. Cell. Physiol. 222, 540–5 (2010).

125. Saini, H. K., Griffiths-Jones, S. & Enright, A. J. Genomic analysis of human microRNA transcripts. Proc. Natl. Acad. Sci. U. S. A. 104, 17719–24 (2007).

126. Rodriguez, A., Griffiths-Jones, S., Ashurst, J. L. & Bradley, A. Identification of mammalian microRNA host genes and transcription units. Genome Res. 14, 1902–10 (2004).

127. Lee, Y. et al. MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 23, 4051–60 (2004).

128. Cai, X., Hagedorn, C. H. & Cullen, B. R. Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. RNA 10, 1957–66 (2004).

129. Lee, Y., Jeon, K., Lee, J.-T., Kim, S. & Kim, V. N. MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, 4663–70 (2002).

130. Denli, A. M., Tops, B. B. J., Plasterk, R. H. A., Ketting, R. F. & Hannon, G. J. Processing of primary microRNAs by the Microprocessor complex. Nature 432, 231–5 (2004).

131. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415–9 (2003).

132. Meister, G. et al. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol. Cell 15, 185–97 (2004).

133. Okamura, K., Hagen, J. W., Duan, H., Tyler, D. M. & Lai, E. C. The mirtron pathway generates microRNA-class regulatory RNAs in Drosophila. Cell 130, 89–100 (2007).

134. Bohnsack, M. T., Czaplinski, K. & Gorlich, D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10, 185–91 (2004).

135. Lund, E., Güttinger, S., Calado, A., Dahlberg, J. E. & Kutay, U. Nuclear export of microRNA precursors. Science 303, 95–8 (2004).

136. Hutvágner, G. et al. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834–8 (2001).

137. Ketting, R. F. et al. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev. 15, 2654–9 (2001).


78

!138. Saito, K., Ishizuka, A., Siomi, H. & Siomi, M. C. Processing of pre-microRNAs

by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol. 3, e235 (2005).

139. Förstemann, K. et al. Normal microRNA maturation and germ-line stem cell maintenance requires Loquacious, a double-stranded RNA-binding domain protein. PLoS Biol. 3, e236 (2005).

140. Chendrimada, T. P. et al. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436, 740–4 (2005).

141. Lau, N. C., Lim, L. P., Weinstein, E. G. & Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858–62 (2001).

142. Aravin, A. A. et al. The small RNA profile during Drosophila melanogaster development. Dev. Cell 5, 337–50 (2003).

143. Lagos-Quintana, M. et al. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12, 735–9 (2002).

144. Murchison, E. P. & Hannon, G. J. miRNAs on the move: miRNA biogenesis and the RNAi machinery. Curr. Opin. Cell Biol. 16, 223–9 (2004).

145. Hutvagner, G. & Simard, M. J. Argonaute proteins: key players in RNA silencing. Nat. Rev. Mol. Cell Biol. 9, 22–32 (2008).

146. MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V & Doudna, J. A. In vitro reconstitution of the human RISC-loading complex. Proc. Natl. Acad. Sci. U. S. A. 105, 512–7 (2008).

147. Maniataki, E. & Mourelatos, Z. A human, ATP-independent, RISC assembly machine fueled by pre-miRNA. Genes Dev. 19, 2979–90 (2005).

148. Hutvagner, G. Small RNA asymmetry in RNAi: function in RISC assembly and gene regulation. FEBS Lett. 579, 5850–7 (2005).

149. Filipowicz, W., Jaskiewicz, L., Kolb, F. A. & Pillai, R. S. Post-transcriptional gene silencing by siRNAs and miRNAs. Curr. Opin. Struct. Biol. 15, 331–41 (2005).

150. Filipowicz, W., Bhattacharyya, S. N. & Sonenberg, N. Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat. Rev. Genet. 9, 102–14 (2008).

151. Rana, T. M. Illuminating the silence: understanding the structure and function of small RNAs. Nat. Rev. Mol. Cell Biol. 8, 23–36 (2007).

152. Bartel, D. P., Lee, R. & Feinbaum, R. MicroRNAs,: Genomics , Biogenesis , Mechanism , and Function Genomics,: The miRNA Genes. 116, 281–297 (2004).


79

!153. Ro, S., Park, C., Young, D., Sanders, K. M. & Yan, W. Tissue-dependent

paired expression of miRNAs. Nucleic Acids Res. 35, 5944–53 (2007).

154. Krol, J., Loedige, I. & Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet. 11, 597–610 (2010).

155. Hutvágner, G. & Zamore, P. D. A microRNA in a multiple-turnover RNAi enzyme complex. Science 297, 2056–60 (2002).

156. Lewis, B. P., Burge, C. B. & Bartel, D. P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120, 15–20 (2005).

157. Béthune, J., Artus-Revel, C. G. & Filipowicz, W. Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells. EMBO Rep. 13, 716–23 (2012).

158. Guo, H., Ingolia, N. T., Weissman, J. S. & Bartel, D. P. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466, 835–40 (2010).

159. Hendrickson, D. G. et al. Concordant regulation of translation and mRNA abundance for hundreds of targets of a human microRNA. PLoS Biol. 7, e1000238 (2009).

160. Cobb, B. S. et al. T cell lineage choice and differentiation in the absence of the RNase III enzyme Dicer. J. Exp. Med. 201, 1367–73 (2005).

161. Muljo, S. A. et al. Aberrant T cell differentiation in the absence of Dicer. 202, 261–269 (2005).

162. Steiner, D. F. et al. MicroRNA-29 Regulates T-Box Transcription Factors and Interferon-γ Production in Helper T Cells. Immunity 35, 169–181 (2011).

163. Muljo, S. a et al. Aberrant T cell differentiation in the absence of Dicer. J. Exp. Med. 202, 261–9 (2005).

164. Cobb, B. S. et al. T cell lineage choice and differentiation in the absence of the RNase III enzyme Dicer. J. Exp. Med. 201, 1367–73 (2005).

165. Chong, M. M. W., Rasmussen, J. P., Rudensky, A. Y., Rundensky, A. Y. & Littman, D. R. The RNAseIII enzyme Drosha is critical in T cells for preventing lethal inflammatory disease. J. Exp. Med. 205, 2005–17 (2008).

166. Liston, A., Lu, L.-F., O’Carroll, D., Tarakhovsky, A. & Rudensky, A. Y. Dicer-dependent microRNA pathway safeguards regulatory T cell function. J. Exp. Med. 205, 1993–2004 (2008).

167. Zhou, X. et al. Selective miRNA disruption in T reg cells leads to uncontrolled autoimmunity. J. Exp. Med. 205, 1983–91 (2008).


80

!168. Bronevetsky, Y. et al. T cell activation induces proteasomal degradation of

Argonaute and rapid remodeling of the microRNA repertoire. J. Exp. Med. 210, 417–32 (2013).

169. Zhang, N. & Bevan, M. J. Dicer controls CD8+ T-cell activation, migration, and survival. 107, (2010).

170. Kuchen, S. et al. Regulation of microRNA expression and abundance during lymphopoiesis. Immunity 32, 828–39 (2010).

171. Rossi, R. L. et al. Distinct microRNA signatures in human lymphocyte subsets and enforcement of the naive state in CD4+ T cells by the microRNA miR-125b. Nat. Immunol. 12, 796–803 (2011).

172. Holmstrøm, K., Pedersen, A. W., Claesson, M. H., Zocca, M.-B. & Jensen, S. S. Identification of a microRNA signature in dendritic cell vaccines for cancer immunotherapy. Hum. Immunol. 71, 67–73 (2010).

173. Neilson, J. R., Zheng, G. X. Y., Burge, C. B. & Sharp, P. A. Dynamic regulation of miRNA expression in ordered stages of cellular development. Genes Dev. 21, 578–89 (2007).

174. Li, Q.-J. et al. miR-181a is an intrinsic modulator of T cell sensitivity and selection. Cell 129, 147–61 (2007).

175. Fragoso, R. et al. Modulating the strength and threshold of NOTCH oncogenic signals by mir-181a-1/b-1. PLoS Genet. 8, e1002855 (2012).

176. Ghisi, M. et al. Modulation of microRNA expression in human T-cell development: targeting of NOTCH3 by miR-150. Blood 117, 7053–62 (2011).

177. Monticelli, S. et al. MicroRNA profiling of the murine hematopoietic system. Genome Biol. 6, R71 (2005).

178. Barski, A. et al. Chromatin poises miRNA- and protein-coding genes for expression. Genome Res. 19, 1742–51 (2009).

179. Sandberg, R., Neilson, J. R., Sarma, A., Sharp, P. A. & Burge, C. B. Proliferating cells express mRNAs with shortened 3’ untranslated regions and fewer microRNA target sites. Science 320, 1643–7 (2008).

180. Jiang, S. et al. Molecular dissection of the miR-17-92 cluster’s critical dual roles in promoting Th1 responses and preventing inducible Treg differentiation. Blood 118, 5487–97 (2011).

181. Wu, H. et al. miRNA profiling of naïve, effector and memory CD8 T cells. PLoS One 2, e1020 (2007).

182. O’Shea, J. J. & Paul, W. E. Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells. Science 327, 1098–102 (2010).

183. Zhu, J., Yamane, H. & Paul, W. E. Differentiation of effector CD4 T cell populations (*). Annu. Rev. Immunol. 28, 445–89 (2010).


81

!184. Sharp, P. A. The centrality of RNA. Cell 136, 577–80S (2009).

185. Baumjohann, D. & Ansel, K. M. MicroRNA-mediated regulation of T helper cell differentiation and plasticity. Nat. Rev. Immunol. 13, 666–78 (2013).

186. Kanno, Y., Vahedi, G., Hirahara, K., Singleton, K. & O’Shea, J. J. Transcriptional and epigenetic control of T helper cell specification: molecular mechanisms underlying commitment and plasticity. Annu. Rev. Immunol. 30, 707–31 (2012).

187. Tsai, C.-Y., Allie, S. R., Zhang, W. & Usherwood, E. J. MicroRNA miR-155 affects antiviral effector and effector Memory CD8 T cell differentiation. J. Virol. 87, 2348–51 (2013).

188. Lind, E. F., Elford, A. R. & Ohashi, P. S. Micro-RNA 155 is required for optimal CD8+ T cell responses to acute viral and intracellular bacterial challenges. J. Immunol. 190, 1210–6 (2013).

189. Wu, T. et al. Temporal expression of microRNA cluster miR-17-92 regulates effector and memory CD8+ T-cell differentiation. Proc. Natl. Acad. Sci. U. S. A. 109, 9965–70 (2012).

190. Ma, F. et al. The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-γ. Nat. Immunol. 12, 861–9 (2011).

191. Ma, F. et al. The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-γ. Nat. Immunol. 12, 861–9 (2011).

192. Lu, L.-F. et al. Function of miR-146a in controlling Treg cell-mediated regulation of Th1 responses. Cell 142, 914–29 (2010).

193. Boldin, M. P. et al. miR-146a is a significant brake on autoimmunity, myeloproliferation, and cancer in mice. J. Exp. Med. 208, 1189–201 (2011).

194. Yang, L. et al. miR-146a controls the resolution of T cell responses in mice. J. Exp. Med. 209, 1655–70 (2012).

195. Taganov, K. D., Boldin, M. P., Chang, K. & Baltimore, D. an inhibitor targeted to signaling proteins of innate immune responses. 6–11 (2006).

196. Lagos-Quintana, M., Rauhut, R., Lendeckel, W. & Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science 294, 853–8 (2001).

197. Kroesen, B.-J. et al. Immuno-miRs: Critical regulators of T-cell development, function and ageing. Immunology (2014).

198. Bernstein, B. E. et al. Genomic maps and comparative analysis of histone modifications in human and mouse. Cell 120, 169–81 (2005).

199. Yang, W. J. et al. Dicer is required for embryonic angiogenesis during mouse development. J. Biol. Chem. 280, 9330–5 (2005).


82

!200. Garvin, A. M. et al. Disruption of thymocyte development and

lymphomagenesis induced by SV40 T-antigen. Int. Immunol. 2, 173–80 (1990).

201. Stetson, D. B. et al. Constitutive cytokine mRNAs mark natural killer (NK) and NK T cells poised for rapid effector function. J. Exp. Med. 198, 1069–76 (2003).

202. Gerber, S. a et al. IFN-γ mediates the antitumor effects of radiation therapy in a murine colon tumor. Am. J. Pathol. 182, 2345–54 (2013).

203. Trambas, C. M. & Griffiths, G. M. Delivering the kiss of death. Nat. Immunol. 4, 399–403 (2003).

204. Guidotti, L. G. et al. Intracellular inactivation of the hepatitis B virus by cytotoxic T lymphocytes. Immunity 4, 25–36 (1996).

205. Schüler, T. & Blankenstein, T. Cutting edge: CD8+ effector T cells reject tumors by direct antigen recognition but indirect action on host cells. J. Immunol. 170, 4427–31 (2003).

206. Tajima, M., Wakita, D., Satoh, T., Kitamura, H. & Nishimura, T. IL-17/IFN-γ double producing CD8+ T (Tc17/IFN-γ) cells: a novel cytotoxic T-cell subset converted from Tc17 cells by IL-12. Int. Immunol. 23, 751–9 (2011).

207. Kägi, D. et al. Cytotoxicity mediated by T cells and natural killer cells is greatly impaired in perforin-deficient mice. Nature 369, 31–7 (1994).

208. Berg, R. E., Cordes, C. J. & Forman, J. Contribution of CD8+ T cells to innate immunity: IFN-gamma secretion induced by IL-12 and IL-18. Eur. J. Immunol. 32, 2807–16 (2002).

209. Cruz-Guilloty, F. et al. Runx3 and T-box proteins cooperate to establish the transcriptional program of effector CTLs. J. Exp. Med. 206, 51–9 (2009).

210. Dai, R. & Ahmed, S. A. MicroRNA, a new paradigm for understanding immunoregulation, inflammation, and autoimmune diseases. Transl. Res. 157, 163–79 (2011).

211. Jeker, L. T. & Bluestone, J. a. MicroRNA regulation of T-cell differentiation and function. Immunol. Rev. 253, 65–81 (2013).

212. Steiner, D. F. et al. MicroRNA-29 regulates T-box transcription factors and interferon-γ production in helper T cells. Immunity 35, 169–81 (2011).

213. Muljo, S. A. et al. Aberrant T cell differentiation in the absence of Dicer. J. Exp. Med. 202, 261–9 (2005).

214. Zhang, N. & Bevan, M. J. Dicer controls CD8+ T-cell activation, migration and survival. Proc. Natl. Acad. Sci. U. S. A. 107, 21629–21634 (2010).


83

!215. Kambayashi, T., Assarsson, E., Lukacher, A. E., Ljunggren, H.-G. & Jensen,

P. E. Memory CD8+ T cells provide an early source of IFN-gamma. J. Immunol. 170, 2399–408 (2003).

216. Lee, Y. J., Jameson, S. C. & Hogquist, K. A. Alternative memory in the CD8 T cell lineage. Trends Immunol. 32, 50–56 (2011).

217. Berg, L. J. Signalling through TEC kinases regulates conventional versus innate CD8(+) T-cell development. Nat. Rev. Immunol. 7, 479–85 (2007).

218. Weinreich1, M. A., Odumade1, O. A., Jameson1, S. & Hogquist, C. K. A. PLZF+ T cells regulate memory-like CD8+ T cell development. 11, 709–716 (2011).

219. Hu, J., Sahu, N., Walsh, E. & August, A. Memory phenotype CD8+ T cells with innate function selectively develop in the absence of active Itk. Eur. J. Immunol. 37, 2892–9 (2007).

220. Su, J., Berg, R. E., Murray, S. & Forman, J. Thymus-dependent memory phenotype CD8 T cells in naive B6.H-2Kb-/-Db-/- animals mediate an antigen-specific response against Listeria monocytogenes. J. Immunol. 175, 6450–7 (2005).

221. Prince, A. L., Yin, C. C., Enos, M. E., Felices, M. & Berg, L. J. The Tec kinases Itk and Rlk regulate conventional versus innate T-cell development Amanda. 228, 115–131 (2010).

222. Desai, B. B. et al. IL-12 receptor. II. Distribution and regulation of receptor expression. J. Immunol. 148, 3125–32 (1992).

223. Chang, J. T., Segal, B. M., Nakanishi, K., Okamura, H. & Shevach, E. M. The costimulatory effect of IL-18 on the induction of antigen-specific IFN-gamma production by resting T cells is IL-12 dependent and is mediated by up-regulation of the IL-12 receptor beta2 subunit. Eur. J. Immunol. 30, 1113–9 (2000).

224. Zhang, X., Sun, S., Hwang, I., Tough, D. F. & Sprent, J. Potent and selective stimulation of memory-phenotype CD8+ T cells in vivo by IL-15. Immunity 8, 591–9 (1998).

225. Jacobson, N. G., Szabo, S. J., Güler, M. L., Gorham, J. D. & Murphy, K. M. Regulation of interleukin-12 signalling during T helper phenotype development. Adv. Exp. Med. Biol. 409, 61–73 (1996).

226. Ku, C. C., Murakami, M., Sakamoto, A., Kappler, J. & Marrack, P. Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science 288, 675–8 (2000).

227. Robinson, D. et al. IGIF Does Not Drive Th1 Development but Synergizes with IL-12 for Interferon-γ Production and Activates IRAK and NFκB. Immunity 7, 571–581 (1997).


84

!228. Pagès, J. C. & Bru, T. Toolbox for retrovectorologists. J. Gene Med. 6 Suppl

1, S67–82 (2004).

229. Liu, Y. P. & Berkhout, B. miRNA cassettes in viral vectors: problems and solutions. Biochim. Biophys. Acta 1809, 732–45 (2011).

230. Thomson, D. W., Bracken, C. P. & Goodall, G. J. Experimental strategies for microRNA target identification. Nucleic Acids Res. 39, 6845–53 (2011).

231. Ellis, J. & Yao, S. Retrovirus silencing and vector design: relevance to normal and cancer stem cells? Curr. Gene Ther. 5, 367–73 (2005).

232. Wightman, B., Burglin, T. R., Gatto, J., Arasu, P. & Ruvkun, G. Negative regulatory sequences in the lin-14 3’-untranslated region are necessary to generate a temporal switch during Caenorhabditis elegans development. Genes Dev. 5, 1813–1824 (1991).

233. Le Doux, J. M., Morgan, J. R. & Yarmush, M. L. Removal of proteoglycans increases efficiency of retroviral gene transfer. Biotechnol. Bioeng. 58, 23–34 (1998).

234. Le Doux, J. M., Morgan, J. R., Snow, R. G. & Yarmush, M. L. Proteoglycans secreted by packaging cell lines inhibit retrovirus infection. J. Virol. 70, 6468–73 (1996).

235. Merten, O.-W. State-of-the-art of the production of retroviral vectors. J. Gene Med. 6 Suppl 1, S105–24 (2004).

236. Huang, Y. et al. MicroRNA regulation of STAT4 protein expression: rapid and sensitive modulation of IL-12 signaling in human natural killer cells. Blood 118, 6793–802 (2011).

237. Huang, Y., Lei, Y., Zhang, H., Zhang, M. & Dayton, A. Interleukin-12 treatment down-regulates STAT4 and induces apoptosis with increasing ROS production in human natural killer cells. J. Leukoc. Biol. 90, 87–97 (2011).

238. Freeman, B. E., Hammarlund, E., Raué, H.-P. & Slifka, M. K. Regulation of innate CD8+ T-cell activation mediated by cytokines. Proc. Natl. Acad. Sci. U. S. A. 109, 9971–6 (2012).

239. Nakahama, T. et al. Aryl hydrocarbon receptor-mediated induction of the microRNA-132/212 cluster promotes interleukin-17-producing T-helper cell differentiation. Proc. Natl. Acad. Sci. U. S. A. 110, 11964–9 (2013).

240. Cruz-Guilloty, F. et al. Runx3 and T-box proteins cooperate to establish the transcriptional program of effector CTLs. J. Exp. Med. 206, 51–9 (2009).

241. Zhang, N. & Bevan, M. J. Review CD8 + T Cells,: Foot Soldiers of the Immune System. Immunity 35, 161–168 (2011).

242. Pham, D., Vincentz, J. W., Firulli, A. B. & Kaplan, M. H. Twist1 regulates Ifng expression in Th1 cells by interfering with Runx3 function. J. Immunol. 189, 832–40 (2012).


85

!243. Vasudevan, S., Tong, Y. & Steitz, J. A. Switching from repression to activation:

microRNAs can up-regulate translation. Science 318, 1931–4 (2007).

244. Henke, J. I. et al. microRNA-122 stimulates translation of hepatitis C virus RNA. EMBO J. 27, 3300–10 (2008).

245. Ørom, U. A., Nielsen, F. C. & Lund, A. H. MicroRNA-10a binds the 5’UTR of ribosomal protein mRNAs and enhances their translation. Mol. Cell 30, 460–71 (2008).

246. Vasudevan, S. & Steitz, J. A. AU-rich-element-mediated upregulation of translation by FXR1 and Argonaute 2. Cell 128, 1105–18 (2007).

247. Chekulaeva, M. & Filipowicz, W. Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr. Opin. Cell Biol. 21, 452–60 (2009).

248. Chi, S. W., Zang, J. B., Mele, A. & Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 460, 479–86 (2009).

Date post:	14-Nov-2018
Category:	Documents
Upload:	duongdan
View:	215 times
Download:	0 times

The Role Of miRNAs In CD8 T Cell Differentation · In CD8+ T Cell Differentation ... A citocina com...

Documents