THE ROLE OF PLANT MEMBRANE PROTEINS
IN LEGUME-RHIZOBIA SYMBIOSIS
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF BIOLOGY
AND THE COMMITTEE ON GRADUATE STUDIES
OF STANFORD UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
Cara Helene Haney
December 2010
http://creativecommons.org/licenses/by-nc/3.0/us/
This dissertation is online at: http://purl.stanford.edu/yn410td6337
© 2011 by Cara Helene Haney. All Rights Reserved.
Re-distributed by Stanford University under license with the author.
This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.
ii
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Sharon Long, Primary Adviser
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Dominique Bergmann
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
David Ehrhardt
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Suzanne Pfeffer
Approved for the Stanford University Committee on Graduate Studies.
Patricia J. Gumport, Vice Provost Graduate Education
This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.
iii
iv
ABSTRACT
Symbiotic nitrogen fixation occurs when rhizobia bacteria infect the roots of legume
plants, resulting in the formation of a specialized organ called a nodule. In this
mutualistic symbiosis, bacteria provide the plant with nitrogen, and the plant provides
the bacteria with carbon sources. This metabolic exchange occurs inside the root
nodules where bacteria reduce (or “fix”) molecular dinitrogen to ammonia, a form of
nitrogen that plants can use to synthesize amino acids and proteins.
Legume-rhizobia symbiosis initiates with plant recognition of the bacterial
signaling molecule Nod Factor (NF). After plant perception of NF, bacteria infect
plant roots through host-derived infection threads and are eventually endocytosed into
host cells. Inside the host cell, the bacteria remain surrounded by a host membrane
and differentiate into their nitrogen-fixing form. A great deal is known about NF
perception and signaling, but the mechanisms by which infection threads form and by
which bacteria are endocytosed into host cells remain elusive.
To identify genes required for infection or bacterial endocytosis, I used a
candidate gene approach in the model legume Medicago truncatula. I searched the
M. truncatula genome for regions with homology to endocytosis and membrane
shaping genes in plants and other organisms. I identified two M. truncatula flotillin-
like genes, FLOT2 and FLOT4, which are up-regulated in response to the M.
truncatula symbiont, Sinorhizobium meliloti. Flotillins in animals have been
implicated in actin polymerization, maintenance of cell-cell contacts, membrane
trafficking and pathogenesis. I silenced FLOT2 and FLOT4 using RNAi and
amiRNAs and found a non-redundant requirement for both genes in symbiosis. When
FLOT4 was silenced, infection threads typically aborted in root hairs. FLOT2-silenced
plants formed fewer nodules and infection threads. This work implicates plant
flotillins in legume-rhizobia symbiosis and suggests that flotillins in plants and
animals may have a common function.
NF recognition in M. truncatula requires the receptors NFP and LYK3. Each
receptor is required for separate downstream responses: NFP is necessary for all
v
known responses to bacteria, while LYK3 is required for infection. A leucine-rich
repeat receptor-like kinase DMI2 acts downstream of NFP. Using GFP-tagged
proteins, I localized the symbiotic receptor kinases DMI2 and LYK3. Both proteins
had punctate distributions associated with root hair plasma membranes. After
bacterial inoculation, both LYK3:GFP and DMI2:GFP were present on intracellular
vesicles. LYK3:GFP persisted in infected cells and localized to infection thread
membranes. The DMI2:GFP signal was nearly absent by one day post inoculation.
These data are consistent with a role for LYK3 in infection and a role for DMI2 in
signaling.
I found that like LYK3 and DMI2, GFP-tagged FLOT4 is associated with the
plasma membrane and has a patchy distribution. Upon inoculation with S. meliloti,
FLOT4:GFP puncta become more diffuse and redistribute to form a cap at the tips of
elongating root hairs. I investigated the dependence of FLOT4 distribution on NF
perception and signaling via symbiotic receptors NFP, LYK3, and DMI2. I found that
FLOT4:GFP has a decrease in puncta density specific to the putative dead kinase
allele of LYK3, hcl-1. I co-expressed LYK3:GFP and FLOT4:mCherry and found that
in buffer-treated root hairs, there is little co-distribution of the two proteins, and
tagged LYK3 puncta are dynamic while FLOT4 is relatively stable. After inoculation,
I found an increase in LYK3:GFP and FLOT4:mCherry co-localization and that
LYK3:GFP shares the stable distribution shown by FLOT4:mCherry. The similarities
in mutant phenotypes, protein localization, and protein dynamics suggest that FLOT4
and LYK3 may be components of a shared complex.
This work indicates that protein arrangement within plant membranes is
complex and is altered by perception of a symbiotic bacterium. This work suggests
that redistribution of plant membrane proteins upon signal perception may serve to
compartmentalize cellular processes.
vi
PREFACE
Publication of chapters and role of author
Chapter 2 is reprinted from Proceedings of the National Academy of Sciences,
Volume 107, C. H. Haney
The transgenic Medicago truncatula lines used in Chapters 3 and 4 were generated
by Brendan Riely using a protocol developed by David Tricoli in Doug Cook’s Lab at
University of California, Davis. I performed all experiments and generated all remaining
materials.
and S. R. Long, “Plant flotillins are required for infection
by nitrogen-fixing bacteria”, pp 478-483. © Haney and Long, 2010. Reprinted with
permission from S. R. Long.
vii
Acknowledgements
I am grateful to the many people who have supported, encouraged, and tolerated me
during my Ph.D. years.
I would first like to thank Sharon for giving me the opportunity to work in her
lab. Sharon allowed me the freedom to pursue my own interests and to make my own
mistakes, which in the end allowed me to discover how much I love science. She is an
endless source of insight and wisdom about scientific methods and scientific integrity.
Sharon is an extraordinary mentor, filled with a rare combination of alarming
brilliance and quiet grace. It has been a privilege to learn from her.
I doubt on any planet, in any galaxy, in all the universe, that there is a place
quite like the Long Lab. The lab is filled with exceptional people who are both smart
and kind. The unique aura of the Long lab is largely a consequence of Bob Fisher,
who is much nicer than he lets on. I’ve been lucky enough to share a bay with Bob for
the past few years, and consequently have learned about everything from cloning to
Schadenfreude. I’m glad to have found a partner in crime, the lab’s “junior” graduate
student, Alisa Lehman, who always listened when daily ice cream was not sufficient to
alleviate the grad-school blues. Cindy Smith is the coolest roller skating, mystery
novel writing, plant biologist I’ve ever met. She has also been the best conference
travel buddy a girl could ask for and has been an unending source of support, plant
expertise, and perspective. I’m thankful to Melanie Barnett for sharing her
encyclopedic knowledge of microbes, and to Carol Toman for her kindness, generosity
and eternal willingness to streak out a strain. I’m grateful to Michelle Diodati for
being sweet and genuine and for teaching me about the many wonders of bacteria.
I’m grateful to Dong Wang for taking my side in most battles of Good vs. Bob. And
I’m thankful for the two newest postdocs in the lab, Claus Lang and Hiro Ichida, for
sharing late night ice cream. Alex Bloom and Janet Ladner have helped navigate the
day to day labyrinth of university administration.
I am also in debt to three former Long Lab postdocs. Joel Griffitts’s infectious
excitement was truly inspiring during my early days in the lab. Adriana Rightmyer
gave me endless help and sympathy when experiments were troublesome and was an
viii
example in patience and thoroughness. Esther Chen shared a bay with me during my
early years in the lab and it is hard to imagine how I would have navigated those years
without her. I am grateful to Esther for believing in me and helping me see myself as
a scientist. Esther is a phenomenal scientist, an exceptional teacher, and as time has
revealed, one of my dearest friends.
I have also been lucky enough to work with two extremely talented
undergraduate students, Quynh Anh Nguyen and Elizabeth Xiao. Quynh Anh began
helping me when I was still getting my own feet wet, and contributed several valuable
tools to the lab. Elizabeth’s patience and steady hands allowed me to take on a
profoundly labor intensive project. A great deal of that labor was done by Elizabeth,
who never once complained.
I owe a great deal to David Ehrhardt who, for the latter part of my thesis, has
been like a second adviser. He has gone beyond the call of duty of any committee
member and spent many patient hours teaching me about microscopy and helping with
data analysis and interpretation. My thesis and scientific interests would look very
different if it weren’t for David’s influence. I am also in dept to Ryan Gutierrez for
his willingness to act as a surrogate David when microscopes were troublesome. I am
grateful to have found a fellow flotillin-enthusiast in Guido Grossman who, if
possible, loves flotillins more than I do. I am also in debt to Wolf Frommer and the
rest of the Carnegie Institute for allowing me to use their microscopes, and for being a
second home at Stanford.
I’d also like to thank the Long Lab’s neighbors, the Mudgett and Bergmann
labs, for shared advice and reagents. I am particularly grateful to Dominique for
advice about science and life in general. Dominique sees things with clarity that is
frequently disarming, but I am a better scientist thanks to her perspectives. I am also
grateful to my classmate Cora MacAlister who would have been my friend even if our
first names were not nearly identical, as she was kind enough to show me her
sporulating Physcomitrella and share meditations on the adorableness of cats.
Thanks to the student services office including Matt Pinheiro, Valerie Kiszka
and Jennifer Mason. They have made the logistics of a PhD as smooth and pain-free
ix
as possible. And thanks to the Stanford Biology Department for giving me a shot at a
PhD at Stanford.
I definitely wouldn’t be where I am today if it weren’t for my undergraduate
advisor Bill Fry who introduced me to plant pathology, encouraged me to work in his
lab, and gave me the crazy idea to apply to Stanford for grad school. I am also grateful
to Ralph Obendorf who taught me about carbohydrate biosynthesis, and that every
situation is what you make of it.
I have wonderful and supportive friends and family who deserve many thanks.
My best friend David Johnson has continued to be a friend and support, and has kept
me connected to the world outside of the lab. My younger brother Kenny was always
kind enough to ask how my “glowing plants” were doing. I’m grateful for long
conversations about our mutual love of plants, music, and Kenny’s continued
suggestions of how to merge those two passions. (I’m still working on that
photosynthetic fiddle-playing accompanist for you, Kenny.) I am grateful to my Aunt
Jessie and my Grandmother Lois, both of whom I lost during my years at Stanford, but
whose lives remembered were full and vibrant and serve as a reminder to cherish
family, friends and life. Jessie’s photography continues to be a reminder of how weird
and beautiful life is. My parents have both been examples of how to make a career out
of something that you are passionate about and taught me that the price of ambition
should never be happiness or integrity. I’m grateful to have a family that will always
be proud of me as long as I’m doing my best. And I’m glad to have inherited from my
maternal lineage, an X-linked obsessive compulsive plant gene.
Finally, I would like to thank Dirk, for support, fun and for being enough of a
nerd to think what I do is cool. Dirk has brought joy and balance to my life and has
been a partner through life’s ups and downs. I’m so grateful to have shared these
years with Dirk, and I look forward to our adventures to come.
x
TABLE OF CONTENTS
ABSTRACT .......................................................................................................................... iv
PREFACE ............................................................................................................................. vi
Publication of chapters and role of author ......................................................................... vi
Acknowledgements .......................................................................................................... vii
TABLE OF CONTENTS ....................................................................................................... x
LIST OF TABLES ............................................................................................................... xii
LIST OF FIGURES ............................................................................................................. xiii
CHAPTER 1: Introduction and contributions ............................................................... 1 Bacterial NF production and plant NF recognition ............................................................ 2
Plant requirements for infection ......................................................................................... 5
Bacterial invasion factors ................................................................................................... 6
A reverse genetics approach to identify genes required for infection ................................ 7
Flotillins and membrane rafts in animals ........................................................................... 7
Flotillins are conserved in plants ...................................................................................... 10
Contributions .................................................................................................................... 11
CHAPTER 2: Plant flotillins are required for infection by nitrogen-fixing bacteria ............................................................................................................................. 13
ABSTRACT ......................................................................................................................... 13
INTRODUCTION ................................................................................................................ 14
RESULTS............................................................................................................................. 17
Identification of flotillin-like genes in M. truncatula ....................................................... 17
FLOT2 and FLOT4 show NF-dependent upregulation during nodulation ....................... 19
FLOT2 and FLOT4 localize to membrane microdomains and FLOT4 becomes polarly localized in response to bacterial signals.......................................................................... 23
FLOTs are required for nodulation ................................................................................... 24
FLOT2- and FLOT4-silenced plants are defective in both nodule form and function ..... 29
FLOT silencing results in infection thread initiation and elongation defects ................... 30
FLOT4 localizes to infection thread membranes ............................................................. 30
DISCUSSION ...................................................................................................................... 32
A requirement for FLOT2 and FLOT4 for early nodulation events ................................. 32
xi
Flotillin-like genes are ubiquitous in plants ..................................................................... 33
MATERIALS AND METHODS ......................................................................................... 34
CHAPTER 3: Localization of the symbiotic receptor kinases LYK3 and DMI2 ..... 43 ABSTRACT ......................................................................................................................... 43
INTRODUCTION ................................................................................................................ 44
RESULTS............................................................................................................................. 45
Localization of symbiotic receptor kinases LYK3 and DMI2 ......................................... 45
LYK3:GFP localizes to intracellular vesicles and infection threads post inoculation ..... 52
DMI2:GFP localizes to intracellular vesicles post-inoculation ........................................ 55
DISCUSSION ...................................................................................................................... 58
MATERIALS AND METHODS ......................................................................................... 61
CHAPTER 4: Co-localization of flotillin protein FLOT4 with the symbiotic receptor LYK3 ................................................................................................................. 63
ABSTRACT ......................................................................................................................... 63
INTRODUCTION ................................................................................................................ 64
RESULTS............................................................................................................................. 66
A change in FLOT4 distribution is associated with rhizobia-triggered re-initiation of root hair growth ....................................................................................................................... 66
Over-expression of FLOT2 results in increased FLOT4 polarity .................................... 67
FLOT4 mis-localizes in a LYK3 mutant .......................................................................... 69
FLOT4 and LYK3 have increased co-localization after bacterial inoculation ................. 71
DISCUSSION ...................................................................................................................... 77
FLOT2 affects FLOT4:GFP distribution ......................................................................... 77
Plant membrane protein compartmentalization ................................................................ 77
MATERIALS AND METHODS ......................................................................................... 79
CHAPTER 5: Conclusions and Future Directions ....................................................... 81 Plant membrane protein compartmentalization ................................................................ 81
Plasma membrane protein compartmentalization during symbiosis ................................ 82
Possible functions for plant membrane protein compartmentalization during host-microbe interactions ....................................................................................................................... 85
REFERENCES ................................................................................................................... 87
xii
LIST OF TABLES
CHAPTER 2 Table 2-1.Summary of the FLOT gene family. ............................................................ 17Table 2-2. PCR and qPCR primers to monitor FLOT expression ............................... 39Table 2-3. RNAi Construct Primers ............................................................................ 40Table 2-4. amiRNA Construct Primers ....................................................................... 41Table 2-5. Vector Construction ................................................................................... 42 CHAPTER 3 Table 3-1. Transgenes complement LYK3 and DMI2 mutants .................................... 47
xiii
LIST OF FIGURES CHAPTER 2
Figure 2-1. Alignment of predicted FLOT amino acid sequences and arrangement of FLOT1-5 within a single BAC ..................................................................................... 19Figure 2-2. Expression of FLOTs during nodulation and in plant tissues ................... 20Figure 2-3. Up-regulation of FLOT2 and FLOT4 is dependent on NF and NF perception ..................................................................................................................... 21Figure 2-4. FLOT2 and FLOT4 are expressed in the root elongation zone and in the infection zone of nodules .............................................................................................. 22Figure 2-5. FLOT2 and FLOT4 localize to membrane-associated puncta .................. 23Figure 2-6. FLOTs localize to membrane-associated puncta and become polarly localized after inoculation ............................................................................................ 24Figure 2-7. Silencing FLOTs results in a decrease in nodule number, a decrease in infection events and nodules that do form are non-functional ..................................... 26Figure 2-8. Root and nodule phenotypes of FLOT-silenced roots .............................. 28Figure 2-9. FLOT4 localizes to infection thread membranes ...................................... 31 CHAPTER 3
Figure 3-1. LYK3 and DMI2 fusion proteins rescue mutant phenotypes ................... 46Figure 3-2. LYK3 has a punctate distribution in root hairs ......................................... 48Figure 3-3. LYK3:GFP has little overlap with a cytoplasmic marker in root hairs ..... 49Figure 3-4. LYK3:GFP signal stays with the membrane upon plasmolysis ............... 50Figure 3-5. DMI2 has a punctate distribution associated with root hair plasma membranes .................................................................................................................... 51Figure 3-6. LYK3 localizes to intracellular vesicles and infection threads post inoculation .................................................................................................................... 54Figure 3-7. LYK3:GFP is not visible on infection threads in interior nodule cells .... 55Figure 3-8. After bacterial treatment, DMI2:GFP localizes to intracellular vesicles .. 57Figure 3-9. DMI2:GFP is not visible on infection threads in interior nodule cells ..... 57
xiv
CHAPTER 4
Figure 4-1. Redistribution of FLOT4 during re-initiation of root hair tip growth ...... 66Figure 4-2. Co-expression of FLOT2:GFP and FLOT4:mCherry .............................. 69Figure 4-3. FLOT4 mis-localizes in roots carrying mutations in a symbiotic receptor
...................................................................................................................................... 71Figure 4-4. LYK3:GFP complements the decrease in FLOT4 puncta density in the hcl-1 mutant .................................................................................................................. 72Figure 4-5. LYK3 and FLOT4 co-localize in inoculated root hairs in 3-D space ....... 74Figure 4-6. After inoculation, LYK3 puncta shift from dynamic to stable ................. 75Figure 4-7. FLOT4:mCherry does not label LYK3:GFP intracellular vesicles .......... 76
1
CHAPTER 1: Introduction and contributions
Overview of legume-rhizobia symbiosis
Plants in the family Fabaceae (legumes) form symbiotic relationships with Gram
negative α-proteobacteria including the genera Sinorhizobium, Rhizobium,
Mesorhizobium, and Bradyrhizobium. These bacteria live in association with plant
roots inside morphologically unique structures called nodules. The interaction between
plant and bacterium is viewed as mutualistic: the bacteria reduce (or “fix”) molecular
dinitrogen to ammonia, a form of nitrogen that plants can utilize; in exchange, the
plants supply the bacteria with carbon sources. Through this intimate metabolic
partnership, both plant and bacteria benefit.
Of all biologically-available fixed nitrogen in soil, about half is formed via
biological fixation (Zahran, 1999); nearly half of biological nitrogen fixation is
symbiotic (Werner and Newton, 2005). Naturally occurring forms of nitrogen are
insufficient to sustain agriculture at current levels of production and as a consequence,
use of synthetic ammonium fertilizer is necessary. Industrial fertilizer production is
costly and requires large inputs of fossil fuel. In 2008, nitrogen fertilizer production
was the eighth largest source of atmospheric carbon dioxide (E.P.A., 2010). Post-
production field application of synthetic fertilizers results in pollution in the form of
additional greenhouse emissions and fertilizer runoff. By understanding symbiotic
nitrogen fixation, biological nitrogen fixation may be improved and reduce the need
for synthetic nitrogen fertilizer.
In addition to its importance to agronomic sustainability, symbiotic nitrogen-
fixation provides a genetically tractable framework to study host-microbe interactions.
Several rhizobia-legume pairs have both genetic and molecular tools available
including microarrays, mutant libraries, and genome sequences. Model rhizobia-
legume pairs include (1) Medicago truncatula, a diploid relative of alfalfa, and its
bacterial symbiont Sinorhizobium meliloti and (2) Lotus japonicus and its symbiont
Mesorhizobium loti. Experiments in these model systems have elucidated some of the
2
genetic and molecular mechanisms by which bacteria communicate with and infect
eukaryotes.
Studies of legume-rhizobia symbioses have described developmental events
during the establishment of symbiosis. Symbiosis initiates with a signal exchange
between legumes and bacteria. Plant roots secrete flavonoids, which cause induction
of bacterial genes required for synthesis of a lipochitooligosaccharide called Nod
Factor (NF) (Peters et al., 1986). NFs act as species-specific signals to promote plant
nodule development (Debellé et al., 2001; Oldroyd et al., 2001b). In response to
bacteria or purified NF, specialized plant root epidermal cells, called root hairs, grow
to form a curl around a colony of bacteria (or spot of applied NF). Bacteria then enter
the plant root through plant-derived intracellular structures called infection threads.
Bacteria divide and penetrate nodules inside infection threads until eventually they are
released into host cells via an endocytosis-like event. Inside the plant host cell,
bacteria remain surrounded by a host-derived membrane and replicate only a few
times. Following a series of differentiation events, the bacteria (now called
“bacteroids”) synthesize nitrogenase enzyme allowing them to fix nitrogen.
Bacterial NF production and plant NF recognition
Purified NF is sufficient to induce plant morphological and transcriptional changes.
Within minutes of NF application, the root hair plasma membrane depolarizes
(Ehrhardt et al., 1992). Within the first hour after NF treatment, there are detectible
oscillations in nuclear calcium levels (called “calcium spiking”) in root hairs and
epidermal cells (Ehrhardt et al., 1996). A number of phenotypic changes occur in root
hairs following calcium spiking. First, actively elongating root hairs stop growing and
swell. The root hairs then reinitiate tip growth and grow to form a curl around a
bacterial colony. These events coincide with transcriptional changes that are largely
NF-dependent (Mitra et al., 2004a). When applied to some species such as M. sativa
(alfalfa), NF is sufficient to induce nodule formation, although these nodules are not
occupied by bacteria (Debellé et al., 2001).
3
The structure for NF and genes involved in its biosynthesis have been well
characterized (reviewed in Spaink et al., 1998). The NF backbone is a tetramer of β-
1,4-linked N-acetyl glucosamine (Roche et al., 1991a). Species-specific decorations
on the chitin backbone of S. meliloti NF include: (1) a C16:2 N-acylation on the
terminal non-reducing N-acetyl glucosamine residue, (2) an C6-O-acetylation on the
terminal non-reducing glucosamine, and (3) a C6-sulfate modification on the reducing
residue. Modified forms of S. meliloti NF alter host specificity and elicit altered host
responses. NodH mutants lack the sulfate modification and elicit no measurable plant
response (Roche et al., 1991b; Ehrhardt et al., 1995; Schultze et al., 1995). In contrast
nodF mutants (which have a modified acyl chain; Shearman et al., 1986; Demont et
al., 1993) and nodL mutants (which lack O-acetylation; Downie, 1989) trigger root
hair deformation but have reduced infection (Ardourel et al., 1994). NodFL double
mutants are completely unable to infect (Ardourel et al., 1994). NodH mutants fail to
induce calcium spiking on M. sativa while nodFL double mutants are able to trigger
calcium spiking (Wais et al., 2002). The observation that altering NF structure either
abolishes all plant responses, or specifically abolishes infection, led to a two-receptor
model in host NF perception where: (1) a less stringent “signaling” receptor controls
calcium spiking and transcription and (2) a highly stringent “entry” receptor controls
bacterial entry into root hairs (Ardourel et al., 1994).
The two-receptor model is supported by host genetics in M. truncatula which
have identified two putative NF receptor loci NFP and LYK3. Both encode LysM-
family receptors; LysM receptors binds chitin (Iizasa et al., 2010) so these are good
candidates for binding the chitin backbone of NF. Loss of function mutations in NFP
(in Medicago truncatula) and NFR1/NFR5 (homologues in Lotus japonicus) result in
complete insensitivity of plants to NF (Wais et al., 2002; Amor et al., 2003; Madsen et
al., 2003; Radutoiu et al., 2003). LYK3 mutants (also called hcl) undergo root hair
deformation in response to NF but do not form root hair curls (mutants were originally
called hcl for their root hair curling defect) or infection threads (Catoira et al., 2001;
Limpens et al., 2003; Smit et al., 2007). Hcl mutants undergo few or no cortical cell
divisions (Catoira et al., 2001). Weaker mutant alleles of LYK3 and LYK3 RNAi
4
plants form infection threads that fail to penetrate the root cortex (Limpens et al.,
2003; Smit et al., 2007). Based on these observations, NFP is alleged to encode the
low stringency receptor which controls calcium spiking and gene expression, and
LYK3 encodes the high stringency receptor which controls bacterial entry into root
hairs (Smit et al., 2007).
Forward genetics in the model legumes M. truncatula and Lotus japonicus
have identified what are likely the major components of the NFP signaling pathway.
The NFP receptor signals through a Leucine-rich repeat receptor-like kinase encoded
by DMI2 (in M. truncatula) and SymRK (L. japonicus) which are necessary for
calcium spiking in their respective species (Endre et al., 2002; Stracke et al., 2002).
Also necessary for calcium spiking are a putative nuclear ion channel DMI1 (in M.
truncatula) and CASTOR/POLLUX (L. japonicus) (Ané et al., 2004; Riely et al., 2007;
Charpentier et al., 2008) and the nucleoporins Nup85 and Nup133 (L. japonicus)
(Kanamori et al., 2006; Saito et al., 2007). Calcium spiking likely controls activity of
a calcium/calmodulin-dependent protein kinase (CCaMK) encoded by DMI3 (M.
truncatula) and Sym15 (L. japonicus) (Levy et al., 2004; Mitra et al., 2004b; Tirichine
et al., 2006). Gain of function alleles of CCaMK in both L. japonicus and M.
truncatula are sufficient for nodule organogenesis in the absence of bacteria (Gleason
et al., 2006; Tirichine et al., 2006). In response to NF signal transduction, CCaMK
phosphorylates two GRAS-family transcription factors NSP1 and NSP2 which form
heterodimers that directly bind the promoters of NF-responsive genes (Catoira et al.,
2000; Oldroyd and Long, 2003; Kaló et al., 2005; Smit et al., 2005; Heckmann et al.,
2006; Murakami et al., 2006; Hirsch et al., 2009). NSP1 and NSP2 are necessary for
all known NF-dependent transcriptional changes (Mitra et al., 2004a). A downstream
transcription factor ERN is required for a subset of NF-dependent gene expression and
CCaMK-dependent nodule formation (Middleton et al., 2007). These genes likely
represent the majority of components required for NF signal perception at the host cell
membrane and NF-induced signal transduction to activate gene expression and nodule
organogenesis.
5
Crosstalk between the NF signaling and entry pathway likely occurs, as plants
must coordinate infection with nodule formation. Crosstalk is supported by the
phenotypes of several mutants. M. truncatula NIN encodes a putative transcriptional
regulator (Schauser et al., 1999; Borisov et al., 2003; Schauser et al., 2005) and is
required for CCaMK-dependent nodule organogenesis and infection events but not
NF-dependent transcriptional changes suggesting that it may coordinate signals
through both NF receptors (Marsh et al., 2007). L. japonicus CCaMK is able to
phosphorylate CYCLOPS (Yano et al., 2008), a protein of unknown function which
contains a nuclear localization signal and a coiled-coil domain. CYCLOPS is
dispensable for CCaMK-dependent nodule organogenesis but not for infection and
may represent a branch point in NFP-signaling (Capoen and Oldroyd, 2008). The
mechanisms by which NIN, CYCLOPS and other genes mechanistically enable
crosstalk between nodule formation and infection pathways are a focus of ongoing
work.
Plant requirements for infection
The genetic requirements for infection and invasion are not as well defined as early
signaling events. A number of Fix- mutants (which form nodules but do not support
nitrogen fixation) have been characterized based on microscopic observation of the
progress of bacterial infection and monitoring nitrogen fixation (Utrup et al., 1993;
Schauser et al., 1998; Morzhina et al., 2000; Starker et al., 2006). These mutants can
be divided into two major groups (1) infection mutants that form nodules but have few
infection threads and no bacterial release or (2) invasion mutants that are able to
support bacterial infection and release but not nitrogen fixation. Genes required for
later symbiotic events are still in early stages of characterization; it unclear how they
fit together in pathways and how later events are affected by early signal transduction.
Genes required for infection are potential components of the LYK3 entry
pathway. The E3-ubiqutin ligase PUB1 negatively regulates infection likely by
targeting LYK3 for degradation (Mbengue et al., 2010). A second putative E3-
ubiquitin ligase LIN1 is required for infection, suggesting that protein degradation
6
both positively and negatively regulates infection (Kiss et al., 2009). A plant-specific
gene RPG encodes a nuclear-localized protein with a long coiled-coil domain and is
required for infection thread polar growth (Arrighi et al., 2008). Infection thread
growth in L. japonicus requires the genes NAP1 and PIR1, which are involved in actin
reorganization (Yokota et al., 2009). A plant-specific membrane protein, remorin, is
also required for infection (Lefebvre et al., 2010). While all of these genes appear to
be required for normal infection, how they work co-operatively and integrate signals
from the LYK3-dependent NF perception pathway remains to be seen.
After bacteria are endocytosed into their legume host cells, several genes
involved in protein secretion and vesicle trafficking are required for symbiosome
maturation. DNF1 encodes a nodule-specific signal peptidase required for secretion of
antimicrobial cysteine-rich peptides which control bacterial differentiation (Van de
Velde et al., 2010; Wang et al., 2010). The syntaxin SYP132 localizes to symbiosome
membranes (Catalano et al., 2007), and a RAB7 homologue is required for
symbiosome senescence in mature nodules (Limpens et al., 2009). These are few of
what will certainly be many proteins required for endocytosis, trafficking and
maintenance of symbiotic bacteria within their host cells.
Bacterial invasion factors
A number of bacterial genera in the α-proteobacteria can cause chronic infections of
mammals (Brucella, Bartonella and Rickettsia sp.), plants (Sinorhizobium,
Bradyrhizobium, and Agrobacterium sp.), and insects (Wolbachia sp.) (Sallstrom and
Andersson, 2005). Although these closely-related bacteria infect and persist in
different host environments, they share a number of genes required for infection
including production of the correct types and amounts of cell surface polysaccharides
(reviewed in Batut et al., 2004; Sallstrom and Andersson, 2005). Conserved
virulence factors suggest the possibility of conserved host targets.
7
A reverse genetics approach to identify genes required for infection
Forward genetics may be limited in its ability to uncover plant genes required for the
infection and invasion processes. This may occur if infection and invasion share
common mechanisms with essential host functions. Detailed electron microscopy
studies have described the cytology of rhizobia entry into legume root hairs
(Newcomb, 1976). We observed that invagination of the root hair plasma membrane
during infection thread initiation resembles a partial endocytosis event where the
membrane begins to bud but instead of pinching off, elongates through the cell. When
the infection thread reaches the end of the root hair cell, the bacteria release into the
intercellular space and a new membrane invagination occurs in the underlying cell
layers (reviewed in Gage, 2004). Like endocytosis and other membrane shaping
events, infection thread growth in Lotus has been shown to depend on actin
reorganization (Yokota et al., 2009). Other genes involved in infection may not be
revealed in forward genetic screens because they are essential, have pleiotropic
phenotypes, or have genetic redundancy.
We hypothesized that symbiotic infection thread formation and bacterial
endocytosis may have co-opted gene function normally involved in vesicle trafficking,
endocytosis and membrane shaping, and that these might represent common host
targets for intracellular bacteria. We employed a reverse genetics approach to identify
plant endocytosis and membrane-shaping genes required for bacterial infection and
invasion. We conducted a reverse genetics screen to identify genes that are (1)
associated with infection or survival of Brucella in animal cells, (2) conserved in
plants, (3) transcriptionally regulated during nodulation, and (4) expanded gene
families in legumes. M. truncatula flotillins met all of these criteria, so their role in
symbiosis was explored further (Chapters 2 and 4).
Flotillins and membrane rafts in animals
Flotillins were first identified in a search for membrane proteins that co-fractionate
with detergent insoluble membrane fractions (Bickel et al., 1997). At the same time,
they were identified as proteins upregulated during axon regeneration in zebra fish
8
retina and as a result, named Reggies (Schulte et al., 1997). Animals have two
flotillin/reggie-family proteins, FLOT1 and FLOT2, that are ~50% identical. Both
proteins have patchy distributions associated with cellular plasma membranes and
localize to several intracellular compartments (Solomon et al., 2002; Glebov et al.,
2006; Langhorst et al., 2007). FLOT1 and FLOT2 lack trans-membrane domains and
are membrane associated by N-terminal fatty acid modifications (Morrow et al., 2002;
Neumann-Giesen et al., 2004). The N-terminus of FLOT contains a
stomatin/prohibitin/flotillin/HflK (SPFH) domain (Browman et al., 2007). Several
SPFH domain-containing proteins can bind cholesterol (Huber et al., 2006), and it has
been proposed that by binding cholesterol, they may play a role in structuring the
plasma membrane (Browman et al., 2007). FLOT1 and FLOT2 co-localize
(Langhorst et al., 2007) and form hetero- and homo-oligomers which are mediated by
C-terminal coiled-coil domains (Neumann-Giesen et al., 2004; Solis et al., 2007).
FLOTs are frequently used as markers for the detergent resistant membrane
(DRM) fraction, a technique which for many years was used to prove that a protein
localized to “lipid rafts” (Lingwood and Simons, 2010). It was believed that proteins
closely associated with cholesterol and sphingolipids would be shielded from
detergents allowing them to be isolated from the remainder of the plasma membrane,
and that these lipid-rich regions of plasma membrane corresponded to functionally
active membrane rafts. However, it has been shown that detergent-based methods can
introduce artifacts, and the DRM fraction may not correlate with protein distribution in
a living cell (Munro, 2003; Lingwood and Simons, 2010). As a consequence, DRM
localization does not necessarily have functional implications and two proteins that co-
partition in the DRM fraction may not co-localize in a living cell. Membrane rafts (or
lipid rafts) are defined as “small (10-200 nm), heterogeneous, highly dynamic, sterol-
and sphingolipid-enriched domains that compartmentalize cellular processes” (Pike,
2006). Despite the controversy and confusion surrounding the DRM/membane raft
debate, the domains marked by FLOTs meet the criteria for membrane rafts. FLOT
puncta are small (50-100 nm; Stuermer et al., 2001) and likely cholesterol enriched
(shown by indirect means; Kokubo et al., 2003). FLOT puncta co-distribute with
9
many of their interaction partners and as such, FLOT-containing membrane puncta
can be said to compartmentalize cellular processes (see below).
Membrane puncta marked by FLOTs appear to be involved in
compartmentalization of cellular processes. FLOTs co-distribute and can interact with
cortical f-actin, Src kinases and the CAP adaptor protein (Liu et al., 2005). Via these
interactions, FLOTs mediate membrane shaping events including membrane budding,
actin-mediated neuronal differentiation, and filopodia formation (Baumann et al.,
2000; Neumann-Giesen et al., 2004; Frick et al., 2007; Langhorst et al., 2008a).
FLOTs co-localize with and are important for the function of several GPI-anchored
proteins (Stuermer et al., 2001; Deininger et al., 2003; Reuter et al., 2004; Stuermer et
al., 2004). FLOT1 and FLOT2 are both targets of the Fyn kinase which is required for
GPI protein signaling (Neumann-Giesen et al., 2007; Riento et al., 2009).
The molecular function of FLOTs in signaling remains elusive. It has been
suggested that FLOTs are required for receptor-mediated endocytosis of cholera toxin
and epidermal growth factor (EGF) and may define a clathrin-independent endocyotic
pathway (Glebov et al., 2006; Neumann-Giesen et al., 2007; Riento et al., 2009).
However, while FLOTs are required for receptor-mediated signaling in response to
many ligands, there are several examples where they are not required for endocytosis
of the receptor (Katanaev et al., 2008; Langhorst et al., 2008b; Pust et al., 2010).
There is evidence the role of FLOTs in receptor signaling may not be directly in
receptor-mediated endocytosis (Schneider et al., 2008; Pust et al., 2010). There is also
evidence that FLOTs are required for retrograde transport of bacterial toxins (Pust et
al., 2010). It has been proposed that FLOTs are involved in recruitment and assembly
of membrane proteins at plasma membrane cell-cell contacts or during tip growth
(Langhorst et al., 2007; Stuermer, 2010). However, not all receptors that require
FLOTs for their signaling also require FLOTs for their plasma membrane association
(Glebov et al., 2006). More experiments are required to elucidate the exact function
of FLOTs in signaling, and the existing models need to be refined to account for
emerging flotillin behaviors.
10
FLOTs in animals have been implicated in bacterial pathogenesis and toxin-
induced disease. Upon uptake into animal cells, Brucella is surrounded by a FLOT-
positive host membrane (Watarai et al., 2002; Arellano-Reynoso et al., 2005).
Silencing FLOT1 has been shown to inhibit clathrin-independent, receptor-mediated
endocytosis of cholera toxin (Glebov et al., 2006). FLOTs are also required for the
full toxicity of bacterial Shiga toxin and for the plant toxin ricin (Pust et al., 2010).
This suggests that pathogens may co-opt FLOT function, or the function of FLOT-
associated proteins, to gain entry into host cells and to cause disease.
Flotillins are conserved across kingdoms, although their low sequence
identity suggests FLOTs in diverse kingdoms may have adopted similar 3-dimensional
structures via convergent evolution (Rivera-Milla et al., 2006). The crystal structure
of an archael SPFH domain-containing protein is highly similar to animal FLOT2
(Yokoyama et al., 2008). Bacterial flotillins have been characterized and have a
punctate, membrane-associated distribution (Donovan and Bramkamp, 2009; Lopez
and Kolter, 2010); in Bacillus, flotillin mutants show a delay in sporulation (Donovan
and Bramkamp, 2009) and defects in signaling via a membrane-associated histidine
kinase (Lopez and Kolter, 2010). These results suggest that receptor signaling may be
a conserved function of SPFH domain-containing proteins.
Flotillins are conserved in plants
Bioinformatic analysis predicts that plant flotillin-like proteins share some features
with animal FLOT2 including two N-terminal hydrophobic stretches, a palmitoylation
site at Cys-34, and a C-terminal coiled-coil domain (Rivera-Milla et al., 2006). Plant
flotillin-like genes are nearly all annotated as nodulins (a generic name for a gene that
is expressed uniquely in nodules). This annotation is due to the early identification of
a plant flotillin-like gene, GmNod53b, that is induced in soybean nodules (Winzer et
al., 1999). Proteomic analyses of the peribacteroid membranes in soybean and pea
nodules identified peptide sequences identical to GmNod53b (Panter et al., 2000;
Saalbach et al., 2002). An Arabidopsis flotillin is upregulated in roots in response to
fungal chitin and bacterial flagellin, both of which elicit a defense response (Millet et
11
al., 2010). These results indicate that flotillins are conserved in plants and likely have
a role in plant-microbe interactions.
Contributions
In Chapter 2, I describe the characterization of M. truncatula flotillins (FLOTs) in
symbiosis with S. meliloti. I found that FLOT2 and FLOT4 are required for symbiosis
and that FLOT4 has a unique requirement in infection thread elongation. This work is
the first demonstration that flotillins are required for bacterial infection of any
eukaryotic host. Additionally, these are the first functions ascribed to plant flotillin
homologues. I showed that like their animal and bacterial counterparts, GFP-tagged
M. truncatula FLOTs have a punctate, plasma membrane-associated distribution. This
suggests that compartmentalization of plant membrane proteins may have a function
during symbiosis.
I investigated the localization of receptor kinase proteins required for
symbiosis and found that like GFP-tagged FLOTs, GFP-tagged symbiotic receptors
have a patchy distribution associated with root hair plasma membranes. In Chapter 3,
I describe localization of tagged functional symbiotic receptor kinases LYK3 and
DMI2. I found that like FLOT4:GFP, LYK3:GFP localizes to infection threads in root
hairs. Localization of LYK3:GFP and DMI2:GFP is discussed in the context of their
proposed functions. These findings further implicate plant membrane
compartmentalization in perception and transduction of signals.
I observed that FLOT4:GFP puncta have a change in distribution during the
early events in symbiosis. Chapter 4 explores the localization of FLOT4:GFP in the
context of known signaling events. I found that FLOT4:GFP localization is strongly
affected in a lyk3 kinase mutant. This suggests that membrane proteins themselves
have a role in structuring protein distribution within plant membranes. I co-expressed
tagged FLOT4 and LYK3 in M. truncatula roots and found that in the absence of
bacteria, the two proteins have little co-distribution in space and time. Bacterial
inoculation triggers redistribution of both FLOT4:GFP and LYK3:GFP and increases
co-distribution of the two proteins. Based on the similarity in flot4 and lyk3
12
phenotypes, the dependence of FLOT4:GFP localization on LYK3, and the observation
that they co-localize after bacterial treatment, I propose that FLOT4 is a component of
the high stringency NF entry pathway previously defined by LYK3 and NIN. These
data demonstrate that changes in plant membrane protein distribution accompany root
hair morphological changes in response to symbiotic bacteria.
13
Chapter 2 CHAPTER 2: Plant flotillins are required for infection by nitrogen-fixing bacteria
ABSTRACT To establish compatible rhizobial-legume symbioses, plant roots support bacterial
infection via host-derived infection threads. Here we report the requirement of plant
flotillin-like genes (FLOTs) in Sinorhizobium meliloti infection of its host legume
Medicago truncatula. Flotillins in other organisms have roles in viral pathogenesis,
endocytosis and membrane shaping. We identified seven FLOT genes in the M.
truncatula genome and show that two, FLOT2 and FLOT4, are strongly upregulated
during early symbiotic events. This upregulation depends on bacterial NF and the
plant’s ability to perceive NF. Microscopy data show that M. truncatula FLOT2 and
FLOT4 localize to membrane microdomains. Upon rhizobial inoculation, FLOT4
uniquely becomes localized to the tips of elongating root hairs. Silencing FLOT2 and
FLOT4 gene expression reveals a non-redundant requirement for both genes in
infection thread initiation and nodule formation. FLOT4 is uniquely required for
infection thread elongation, and FLOT4 localizes to infection thread membranes. This
work is reveals a critical role for plant flotillins in symbiotic bacterial infection.
14
INTRODUCTION Symbiotic nitrogen-fixing rhizobial bacteria live in association with legume roots
inside developmentally unique structures called nodules. Bacteria penetrate nodules
via plant-derived structures called infection threads. Invagination of the root hair
plasma membrane during infection thread initiation resembles a partial endocytosis
event where the membrane begins to bud, but instead of pinching off, elongates
through the cell. As the infection thread finishes traversing the cell, the bacteria
release into the intercellular space. New membrane invagination and infection thread
formation take place in the underlying cell layers. Eventually, the bacteria are released
into host cells via an endocytosis-like event where they remain surrounded by a host-
derived membrane (Newcomb, 1976; Gage, 2004).
A bacterially-produced lipochitooligosaccharide called Nod Factor (NF) is a
species-specific rhizobial signal that is recognized by the legume host. NF promotes
nodule development (Debellé et al., 2001) and via signal transduction induces calcium
spiking and transcriptional changes (Ehrhardt et al., 1996; Mitra et al., 2004a).
Forward genetic studies in rhizobial-legume systems have revealed genes required for
host NF signal perception, signal transduction, and transcriptional changes (see
Oldroyd and Downie, 2008 and references therein). NF perception is mediated by
LysM-family receptor-like kinases NFP and LYK3 (in Medicago truncatula;
NFR1/NFR5 in Lotus japonicus). The NFP receptor induces calcium spiking via a
pathway that includes a leucine-rich repeat receptor-like kinase and a putative ion
channel. Calcium spiking appears to control activity of a calcium/calmodulin-
dependent protein kinase and two downstream GRAS-family transcription factors
NSP1 and NSP2 which interact in the plant nucleus and directly bind the promoters of
nodulation genes (Hirsch et al., 2009). NSP1 and NSP2 are necessary for all known
NF-dependent transcriptional changes (Mitra et al., 2004a).
A second “entry” pathway (controlling bacterial entry into root hair cells) has
been proposed that includes the high stringency receptor encoded by LYK3. Loss of
function lyk3 mutants undergo a small number of cortical cell divisions and form no
infection threads. An additional transcriptional regulator NIN is required for nodule
15
organogenesis and infection events but not NF-dependent transcriptional changes.
Current evidence suggests that NIN may coordinate signals through both the signaling
and entry pathways (Marsh et al., 2007). Components of the proposed NF entry
receptor pathway are currently limited to NIN and LYK3; how LYK3 signaling is
perceived and translated into infection thread initiation is unknown.
Sinorhizobium meliloti, the nitrogen fixing symbiont of Medicago (the alfalfa
genus), is a close relative of the animal pathogen Brucella. Sinorhizobium and
Brucella have common genes required for infection and invasion of their hosts (Batut
et al., 2004). Given these common features, we asked whether required eukaryotic
host-cell factors might also be shared across kingdoms.
Upon uptake into host cells, Brucella is surrounded by a flotillin-positive
membrane (Watarai et al., 2002; Arellano-Reynoso et al., 2005) . Flotillins were
initially used as markers for cholesterol-rich, detergent-resistant, membrane
microdomains called “lipid rafts”, and are now believed to define a clathrin-
independent, caveolin-independent endocytic pathway (Glebov et al., 2006). By
interacting with effectors that can bind actin, flotillins mediate membrane shaping
events including membrane budding, actin-mediated neuronal differentiation, and
filopodia formation (Baumann et al., 2000; Frick et al., 2007; Neumann-Giesen et al.,
2007; Langhorst et al., 2008a). Flotillins are also responsible for secretion and spread
of long-range signaling forms of Wingless and Hedgehog in Drosophila, for insulin-
stimulated glucose transport, and for epidermal growth factor signaling (Baumann et
al., 2000; Neumann-Giesen et al., 2007; Katanaev et al., 2008).
Due to the importance of flotillins in pathogenesis, we investigated whether
plant flotillin-like proteins might be candidates for symbiotic events from infection
thread initiation and elongation to hormone transport to the final endocytosis of
bacteria into their host cells. Seventeen flotillin-like proteins in 10 different plant
species were identified by sequence similarity to mammalian flotillin-1 (Rivera-Milla
et al., 2006). Plant flotillin-like proteins are predicted to have many features of animal
flotillins including two N-terminal hydrophobic stretches, a palmitoylation site at Cys-
34, and a C-terminal coiled-coil domain (Rivera-Milla et al., 2006). At the start of
16
this work, plant flotillin-like genes were annotated as nodulins (a generic name for a
gene that is expressed uniquely in nodules). The nodulin annotation was due to the
early identification of a plant flotillin-like gene, GmNod53b, which is induced in
soybean nodules (Winzer et al., 1999). Proteomic analyses of the peribacteroid
membranes in soybean and pea nodules identified peptide sequences identical to
GmNod53b (Panter et al., 2000; Saalbach et al., 2002). An Arabidopsis flotillin gene
was among the most strongly up-regulated genes in response to root application of
flagellin peptide Flg22 (Millet et al., 2010). A flotillin was identified in the detergent-
resistant microsomal fraction of Arabidopsis leaf cells (Borner et al., 2005). These
results imply that flotillins are conserved between plants and animals. The conserved
sub-cellular localization suggests the possibility of conserved function(s). In this work
we employ a reverse genetics approach to investigate the role of the Medicago
truncatula flotillin-like gene family (FLOTs) in symbiosis. We demonstrate that two
family members, FLOT2 and FLOT4 are required for early symbiotic events and have
non-redundant functions.
17
RESULTS Identification of flotillin-like genes in M. truncatula
A search of the M. truncatula genome sequence yielded 7 genomic regions with high
homology (E-value < 1e-151) to the amino acid sequence of the soybean flotillin
homologue GmNod53b, which we have designated FLOT1-7 (Table 2-1). All seven
predicted ORFs have >85% identity on the nucleotide level (Figure 2-1A). FLOT1-5
are located within a 30 kb region of chromosome 3 (Figure 2-1B). While all other
plant flotillin-like proteins described thus far have a conserved predicted
palmitoylation site at Cys-35 (Rivera-Milla et al., 2006), FLOT4 is predicted to have a
Tyr substitution at this residue (Figure 2-1A). FLOT5 has no obvious translational
start site and lacks a two-exon, one-intron structure. Only three FLOT genes are
present in the Arabidopsis genome (Rivera-Milla et al., 2006) implying an expansion
of the FLOT family in M. truncatula. Gene Name
EST (TIGR)
Affymetrix probe set (expressed?)
BAC ID (imgag, genbank)
Genomic location Chromosome (position cM)
Number of exons
Estimated spliced mRNA size
FLOT1 BF644444 Mtr.5691.1 (No) Mth2-115c19, CT009553
3 (71.8) 2 1434 bp
FLOT2 EX527915 Mth2-115c19, CT009553
3 (71.8) 2 1440 bp
FLOT3 TC139669 Mtr.45231.1 (Yes) Mth2-115c19, CT009553
3 (71.8) 2 1422 bp
FLOT4 TC133140, TC127236
Mtr.11786.1 (Yes), Mtr.42072.1 (Yes)
Mth2-115c19, CT009553
3 (71.8) 2 1425 bp
FLOT5 TC126348 Mth2-115c19, CT009553
3 (71.8) 5 ?
FLOT6 AW574030 Mtr.3447.1 (No) Mth2-193c3, AC161241
1 (49.4) 2 1416 bp
FLOT7 TC117648 Mtr.10214.1 (No) Mth2-135j6, AC151528
1 (43.9) 2-3 ?
FLOT7 Mth2-58k14, AC174291
Unanchored 2-3 ?
Table 2-1. Summary of the FLOT gene family Location, size, gene structure and available ESTs for putative M. truncatula flotillin-like genes are shown. Data were compiled from the Noble foundation (http://bioinfo.noble.org/gene-atlas ), GenBank (/ http://www.ncbi.nlm.nih.gov/ Genbank/), the International Medicago Genome Annotation Group (IMGAG, http://www.medicago.org/genome/IMGAG ) and the M.t. Gene Index (
/http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/gimain.pl?gudb=medicago).
18
19
Figure 2-1. Alignment of predicted FLOT amino acid sequences and arrangement of FLOT1-5 within a single BAC (A) Sequences were aligned using CLUSTALW available from SDSC Biology Work Bench (http://workbench.sdsc.edu/
(B) Arrangement of FLOT1-5 BAC CT009553 (mth2-115c19) (IMGAG,
). Conserved residues between all FLOTs are highlighted blue, residues conserved between four or more sequences are yellow, and similar residues are green. Note change in FLOT4 Cys35 to Tyr (residue 37 as numbered).
http://www.medicago.org/genome/IMGAG/).
FLOT2 and FLOT4 show NF-dependent upregulation during nodulation
We assayed expression of M. truncatula FLOTs during nodulation by quantitative RT-
PCR at times corresponding to key events in nodule development (Starker et al.,
2006). FLOT2 and FLOT4 expression increases early in nodule formation (Figure 2-
2A). FLOT2 is up-regulated for the entire 21-day developmental time course while
FLOT4 expression returns to baseline by 7 days post inoculation (dpi). In contrast,
neither FLOT1 nor FLOT3 expression changes during nodule development. We
explored expression of FLOTs in diverse plant organs and found that FLOT4
expression is largely limited to roots and nodules, while FLOT2 has highest
expression in flowers and green pods, and FLOT1 and FLOT3 expression was detected
in all plant organs (Figure 2-2B). We did not detect expression of FLOT5 or FLOT7
in any plant tissue including roots and nodules. FLOT6 expression was occasionally
detected in roots and nodules at levels so low that it could not be consistently detected
even in the same sample. The roles of FLOT5-7 in nodulation were therefore not
explored further.
20
A small group of plant transcripts is up-regulated in the first 24 hours of
symbiosis; NF is necessary and sufficient for the majority of these early transcriptional
changes (Mitra et al., 2004a). We asked if NF was required for up-regulation of
FLOT2 and FLOT4 at 24 hours post inoculation (hpi). An S. meliloti mutant unable to
synthesize NF (ΔnodD1-nodABC) failed to up-regulate FLOT2 and FLOT4 at 24 hpi
which implies NF is necessary, but purified NF was not sufficient for up-regulation
(Figure 2-3A). We wondered if a second bacterial component such as a cell surface
polysaccharide was also necessary for FLOT induction. Mutants deficient in synthesis
of succinoglycan (exoA:Tn5), lipopolysaccharide (lpsB:Tn5), cyclic β-1,2-glucan
(ndvB:Tn5) and a succinoglycan over-producer (exoX:Tn5) caused up-regulation of
Figure 2-2. Expression of FLOTs during nodulation and in plant tissues (A) FLOT1-4 expression was measured by quantitative RT-PCR in Rm1021 vs. buffer treated A17 roots at 1, 4, 7 14, 21 dpi. Each FLOT expression was normalized to an internal actin control. All data are the ratio of treated vs. buffer control of M. truncatula cv Jemalong A17 plants or mutant derivatives. Each data point is an average of three replicates; error bars indicate standard error of the ratio. (B) Semi-quantitative RT-PCR was conducted to monitor expression of FLOT1-7 in leaves, stems, flowers, green pods. Actin primers were used to monitor total input of cDNA. 25 PCR cycles were used to amplify actin, 30 cycles for FLOT2-4 and 35 cycles were used to amplify FLOT1. Expression of FLOT5,6, and 7 was not detectible after 35 cycles.
21
FLOT2 and FLOT4 (Figure 2-3A) suggesting that known cell surface polysaccharides
are not required.
Evidence suggests that NF effects are transduced via two pathways: a signaling
pathway and a distinct entry pathway (Oldroyd and Downie, 2008). The most
downstream component of the signaling pathway, transcription factor NSP2, is
required for up-regulation of FLOT2 and FLOT4 at 24 hpi (Figure 2-3B). The parallel
entry NF perception pathway, defined by LYK3, is also required for up-regulation of
FLOT2 and FLOT4 at 24 hpi (Figure 2-3B) as is the transcriptional regulator NIN,
which is common to both signaling and entry pathways (Figure 2-3B). However, ERN
(BIT1), an ERF-like transcription factor required for upregulation of a subset of early
nodulins but not for infection thread initiation (Middleton et al., 2007), is not required
(Figure 2-3B). Rit-1 contains a mutation in an unknown gene, and has a block in early
infection (Mitra and Long, 2004); FLOT2 and FLOT4 are not induced in the rit-1
mutant at 24 hpi. NF perception by both signaling and entry NF receptors and signal
transduction via NSP2 and NIN are required for up-regulation of FLOT2 and FLOT4 at
24 hpi.
Figure 2-3. Up-regulation of FLOT2 and FLOT4 is dependent on NF and NF perception (A) FLOT2 and FLOT4 expression was evaluated in response to bacterial mutants at 1 dpi using qRT-PCR. A17 plants were treated with NF, a ΔnodD1-nodABC (SL44) bacterial mutant, or with mutants altered in succinoglycan synthesis (exoA:Tn5 and exoX:Tn5), lipopolysaccharide biosynthesis (lpsB:Tn5), or cyclic β-1,2-glucan synthesis (ndvB:Tn5) (B) Plant mutants unable to perceive NF or unable to initiate subsets of NF-dependent gene transcription were treated with Rm1021 or buffer. Error bars show standard error of the ratio.
22
We asked whether FLOT2 and FLOT4 were up-regulated specifically in the
plant cells that become infected by S. meliloti. Using transcriptional fusions
consisting of FLOT promoters and the GUS reporter gene, we found that in
uninoculated roots, FLOT1-4 are primarily expressed in vascular tissue (Figure 2-4A),
and FLOT4 is also weakly expressed in elongating root hairs (Figure 2-4B). Upon
inoculation with Rm1021, FLOT2 and FLOT4 show an expansion of expression in the
root cortex in the region of elongating root hairs (Figure 2-4), which will eventually
become colonized by bacteria (Gage, 2004). In nodules, FLOT2 and FLOT4 are
expressed in the infection zone (Figure 2-4A, bottom panels). In contrast FLOT1 and
FLOT3 show little change in their spatial expression or in intensity of expression in
roots upon inoculation, and expression is limited to the nodule vascular tissue (Figure
2-4A).
Figure 2-4. FLOT2 and FLOT4 are expressed in the root elongation zone and in the infection zone of nodules (A) A17 plants were transformed to generate hairy roots expressing FLOT1-4 promoter-GUS fusions; GUS activity is shown for the indicated strains and times. Ten transgenic lines were observed for each construct at each time point (scale bars: 1 mm); representative roots are shown. (B) FLOT2 and FLOT4 are expressed in inoculated root hairs. A17 plants were transformed to generate hairy roots expressing FLOT2 and FLOT4 promoter-GUS fusions; GUS activity is shown for buffer- and Rm1021-inoculated roots at 24 hpi. Ten transgenic lines were observed for each construct at each time point (scale bars: 30 nm); a representative sample at the indicated time points is shown.
23
FLOT2 and FLOT4 localize to membrane microdomains and FLOT4 becomes
polarly localized in response to bacterial signals
To study the localization and dynamics of FLOT2 and FLOT4 during nodulation, we
constructed FLOT:GFP fusions using the FLOT genomic sequence (promoter and
intron). FLOT2:GFP was not visible under control of its native promoter so we
expressed FLOT2 using the CaMV 35S promoter. In root cells, signals from both
FLOT2:GFP and FLOT4:GFP appear punctate and co-localize with FM4-64, a plasma
membrane marker (Figure 2-5). In the absence of bacteria, FLOT4:GFP and
FLOT2:GFP puncta are evenly distributed in the plasma membrane of root hair cells
(Figure 2-6). Upon inoculation with S. meliloti, FLOT4:GFP accumulates in the tips
of elongating root hairs while FLOT2:GFP puncta remain evenly distributed
throughout root hair plasma membranes (Figure 2-6). FLOT2:GFP is polarly
localized in uninoculated and inoculated epidermal cells while FLOT4:GFP is not
(Figure 2-6).
Figure 2-5. FLOT2 and FLOT4 localize to membrane-associated puncta We generated A17 hairy roots expressing 35S:FLOT2::GFP or FLOT4p:FLOT4:GFP. Transgenic roots were visualized using a spinning disk confocal microscope (scale bars: 15 μm). At least six transgenic lines were observed for each treatment. Representative images are shown. (A) 35S:FLOT2:GFP in root cells is punctate. (B) FM4-64 membrane-associated dye. (C) Co-localization of FLOT2:GFP puncta (green) and FM4-64 (red).
24
Figure 2-6. FLOTs localize to membrane-associated puncta and become polarly localized after inoculation We generated A17 hairy roots expressing 35S:FLOT2:GFP or FLOT4:GFP driven by its native promoter. Transgenic roots were visualized using a spinning disk confocal microscope (scale bars: 15 μm). FLOT4:GFP and FLOT2:GFP are visibly punctate and evenly distributed in the membranes of uninoculated root hair cells. FLOT4:GFP puncta localize to root hair tips by 24 hpi while the localization of FLOT2:GFP does not change upon inoculation. FLOT2:GFP is weakly polar in uninoculated epidermal cells (arrows) and remains polar on inoculation. FLOT4:GFP is evenly distributed in epidermal cell membranes in inoculated and uninoculated roots. At least fifteen transgenic lines were observed for each treatment. Representative images are shown. Root hair images are maximum intensity projections of 100 sections, taken at 0.2 μm increments.
FLOTs are required for nodulation
We tested FLOT function using RNA interference (RNAi) or artificial micro RNAs
(amiRNAs) to silence FLOT expression and found that FLOTs are required for
symbiosis (Figures 2-7 and 2-8). We targeted FLOT2 and FLOT4, which are
regulated during nodulation, and the constitutively expressed FLOT3 as a control
25
(FLOT1 was also silenced and gave similar nodulation results as FLOT3). We
confirmed efficacy of silencing by qRT-PCR at 24 dpi, a time point when no FLOTs
are significantly up-regulated in inoculated hairy roots (Figure 2-8C). Constructs are
designated by their primary target gene (greater than 50 percent reduction in
expression); numbers in parentheses show genes that have partial reduction in
expression due to cross silencing. The most dramatic phenotype of the FLOT-silenced
lines was observed when FLOT2,3, and 4 are silenced as a group (FLOT2,3,4 RNAi,
Figure 2-7B; this construct also silences FLOT1 (Figure 2-8A,B)). Roots transformed
with the empty vector formed nodules 87 percent of the time while only half of the
FLOT2,3,4 RNAi roots formed nodules. Pink nodules were observed on control
plants more than 25 percent of the time compared to only 2.5 percent for FLOT2,3,4
RNAi roots. On average control roots formed around 6 nodules while FLOT2,3,4
RNAi root formed an average of only 2 nodules. FLOT2,3,4 RNAi roots also had
altered morphology including a decrease in primary root length, an increase in the
number of primary and secondary lateral roots (Figure 2-8A) and reduction in root
weight (Figure 2-8D). These results indicate that FLOTs are required for symbiosis
and normal root development.
26
Figure 2-7. Silencing FLOTs results in a decrease in nodule number, a decrease in infection events and nodules that do form are non-functional (A) Expression of FLOT2,3, and 4 in individual hairy roots expressing the indicated RNAi or amiRNA construct was assessed using qRT-PCR, normalized to an internal actin control, and then to expression in plants transformed with the empty vector (average of at least 10 roots). Constructs are designated by their primary target gene(s) (*>50 percent reduction in expression); numbers in parentheses show genes that have partial but significant (#P< 0.05) reduction in expression due to cross silencing. (B) Nodulation phenotypes were assayed from a minimum of three biological replicates representing 50-100 plants per construct. (C) Acetylene reduction assays were performed at 21 dpi to determine the efficacy of nodules that form (14-20 plants were assayed per silenced line). (D) Hairy roots were stained for Rm1021 expressing phemA:lacZ and stained for lacZ activity at 7 dpi to visualize infection events. Infection events and nodules were scored on ten transformed plants per amiRNA or RNAi and normalized to root weight (Figure 2-8D). Between 104 (FLOT2,3,4 RNAi) and 371 (empty vector) total infection events were observed per line.
27
(E) Progression of infection threads on silenced roots (from Figure 2-4C). Infection threads were scored as aborting in the root hair, penetrating the hypodermal/cortical cell layers but not releasing bacteria into cortical cells, or releasing bacteria into cortical cells. Release was inferred by diffuse blue staining in the nodule cortex. (A-E) Error bars represent ±SEM ; *#P < 0.05 (F-I) Abortive infection threads in plants transformed with the FLOT4 amiRNA construct (F and G) compared to control infection threads (H and I) (scale bars: 15 μm). (J) Linear regressions were conducted on plants described in (A) to determine if a correlation exists between expression of FLOTs and nodule number. FLOT2 expression level has a strong linear relationship with nodule number (y = 5.1x + 2.7; Pintercept = 0.005; Pslope = 3x10-5); FLOT4 expression level has a weaker but statistically significant correlation (y = 2.0x + 5.8; Pintercept = 3x10-8; Pslope = 0.02). FLOT3 expression does not correlate with nodule number (Pslope = 0.6). FLOT2 and FLOT4 expression have additive effects (y = 7.1x + 0.9; Pintercept = 0.003; Pslope = 3x10-10).
Silencing different combinations of FLOTs results in varying degrees of
nodulation and root morphological defects, although none as severe as FLOT2,3,4
RNAi roots (Figures 2-7 and 2-8). Silencing FLOT2 results in fewer nodules per
plant, an increase in Nod- plants, and a decrease in plants that form pink nodules.
Silencing FLOT2 resulted in a decrease in primary root length and long primary lateral
roots but no significant change in root weight. Plants silenced for FLOT4 expression
are significantly less likely to form pink nodules than roots transformed with the
vector control; FLOT4-silenced roots had an increase in numbers of secondary lateral
roots but no decrease in primary root length or root weight. The FLOT3(4) amiRNA
construct silences FLOT3 as completely as FLOT2,3,4 RNAi but these roots show no
significant nodulation defects compared to controls (this construct also targets
FLOT1—Figure 2-8B). We observed shorter roots and reduced root weight in lines
with the greatest reduction in FLOT3 expression. These data suggest that FLOT2 and
FLOT4 play the largest role in symbiosis and the symbiotic defects are separable from
the small root phenotype observed upon silencing FLOT2,3,and 4.
28
Figure 2-8. Root and nodule phenotypes of FLOT-silenced roots (A) A representative plant for amiRNA and RNAi constructs described in this study is shown. Nodules that formed in silenced lines were small and white (with the exception of FLOT1+3(4) amiRNA line). Note smaller overall roots in FLOT3-silenced lines, shorter primary roots in FLOT2-silenced lines and increase in short secondary lateral roots in FLOT4-silenced lines. (B) Silencing data including the data for FLOT1 and one additional construct that primarily targets FLOT1 (FLOT1(2) amiRNA). Gene expression of FLOTs in individual hairy roots expressing the indicated RNAi or amiRNA construct was assessed using qRT-PCR, normalized to an internal actin control and then to expression in control plants (average of at least 10 roots). Constructs are designated by their primary target gene(s); numbers in parentheses show genes that have partial but significant (P < 0.05) reduction in expression due to cross silencing. (C) Hairy root time course. Jemalong seedlings were transformed using A. rhizogenes with the amiRNA empty vector to generate hairy roots. Plants were
29
inoculated with S. meliloti Rm1021 or 1/2X BNM and harvested at the indicated time. QRT-PCR was performed to analyze expression of FLOT2 and FLOT4 at all time points; FLOT1 and FLOT3 expression were monitored at 21 dpi only. Expression of each gene is normalized to an actin internal control; the ratio of inoculated to uninoculated plants is shown. Error bars represent standard error of the ratio. (D) Average root weight of silenced lines. The ten plants per construct used to count infection events (Figure 2-7A to G) were weighed. Error bars represent ±SEM; *P <0.05. (E) Linear regressions were conducted on plants described in Figure 2-7B to determine if a correlation exists between expression of FLOTs and nodule number. FLOT1 expression does correlates with nodule number (Pslope = 0.9).
FLOT2- and FLOT4-silenced plants are defective in both nodule form and
function
Nodules that form in FLOT-silenced lines are predominantly small and white
suggesting that they are unable to fix nitrogen. We found that all silenced lines (with
the exception of FLOT3(4) amiRNA) had a significant decrease in their ability to
reduce acetylene, a reporter for nitrogen fixation (P < 0.01, Figure 2-7C).
To explore the individual contribution of each FLOT to nodule number, we
used the data set from Figure 2-7A to determine whether a correlation exists between
nodule number and the expression of a particular FLOT gene (each hairy root
transformation event results in a unique genomic insertion of the RNAi or amiRNA
construct and a different degree of gene silencing). We found that that FLOT2
expression has a strong linear correlation with nodule number while FLOT4
expression has a weaker but significant linear correlation with nodule number (Figure
2-7J). In contrast, FLOT1 and FLOT3 expression levels have no significant
correlation with nodule number (Figures 7J and 8E). To assess if FLOTs have
additive effects, we compared the pooled expression of different combinations of
FLOTs and found that the combination of FLOT2 and FLOT4 expression levels was
the only grouping that increased the strength of the correlation (Figure 2-7J). This is
consistent with a model in which FLOT2 and FLOT4 contribute independently to
nodule number.
30
FLOT silencing results in infection thread initiation and elongation defects
We used lacZ-staining of S. meliloti to visualize infection threads in silenced roots.
FLOT-silencing results in reductions in both the number of nodules and the number of
infection events (with the exception of FLOT3(4) amiRNA) (Figure 2-7D). The
decrease in the total number of infection events in FLOT2- and FLOT4-silenced roots
indicates that the decrease in nodule number observed may in part be due to an
infection thread initiation defect.
We wondered if the infection defects (Figure 2-7D) are limited to infection
thread initiation or if FLOT2- and FLOT4-silenced roots also have infection thread
elongation defects. We evaluated the progression of infection threads on silenced
roots and found that infection threads on FLOT4-silenced roots were significantly
more likely to abort in the root hair than control plants (Figure 2-7E). Infection
threads on roots silenced for FLOT4 and all FLOTs were also significantly less likely
to have bacterial release into cortical cells. FLOT2- and FLOT3-silenced roots
showed normal infection thread development (Figure 2-7E). Representative images of
the abortive infection threads observed on FLOT4-silenced roots are shown in Figure
2-7F and G (compare to controls in Figure 2-7H,I). This suggests that FLOT4, but not
other FLOTs, is required for normal infection thread elongation. It may suggest a
defect in bacterial release in FLOT4-silenced plants, or that infection threads fail to
reach the cell layers where release normally occurs.
FLOT4 localizes to infection thread membranes
Because silencing FLOT4 results in infection thread elongation defects (Figure 2-7E to
I), we explored whether FLOT4 localizes to infection threads. In infected root hair
cells, FLOT4:GFP localizes to infection thread membranes (Figure 2-8A). A section
through the infection zone of a 7 day old nodule revealed that FLOT4 is present in
infection thread membranes in the nodule (Figure 2-8B). In contrast, FLOT2 is not
present on infection thread membranes in root hairs (Figure 2-8C).
31
Figure 2-9. FLOT4 localizes to infection thread membranes (A-C) Transgenic roots expressing FLOT4p:FLOT4:GFP or 35S:FLOT2:GFP (green) are inoculated with S. meliloti Rm1021 expressing ptrp:mCherry (red) (Scale bars: 30 μm). (A) FLOT4:GFP localizes to infection thread membranes in root hair cells (stack of 50 images taken at 0.2 μm increments, arrows mark infection threads). (B) FLOT4:GFP localizes to infection thread membranes in the infection zones of maturing nodules (arrows). (C) FLOT2:GFP does not localize to infection thread membranes in root hair cells.
32
DISCUSSION A requirement for FLOT2 and FLOT4 for early nodulation events
Data presented in this study indicate that FLOT2 and FLOT4 have roles in early
nodulation. FLOT2 and FLOT4 are among a select group of plant genes up-regulated
at 24 hpi; this up-regulation is dependent on both the NF signaling and entry receptor
pathways, and on NIN (Figure 2-3B). The unexpected result that NF is insufficient for
induction of FLOT2 and FLOT4 suggests that a second bacterial factor may also be
required, although known surface polysaccharides are not apparently required (Figure
2-3A).
FLOT4 shows a prominent accumulation in the tips of elongating root hairs
upon inoculation with S. meliloti (Figure 2-6). Plant proteins with similar localizations
have been implicated in polar growth of root hairs and pollen tubes (Yang, 2008).
Upon silencing FLOT4, we did not observe an obvious defect in normal root hair
elongation or in curling around bacterial colonies, so it seems unlikely that FLOT4 is
required for root hair elongation or directional growth. It seems more likely that this
protein is involved in polar growth of the infection thread.
We observed that silencing FLOT2 and FLOT4 results in fewer infection
threads (Figure 2-7D) and silencing FLOT4 causes infection thread elongation defects
(Figure 2-7E). By analogy to flotillins in other organisms, one might predict that
FLOT2 and FLOT4 have a role in the initial invagination of infection threads into the
root hair and that FLOT4 additionally functions in elongation of the infection thread.
At is also possible that FLOTs coordinate infection thread initiation and nodule
organogenesis (as has been proposed for NIN; Marsh et al., 2007) or that FLOTs are
involved in endocytosis or trafficking of a signal involved in nodule organogenesis.
Further studies are needed to determine if, like their animal counterparts, plant
flotillins interact with the actin cytoskeleton to facilitate membrane rearrangements.
FLOTs were previously isolated from soybean and pea peribacteroid
membranes (Panter et al., 2000; Saalbach et al., 2002); however, we were unable to
detect either FLOT2:GFP or FLOT4:GFP on symbiosome membranes in M.
truncatula. This may be due to limitations in the sensitivity of our microscope or to an
33
absence of the proteins on the symbiosome membranes in this system. We found
evidence that FLOTs are required for later stages of nodulation: FLOT2-silenced
nodules were populated with infection threads that looked similar to wild type
infection threads (Figure 2-7E); however, these nodules were unable to fix nitrogen
(Figure 2-7C) indicating a defect post-infection. Future studies are needed to
determine if FLOTs have a role in endocytosis and trafficking of bacteria.
Flotillin-like genes are ubiquitous in plants
Possible roles for flotillin-like genes in general plant development may be suggested
by the root phenotypes of FLOT-silenced plants (Figure 2-8). We found that FLOT3-
silenced plants had a reduction in root weight, FLOT2-silenced plants had a decrease
in primary root length and FLOT4-silenced plants had an increase in secondary lateral
roots (Figure 3-8). These silencing phenotypes suggest that FLOTs may have a
normal role in plant growth and development and that legumes may have co-opted the
ancestral FLOT function for symbiosis.
Because plant membranes have different compositions than animal membranes
(reviewed in Zappel and Panstruga, 2008), it is likely that plant membrane
microdomains will have different properties than animal membrane microdomains.
Plant membranes contain little cholesterol but rather a mix of sterols that vary across
plant taxa. Most plants including the model Arabidopsis contain primarily sitosterol,
campesterol, and stigmasterol. Medicago has a less common membrane composition
consisting largely of spinasterol (Lefebvre et al., 2007). Determining how the
membrane microdomains defined by FLOTs are similar to and different from the
membrane microdomains defined by flotillins in other plants and other organisms will
give valuable insight into plant membrane microdomains and plant membrane
organization.
34
MATERIALS AND METHODS Plant growth and bacterial treatments
Medicago truncatula Gaertner cv Jemalong, cv Jemalong A17 (an inbred line of
Jemalong), nin-1 (Marsh et al., 2007) and bit1-1 (Middleton et al., 2007) were grown,
inoculated and harvested as described (Mitra and Long, 2004). S meliloti strain
Rm1021 is a streptomycin-resistant derivative of WT field isolate SU47 (Meade et al.,
1982). SL44 has a deletion of the nodD1-nodABC region (Fisher et al., 1988). The
exoA strain (Rm7031) is described in Leigh et al. (1985). The exoX (MB801), lpsB
(R1A6) and ndvB (B587) mutants are described in Griffitts et al. (2008) and Griffitts
and Long (2008). Bacteria were grown in liquid TY-medium or Luria-Bertani (LB)
medium supplemented with appropriate antibiotics. For inoculations, bacteria were
grown to an OD600 between 0.5 and 1. They were then pelleted and resuspended in
1/2X Buffered Nodulation Medium (BNM; Ehrhardt et al., 1992) at an OD600 of 0.05.
RNA sample preparation
RNA used for 24 hour time points (A17 inoculated with NF, or with SL44, or exoA
bacterial mutants and uninoculated and inoculated nps2-2 and hcl-1 plant mutants)
were the same RNA samples that were used in Mitra et al. (2004a). The RNA
samples from the A17 time course were the same samples used by Starker et al.
(2006) with the exception of the 21 dpi RNA samples which were prepared by
Adriana Parra-Rightmyer using methods described in Starker et al. (2006). Remaining
RNA samples were isolated using the TRIzol (Invitrogen) method previously
described by Mitra and Long (2004).
Quantitative RT-PCR
To ensure primer specificity, primers were designed to amplify the most divergent
region of each FLOT and to flank intron splice sites (Table 2-2). Primer pairs were
tested against a cloned genomic region containing FLOT1,2,3 or 4 to ensure that each
primer pair would only amplify its intended target. Primer pairs were also tested for
specificity using cDNA from uninoculated and inoculated M. truncatula cv Jemalong
35
and cv Jemalong A17. The resulting products were sequenced to ensure they were
from a single gene. Quantitative RT-PCR, data quantification and analysis were
performed as described in Mitra et al. (2004a).
To prepare template for qRT-PCR, RNA was DNAse treated using DNAse-
free turbo (Ambion). 35 PCR using actin-specific primers (Table 2-2) was used to
check for DNA contamination post DNAse treatment. The DNAse-treated RNA was
used in single stranded cDNA synthesis using Superscript III (Invitrogen) and
oligo(dT) primer (Invitrogen). 25 PCR cycles were used to check for successful
cDNA synthesis. Template concentration per reaction was determined empirically
based on relative abundance of the transcript of each FLOT; each template was run at
two different concentrations. Template quantification was done at the level of total
RNA; an internal actin control in each PCR controlled for differences in efficiency of
cDNA synthesis. Actin was amplified from cDNA made from 2.5 ng and 7.5 ng of
RNA; FLOT2, FLOT3, and FLOT4 were amplified from cDNA made from 7.5 and 25
ng RNA; FLOT1 was amplified using cDNA made from 25 and 75 ng total RNA.
qPCR was performed using DyNAmo Flash SYBR Green qPCR kit (Finnzymes,
Helsinki).
A. rhizogenes-mediated hairy root transformations
Plasmids were transformed into A. rhizogenes Arqua1 (Quandt, 1993) and selected
using the appropriate antibiotic. A. rhizogenes-mediated hairy root transformations
were done according to Boisson-Dernier et al. (2001) with modifications. We found
that transformation efficiency was increased if the plants were first placed on modified
Fahraeus medium containing 1 mM α-aminoisobutyric acid (AIB) without selection
for 7 days. All newly formed roots were removed, and plants were transferred to
selective media with no ethylene inhibitor and either 25 mg/L kanamycin (remained
on selective media for 17-21 days) or 10 mg/L hygromycin (for 10 days). Plants
remained on selective media until roots reached approximately 2.5 cm (we found that
less time was often needed for Jemalong A17 than for Jemalong). Plants were then
transferred to 1/2X Gamborg’s B5 Basal Salt medium (Sigma) with 1% agar to
36
recover from antibiotic selection. For confocal microscopy studies, 300 mg/mL
Augmentin (Research Products International) and 500 mg/L Cefotaxime (Sigma) were
added to the B5 medium to reduce the amount of A. rhizogenes carryover. Plants
remained on B5 for 1 week then were transferred to Buffered Nodulation Medium
(BNM; Ehrhardt et al., 1992) containing 0.1 μM aminoethoxyvinylglycine (AVG).
Plants were flood inoculated one week later with 10 mLs of the appropriate S. meliloti
strain diluted to OD600 = 0.05 in 1/2X BNM.
β-Glucuronidase assays
The upstream region of each open reading frame (3 kb at most, less if another ORF is
< 3 kb upstream) was amplified from BAC mth2-115c19 and cloned into pENTR
D/TOPO (Invitrogen) (Table 2-5). LR recombination was performed with the
Gateway-compatible vector pMDC163 (Curtis and Grossniklaus, 2003). Plasmids
were used to transform A. rhizogenes Arqua1. A. rhizogenes-mediated hairy root
transformation was performed as described above with hygromycin selection. GUS
assays were conducted as described in Oldroyd et al. (2001a).
RNAi and amiRNA construct design and screen
For RNAi constructs, 100-200 bp of either the conserved region of FLOTs or the
3’UTR were amplified from DNA prepared from BAC mth2-115c19 (Table 2-3). The
PCR products were first cloned into pENTR/D TOPO (Invitrogen). LR recombination
was performed with the binary vector pHELLSGATE8 (Helliwell and Waterhouse,
2003).
AmiRNA constructs were designed as described in Ossowski et al. (2008)
using the web designer described in Schwab et al. (2006)
(http://wmd2.weigelworld.org) which cross-references with available Medicago EST
databases (Table 2-4). The full length sequence for the desired FLOT target was
entered as the “target gene” and available ESTs for that target were entered as
“accepted off-targets”. The suggested amiRNAs were BLASTed against the available
M. truncatula genome to ensure there were no off target sequences that are absent
37
from the available EST library. The pRS300 plasmid (Ossowski et al., 2008) was
used as a template to create the amiRNA hairpin with an intron.
The final amiRNA PCR product was digested at the XhoI and XbaI sites
flanking the sequence encoding the amiRNA hairpin. The resulting product was
ligated into the pHELLSGATE8 vector XhoI and XbaI sites (thus removing the
Gateway cassette). The result was an amiRNA construct driven by the CaMV 35S
promoter with the same vector backbone as the RNAi constructs.
Using A. rhizogenes to generate transgenic hairy roots, we conducted a
preliminary screen of eight RNAi and twelve amiRNA constructs to identify those that
effectively silenced expression of one or more FLOT. ANOVA was used to identify
constructs that caused significant reduction in gene expression. Two-tailed t-tests
were used to determine if nodule number, percent Nod- and percent pink nodules were
different in silenced lines compared to the empty vector control. Linear regressions
were done using Microsoft Excel data analysis feature. To determine if second and
third order correlations existed, second and third order transformations were
performed on the data and linear regressions were conducted. Gene expression was
pooled by averaging the expression level of each gene in the same plant.
Plant Assays
Acetylene reduction (Turner, 1980) was performed as described (Oke and Long,
1999). Plants were initially grown on BNM plates as described above; at 21 dpi the
entire plant was moved to test tubes for the assays. At least 3 uninoculated plants
were assayed per construct to ensure that silencing FLOTs did not intrinsically cause
an increase in ethylene production.
To visualize infection events, plants were inoculated with Rm1021 expressing
lacZ from the plasmid pXLGD4 and stained for β-galactosidase activity at 7 dpi as
described (Boivin et al., 1990). Due to the altered lateral branching observed in some
FLOT-silenced lines, we used root weight rather than root length as a measure of root
size.
38
Localization of fusion proteins
The genomic regions of FLOT2 and FLOT4 were amplified from BAC Mth2-115c19
DNA and inserted into pCH010 (Table 2-5). pCH010 was constructed in two steps by
first inserting eGFP (with added 5’ EcoRI and XmaI sites) into the BamHI/XbaI sites
of pJG159; then the NPTII ORF was amplified from the pHELLSGATE8 vector and
inserted into the XhoI site in pJG159. pJG159 is a small (7.8 kb) binary vector that
was constructed by J. Griffitts (unpublished) by a three way ligation of inserts A and B
from pEGAD (Cutler et al., 2000); Table 2-5) and the SphI/XhoI fragment from
pCAMBIA1300 (www.cambia.org). To create insert A (Sph-RB-P35S-RI), pEGAD
was amplified with primers oJG346/347 and 348/349 followed by overlap extension-
PCR with oJG346/349. Insert B (RI-nosT-P35S-XhoI) was amplified from pEGAD
with oJG350/351.
For 24 hpi localization studies, plants were inoculated with Rm1021 over-
expressing NodD3 from the plasmid pRmE65 (Fisher et al., 1988). For infection
thread co-localization studies, plants were inoculated with Rm1021 constitutively
expressing mCherry from the plasmid pQDN03. pQDN03 was constructed by
replacing GFP in pDG71 (Gage, 2002) with mCherry (Table 2-5).
Root segments and nodule hand sections (for imaging the infection zone) were
excised and mounted in 0.1 M potassium phosphate buffer pH 7. Spinning disk
confocal microscopy was performed on a system described previously in Gutierrez et
al. (2009) using a 63X/1.3 NA glycerol immersion objective. GFP and RFP were
excited at 491 nm and 561 nm, respectively, by solid-state lasers. Z-projections of
root hairs are from 100-200 images taken at increments of 0.2 μms (MCL NanoDrive).
Stacks were processed using ImageJ software (http://rsbweb.nih.gov/ij
FM4-64 was dissolved in 0.1 M phosphate buffer pH 7.0 to a final
concentration of 20 μM and kept on ice until use (Bolte et al., 2004). The GFP/FM4-
64 experiment was imaged on a system described in Paredez et al. (2006) with the
same excitation settings listed above for GFP/RFP and 1000 ms exposures. Typical
exposure times were 1000 ms for GFP, 500 ms for mCherry and 1000 ms for FM4-64.
/). Typical
exposure times were 1000 ms for GFP, 500 ms for mCherry.
39
Hairy root time course
To determine if regulation of FLOTs was altered in hairy roots, we assayed FLOT
expression levels in uninoculated and inoculated M. truncatula cv Jemalong seedlings
transformed with the amiRNA empty vector construct EX117 (Table 2-4) at 1, 4, 7, 14
and 21 dpi. Plants were grown as described above and inoculated with 1/2X BNM or
Rm1021 in 1/2X BNM. Plants were harvested just below the callus at the appropriate
time point and flash frozen in liquid nitrogen. Three independent replicates of the
entire time course were performed; each time point sample was a pool of the ten plants
from a single plate. RNA was isolated with a yield of 50-100 μg per ten plants.
Experiment Intended Target Primer Name Primer sequence qPCR Actin chh256 CACGAGACCACCTACAACTCT chh257 GGACTTAGAAGCACTTCCTGT qPCR FLOT1 chh250 CTGAGCTTGAGGCTGCTAAAG chh251 TTAGCCTCTTGTACCTTAGTGTC qPCR FLOT2 chh234 CAAGAGCTTTTCTCAGATAAGGC chh237 ACTGATGGTGCCATGGGTATG qPCR FLOT3 chh244 AGTTGGCCAAAAAGAAGGCTG chh247 TTAGCCTCTTGTACCTTAGTTTC qPCR FLOT4 chh241 TGCGTCTGCTAATGCTTTCTGTG chh243 CCGAAGTTGAGGCTGCCAAAG PCR/expression FLOT1 chh073 TATGACATAGTAGTAGTTTG chh068 ATGTACCGGGTAGCAAAAGCA PCR/expression FLOT2 chh258 AGTCGAGGCGAAGAAGGCTGTT chh259 AGTCTCTTTCTGTTTCTTGTACAGC PCR/expression FLOT2 chh067 ATGAAAATTTACCGGGTCGCG chh074 TCAGGCATGTATGATCACGTA PCR/expression FLOT3 chh068 ATGTACCGGGTAGCAAAAGCA chh075 TGCATCTCCTAATTAAGACTT PCR/expression FLOT4 chh068 ATGTACCGGGTAGCAAAAGCA chh076 GCCAAAATAAAATTCCACAAT PCR/expression FLOT5 chh090 GTGGGACTTCATCGTGTAGC chh091 CCTAATACTTGCATTGCATCAT PCR/expression FLOT6 chh067 ATGAAAATTTACCGGGTCGCG chh077 CTACTATAAACCTCTAAACCC PCR/expression FLOT6 chh252 GGGTGAAGCAGGTGGTATG chh253 CTACTACTATAAACCTCTAAACCC PCR/expression FLOT6 chh254 AGGCGAAGAAGGCTGTGAAAC chh255 ACCCCTTGAGCTTGTCCAACT PCR/expression FLOT7/8 chh230 GTAGTTTAGTAATTTAGTAGTTTAAG chh231 TCAAAGAGAGGCTGAAGTGGCTGAGG PCR/expression FLOT7/8 chh231 TCAAAGAGAGGCTGAAGTGGCTGAGG chh107 AGTCTCTTTCTGTTTCTTGT
Table 2-2. PCR and qPCR primers to monitor FLOT expression
40
Construct (original: name used here)
Intended Target Primer Name Primer sequence
E: FLOT1-4 RNAi FLOT1-4 chh112 CCACAATTCTGTATGAGAAGAA chh113 GTTTCCAAGTGCATTGAGAAG
J FLOT1 UTR chh224 CACCACCTTTTATTGTGTGATATGTGTT chh225 TGTAAACTAAATCATCATATGACATAG
K FLOT2 UTR chh226 CACCGGTTTTGGTAATTTAGTAGCAGT chh227 ATTAAATTGGCATTTAATATAAGAG
L: FLOT4(3) RNAi FLOT3 UTR chh228 CACCAATTAGGATGATGCAACTATTATG chh229 ACCTGAAAATCTGAAAGACTAGTGA
M FLOT1 UTR chh277 CCACATCTTTACCTGACAAAAACTC chh278 GACTGGTGAATAAAACACATATCAC
N FLOT2 UTR chh279 CCACAGCCTTATCTGAGAAAAGCTC chh280 TCACGTAATAAAAAGTACTGCTAC
O FLOT2 chh281 CCACATGAAAATTTACCGGGTCGC chh282 GAGTTTGATGTCTTTGATGAAAATAC
Q FLOT1-4 chh285 CACCGTAAGGGATTACTTGATGATAAA chh286 TATTATCACCACCATTAGTCCAAAT
Table 2-3. RNAi Construct Primers Construct (original: targets)
Intended Target
Primer Name
Primer sequence
pRS300 amiRNA-A CACCCTGCAAGGCGATTAAGTTGGGTAAC amiRNA-B GCGGATAACAATTTCACACAGGAAACAG EX101 FLOT 1-4 chh287 gaTCAAGTGTCACAATCCCCTATtctctcttttgtattcc chh288 gaATAGGGGATTGTGACACTTGAtcaaagagaatcaatga chh289 gaATCGGGGATTGTGTCACTTGTtcacaggtcgtgatatg chh290 gaACAAGTGACACAATCCCCGATtctacatatatattcct EX102: FLOT1,3(4) amiRNA
FLOT 1-4 chh291 chh292 chh293 chh294
gaTTTCACTTCAGTTCTCACTTAtctctcttttgtattcc gaTAAGTGAGAACTGAAGTGAAAtcaaagagaatcaatga gaTACGTGAGAACTGTAGTGAATtcacaggtcgtgatatg gaATTCACTACAGTTCTCACGTAtctacatatatattcct
EX103 FLOT2 chh295 gaTTTAACGTGATTGGAGTCCCGtctctcttttgtattcc chh296 gaCGGGACTCCAATCACGTTAAAtcaaagagaatcaatga chh297 gaCGAGACTCCAATCTCGTTAATtcacaggtcgtgatatg chh298 gaATTAACGAGATTGGAGTCTCGtctacatatatattcct EX104 FLOT2 chh299 gaTGGTCCAAGACAGTGCACGGTtctctcttttgtattcc chh300 gaACCGTGCACTGTCTTGGACCAtcaaagagaatcaatga chh301 gaACAGTGCACTGTCATGGACCTtcacaggtcgtgatatg chh302 gaAGGTCCATGACAGTGCACTGTtctacatatatattcct EX105: FLOT2(3) amiRNA
FLOT2 chh303 chh304 chh305 chh306
gaTTTCTCGGCACTCATAGCTCGtctctcttttgtattcc gaCGAGCTATGAGTGCCGAGAAAtcaaagagaatcaatga gaCGCGCTATGAGTGGCGAGAATtcacaggtcgtgatatg gaATTCTCGCCACTCATAGCGCGtctacatatatattcct
EX106 FLOT3 chh307 gaTACTAGTGAATCTCAGACGTGtctctcttttgtattcc chh308 gaCACGTCTGAGATTCACTAGTAtcaaagagaatcaatga chh309 gaCAAGTCTGAGATTGACTAGTTtcacaggtcgtgatatg
41
chh310 gaAACTAGTCAATCTCAGACTTGtctacatatatattcct EX107: FLOT2(3,4) amiRNA
FLOT3 chh312 chh313 chh314 chh315
gaTACTAGTGAATCTCAGACACGtctctcttttgtattcc gaCGTGTCTGAGATTCACTAGTAtcaaagagaatcaatga gaCGCGTCTGAGATTGACTAGTTtcacaggtcgtgatatg gaAACTAGTCAATCTCAGACGCGtctacatatatattcct
EX108 FLOT1 chh315 gaTAAATATTCATGACCCGCGACtctctcttttgtattcc chh316 gaGTCGCGGGTCATGAATATTTAtcaaagagaatcaatga chh317 gaGTAGCGGGTCATGTATATTTTtcacaggtcgtgatatg chh318 gaAAAATATACATGACCCGCTACtctacatatatattcct EX109 FLOT1 chh319 gaTATTGAAGCAACGAGGACGCGtctctcttttgtattcc chh320 gaCGCGTCCTCGTTGCTTCAATAtcaaagagaatcaatga chh321 gaCGAGTCCTCGTTGGTTCAATTtcacaggtcgtgatatg chh322 gaAATTGAACCAACGAGGACTCGtctacatatatattcct EX110: FLOT4 amiRNA
FLOT4 chh323 chh324 chh325 chh326
gaTAAAGGTGTAATTTACAGGCGtctctcttttgtattcc gaCGCCTGTAAATTACACCTTTAtcaaagagaatcaatga gaCGACTGTAAATTAGACCTTTTtcacaggtcgtgatatg gaAAAAGGTCTAATTTACAGTCGtctacatatatattcct
EX111 FLOT4 chh327 gaTGCACTTAGATACACCCGTTCtctctcttttgtattcc chh328 gaGAACGGGTGTATCTAAGTGCAtcaaagagaatcaatga chh329 gaGACCGGGTGTATCAAAGTGCTtcacaggtcgtgatatg chh330 gaAGCACTTTGATACACCCGGTCtctacatatatattcct EX112: FLOT1(2) amiRNA
FLOT1+2 chh331 chh332 chh333 chh334
gaTATAATCCGAATTGGTTCAGCtctctcttttgtattcc gaGCTGAACCAATTCGGATTATAtcaaagagaatcaatga gaGCCGAACCAATTCCGATTATTtcacaggtcgtgatatg gaAATAATCGGAATTGGTTCGGCtctacatatatattcct
EX116 None chh349 gaTAGCCATAGCTAACTACTTCCtctctcttttgtattcc chh350 gaGGAAGTAGTTAGCTATGGCTAtcaaagagaatcaatga chh351 gaGGCAGTAGTTAGCAATGGCTTtcacaggtcgtgatatg chh352 gaAAGCCATTGCTAACTACTGCCtctacatatatattcct EX117: empty vector
None chh353 chh354 chh355 chh356
gaTATCAATCTTCTGTCACTCTTtctctcttttgtattcc gaAAGAGTGACAGAAGATTGATAtcaaagagaatcaatga gaAAAAGTGACAGAACATTGATTtcacaggtcgtgatatg gaAATCAATGTTCTGTCACTTTTtctacatatatattcct
Table 2-4. amiRNA Construct Primers
42
Construct
Insert Template backbone vector
Primer Name
Primer sequence
pJG159 A (Sph-RB-P35S-RI)
pEGAD pCAMBIA 1300
oJG346 CGAGGCGCATGCCAAATGGACGAACGGATAAAC oJG347 GGTACCGGAAGCTTCGAGCTCTTAATTAAGGCCT oJG348 CGAAGCTTCCGGTACCCCGTCAACATGGTGGAGC oJG349 TCTAGAGAATTCGGATCCGTCCTCTCCAAATGAAATG pJG159 B (RI-osT-
P35S-XhoI) pCAMBIA
1300 oJG350 GGATCCGAATTCTCTAGACCCGATCGTTCAAACATTTG
oJG351 CTCGCGCTCGAGCTGCAGTCCTCTCCAAATGAAATGAA pCH010 eGFP pDG71 pJG159 chh050 AAAAGGATCCAAGAATTCAACCCGGGATGGTGAGCAAG
GGCGAGGAG chh051 AAAATCTAGATTACTTGTACAGCTCGTCCATG pCH010 NPTII pHELLS-
GATE8 pJG159 chh039 TTTTCTCGAGCACTCTCAATCCAAATAATCTGCA
chh040 TTTTCTCGAGTCAGAAGAACTCGTCAAGAAGGCG pCH035 FLOT2 ORF BAC
Mth2-115c19
pCH010 chh156 TTTTGAATTCATGAAAATTTACCGGGTCGCG chh172 TTTTCCCGGGAGAGCTTTTCTCAGATAAGGC
pCH118 FLOT4 genomic
BAC Mth2-115c19
pCH010 chh180 TTTCCCGGGATTCAAGTTTTTGTCAGGCAAGA chh181 TTTGGTACCTTCCCATGAACTTAACTCAATTG
pCH037 FLOT2 promoter
BAC Mth2-115c19
pMDC163 chh209 CACCTTGGCGGATATATGTGTGTGAT chh210 TCTTGATGATTTTGAGAAGAG
pCH038 FLOT3 promoter
BAC Mth2-115c19
pMDC163 chh211 CCACCCTCTAAAATCAGAATTGTCTG chh212 GTTGATTTTGGTTTGAATTTAG
pCH041 FLOT1 promoter
BAC Mth2-115c19
pMDC163 chh233 CACCGTCTTAATTAGGAGATGCAAGTA chh218 GTTGATAATGGTTTGAATTCGAGAAG
pCH042 FLOT4 promoter
BAC Mth2-115c19
pMDC163 chh232 CACCTTCCCATGAACTTAACTCAATTG chh220 CGTTGATTTTGATTTAATTTTTAAAAA
pQDN03 mCherry pRSET-B mCherry
pDG71 QDN01 TTTGGATCCACCATGGTGAGCAAGGGC
QDN02 TTTTCTAGATTACTTGTACAGCTCGTCCATGC
Table 2-5. Vector Construction
43
Chapter 3 CHAPTER 3: Localization of the symbiotic receptor kinases LYK3 and DMI2
ABSTRACT
Legume-rhizobia symbiosis initiates with plant recognition of the bacterial molecule
Nod Factor (NF). In Medicago truncatula, two receptor kinases, LYK3 and DMI2,
are known to be required for perception of the bacterial signal. LYK3 encodes a LysM-
family receptor required for bacterial entry into plant root hair cells. DMI2 encodes a
leucine-rich repeat receptor kinase that is required for early signaling events. We
report localization of GFP-tagged LYK3 and DMI2 prior to bacterial inoculation and
during symbiosis. In uninoculated root hairs, we found that both proteins have
punctate plasma membrane-associated distrubtions. Within minutes of bacterial
treatment, we observed an increase in DMI2:GFP-containing vesicles followed by a
rapid loss of DMI2:GFP signal. We did not observe DMI2:GFP on infection threads or
in nodule cells. We also observed an increase in LYK3:GFP-positive vesicles
following bacterial treatment but not until 6 hours post inoculation, and vesicles
persisted at 24 hours. We observed LYK3:GFP along infection threads in root hairs
but not associated with infection threads in mature nodules. Our data support genetic
evidence that DMI2 plays a role in signaling while LYK3 is involved in infection.
Our observation that LYK3:GFP infection thread association is restricted to root hair
cells suggest that infection thread growth in root hairs may involve different cellular
processes or receptors than infection of cortical cells.
44
INTRODUCTION Symbiosis between nitrogen-fixing bacteria and legume plants initiates with a signal
exchange between plant host and bacterium. Plants secrete compounds called
flavonoids into the surrounding soil. Flavonoids activate a Sinorhizobium meliloti
transcription factor NodD1 which upregulates expression of genes involved in
biosynthesis of a bacterial lipochitooligosaccharide called Nod Factor (NF) (Peck et
al., 2006). Medicago truncatula NF perception requires LysM-family receptors LYK3
and NFP. Other plant LysM receptors bind chitin (Iizasa et al., 2010) so LYK3 and
NFP are good candidates for receptors that directly bind the chitin backbone of
bacterial NF. NFP mutants have no measurable response to bacterial NF, while LYK3
mutants can perceive NF and initiate a number of preliminary events including
calcium spiking (Wais et al., 2000) and root hair tip growth, but form no infection
threads (Catoira et al., 2001; Smit et al., 2007). A leucine-rich repeat receptor kinase
DMI2 is genetically downstream of NFP (Catoira et al., 2000). These phenotypes
support a model where the NFP and LYK3 receptors bind NF and signal through
parallel pathways to initiate signaling events and bacterial entry into root hairs
respectively (Geurts et al., 2005; Smit et al., 2007).
Little is known about the cell biology of receptors during bacterial recognition
events or during infection. It is also unknown whether the receptors interact with one
another or if cross-talk is mediated downstream of the receptors. There is one report
that DMI2 is present on infection thread and cellular plasma membranes in nodules
(Limpens et al., 2005). When LYK3 was transiently expressed in Nicotiana
benthamiana, the protein appeared homogenous along the plasma membrane
(Lefebvre et al., 2010). We expressed GFP-tagged LYK3 and DMI2 by their native
promoters in the roots of M. truncatula. In uninoculated roots we observed that both
receptors had patchy distributions associated with the plasma membrane. After
bacterial treatment, DMI2:GFP and LYK3:GFP displayed distinct behaviors. Our
observations add to understanding of the function of these receptors during perception
of symbiotic bacteria and the role of bacterial perception during later stages of
symbiosis.
45
RESULTS Localization of symbiotic receptor kinases LYK3 and DMI2
To localize the LYK3 and DMI2 proteins, plants were stably transformed with a full
genomic copy of LYK3 (pLYK3:gLYK3) or DMI2 (pDMI2:gDMI2) translationally
fused to either GFP or an HASt dual-affinity tag (B. Riely and D. Cook, personal
communication). Root hair walls and other structures are known to display auto-
fluorescence; the HASt-tagged lines were used as controls for auto-fluorescence. The
hcl-1 mutant, which contains a point mutation in the predicted kinase domain of LYK3
(Smit et al., 2007), was transformed with the pLYK3:gLYK3:HASt and
pLYK3:gLYK3:GFP transgenes; two lines were recovered with each transgene. The
dmi2-1 mutant was transformed with the pDMI2:DMI2:GFP and
pDMI2:gDMI2:HASt transgenes; one line was recovered with each transgene. The
dmi2-1 mutant has a point mutation resulting in an early stop codon in the DMI2 open
reading frame and is a predicted null allele of DMI2 (Endre et al., 2002). In the
absence of the complementing transgenes, hcl-1 and dmi2-1 mutants form no nodules
or infection threads (Catoira et al., 2000; Catoira et al., 2001).
We confirmed that the LYK3 and DMI2 transgenes were able to complement
the hcl-1 and dmi2-1 mutant phenotypes by comparing nodulation and nitrogen
fixation to wildtype M. truncatula cv Jemalong A17 plants. All lines with the
exception of one pLYK3:gLYK3:HASt line (163.8) formed significantly fewer nodules
than wildtype plants (P < 0.01 by two-tailed t-test) (Figure 3-1A). We assessed
nitrogen fixation by indirect means by measuring the plants’ ability convert acetylene
to ethylene (Turner, 1980). We found that both pLYK3:gLYK3:HASt lines (163.5 and
46.10) and the pDMI2:gDMI2:GFP (63.8) had significantly reduced rates of acetylene
reduction per plant and per nodule (Figure 3-1B,C). The other lines had no significant
difference from wildtype plants in their ability to reduce acetylene. All lines tested
had some nitrogen fixation ability indicating that the DMI2 and LYK3 C-terminal
fusions are functional.
46
In concert with our attempt to localize GFP-tagged DMI2 and LYK3 in stable
transgenic lines, we used Agrobacterium rhizogenes-generated hairy roots transformed
with the gLYK3:GFP and gDMI2:GFP fusion proteins. We confirmed that when
introduced by hairy root transformation, the transgenes could complement the
nodulation defects in hcl and dmi2 mutants. We found that introduction of
Figure 3-1. LYK3 and DMI2 fusion proteins rescue mutant phenotypes Approximately 30 plants per genotype or transgenic line type were assayed for nodulation and acetylene reduction phenotypes at 21 dpi; error bars represent SEM. *P< 0.05 by two-tailed t-tests; n.d. not detected. In some cases, multiple transgenic lines were recovered with each construct; line numbers are in parentheses. (A) Average nodule number per plant. (B) Acetylene reduction assays showed that nodules on transgenic lines were able to fix nitrogen. (C) Adjusted acetylene reduction level per plant per nodule.
47
pLYK3:gLYK3:GFP into hairy roots restored nodulation in the hcl-1 allele as well as
hcl-2 and hcl-3 alleles (See Table 3-1 for a description of each mutant allele and
results of complementation assays). We found that introduction of
pDMI2:gDMI2:GFP into hairy roots restored nodulation to dmi2-1 as well as the
dmi2-3 and dmi2-4 mutants (Table 3-1).
Construct Genetic Background
Nature of mutation
Predicted effect on gene function
Hairy roots or Stable line
Nod+/ total plants
No Transgene A17 Wild type 36/36 No transgene hcl-1 (B56) Point mutation Non-functional
kinase domain 0/20
pLYK3:gLYK3:HASt hcl-1 (B56) Point mutation Non-functional kinase domain
Lines 46.10 and 163.8
22/29; 28/29
pLYK3:gLYK3:GFP hcl-1 (B56) Point mutation Non-functional kinase domain
Lines 22.3 and 26.1
28/30; 29/29
pLYK3:gLYK3:GFP A17 Wild type Hairy roots 3/5 pLYK3:gLYK3:GFP hcl-1 (B56) Point mutation Non-functional
kinase domain Hairy roots 3/5
pLYK3:gLYK3:GFP hcl-2 (W1) Point mutation in splice site
Loss of transcript; predicted null
Hairy roots 5/7
pLYK3:gLYK3:GFP hcl-3 (AF3) Point mutation Non-functional receptor domain
Hairy roots 1/2
No transgene dmi2-1 (TR25)
Frame shift Loss of transcript, predicted null
0/20
pDMI2:gDMI2:HASt dmi2-1 (TR25)
Frame shift Loss of transcript, predicted null
Line 73.9 27/28
pDMI2:gDMI2:GFP dmi2-1 (TR25)
Frame shift Loss of transcript, predicted null
Line 63.8 19/27
pDMI2:gDMI2:GFP A17 Wild type Hairy roots 5/7 pDMI2:gDMI2:GFP dmi2-1
(TR25) Frame shift Loss of transcript,
predicted null Hairy roots 8/15
pDMI2:gDMI2:GFP dmi2-3 (P1) Point mutation in splice site
Loss of exon 6 Hairy roots 1/3
pDMI2:gDMI2:GFP dmi2-4 (R38) Point mutation Non-functional kinase domain
Hairy roots 2/7
Table 3-1. Transgenes complement LYK3 and DMI2 mutants LYK3 and DMI2 transgenes were stably integrated or inserted via A. rhizogenes hairy roots into wildtype and mutant plants. Roots were scored for their ability to form nodules.
48
Both stable and hairy-root transgenics were used for LYK3:GFP localization
and yielded equivalent results. In uninoculated root hairs, we observed LYK3:GFP in
a punctate distribution at the extreme cell periphery in a gradient that was denser near
the growing tip (Figures 3-2 and 3-3). There was little co-localization of LYK3:GFP
with a cytoplasmic marker and few labeled cytoplasmic vesicles were visible (Figure
3-3). The LYK3:GFP signal followed the membrane after plasmolysis (Figure 3-4)
confirming that the labeled protein was not localized to the cell wall. These
observations suggest that majority of the LYK3:GFP signal is associated with the
plasma membrane. No signal was detectible in the LYK3:HASt transgenic lines. As
the signal was somewhat brighter in the LYK3:GFP (22.3) line (Table 3-1) and in
hairy roots in the hcl-2 background, these were used for subsequent localization
studies.
Figure 3-2. LYK3 has a punctate distribution in root hairs In uninoculated root hairs of the stable transgenic line 22.3 (hcl-1 mutant transformed with pLYK3:LYK3:GFP). The GFP signal was most evident in emerging (A) and elongating (B) root hairs. The signal was punctate and densest near the growing root hair tips. Images are maximum intensity projections of ~50 z-sections taken at 0.3µm increments. Scale: 10 µm.
49
Figure 3-3. LYK3:GFP has little overlap with a cytoplasmic marker in root hairs Hairy roots were generated in the hcl-2 mutant background with a plasmid containing the genomic LYK3 fused to GFP (pLYK3:gLYK3:GFP) and dsRed which marks the cytoplasm and nucleus (Curtis and Grossniklaus, 2003). The top half of each panel shows single z-slices through root hairs; the bottom halves show maximum intensity projections of ~50 z-sections taken at 0.3µm increments. Scale: 10 µm. LYK3:GFP has a punctate distribution (A) emerging, (B) elongating and (C) fully elongated root hairs.
50
Figure 3-4. LYK3:GFP signal stays with the membrane upon plasmolysis Roots in the transgenic line 22.3 were treated with 0.5 M sodium chloride for 10 minutes until the plasma membrane (arrow) had visibly retracted from the cell wall (arrowhead). (A) Single optical section of plasmolysed root hair. (B) Maximum intensity projection of 100 z-sections taken at 0.3µm increments showing reconstruction of the root hair cell. (C) DIC image of plasmolysed root hair. Scale: 10 µm.
DMI2:GFP signal was visible in hairy roots but not in the single available
stable transgenic line. In hairy roots in all dmi2 mutant backgrounds tested (Table 3-
1), DMI2:GFP had a punctate distribution at the extreme cell periphery similar to
LYK3:GFP (Figure 3-5). However, the signal gradient observed with LYK3:GFP,
with the densest signal at the root hair tip, was not observed with DMI2:GFP. There
was little co-localization of DMI2:GFP with a cytoplasmic marker and few
intracellular vesicles were evident (Figure 3-5).
51
Figure 3-5. DMI2 has a punctate distribution associated with root hair plasma membranes Hairy roots were generated in the dmi2-1 mutant background with a plasmid containing the genomic DMI2 fused to GFP (pDMI2:gDMI2:GFP). The top half of each panel shows single z-slices through root hairs; the bottom halves show maximum intensity projections of ~50 z-sections taken at 0.3µm increments. Scale: 10 µm. Plasmids for hairy root transformation contain a dsRed marker that marks the plant cytoplasm and nucleus enabling screening for transgenic roots (Curtis and Grossniklaus, 2003). DMI2:GFP has a patchy appearance in (A) emerging, (B) elongating and (C) fully elongated root hairs.
52
LYK3:GFP localizes to intracellular vesicles and infection threads post
inoculation
Few LYK3:GFP vesicles were visible in the cytoplasm in uninoculated root hairs
(Figure 3-4 and Figure 3-6A). Following treatment of roots with an S. meliloti strain
producing constitutive high levels of NF (Fisher et al., 1988), an increase in
LYK3:GFP intracellular vesicles was evident by 6 hours post inoculation (hpi) (Figure
3-6B) and persisted at 24 hpi (Figure 3-6C). An increase in vesicles was also
observed with 1 nM purified S. meliloti NF at 24 hpi, although the response was less
robust (Figure 3-6D). No consistent increase in vesicles was evident at 0.5 or 3 hpi
(not shown).
After bacterial treatment, LYK3:GFP signal was visible on the membrane
surrounding initiating and elongating infection threads in root hairs (Figure 3-6E to
N). By analogy to the membrane localization of LYK3:GFP in plasmolysed root
hairs (Figure 3-3), we inferred that LYK3 localized to infection thread membranes and
not the infection thread wall. No signal was associated with infection threads of
control plants expressing LYK3:HASt (Figure 3-6F). No signal was visible along
infection thread membranes in cortical cell layers at 4, 7, 10 and 14 dpi (Figure 3-7).
We observed pronounced auto-fluorescence associated with older infection threads in
the infection zone in control LYK3:HASt nodules (Figure 3-7).
53
54
Figure 3-6. LYK3 localizes to intracellular vesicles and infection threads post inoculation (A-F) M. truncatula stable lines transformed with pLYK3:LYK3:GFP (A-E) or pLYK3:LYK3:HASt (F). (A) In uninoculated roots, LYK3:GFP localized to the cell periphery and few intracellular vesicles were visible. (B) By 6 hours post inoculation with rhizobia, intracellular LYK3:GFP vesicles were visible. (C) LYK3:GFP vesicles persisted at 24 hours post inoculation. (D) Treatment with NF also increased appearance of vesicles, although less robustly than bacterial treatment. (A-D) are single optical sections. (E) After inoculation LYK3:GFP (green) was visible on growing infection thread membranes at 4 dpi (bacteria are expressing ptrp:mCherry and shown in red). (F) No GFP signal was visible on infection threads of plants expressing LYK3:HASt. (E-F) are maximum intensity projections of ~50 optical sections taken at 0.3 µm increments. Arrows mark infection thread membranes; arrowheads point to bacterial colonies in curled root hairs. (G-N) Introduction of pLYK3:gLYK3:GFP into hairy roots complemented the infection defect in the LYK3 mutant hcl-2. Arrows mark infection thread membranes; arrowheads point to bacterial colonies in curled root hairs. (G) LYK3:GFP was visible at the sites of initiating and (K) elongating infection threads. (H, L) The inserted plasmid contains pUbq:dsRed which marked the cytoplasm and nucleus (*). (I,M) Plants were inoculated with S. meliloti expressing ptrp:CFP. (J) is an overlay of (G-I) and (N) is an overlay of (K-M). (G-J) are single optical sections; (K-N) are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.
55
Figure 3-7. LYK3:GFP is not visible on infection threads in interior nodule cells Transgenic roots expressing either LYK3:GFP (line 22.3; bottom panels) or LYK3:HASt (line 46.10; top panels) were inoculated with S. meliloti expressing ptrp:mCherry. Images show infection threads (arrows) in the infection zone of a 10 day old nodule where bacterial release was evident (*) but little differentiation had occurred. No signal that was consistently different than auto-fluorescence was observed on infection threads in mature nodules in the LYK3:GFP-expressing plants. Images are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.
DMI2:GFP localizes to intracellular vesicles post-inoculation
Like uninoculated pLYK3:gLYK3:GFP-expressing root hairs, the majority of the
DMI2:GFP signal localized to the extreme cell periphery and not to intracellular
vesicles (Figures 3-5 and 3-8A). As early as 30 minutes post inoculation with either S.
meliloti or purified NF, a DMI2:GFP signal was evident on numerous intracellular
structures (Figure 3-8B). By 1 dpi, little signal was associated with either the plasma
membrane or cytosolic vesicles (Figure 3-8C). A faint cytoplasmic GFP signal was
visible at this time. No DMI2:GFP signal was detectible on infection threads in root
hairs (Figure 3-8D) or infection threads in nodules (Figure 3-9).
56
57
Figure 3-8. After bacterial treatment, DMI2:GFP localizes to intracellular vesicles Hairy roots were generated with pDMI2:gDMI2:GFP on the dmi2-1 mutant background; dsRed marks the cell cytoplasm and nucleus (*). (A) In uninoculated root hairs, the majority of the DMI2:GFP signal localizes to the extreme cell periphery and little DMI2:GFP signal co-localizes with a cytoplasmic marker (red). (B) By 30 minutes post treatment with NF, there is an increase in DMI2:GFP cytoplasmic vesicles. (C) By 1 day post treatment with NF, very little DMI2:GFP signal is visible along the plasma membrane or cytosolic vesicles. (D) 4 days post inoculation with S. meliloti expressing ptrp:CFP, no DMI2:GFP signal is visible along infection thread membranes (arrow). (A and B) are single optical sections; (C-D) are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.
Figure 3-9. DMI2:GFP is not visible on infection threads in interior nodule cells Transgenic hairy roots generated on dmi2-1 mutants expressing either DMI2:HASt (top panels) or DMI2:GFP (bottom panels) were inoculated with S. meliloti expressing ptrp:CFP. Images show infection threads (arrows) in the infection zone of a 10 day old nodule where bacterial release was evident (asterisk) but little differentiation had occurred. No signal that was consistently different than auto-fluorescence was observed in the DMI2:GFP-expressing plants. Images are maximum intensity z-projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm.
58
DISCUSSION We demonstrated that LYK3 and DMI2 N-terminal fusions can complement infection,
nodulation and nitrogen fixation defects in lyk3 and dmi2 mutants. We show that the
nodules on stable transgenic lines can fix nitrogen, but that some lines have reduced
fixation compared to wild type nodules (Figure 3-1). This indicates that the fusion
proteins were functional; the most likely explanation for partial complementation is
that the transgenes did not reflect endogenous expression levels due to positional
effects. The formation of nodules with reduced fixation suggests that LYK3 and DMI2
are required at multiple stages or continually during symbiosis, and not just during
initiation of symbiosis. This is consistent with previous characterizations of partial
loss of function mutants and RNAi lines showing that both LYK3 and DMI2 are
required for infection to progress (Limpens et al., 2005; Smit et al., 2007).
LYK3 is required for infection thread initiation and continued infection thread
growth (Catoira et al., 2001; Smit et al., 2007). The presence of LYK3:GFP at the
plasma membrane prior to interaction with bacteria, and the persistence of LYK3 on
infection threads, are consistent with these genetic data (Figures 3-2, 3-3 and 3-6).
We observed that LYK3:GFP is associated with intracellular vesicles post inoculation.
The origin of these vesicles is unknown; it is possible that they are the result of
endocytosis of LYK3:GFP from the membrane or that they are the result of new
protein synthesis and packaging into secretory compartments. LYK3 eventually
localizes to infection threads in root hairs; determining the origin of LYK3-containing
vesicles will help elucidate both how proteins are trafficked to infection threads during
symbiosis, and the mechanism of LYK3-mediated infection.
While LYK3:GFP was present on infection threads in root hairs, we could not
detect LYK3:GFP along infection thread membranes in interior nodule cells (Figure 3-
7). This lack of signal is consistent with previous reports that LYK3 expression is
weak to absent in the infection zone of mature nodules (Limpens et al., 2005;
Mbengue et al., 2010). The apparent absence of the LYK3 protein associated with
interior nodule cells is consistent with several interpretations: (a) low levels of LYK3
59
are sufficient for NF perception in nodules, (b) LYK3 may not be required for later
stages of infection, and/or (c) a different receptor is involved.
The observed behavior of DMI2:GFP was distinct from that of LYK3:GFP.
While LYK3 vesicles were evident no earlier than 6 hpi and persisted at 24 hpi, DMI2
vesicles were evident within 30 minutes of bacterial or NF treatment (Figure 3-8).
These vesicles did not persist and little to no DMI2:GFP signal was visible in root
hairs or in infected cells beyond 1 dpi. The rapid appearance of DMI2:GFP vesicles
upon NF application followed by signal loss is reminiscent of the ligand-dependent
endocytosis observed with the plant flagellin receptor FLS2 (Robatzek et al., 2006).
DMI2 is not predicted to bind NF; if the observed vesicles are in fact the result of
endocytosis, the most likely explanation is that NFP receptor (which itself lacks a
predicted kinase domain) binds NF and then interacts with DMI2, and NFP and DMI2
are internalized as a complex. This sort of receptor cooperation has been shown for
the BAK1 receptor like kinase and several receptor partners including the
brassinosteroid receptor BRI1 (Li et al., 2002; Nam and Li, 2002) and flagellin
receptor FLS2 (Chinchilla et al., 2007). Future studies are needed to determine if the
increase in DMI2:GFP vesicles are in fact the result of endocytosis of the membrane
signal, and whether this depends on NFP. Exploring the origin of DMI2 vesicles will
help elucidate the mechanism by which plants perceive and transduce the NF signal.
Our DMI2:GFP localization data conflict with a previous report that
DMI2:GFP is visible along infection threads and plasma membranes in infected
nodule cells (Limpens et al., 2005). Our experimental design closely mirrored the
Limpens et al. (2005) study; in both experiments, DMI2:GFP driven by its native
promoter was introduced into the dmi2-1 mutant background via A. rhizogenes-
mediated hairy roots. The prior study reported using a laser scanning confocal for
their localization while we used a more sensitive spinning-disk confocal; it is unlikely
that sensitivity of the instrument can account for the absence of signal in our
experiment. Additionally, the previous study did not report a DMI2:GFP signal in
root hairs prior to inoculation, again suggesting that our methods are equally or more
sensitive. A few subtle differences in the experimental designs exist. First, Limpens
60
et al. (2005) used a 2.2 kb promoter instead of our 2.0 kb promoter; it is possible that
there is an enhancer element in the missing 200 bps that is important for DMI2
expression. Second, Limpens et al. (2005) used a slightly different hairy root
transformation method; it is feasible that their method allowed for recovery of roots
with stronger expression of the DMI2:GFP transgene. A final possibility is that what
Limpens et al. (2005) reported as signal was actually auto-fluorescence. No controls
for auto-fluorescence were used in their study, and we observed substantial auto-
fluorescence on older infection threads (Figure 3-9). Resolving these issues will help
establish whether DMI2 functions locally to regulate infection thread growth and
bacterial release (as proposed by Limpens et al., 2005) or more globally to help
establish and monitor the progress of symbiosis (Endre et al., 2002; Bersoult et al.,
2005).
We demonstrated that symbiotic receptor-like kinases have patchy
distributions associated with plant plasma membranes that are reminiscent of
membrane raft signaling domains in animals (Lingwood and Simons, 2010). Our
findings suggest that compartmentalization of membrane proteins may be important
for signaling in plants. Prior to inoculation, the similarity in appearance and
distribution of LYK3:GFP and DMI2:GFP signals raises the possibility that the
proteins are co-distributed and possibly form a symbiotic receptor complex. The
differences in observed behaviors after inoculation support genetic data suggesting
that DMI2 functions as a component of the NF perception signaling pathway (Catoira
et al., 2000; Bersoult et al., 2005) while LYK3 is involved in infection (Smit et al.,
2007). Our studies are the first steps in elucidating the localization and regulation of
symbiotic receptor kinases before and during symbiosis. These studies complement a
decade of genetics that established the roles of receptor kinase genes in early
symbiotic events.
61
MATERIALS AND METHODS Plant growth and bacterial treatments.
Medicago truncatula Gaertner cv Jemalong, cv Jemalong A17 (an inbred line of
Jemalong), and mutant lines hcl-1, hcl-2, and hcl-3 (Catoira et al., 2001), dmi2-1
(Catoira et al., 2000), dmi2-3 and dmi2-4 (Endre et al., 2002) and transgenic lines
were grown, inoculated and harvested as described (Mitra and Long, 2004). Bacterial
growth and inoculations were done as described in Chapter 2.
Generation of LYK3 and DMI2 translational fusion constructs and transgenic
plants
pLYK3:gLYK3:GFP and :HASt and pDMI2:gDMI2:GFP and :HASt constructs and
transgenic lines were obtained from Brendan Riely in Doug Cook’s Lab (University of
California, Davis; personal communication).
Fluorescent bacterial plasmid construct design
pQDN01 was constructed by replacing GFP in pDG71 (Gage, 2002) with CFP.
pQDN03 was constructed by replacing GFP in pDG71 with mCherry (Haney and
Long, 2010). Both mCherry and CFP were amplified using forward primer
TTTGGATCCACCATGGTGAGCAAGGGC and reverse primer
TTTTCTAGATTACTTGTACAGCTCGTCCATGC. PCR products and were
digested with BamHI and XbaI and ligated into the corresponding sites in pDG71.
Acetylene reductions and hairy root transformation
were conducted as described in Chapter 2 materials and methods.
Confocal Microscopy
For 24 hpi localization studies, plants were inoculated with Rm1021 over-expressing
NodD3 from the plasmid pRmE65 (Fisher et al., 1988). For infection thread
localization studies, plants were inoculated with Rm1021 constitutively expressing
mCherry or CFP from the plasmids pQDN03 or pQDN01 pretreated for ~2 hours with
62
3 µM luteolin. The signal was brighter in the 22.3 LYK3:GFP than in the 46.10 line
possible likely due to positional effects of the transgene. The 22.3 line was used for
localization studies.
Root segments and nodule hand sections (for imaging the infection zone) were
excised and mounted in BNM buffer pH 6.5. Spinning disk confocal microscopy was
performed on a system described previously in Gutierrez et al. (2009) using a
100X/1.4 NA oil immersion objective for root hair membrane imaging or a 63X/1.3
NA glycerol immersion objective for infection thread and nodule imaging. CFP, GFP
and dsRed/mCherry were excited at 442, 491 nm and 561 nm, respectively, by solid-
state lasers; emission filtering was accomplished with band pass filters (470/40 for
CFP, 530/50 nm for GFP, and 640/50 nm for mCherry/dsRed; Chroma Technology).
Maximum intensity z-projections of root hairs are from ~100 images taken at
increments of 0.3 μms (MCL NanoDrive). Time-lapse images were taken at 2s
increments. Stacks were processed using ImageJ software (http://rsbweb.nih.gov/ij/).
Typical exposure times were 1000 ms for GFP, 300 ms for dsRed, 500 ms for
mCherry, and 500 ms for CFP.
63
Chapter 4 CHAPTER 4: Co-localization of flotillin protein FLOT4 with the symbiotic receptor LYK3
ABSTRACT In response to signals, proteins with patchy distributions in animal membranes
redistribute laterally, a previously unreported phenomenon in plants. A Medicago
truncatula flotillin protein, FLOT4, has a punctate plasma membrane distribution and
is required for infection by the nitrogen-fixing symbiotic bacterium Sinorhizobium
meliloti. We show that FLOT4 puncta density is altered in a predicted dead kinase
mutant of the symbiotic receptor LYK3. Like FLOT4, LYK3 has a patchy plasma
membrane distribution and localizes to infection thread membranes. In buffer-treated
control roots expressing tagged LYK3 and FLOT4, FLOT4 puncta are relatively stable
while LYK3 puncta are dynamic; the two labeled proteins show relatively little co-
localization. Bacterial treatment causes an increase in FLOT4 and LYK3 co-
localization, and both proteins occupy positionally stable plasma membrane domains.
Our work indicates that plant membrane protein arrangement and dynamics are altered
in response to symbiotic bacteria.
64
INTRODUCTION Proteins, sterols and lipids are often heterogeneously distributed in cellular plasma
membranes, defining domains of varying size. Studies of animals and fungal cells
show that extracellular stimuli and changes in membrane potential elicit changes in
microdomain structure and composition (Giri et al., 2007; Grossmann et al., 2007).
Emerging evidence suggests that some plant membrane components also have patchy
distributions (Homann et al., 2007; Gutierrez et al., 2009; Raffaele et al., 2009; Haney
and Long, 2010). How plant membrane proteins are organized and the significance of
lateral compartmentalization has yet to be established except by analogy to animals
and fungi. Legume-rhizobia symbioses provide a model for exploring changes in
membrane protein distribution during signal perception. In this system, membrane
protein distribution and dynamics can be monitored in an intact live host, abundant
molecular and genetic tools are available, and there is an extensive body of work
establishing a clear sequence of distinct cellular behaviors for early plant responses to
bacteria.
Recent studies implicated the flotillin proteins (FLOT) and a remorin protein
(SymREM) in symbiotic plant-microbe interactions (Haney and Long, 2010; Lefebvre
et al., 2010). FLOT2 and FLOT4 function non-redundantly during symbiosis between
Medicago truncatula and its bacterial symbiont Sinorhizobium meliloti (Haney and
Long, 2010). Fluorescent protein fusions to FLOT2 and FLOT4 have a punctate
plasma membrane distribution. Both FLOT4:GFP and SymREM localize to host-
derived infection structures called infection threads and are required for normal
infection thread growth. FLOT4:GFP redistributes after bacterial inoculation to form
a bright cap at the root hair cell tip (Haney and Long, 2010) suggesting that perception
of symbiotic bacteria alters membrane protein distribution.
Legumes are able to recognize rhizobial signaling molecules known as Nod
Factors (NFs). NFs consist of a chitin backbone with several species-specific
modifications (Roche et al., 1991a). NF perception and signaling in M. truncatula is
dependent on the receptors NFP, LYK3 and DMI2 (Catoira et al., 2000). NFP and
LYK3 encode LysM-type receptors that are hypothesized to bind bacterially secreted
65
NFs (Amor et al., 2003; Smit et al., 2007; Lefebvre et al., 2010); LysM-family
receptors bind chitin in Arabidopsis (Iizasa et al., 2010). DMI2 is a leucine-rich
repeat receptor kinase predicted to act downstream of NFP (Catoira et al., 2000). NFP
and DMI2 mutants are impaired in nearly all responses to symbiotic bacteria (Catoira
et al., 2000) whereas LYK3 mutants (also known as hcl) are impaired in infection
(Catoira et al., 2001; Smit et al., 2007).
Using the patchy distribution of FLOT4:GFP (Chapter 2), we explored the role
of signal perception (via NFP, LYK3 and DMI2) in regulating organization of
membrane proteins. While the function of FLOT4 distribution is not known, it can
serve as a scorable marker for membrane organization and can be used as a phenotype
to assess the effect of genetic changes on membrane structure. We found that the
density of FLOT4 puncta is decreased in a predicted dead kinase mutant of LYK3.
Like FLOT4, tagged LYK3 has a patchy distribution in plant membranes, forming
puncta at or below the limit of optical resolution. LYK3 puncta undergo a shift in
dynamics from mobile to immobile after treatment with symbiotic bacteria. Immobile
LYK3 puncta co-localize with FLOT4 after bacterial treatment. These results show
that plant membrane proteins undergo complex lateral reorganization in response to a
signal.
66
RESULTS A change in FLOT4 distribution is associated with rhizobia-triggered re-
initiation of root hair growth
Prior to inoculation, FLOT4:GFP localizes to puncta that are evenly distributed along
root hair plasma membranes; by 24 hours post inoculation FLOT4 is distributed in a
cap at the tip of some elongating root hairs (Haney and Long, 2010). To explore the
timing of these events in more detail, we repeated these experiments at 1, 6, 12, 18,
24, and 36 hours post inoculation (hpi). We found that the tip localization was
observed in root hairs that had re-initiated directional growth but had not formed a full
curl (Figure 4-1). Root hair responses to bacteria are asynchronous; nonetheless we
were able to assign these events primarily to the interval between 12 and 24 hpi. We
also found that in responding root hairs, FLOT4:GFP puncta appear dimmer and more
diffuse (Figure 4-1). By 36 hours, many root hairs had formed full curls and tip
localization was less apparent, possibly due to auto-fluorescence in the inner portion
of the curl (Figure 4-1, right panel).
Figure 4-1. Redistribution of FLOT4 during re-initiation of root hair tip growth Hairy roots expressing pFLOT4:gFLOT4:GFP were observed at 1, 4, 6, 12, 24, and 36 hours post inoculation. Tip localization of FLOT4:GFP was observed in root hairs that had re-initiated directional growth but not formed a full curl; root hairs in this stage were primarily observed between 12 and 24 hours post inoculation with S. meliloti Rm1021 over-expressing NodD3. At least 10 root hairs on 5 roots were observed at each time point. Images are maximum intensity projections of ~50 optical sections taken at 0.3 µm increments. Scale bar: 10 µm.
67
Over-expression of FLOT2 results in increased FLOT4 polarity
Since GFP-tagged FLOT2 and FLOT4 have similar localizations in root hairs but
differ in epidermal cells (Chapter 2), we explored the degree of co-distribution of
tagged FLOT2 and FLOT4 proteins. We used Agrobacterium rhizogenes to generate
A17 hairy roots co-transformed with pFLOT4:gFLOT4:GFP and
35S:gFLOT2:mCherry (FLOT2 was not visible under its native promoter). In roots
with visible green and red puncta, FLOT4:GFP had an increase in polarity compared
to roots transformed with just FLOT4 alone (Figure 4-2A and B). In root hair cells,
FLOT2:mCherry and FLOT4:GFP puncta had a high degree of overlap. We
quantified the overlap in three dimensional space and found a Pearson’s correlation
coefficient (r) of 0.73±0.06 (n=12 root hairs from 4 plants; Figure 4-2C). Post
inoculation, we observed a decrease in overlap of FLOT2 and FLOT4 puncta in root
hairs that had reinitiated directional growth and now r=0.45±0.12 (n=15 root hairs
from 3 plants; Figure 4-2D; P=0.0004). We occasionally observed tip localization of
the FLOT2:mCherry signal in root hairs that have reinitiated growth, which was not
observed in plants transformed with FLOT2:GFP (Chapter 2) or FLOT2:mCherry
alone.
68
69
Figure 4-2. Co-expression of FLOT2:GFP and FLOT4:mCherry (A) In uninoculated epidermal cells, FLOT4:GFP was evenly distributed along the plasma membrane and FLOT2:mCherry was polarly localized (arrows). Images are single optical sections; scale bar: 10 µm. (B-D) Hairy roots co-expressing pFLOT4:gFLOT4:GFP and p35S:gFLOT2:mCherry. Images in (B) are single optical sections of epidermal cells; (C-D) are maximum intensity projections of ~50 optical sections taken at 0.3 µm increments. Scale bars: 10 µm. (B) In uninoculated epidermal cells, an increase in polar distribution of FLOT4:mCherry was observed (arrows). (C) FLOT4:GFP and FLOT2:mCherry puncta co-localize in uninoculated root hairs. (D) Upon inoculation, there is a lower degree of co-localization in root hairs that have re-initiated directional growth and there is an increase in signal from both proteins at root hair tips (arrows).
FLOT4 mis-localizes in a LYK3 mutant
Early plant responses to bacteria and Nod Factor, including re-initiation of root hair
growth, depend on NFP and LYK3 pathways. To determine if these pathways are also
required for FLOT4 redistribution in response to S. meliloti, we expressed
FLOT4:GFP in mutant backgrounds of the symbiotic receptors DMI2, NFP, and
LYK3. We found that in the absence of bacteria, the density of FLOT4 puncta
decreased in epidermal cells of the LYK3 mutant hcl-1 (predicted dead kinase allele)
but was unaffected in nfp (predicted null allele) or dmi2-4 (predicted dead kinase)
genetic backgrounds (Figure 4-3A through D, I). In wildtype plants, FLOT4 puncta
are relatively evenly dispersed along cell membranes of epidermal cells and root hairs
(Haney and Long, 2010). There was a slight increase in polar localization of
FLOT4:GFP puncta in all three mutant backgrounds (Figure 4-3J; P<0.01). By
contrast, FLOT2:GFP, which normally shows marked polarity in epidermal cells but
not root hairs, had no decrease in spot density or increase in polar localization when
expressed in the hcl-1 background (Figure 4-3G and H). Thus, increased polar
localization is specific to FLOT4, and mis-localization of FLOT4 is not due to a
general perturbation of membrane proteins in the hcl-1 mutant. We conclude that prior
to bacterial inoculation, FLOT4 distribution is partially dependent on symbiotic
receptors while FLOT2 is not.
The hcl-1 mutant allele harbors a single-base substitution within the highly
conserved ATP binding pocket of the LYK3 kinase domain, a change that is predicted
70
to abolish kinase activity (Smit et al., 2007). By contrast, the hcl-2 and hcl-4 alleles
contain mutations in first intron splice sites and display reduced (hcl-4) or no (hcl-2)
LYK3 transcript (Smit et al., 2007). We tested if decreased FLOT4 puncta density was
specific to the hcl-1 allele or if it also occurred in the LYK3 splice mutants. The
density of FLOT4:GFP puncta in hcl-2 and hcl-4 was indistinguishable from wild type
roots (Figure 4-3E,F,I and J). We also assessed FLOT4 distribution and found
FLOT4:GFP was significantly more polar in hcl-2 while localization in hcl-4 was
indistinguishable from wild type roots (Figure 4-3J). The degree of increase in FLOT4
polar localization correlates with the strength of the symbiotic defect suggesting that
FLOT4 localization depends on the activity of LYK3 (Smit et al., 2007).
71
Figure 4-3. FLOT4 mis-localizes in roots carrying mutations in a symbiotic receptor (A-F) Hairy roots transformed with pFLOT4:gFLOT4:GFP; images are maximum intensity z-projections of ~45 optical sections taken at 0.3 µm increments. (A) FLOT4:GFP puncta in epidermal cells of wild type (A17), (B) hcl-1, (C) dmi2-4, (D) nfp-1 (E) hcl-2 or (F) hcl-4 roots. Arrows point to cells with polar protein localization. (G-H) Epidermal cells of hairy roots transformed with 35S:gFLOT2:GFP (images are single optical sections) in (G) wild type (A17) or (H) hcl-1 roots. (I) Decreased spot density was specific to FLOT4:GFP in the hcl-1 mutant background. (J) Polar localization was approximated by the ratio of apical cell membrane signal density to abaxial membrane signal density (see methods). Increased polar localization was found for FLOT4:GFP when expressed in hcl-1, hcl-2, dmi2-4 and nfp mutants. (I-J) Maximum intensity z-projections of ~45 optical sections taken at 0.3 µm increments were used for analyses. Error bars represent ± SEM; *P<0.01. Scale bars: 10 µm.
FLOT4 and LYK3 have increased co-localization after bacterial inoculation
FLOT4 and LYK3 have similar RNAi phenotypes, gene expression patterns, and
protein localization, suggesting they may function cooperatively to mediate symbiotic
infection and that FLOT4 and LYK3 membrane puncta may be co-distributed (Smit et
al., 2007; Haney and Long, 2010; Mbengue et al., 2010). We generated hairy roots
expressing pFLOT4:gFLOT4:mCherry in wild type plants, the hcl-1 mutant, or the
hcl-1 mutant stably transformed with pLYK3:gLYK3:GFP. The hcl-1 mutant displayed
both a decrease in density of FLOT4:mCherry puncta and a polarity defect; the
pLYK3:gLYK3:GFP transgene complemented only the density phenotype (Figure 4-
4).
72
Figure 4-4. LYK3:GFP complements the decrease in FLOT4 puncta density in the hcl-1 mutant (A-C) Hairy roots expressing pFLOT4:gFLOT4:mCherry were generated on wild type A17 plants, hcl-1 mutant plants or the hcl-1 mutant stably transformed with pLYK3:gLYK3:GFP. Maximum intensity z-projections of ~45 optical sections taken at 0.3 µm increments were used for analyses. Scale bar: 10 µm. (A) FLOT4:mCherry localizes to membrane puncta in A17 plants. (B) In the hcl-1 mutant, FLOT4:mCherry has a lower density of puncta and has increased polarity. (C) The LYK3:GFP transgene complements the decrease in density of FLOT4 puncta in an hcl-1 mutant background. (D) Quantification of localization shows that LYK3:GFP rescues the decrease in FLOT4 puncta but not polarity. (a vs. b P < 0.05 by two-tailed t-test).
In buffer-treated root hairs, FLOT4:mCherry and LYK3:GFP showed a limited
overlap in distribution but had distinct dynamic behaviors (Figures 4-5 and 4-6, left
panels). Using 3-D image volumes acquired at the root hair cell tip, we calculated
Pearson’s correlation coefficients (r) in voxels (Costes et al., 2004). In buffer-treated
root hairs, r=0.15±0.03, indicating that FLOT4 and LYK3 co-localize only slightly
more often than is predicted by an uncorrelated distribution of the proteins. Time-
lapse imaging revealed that bright FLOT4 puncta were relatively stable while the
majority of LYK3 puncta were dynamic (Figure 4-6A,B, and C). Intensities from
FLOT4 and LYK3 signals along linear transects of the time-averaged images show
that in the absence of bacteria there is little correlation of average LYK3 and FLOT4
position and intensity (Figure 4-6D,E).
Bacterial treatment of root hair cells had a pronounced effect on FLOT4 and
LYK3 co-localization at 24 hours (Figure 4-5, right panels). In cells that reinitiated tip
growth FLOT4 and LYK3 co-localization rose sharply (Figure 4-5C; r=0.66±0.03;
P=5x10-15). In inoculated root hairs that had not reinitiated tip growth (swollen or no
73
visible response), we observed an increase in co-localization compared to buffer
treated roots, although to a lesser degree (r=0.40±0.05; P=1x10-4). As observed with
FLOT4:GFP (Figure 4-1; Haney and Long, 2010), FLOT4:mCherry became
distributed in more spots by 24 hpi and redistributed to form a cap at the cell tip
(Figure 4-5A).
After bacterial treatment, the dynamics of LYK3:GFP also changed
significantly in root hairs that had re-initiated tip growth. The LYK3:GFP signal
shifted from motile to relatively stable puncta, and both the positions and relative
intensities of stable LYK3:GFP puncta were well correlated with FLOT4:mCherry
puncta (Figure 4-6, compare left and right panels). LYK3:GFP vesicles were evident
in the cytoplasm of these root hairs, but these vesicles were not marked by
FLOT4:mCherry (Figure 4-7).
74
Figure 4-5. LYK3 and FLOT4 co-localize in inoculated root hairs in 3-D space (A) Co-distributions of FLOT4:mCherry and LYK3:GFP signals in 3-D space; z-stacks were obtained at 0.3 µm increments from the top 15 µms of root hairs. (B) Higher magnification of images in (A). (C) Pearson’s correlation coefficients (r) for 3-D voxel intensities were calculated from 2-D correlation plots (Costes et al., 2004). Left panels: buffer-treated root hairs (r=0.15±0.03; n=23 root hairs on 4 plants). Right panels: 24 hours after bacterial treatment a significant increase in co-distribution was observed (r=0.66±0.03; n=22 root hairs on 3 plants; P=5x10-15). Maximum intensity projections, correlation plots, and r-values of representative root hairs are shown.
75
Figure 4-6. After inoculation, LYK3 puncta shift from dynamic to stable Time-series images of FLOT4 and LYK3 after buffer or bacterial treatment acquired at 2s intervals for 180s. (A) Single frame shows that the puncta distribution of LYK3 and FLOT4 is maintained in the absence or presence of bacteria (B) 90-frame averaged images are shown; diffuse signals are indicative of mobile puncta while discrete spots designate stable puncta.
76
(C) Kymographs of intensities in 90-frame time-series images (dashed blue line in B). In the absence of bacteria, LYK3 was dynamic and individual puncta were unstable, which produced an unstructured pattern in the kymograph. FLOT4 puncta were relatively stable and yielded vertical streaks. In the presence of bacteria, both LYK3 and FLOT4 puncta were stable and created vertical streaks in the kymographs. (A-C) Scale bars: 5 µm. (D) Signal intensities from FLOT4 (red) and LYK3 (green) signals along linear transects of the time-averaged images (dashed blue lines) are shown graphically. In the absence of bacteria there is little correlation of average LYK3 and FLOT4 position and intensity (R2=0.27±0.06; n=12 transects on 3 plants). With bacterial treatment, both the position and the relative intensity of the puncta are correlated (R2=0.85±0.02; n=16 transects on 4 plants; P=1x10-10). (E) Slope vs. intensity plots for charts in (B) are shown. These show that the rate of change in signal intensity as a function of position is well correlated between FLOT4:mCherry and LYK3:GFP only in the presence of bacteria. In buffer-treated root hairs R2(slope)=0.10±0.03; in bacteria-treated root hairs R2(slope)=0.74±0.02; P=4x10-13 by two-tailed t-test.
Figure 4-7. FLOT4:mCherry does not label LYK3:GFP intracellular vesicles Hairy roots expressing pFLOT4:gFLOT4:mCherry were generated on plants transformed with pLYK3:gLYK3:GFP. One day post inoculation with S. meliloti, LYK3 and FLOT4 showed an increase in co-distribution at the plasma membrane (arrowheads) but not LYK3:GFP intracellular vesicles (arrow). Images are single optical sections. Scale bar: 5 µm.
77
DISCUSSION FLOT2 affects FLOT4:GFP distribution
We found that FLOT4:GFP localization in epidermal cells was affected by FLOT2.
When FLOT4:GFP was co-expressed with FLOT2:mCherry driven by the constitutive
35S promoter, FLOT4:GFP showed increased polar localization in epidermal cells.
By analogy to animal FLOTs, this result suggests that FLOT2 and FLOT4 might form
hetero-oligomers (Solis et al., 2007; Babuke et al., 2009).
The observation that FLOT4:GFP expressed under its native promoter affects
FLOT2:mCherry localization raises questions of copy number and expression level in
hairy roots. FLOT2:GFP accumulation at root hair tips was only observed in hairy
roots co-transformed with FLOT4:mCherry. When A. rhizogenes strains for the two
constructs were mixed in a 1:1 ratio we obtained a frequency of co-transformation of
about 1 in 4 recovered roots (data not shown). If transformation primarily occurred as
a single event per root, we would not expect nearly this high a rate of co-
transformation. This implies that transgenic hairy roots contain multiple copies of the
transgenes, and even when expressed under native promoters, expression levels may
not be reflective of endogenous levels.
Plant membrane protein compartmentalization
We have found strong evidence that FLOT4 and LYK3 are components of the same
pathway. We show that the phenotype of FLOT4-silenced roots (Chapter 2) closely
resembles the phenotype of LYK3-silenced roots (Smit et al., 2007). A point mutation
in LYK3 caused decreased FLOT4:GFP spot density and increased polarity (Figure 4-
3), and after bacterial treatment, tagged FLOT4 and LYK3 co-localize in space and
time (Figures 4-5 and 4-6). The most parsimonious explanation for these observations
is that FLOT4 and LYK3 are components of a shared complex. An alternative is that
FLOT4 and LYK3 co-localization arises because they occupy distinct (sub-
microscopic resolution) protein complexes within stable microdomains. Further
studies are required to determine the functional significance of co-localization and
regulation of co-distribution of membrane microdomain proteins during symbiosis.
78
We found evidence for root hair membrane puncta with three different
properties: (1) pre-inoculation stable puncta marked by tagged FLOT2/FLOT4, (2)
pre-inoculation mobile puncta marked by tagged LYK3, and (3) post-inoculation
stable puncta marked by tagged LYK3/FLOT4. Our results show that plant
membranes have complex heterogeneity and that proteins exhibit distinct behaviors
that can be altered in response to signals. These data also demonstrate that changes in
membrane-protein architecture accompany altered root hair morphology during early
symbiotic events.
From these observations, we suggest that regulation of protein distribution and
dynamics within plant membranes may be a means of regulating protein function.
While LYK3 is required for infection thread initiation, the underlying mechanism is
unknown. Our data show that after bacterial treatment, LYK3:GFP is not restricted to
infection sites but instead shifts from dynamic to stable puncta that persist on plasma
membranes. One interpretation of this observation is that LYK3 functions within
immobile puncta to send a global signal that reprograms the root hair cell for infection.
An alternative is that sequestering LYK3 in immobile puncta negatively regulates
LYK3 function and serves to limit infection to one site per cell or to only certain cells.
Differentiation between the functional states of mobile and immobile populations of
LYK3 will provide insight into the mechanism by which LYK3 regulates infection
thread initiation.
More generally, our observations suggest two possible models of how
regulation of protein localization within plant membranes may be achieved. One
possibility is that multiple types of microdomains always exist in plant membranes
and that after perception of a signal, proteins travel from one domain to another. A
second possibility is that some proteins (such as LYK3) move freely in and out of
stable microdomains (such as those marked by FLOT4); upon signal perception,
movement of mobile proteins is restricted to stable domains. Both models allow for
the possibility that regulation of plasma membrane protein localization may be a
means by which plants direct responses to external signals.
79
MATERIALS AND METHODS Plant growth, bacterial treatments and hairy root transformations were
performed as described in the materials and methods of Chapter 2. FLOT2:mCherry
and FLOT4:GFP co-transformations were done by mixing equal ratios of A.
rhizogenes carrying each plasmid.
Construct design
pLYK3:gLYK3:GFP and :HASt constructs and transgenic lines were obtained from
Brendan Riely in Doug Cook’s Lab (U.C. Davis, unpublished).
Plasmids pCH153 containing pFLOT4:gFLOT4:mCherry and pCH046
containing 35S:FLOT2:mCherry were generated by replacing GFP in plasmids
pCH118 and pCH035 (Haney and Long, 2010) with mCherry. MCherry was
amplified with primers AAACCCGGGATGGTGAGCAAGGGCGAGGAG and
AAATCTAGATTACTTGTACAGCTCGTCCATG and inserted into the XmaI and
XbaI sites in pCH118 and pCH035 (Haney and Long, 2010).
Confocal microscopy
Microscope setup, optics and filters are described in Chapter 3 materials and methods.
Brightest point z-projections of stacks of epidermal cells or root hairs were
used for quantification of signal or density of spots. Final images included about 45 z-
sections taken at 0.3 μms increments to cover just the top half (~15 μms) of epidermal
cells. As a proxy for polarity, the ratio of signal density on the apical cell pole to the
epidermal surface was determined as follows: (1) the average apical signal was
measured by drawing a 1-pixel wide line along the apical membrane and using
ImageJ’s Measure function to determine the average intensity per pixel (or signal
density), (2) the epidermal signal was measured by a similar method but with a
rectangular selection, (3) the apical signal density was divided by the epidermal signal
density to determine ratio of signal density. To measure density of flotillin puncta,
images were automatically thresholded based on statistical distribution of signal so
that just the puncta on the epidermal surface were defined. Using the “analyze
80
particles” feature in Image J, the total number of spots was determined and divided by
the total area measured to give a spot density. No constraints were placed on spot
size or dimensions. At least 5 cells were measured from at least 3 independent plants
for a total of at least 15 measurements per treatment.
Co-localization experiments were done in three dimensional space using
Imaris’s (Bitplane) co-localization tool as described in Costes et al. (2004). Images
were cropped in three dimensions to include approximately 20 μm of the growing root
hair tip. The background thresholds were set at 1300 and 1080 for the green and red
channels respectively and determined based on auto-fluorescence and background
signals measured in hairy roots on LYK3:HASt plants co-transformed with an empty
vector pCH040 (same as pCH010 described in Chapter 2 except the plasmid lacks
GFP). The Pearson’s correlation co-efficient (r) was determined for co-localization in
3-D space. Twenty-three buffer-treated root hairs were analyzed from 4 individual
plants. Forty-three root hairs were analyzed on 3 independent inoculated plants, 22 of
which had reinitiated direction growth and 21 of which had not. Two-tailed t-tests
with equal variance were used to determine significance of the differences in r.
Time series data was acquired at 2 second intervals over a three minute period.
Analysis was done in ImageJ. Linear manual selections (1 pixel width) were made on
average intensity projections and stacks to generate average pixel intensity and
kymographs. Average pixel intensities were exported to Microsoft Excel to generate
graphical representations and coefficients of determination (R2). Slope at pixel
position x was approximated by the 3-point estimation: (f(x-h) - f(x+h))/2h where the
step h was a single pixel. Two time series data sets were analyzed from each of two
independent inoculated or uninoculated roots (four images per treatment). Three
selections were analyzed per root hair. Two-tailed t-tests with equal variance were
used to determine significance of the differences in R2 values.
81
CHAPTER 5: Conclusions and Future Directions
Plant membrane protein compartmentalization
Some plasma membrane-associated plant proteins have patchy distributions (Sutter et
al., 2006; Homann et al., 2007; Krugel et al., 2008; Gutierrez et al., 2009; Raffaele et
al., 2009). We found several plant proteins required for legume-rhizobia symbiosis,
including two receptor kinases (LYK3 and DMI2) and two flotillin proteins (FLOT2
and FLOT4), that also have patchy distributions associated with plasma membranes.
We showed that the distribution of FLOT4:GFP and LYK3:GFP is altered during
response to a symbiotic bacterium. The finding that signal perception affects
membrane protein distribution is not novel for animal cells (e.g. Stuermer et al., 2004;
Giri et al., 2007); yet, these are the first demonstrations of the phenomenon in plant
cells. In animal cells, evidence suggests that cellular processes are compartmentalized
in punctate plasma membrane domains called “rafts”. Currently, the animal field
defines “membrane rafts” as “small (10-200 nm), heterogeneous, highly dynamic,
sterol- and sphingolipid-enriched domains that compartmentalize cellular processes”
(Pike, 2006). The function and even existence of these domains has been the subject
of much controversy and attention (discussed below and in Lingwood and Simons,
2010).
Are the membrane puncta marked by LYK3 and FLOT4 analogous to animal
membrane rafts? LYK3:GFP and FLOT4:GFP puncta are sub-resolution by light
microscopy, so they are likely on the order of 10-200 nm. Animal membrane rafts are
nearly always defined by their cholesterol-association (Pike, 2006) and plants have
little to no cholesterol (Zappel and Panstruga, 2008). Our observations are consistent
with the possibility that LYK3 and FLOT4 co-localization serves to compartmentalize
a response to symbiotic bacteria. Yet the field of plant membrane biology is too early
in its development to say how similar these domains are to their animal counterparts in
terms of size, lipid and sterol composition, and dynamics.
To date, plant cell biology has been affected by misconceptions about how to
define membrane rafts (discussed in Opekarovà et al., 2010). Detergent resistance has
been used synonymously with membrane raft with little regard for size, composition,
82
or function (Peskan et al., 2000; Mongrand et al., 2004; Borner et al., 2005; Morel et
al., 2006; Lefebvre et al., 2007; Zappel and Panstruga, 2008; Lefebvre et al., 2010;
Mongrand et al., 2010). Detergent-based methods can introduce artifacts, and the
DRM fraction may not correlate with protein distribution in a living cell (Munro,
2003; Lingwood and Simons, 2010). As a consequence, DRM localization does not
necessarily have functional implications, and two proteins that co-partition in the
DRM fraction may not co-localize in a living cell. Despite clear evidence that “rafts”
are not equivalent to DRMs, detergent resistance is still used in many fields to claim
“raft” localization (e.g. Lefebvre et al., 2010; Lopez and Kolter, 2010; Ludwig et al.,
2010). Despite these concerns, is difficult to imagine how proteins could have such
striking, punctate distributions without functional consequence.
The environment of the plant membrane likely results in domains with distinct
properties from animal membranes. Protein diffusion in animal membranes is
constrained by a labyrinth of sterols, proteins, and cytoskeletal elements (Kusumi et
al., 2010). Because plant membrane composition differs from animal membranes, it is
likely that protein diffusion in plant membranes is under distinct constraints and may
differ in diffusion rates. Additionally, plant cells are walled, resulting in forces on the
plasma membrane from both the cell contents and the cell wall itself. Both stable and
dynamic plasma membrane-cell wall contact sites (Kohorn, 2000) could be sites of
membrane protein stabilization. Consequently, plant membranes may have unique
domains that are constrained by the cell wall. Plant membrane puncta size and
dynamics have not been extensively characterized, but evidence suggests that in
walled yeast cells, some punctate domains may be larger than 200 nm (Malinska et al.,
2003) and may be stable for hours (Malinska et al., 2004). Further work will define
the size range of plant membrane puncta, the sterol and lipid environment, and the
behaviors of these domains.
Plasma membrane protein compartmentalization during symbiosis
Nearly concurrent with the discovery of a requirement for FLOTs in symbiosis was the
discovery of a symbiotic remorin (REM) (Lefebvre et al., 2010). REMs, like FLOTs,
83
have punctate plasma membrane distributions (Raffaele et al., 2009) and localize to
infection threads during symbiosis (Lefebvre et al., 2010). Both REMs and FLOTs
are peripheral membrane proteins, predicted to be anchored by palmitoylation, and
have coiled-coil domains. That FLOTs and REMs have such similar predicted
topologies and have nearly indistinguishable but non-redundant requirements in
symbiosis begs the question: why both FLOTs and
One possibility is that FLOTs and REMs function similarly to animal FLOT1
and FLOT2. The two animal flotillins function non-redundantly and cooperatively in
several processes (Solis et al., 2007; Babuke et al., 2009; Riento et al., 2009). As
plants appear to have only one family of flotillins (Rivera-Milla et al., 2006), REMs
may perform a similar function to the second family of animal flotillins. A second
possibility is that FLOTs and REMs occupy distinct membrane compartments and that
a receptor, such as LYK3, may undergo a sort of “handoff” from one protein to the
other. In this model, one might predict that LYK3 and SymREM would co-localize
before inoculation and then a “handoff” of LYK3 to FLOT4 would occur after
inoculation.
REMs?
We observed that GFP-tagged DMI2 and LYK3 have similar punctate
distributions. DMI2 is required for infection and appears to act before LYK3 (Catoira
et al., 2000; Limpens et al., 2005). Genetic data support a model where LYK3 could
be phosphorylated by DMI2, resulting in LYK3 redistribution. Determining: 1) if
LYK3 and DMI2 co-distribute prior to bacterial treatment, 2) if DMI2 is necessary
and sufficient for LYK3 re-distribution and immobilization, and 3) if LYK3 is a target
of the DMI2 kinase domain, will provide insight into the mechanisms by which
symbiotic receptors regulate infection.
What is the function of FLOTs during symbiosis?
In animals, flotillins associate with effectors that interact with the actin cytoskeleton
(Langhorst et al., 2007; Neumann-Giesen et al., 2007; Langhorst et al., 2008a).
Cytoskeletal rearrangements are associated with symbiotic infection (Yokota et al.,
2009); by analogy, perhaps M. truncatula FLOT4 forms a complex with LYK3 and
84
with effectors that bind actin. In this way, flotillins could link NF perception and the
cytoskeletal rearrangements associated with infection. However, if this were the case,
one would expect FLOT4 localization, or FLOT4 and LYK3 co-localization, to be
limited to the site of initiating and growing infection threads. Instead, we observed
that FLOT4 and LYK3 co-localization and LYK3 immobilization is not restricted to
the infection site. This observation suggests that the function of FLOTs in symbiosis
may not be directly in infection thread initiation and growth.
Membrane depolarization is associated with NF perception in legume root
hairs and with signaling in animal neurons and T cells. Animal flotillins function
during T cell activation (Stuermer et al., 2004; Langhorst et al., 2006), a process
which depends on membrane depolarization. Animal flotillins also associate with ion
channels (Morrow and Parton, 2005; Suzuki et al., 2008; Robinson et al., 2010). This
begs the question, is there a link between flotillins and membrane depolarization
during symbiosis? Within minutes of NF application, root hairs undergo a rapid
change in membrane potential followed by calcium spiking (Ehrhardt et al., 1992;
Ehrhardt et al., 1996); both membrane depolarization and calcium spiking are required
for root hair curling (Wais et al., 2000). However, flotillin-silenced roots do not
exhibit root hair curling defects, suggesting that flotillins are not required for
membrane depolarization or calcium spiking during symbiosis (Chapter 2). Drug-
induced membrane depolarization in yeast causes a change in membrane protein
distribution (Grossmann et al., 2007). However, within the first 30 minutes post NF
application, when membrane depolarization and calcium spiking occur, we did not
detect a redistribution of FLOT4:GFP or a change in LYK3:GFP dynamics (Chapter 4
and not shown, respectively). While these observations do not rule out all possible
connections between flotillins and calcium signaling during symbiosis, we did not find
evidence for a role of flotillins in calcium spiking or membrane depolarization.
Our data are most consistent with a role for flotillins downstream of calcium
signaling, prior to and during infection. In animal cells, flotillins have been implicated
in membrane traffic associated with signaling (Langhorst et al., 2008b; Riento et al.,
2009; Pust et al., 2010; Stuermer, 2010). We did not observe a significant pool of
85
intracellular flotillins in any plant cell type under any conditions tested, so it seems
unlikely that plant flotillins are involved in endocytosis or exocytosis during
symbiosis. Rather, a role for structuring clusters of LYK3 receptors, or bringing
LYK3 into contact with other proteins, is most consistent with our observations
(Stuermer, 2010).
Possible functions for plant membrane protein compartmentalization during
host-microbe interactions
We demonstrated that several proteins required for perception of and infection by
symbiotic bacteria have patchy distributions associated with the plasma membrane.
By analogy to animal membrane rafts, changes in membrane protein
compartmentalization may be a general response during plant-microbe interactions.
This is supported by the observation that an Arabidopsis flotillin is upregulated in
roots in response to the fungal elicitor chitin (Millet et al., 2010). As the backbone of
bacterial NF is composed of chitin, it is tempting to speculate that FLOTs may have a
generalized function in organizing membrane receptors in response to microbial
perception. As most plants species have multiple flotillin homologues (Rivera-Milla
et al., 2006), individual flotillins may have different receptor specificities, or
specificity may be regulated on the level of cell-type-specific expression.
A second possible role for membrane protein compartmentalization is in
exocytosis of secondary metabolites. In response to perception of potential pathogens,
plants roots deposit a waxy substance called callose in a patchy distribution on the
plasma membrane (Millet et al., 2010). Patchy callose deposition is reminiscent of
patchy membrane protein distribution and may require targeted exocytosis to specific
plant plasma membrane microdomains. Similarly, plant roots secrete secondary
metabolites including antimicrobial compounds during defense (Bais et al., 2005) and
flavonoids, which act as signaling molecules during legume-rhizobia symbiosis
(Peters et al., 1986). It is unknown how these compounds are secreted from plant
roots into the surrounding environment, but exocytosis is a likely mechanism.
Secondary metabolites are of increasing interest to studies of both plant- and animal-
86
microbe interactions. Understanding how secondary metabolites are secreted, and
determining what role membrane physiology plays in exocytosis in plants, is of
enormous importance in answering the question: how do eukaryotic hosts
communicate with and defend against microbial communities?
87
REFERENCES
Amor, B.B., Shaw, S.L., Oldroyd, G.E., Maillet, F., Penmetsa, R.V., Cook,
D., Long, S.R., Dénarié, J., and Gough, C. (2003). The NFP locus of
Medicago truncatula controls an early step of Nod Factor signal
transduction upstream of a rapid calcium flux and root hair deformation.
Plant J 34, 495-506.
Ané, J.M., Kiss, G.B., Riely, B.K., Penmetsa, R.V., Oldroyd, G.E., Ayax,
C., Levy, J., Debellé, F., Baek, J.M., Kaló, P., Rosenberg, C., Roe,
B.A., Long, S.R., Dénarié, J., and Cook, D.R. (2004). Medicago
truncatula DMI1 required for bacterial and fungal symbioses in legumes.
Science 303, 1364-1367.
Ardourel, M., Demont, N., Debellé, F., Maillet, F., de Billy, F., Promé, J.C.,
Dénarié, J., and Truchet, G. (1994). Rhizobium meliloti
lipooligosaccharide Nodulation Factors: different structural requirements
for bacterial entry into target root hair cells and induction of plant
symbiotic developmental responses. Plant Cell 6, 1357-1374.
Arellano-Reynoso, B., Lapaque, N., Salcedo, S., Briones, G., Ciocchini,
A.E., Ugalde, R., Moreno, E., Moriyon, I., and Gorvel, J.P. (2005).
Cyclic beta-1,2-glucan is a Brucella virulence factor required for
intracellular survival. Nat Immunol 6, 618-625.
Arrighi, J.F., Godfroy, O., de Billy, F., Saurat, O., Jauneau, A., and Gough,
C. (2008). The RPG gene of Medicago truncatula controls Rhizobium-
directed polar growth during infection. Proc Natl Acad Sci U S A 105,
9817-9822.
Babuke, T., Ruonala, M., Meister, M., Amaddii, M., Genzler, C., Esposito,
A., and Tikkanen, R. (2009). Hetero-oligomerization of reggie-
88
1/flotillin-2 and reggie-2/flotillin-1 is required for their endocytosis. Cell
Signal 21, 1287-1297.
Bais, H.P., Prithiviraj, B., Jha, A.K., Ausubel, F.M., and Vivanco, J.M.
(2005). Mediation of pathogen resistance by exudation of antimicrobials
from roots. Nature 434, 217-221.
Batut, J., Andersson, S.G., and O'Callaghan, D. (2004). The evolution of
chronic infection strategies in the alpha-proteobacteria. Nat Rev
Microbiol 2, 933-945.
Baumann, C.A., Ribon, V., Kanzaki, M., Thurmond, D.C., Mora, S.,
Shigematsu, S., Bickel, P.E., Pessin, J.E., and Saltiel, A.R. (2000).
CAP defines a second signalling pathway required for insulin-stimulated
glucose transport. Nature 407, 202-207.
Bersoult, A., Camut, S., Perhald, A., Kereszt, A., Kiss, G.B., and
Cullimore, J.V. (2005). Expression of the Medicago truncatula DM12
gene suggests roles of the symbiotic nodulation receptor kinase in
nodules and during early nodule development. Mol Plant Microbe
Interact 18, 869-876.
Bickel, P.E., Scherer, P.E., Schnitzer, J.E., Oh, P., Lisanti, M.P., and
Lodish, H.F. (1997). Flotillin and epidermal surface antigen define a
new family of caveolae-associated integral membrane proteins. J Biol
Chem 272, 13793-13802.
Boisson-Dernier, A., Chabaud, M., Garcia, F., Becard, G., Rosenberg, C.,
and Barker, D.G. (2001). Agrobacterium rhizogenes-transformed roots
of Medicago truncatula for the study of nitrogen-fixing and
endomycorrhizal symbiotic associations. Mol Plant Microbe Interact 14,
695-700.
89
Boivin, C., Camut, S., Malpica, C.A., Truchet, G., and Rosenberg, C.
(1990). Rhizobium meliloti Genes Encoding Catabolism of Trigonelline
Are Induced under Symbiotic Conditions. Plant Cell 2, 1157-1170.
Bolte, S., Talbot, C., Boutte, Y., Catrice, O., Read, N.D., and Satiat-
Jeunemaitre, B. (2004). FM-dyes as experimental probes for dissecting
vesicle trafficking in living plant cells. J Microsc 214, 159-173.
Borisov, A.Y., Madsen, L.H., Tsyganov, V.E., Umehara, Y., Voroshilova,
V.A., Batagov, A.O., Sandal, N., Mortensen, A., Schauser, L., Ellis,
N., Tikhonovich, I.A., and Stougaard, J. (2003). The Sym35 gene
required for root nodule development in pea is an ortholog of Nin from
Lotus japonicus. Plant Physiol 131, 1009-1017.
Borner, G.H., Sherrier, D.J., Weimar, T., Michaelson, L.V., Hawkins, N.D.,
Macaskill, A., Napier, J.A., Beale, M.H., Lilley, K.S., and Dupree, P.
(2005). Analysis of detergent-resistant membranes in Arabidopsis.
Evidence for plasma membrane lipid rafts. Plant Physiol 137, 104-116.
Browman, D.T., Hoegg, M.B., and Robbins, S.M. (2007). The SPFH domain-
containing proteins: more than lipid raft markers. Trends Cell Biol 17,
394-402.
Capoen, W., and Oldroyd, G. (2008). How CYCLOPS keeps an eye on plant
symbiosis. Proc Natl Acad Sci U S A 105, 20053-20054.
Catalano, C.M., Czymmek, K.J., Gann, J.G., and Sherrier, D.J. (2007).
Medicago truncatula syntaxin SYP132 defines the symbiosome
membrane and infection droplet membrane in root nodules. Planta 225,
541-550.
Catoira, R., Timmers, A.C., Maillet, F., Galera, C., Penmetsa, R.V., Cook,
D., Dénarié, J., and Gough, C. (2001). The HCL gene of Medicago
truncatula controls Rhizobium-induced root hair curling. Development
128, 1507-1518.
90
Catoira, R., Galera, C., de Billy, F., Penmetsa, R.V., Journet, E.P., Maillet,
F., Rosenberg, C., Cook, D., Gough, C., and Dénarié, J. (2000). Four
genes of Medicago truncatula controlling components of a Nod Factor
transduction pathway. Plant Cell 12, 1647-1666.
Charpentier, M., Bredemeier, R., Wanner, G., Takeda, N., Schleiff, E., and
Parniske, M. (2008). Lotus japonicus CASTOR and POLLUX are ion
channels essential for perinuclear calcium spiking in legume root
endosymbiosis. Plant Cell 20, 3467-3479.
Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T.,
Jones, J.D., Felix, G., and Boller, T. (2007). A flagellin-induced
complex of the receptor FLS2 and BAK1 initiates plant defence. Nature
448, 497-500.
Costes, S.V., Daelemans, D., Cho, E.H., Dobbin, Z., Pavlakis, G., and
Lockett, S. (2004). Automatic and quantitative measurement of protein-
protein colocalization in live cells. Biophys J 86, 3993-4003.
Curtis, M.D., and Grossniklaus, U. (2003). A gateway cloning vector set for
high-throughput functional analysis of genes in planta. Plant Physiol
133, 462-469.
Cutler, S.R., Ehrhardt, D.W., Griffitts, J.S., and Somerville, C.R. (2000).
Random GFP::cDNA fusions enable visualization of subcellular
structures in cells of Arabidopsis at a high frequency. Proc Natl Acad Sci
U S A 97, 3718-3723.
Debellé, F., Moulin, L., Mangin, B., Dénarié, J., and Boivin, C. (2001). Nod
genes and Nod signals and the evolution of the Rhizobium-legume
symbiosis. Acta Biochim Pol 48, 359-365.
Deininger, S.O., Rajendran, L., Lottspeich, F., Przybylski, M., Illges, H.,
Stuermer, C.A., and Reuter, A. (2003). Identification of teleost Thy-1
91
and association with the microdomain/lipid raft reggie proteins in
regenerating CNS axons. Mol Cell Neurosci 22, 544-554.
Demont, N., Debellé, F., Aurelle, H., Dénarié, J., and Promé, J.C. (1993).
Role of the Rhizobium meliloti nodF and nodE genes in the biosynthesis
of lipo-oligosaccharidic Nodulation Factors. J Biol Chem 268, 20134-
20142.
Donovan, C., and Bramkamp, M. (2009). Characterization and subcellular
localization of a bacterial flotillin homologue. Microbiol-Sgm 155,
1786-1799.
Downie, J.A. (1989). The nodL gene from Rhizobium leguminosarum is
homologous to the acetyl transferases encoded by lacA and cysE. Mol
Microbiol 3, 1649-1651.
E.P.A. (2010). U.S. Greenhouse Gas Inventory Report--Inventory of U.S.
Greenhouse Gas Emissions and Sinks: 1990-2008. Available online
http://www.epa.gov/climatechange/emissions/usinventoryreport.html.
Ehrhardt, D.W., Atkinson, E.M., and Long, S.R. (1992). Depolarization of
alfalfa root hair membrane potential by Rhizobium meliloti Nod Factors.
Science 256, 998-1000.
Ehrhardt, D.W., Wais, R., and Long, S.R. (1996). Calcium spiking in plant
root hairs responding to Rhizobium nodulation signals. Cell 85, 673-681.
Ehrhardt, D.W., Atkinson, E.M., Faull, K.F., Freedberg, D.I., Sutherlin,
D.P., Armstrong, R., and Long, S.R. (1995). In vitro sulfotransferase
activity of NodH, a nodulation protein of Rhizobium meliloti required for
host-specific nodulation. J Bacteriol 177, 6237-6245.
Endre, G., Kereszt, A., Kevei, Z., Mihacea, S., Kaló, P., and Kiss, G.B.
(2002). A receptor kinase gene regulating symbiotic nodule
development. Nature 417, 962-966.
92
Fisher, R.F., Egelhoff, T.T., Mulligan, J.T., and Long, S.R. (1988). Specific
binding of proteins from Rhizobium meliloti cell-free extracts containing
NodD to DNA sequences upstream of inducible nodulation genes. Genes
Dev 2, 282-293.
Frick, M., Bright, N.A., Riento, K., Bray, A., Merrified, C., and Nichols,
B.J. (2007). Coassembly of flotillins induces formation of membrane
microdomains, membrane curvature, and vesicle budding. Curr Biol 17,
1151-1156.
Gage, D.J. (2002). Analysis of infection thread development using Gfp- and
DsRed-expressing Sinorhizobium meliloti. J Bacteriol 184, 7042-7046.
Gage, D.J. (2004). Infection and invasion of roots by symbiotic, nitrogen-
fixing rhizobia during nodulation of temperate legumes. Microbiol Mol
Biol Rev 68, 280-300.
Geurts, R., Fedorova, E., and Bisseling, T. (2005). Nod Factor signaling
genes and their function in the early stages of Rhizobium infection. Curr
Opin Plant Biol 8, 346-352.
Giri, B., Dixit, V.D., Ghosh, M.C., Collins, G.D., Khan, I.U., Madara, K.,
Weeraratna, A.T., and Taub, D.D. (2007). CXCL12-induced
partitioning of flotillin-1 with lipid rafts plays a role in CXCR4 function.
Eur J Immunol 37, 2104-2116.
Gleason, C., Chaudhuri, S., Yang, T., Munoz, A., Poovaiah, B.W., and
Oldroyd, G.E. (2006). Nodulation independent of rhizobia induced by a
calcium-activated kinase lacking autoinhibition. Nature 441, 1149-1152.
Glebov, O.O., Bright, N.A., and Nichols, B.J. (2006). Flotillin-1 defines a
clathrin-independent endocytic pathway in mammalian cells. Nat Cell
Biol 8, 46-54.
93
Griffitts, J.S., and Long, S.R. (2008). A symbiotic mutant of Sinorhizobium
meliloti reveals a novel genetic pathway involving succinoglycan
biosynthetic functions. Mol Microbiol 67, 1292-1306.
Griffitts, J.S., Carlyon, R.E., Erickson, J.H., Moulton, J.L., Barnett, M.J.,
Toman, C.J., and Long, S.R. (2008). A Sinorhizobium meliloti
osmosensory two-component system required for cyclic glucan export
and symbiosis. Mol Microbiol 69, 479-490.
Grossmann, G., Opekarovà, M., Malinsky, J., Weig-Meckl, I., and Tanner,
W. (2007). Membrane potential governs lateral segregation of plasma
membrane proteins and lipids in yeast. EMBO J 26, 1-8.
Gutierrez, R., Lindeboom, J.J., Paredez, A.R., Emons, A.M., and
Ehrhardt, D.W. (2009). Arabidopsis cortical microtubules position
cellulose synthase delivery to the plasma membrane and interact with
cellulose synthase trafficking compartments. Nat Cell Biol 11, 797-806.
Haney, C.H., and Long, S.R. (2010). Plant flotillins are required for infection
by nitrogen-fixing bacteria. Proc Natl Acad Sci U S A 107, 478-483.
Heckmann, A.B., Lombardo, F., Miwa, H., Perry, J.A., Bunnewell, S.,
Parniske, M., Wang, T.L., and Downie, J.A. (2006). Lotus japonicus
nodulation requires two GRAS domain regulators, one of which is
functionally conserved in a non-legume. Plant Physiol 142, 1739-1750.
Helliwell, C., and Waterhouse, P. (2003). Constructs and methods for high-
throughput gene silencing in plants. Methods 30, 289-295.
Hirsch, S., Kim, J., Munoz, A., Heckmann, A.B., Downie, J.A., and
Oldroyd, G.E. (2009). GRAS proteins form a DNA binding complex to
induce gene expression during nodulation signaling in Medicago
truncatula. Plant Cell 21, 545-557.
94
Homann, U., Meckel, T., Hewing, J., Hutt, M.T., and Hurst, A.C. (2007).
Distinct fluorescent pattern of KAT1::GFP in the plasma membrane of
Vicia faba guard cells. Eur J Cell Biol 86, 489-500.
Huber, T.B., Schermer, B., Muller, R.U., Hohne, M., Bartram, M., Calixto,
A., Hagmann, H., Reinhardt, C., Koos, F., Kunzelmann, K.,
Shirokova, E., Krautwurst, D., Harteneck, C., Simons, M.,
Pavenstadt, H., Kerjaschki, D., Thiele, C., Walz, G., Chalfie, M., and
Benzing, T. (2006). Podocin and MEC-2 bind cholesterol to regulate the
activity of associated ion channels. Proc Natl Acad Sci U S A 103,
17079-17086.
Iizasa, E., Mitsutomi, M., and Nagano, Y. (2010). Direct binding of a plant
LysM receptor-like kinase, LysM RLK1/CERK1, to chitin in vitro. J
Biol Chem 285, 2996-3004.
Kaló, P., Gleason, C., Edwards, A., Marsh, J., Mitra, R.M., Hirsch, S.,
Jakab, J., Sims, S., Long, S.R., Rogers, J., Kiss, G.B., Downie, J.A.,
and Oldroyd, G.E. (2005). Nodulation signaling in legumes requires
NSP2, a member of the GRAS family of transcriptional regulators.
Science 308, 1786-1789.
Kanamori, N., Madsen, L.H., Radutoiu, S., Frantescu, M., Quistgaard,
E.M., Miwa, H., Downie, J.A., James, E.K., Felle, H.H., Haaning,
L.L., Jensen, T.H., Sato, S., Nakamura, Y., Tabata, S., Sandal, N.,
and Stougaard, J. (2006). A nucleoporin is required for induction of
Ca2+ spiking in legume nodule development and essential for rhizobial
and fungal symbiosis. Proc Natl Acad Sci U S A 103, 359-364.
Katanaev, V.L., Solis, G.P., Hausmann, G., Buestorf, S., Katanayeva, N.,
Schrock, Y., Stuermer, C.A., and Basler, K. (2008). Reggie-1/flotillin-
2 promotes secretion of the long-range signalling forms of Wingless and
Hedgehog in Drosophila. EMBO J 27, 509-521.
95
Kiss, E., Olah, B., Kaló, P., Morales, M., Heckmann, A.B., Borbola, A.,
Lozsa, A., Kontar, K., Middleton, P., Downie, J.A., Oldroyd, G.E.,
and Endre, G. (2009). LIN, a novel type of U-box/WD40 protein,
controls early infection by rhizobia in legumes. Plant Physiol 151, 1239-
1249.
Kohorn, B.D. (2000). Plasma membrane-cell wall contacts. Plant Physiol 124,
31-38.
Kokubo, H., Helms, J.B., Ohno-Iwashita, Y., Shimada, Y., Horikoshi, Y.,
and Yamaguchi, H. (2003). Ultrastructural localization of flotillin-1 to
cholesterol-rich membrane microdomains, rafts, in rat brain tissue. Brain
Res 965, 83-90.
Krugel, U., Veenhoff, L.M., Langbein, J., Wiederhold, E., Liesche, J.,
Friedrich, T., Grimm, B., Martinoia, E., Poolman, B., and Kuhn, C.
(2008). Transport and sorting of the Solanum tuberosum sucrose
transporter SUT1 is affected by posttranslational modification. Plant Cell
20, 2497-2513.
Kusumi, A., Shirai, Y.M., Koyama-Honda, I., Suzuki, K.G., and Fujiwara,
T.K. (2010). Hierarchical organization of the plasma membrane:
investigations by single-molecule tracking vs. fluorescence correlation
spectroscopy. FEBS Lett 584, 1814-1823.
Langhorst, M.F., Solis, G.P., Hannbeck, S., Plattner, H., and Stuermer,
C.A. (2007). Linking membrane microdomains to the cytoskeleton:
regulation of the lateral mobility of reggie-1/flotillin-2 by interaction
with actin. FEBS Lett 581, 4697-4703.
Langhorst, M.F., Jaeger, F.A., Mueller, S., Sven Hartmann, L.,
Luxenhofer, G., and Stuermer, C.A. (2008a). Reggies/flotillins
regulate cytoskeletal remodeling during neuronal differentiation via
CAP/ponsin and Rho GTPases. Eur J Cell Biol 87, 921-931.
96
Langhorst, M.F., Reuter, A., Luxenhofer, G., Boneberg, E.M., Legler, D.F.,
Plattner, H., and Stuermer, C.A. (2006). Preformed reggie/flotillin
caps: stable priming platforms for macrodomain assembly in T cells.
FASEB J 20, 711-713.
Langhorst, M.F., Reuter, A., Jaeger, F.A., Wippich, F.M., Luxenhofer, G.,
Plattner, H., and Stuermer, C.A. (2008b). Trafficking of the
microdomain scaffolding protein reggie-1/flotillin-2. Eur J Cell Biol 87,
211-226.
Lefebvre, B., Furt, F., Hartmann, M.A., Michaelson, L.V., Carde, J.P.,
Sargueil-Boiron, F., Rossignol, M., Napier, J.A., Cullimore, J.,
Bessoule, J.J., and Mongrand, S. (2007). Characterization of lipid rafts
from Medicago truncatula root plasma membranes: a proteomic study
reveals the presence of a raft-associated redox system. Plant Physiol 144,
402-418.
Lefebvre, B., Timmers, T., Mbengue, M., Moreau, S., Hervé, C., Toth, K.,
Bittencourt-Silvestre, J., Klaus, D., Deslandes, L., Godiard, L.,
Murray, J.D., Udvardi, M.K., Raffaele, S., Mongrand, S., Cullimore,
J., Gamas, P., Niebel, A., and Ott, T. (2010). A remorin protein
interacts with symbiotic receptors and regulates bacterial infection. Proc
Natl Acad Sci U S A 107, 2343-2348.
Leigh, J.A., Signer, E.R., and Walker, G.C. (1985). Exopolysaccharide-
deficient mutants of Rhizobium meliloti that form ineffective nodules.
Proc Natl Acad Sci U S A 82, 6231-6235.
Levy, J., Bres, C., Geurts, R., Chalhoub, B., Kulikova, O., Duc, G.,
Journet, E.P., Ané, J.M., Lauber, E., Bisseling, T., Dénarié, J.,
Rosenberg, C., and Debellé, F. (2004). A putative Ca2+ and
calmodulin-dependent protein kinase required for bacterial and fungal
symbioses. Science 303, 1361-1364.
97
Li, J., Wen, J., Lease, K.A., Doke, J.T., Tax, F.E., and Walker, J.C. (2002).
BAK1, an Arabidopsis LRR receptor-like protein kinase, interacts with
BRI1 and modulates brassinosteroid signaling. Cell 110, 213-222.
Limpens, E., Franken, C., Smit, P., Willemse, J., Bisseling, T., and Geurts,
R. (2003). LysM domain receptor kinases regulating rhizobial Nod
Factor-induced infection. Science 302, 630-633.
Limpens, E., Ivanov, S., van Esse, W., Voets, G., Fedorova, E., and
Bisseling, T. (2009). Medicago N2-fixing symbiosomes acquire the
endocytic identity marker Rab7 but delay the acquisition of vacuolar
identity. Plant Cell 21, 2811-2828.
Limpens, E., Mirabella, R., Fedorova, E., Franken, C., Franssen, H.,
Bisseling, T., and Geurts, R. (2005). Formation of organelle-like N2-
fixing symbiosomes in legume root nodules is controlled by DMI2. Proc
Natl Acad Sci U S A 102, 10375-10380.
Lingwood, D., and Simons, K. (2010). Lipid rafts as a membrane-organizing
principle. Science 327, 46-50.
Liu, J., Deyoung, S.M., Zhang, M., Dold, L.H., and Saltiel, A.R. (2005). The
stomatin/prohibitin/flotillin/HflK/C domain of flotillin-1 contains
distinct sequences that direct plasma membrane localization and protein
interactions in 3T3-L1 adipocytes. J Biol Chem 280, 16125-16134.
Lopez, D., and Kolter, R. (2010). Functional microdomains in bacterial
membranes. Gene Dev 24, 1893-1902.
Ludwig, A., Otto, G.P., Riento, K., Hams, E., Fallon, P.G., and Nichols,
B.J. (2010). Flotillin microdomains interact with the cortical
cytoskeleton to control uropod formation and neutrophil recruitment. J
Cell Biol 191, 771-781.
Madsen, E.B., Madsen, L.H., Radutoiu, S., Olbryt, M., Rakwalska, M.,
Szczyglowski, K., Sato, S., Kaneko, T., Tabata, S., Sandal, N., and
98
Stougaard, J. (2003). A receptor kinase gene of the LysM type is
involved in legume perception of rhizobial signals. Nature 425, 637-640.
Malinska, K., Malinsky, J., Opekarovà, M., and Tanner, W. (2003).
Visualization of protein compartmentation within the plasma membrane
of living yeast cells. Mol Biol Cell 14, 4427-4436.
Malinska, K., Malinsky, J., Opekarovà, M., and Tanner, W. (2004).
Distribution of Can1p into stable domains reflects lateral protein
segregation within the plasma membrane of living S. cerevisiae cells. J
Cell Sci 117, 6031-6041.
Marsh, J.F., Rakocevic, A., Mitra, R.M., Brocard, L., Sun, J., Eschstruth,
A., Long, S.R., Schultze, M., Ratet, P., and Oldroyd, G.E. (2007).
Medicago truncatula NIN is essential for rhizobial-independent nodule
organogenesis induced by autoactive calcium/calmodulin-dependent
protein kinase. Plant Physiol 144, 324-335.
Mbengue, M., Camut, S., de Carvalho-Niebel, F., Deslandes, L., Froidure,
S., Klaus-Heisen, D., Moreau, S., Rivas, S., Timmers, T., Hervé, C.,
Cullimore, J., and Lefebvre, B. (2010). The Medicago truncatula E3
Ubiquitin Ligase PUB1 Interacts with the LYK3 Symbiotic Receptor
and Negatively Regulates Infection and Nodulation. Plant Cell.
Meade, H.M., Long, S.R., Ruvkun, G.B., Brown, S.E., and Ausubel, F.M.
(1982). Physical and genetic characterization of symbiotic and
auxotrophic mutants of Rhizobium meliloti induced by transposon Tn5
mutagenesis. J Bacteriol 149, 114-122.
Middleton, P.H., Jakab, J., Penmetsa, R.V., Starker, C.G., Doll, J., Kaló,
P., Prabhu, R., Marsh, J.F., Mitra, R.M., Kereszt, A., Dudas, B.,
VandenBosch, K., Long, S.R., Cook, D.R., Kiss, G.B., and Oldroyd,
G.E. (2007). An ERF transcription factor in Medicago truncatula that is
essential for Nod Factor signal transduction. Plant Cell 19, 1221-1234.
99
Millet, Y.A., Danna, C.H., Clay, N.K., Songnuan, W., Simon, M.D., Werck-
Reichhart, D., and Ausubel, F.M. (2010). Innate immune responses
activated in Arabidopsis roots by microbe-associated molecular patterns.
Plant Cell 22, 973-990.
Mitra, R.M., and Long, S.R. (2004). Plant and bacterial symbiotic mutants
define three transcriptionally distinct stages in the development of the
Medicago truncatula/Sinorhizobium meliloti symbiosis. Plant Physiol
134, 595-604.
Mitra, R.M., Shaw, S.L., and Long, S.R. (2004a). Six nonnodulating plant
mutants defective for Nod Factor-induced transcriptional changes
associated with the legume-rhizobia symbiosis. Proc Natl Acad Sci U S
A 101, 10217-10222.
Mitra, R.M., Gleason, C.A., Edwards, A., Hadfield, J., Downie, J.A.,
Oldroyd, G.E., and Long, S.R. (2004b). A Ca2+/calmodulin-dependent
protein kinase required for symbiotic nodule development: Gene
identification by transcript-based cloning. Proc Natl Acad Sci U S A
101, 4701-4705.
Mongrand, S., Stanislas, T., Bayer, E.M., Lherminier, J., and Simon-Plas,
F. (2010). Membrane rafts in plant cells. Trends Plant Sci 15, 656-663
Mongrand, S., Morel, J., Laroche, J., Claverol, S., Carde, J.P., Hartmann,
M.A., Bonneu, M., Simon-Plas, F., Lessire, R., and Bessoule, J.J.
(2004). Lipid rafts in higher plant cells: purification and characterization
of Triton X-100-insoluble microdomains from tobacco plasma
membrane. J Biol Chem 279, 36277-36286.
Morel, J., Claverol, S., Mongrand, S., Furt, F., Fromentin, J., Bessoule,
J.J., Blein, J.P., and Simon-Plas, F. (2006). Proteomics of plant
detergent-resistant membranes. Mol Cell Proteomics 5, 1396-1411.
100
Morrow, I.C., and Parton, R.G. (2005). Flotillins and the PHB domain
protein family: rafts, worms and anaesthetics. Traffic 6, 725-740.
Morrow, I.C., Rea, S., Martin, S., Prior, I.A., Prohaska, R., Hancock, J.F.,
James, D.E., and Parton, R.G. (2002). Flotillin-1/reggie-2 traffics to
surface raft domains via a novel golgi-independent pathway.
Identification of a novel membrane targeting domain and a role for
palmitoylation. J Biol Chem 277, 48834-48841.
Morzhina, E.V., Tsyganov, V.E., Borisov, A.Y., Lebsky, V.K., and
Tikhonovich, I.A. (2000). Four developmental stages identified by
genetic dissection of pea (Pisum sativum L.) root nodule morphogenesis.
Plant Sci 155, 75-83.
Munro, S. (2003). Lipid rafts: elusive or illusive? Cell 115, 377-388.
Murakami, Y., Miwa, H., Imaizumi-Anraku, H., Kouchi, H., Downie, J.A.,
Kawaguchi, M., and Kawasaki, S. (2006). Positional cloning identifies
Lotus japonicus NSP2, a putative transcription factor of the GRAS
family, required for NIN and ENOD40 gene expression in nodule
initiation. DNA Res 13, 255-265.
Nam, K.H., and Li, J. (2002). BRI1/BAK1, a receptor kinase pair mediating
brassinosteroid signaling. Cell 110, 203-212.
Neumann-Giesen, C., Fernow, I., Amaddii, M., and Tikkanen, R. (2007).
Role of EGF-induced tyrosine phosphorylation of reggie-1/flotillin-2 in
cell spreading and signaling to the actin cytoskeleton. J Cell Sci 120,
395-406.
Neumann-Giesen, C., Falkenbach, B., Beicht, P., Claasen, S., Luers, G.,
Stuermer, C.A., Herzog, V., and Tikkanen, R. (2004). Membrane and
raft association of reggie-1/flotillin-2: role of myristoylation,
palmitoylation and oligomerization and induction of filopodia by
overexpression. Biochem J 378, 509-518.
101
Newcomb, W. (1976). A correlated light and electron microscopic study of
symbiotic growth and differentiation in Pisum sativum root nodules.
Can. J. Exp. Bot. 54, 2163-2186.
Oke, V., and Long, S.R. (1999). Bacterial genes induced within the nodule
during the Rhizobium-legume symbiosis. Mol Microbiol 32, 837-849.
Oldroyd, G.E., and Long, S.R. (2003). Identification and characterization of
nodulation-signaling pathway 2, a gene of Medicago truncatula involved
in Nod Factor signaling. Plant Physiol 131, 1027-1032.
Oldroyd, G.E., and Downie, J.A. (2008). Coordinating nodule morphogenesis
with rhizobial infection in legumes. Annu Rev Plant Biol 59, 519-546.
Oldroyd, G.E., Engstrom, E.M., and Long, S.R. (2001a). Ethylene inhibits
the Nod Factor signal transduction pathway of Medicago truncatula.
Plant Cell 13, 1835-1849.
Oldroyd, G.E., Mitra, R.M., Wais, R.J., and Long, S.R. (2001b). Evidence
for structurally specific negative feedback in the Nod Factor signal
transduction pathway. Plant J 28, 191-199.
Opekarovà, M., Malinsky, J., and Tanner, W. (2010). Plants and fungi in the
era of heterogeneous plasma membranes. Plant Biol (Stuttg) 12, 94-98.
Ossowski, S., Schwab, R., and Weigel, D. (2008). Gene silencing in plants
using artificial microRNAs and other small RNAs. Plant J 53, 674-690.
Panter, S., Thomson, R., de Bruxelles, G., Laver, D., Trevaskis, B., and
Udvardi, M. (2000). Identification with proteomics of novel proteins
associated with the peribacteroid membrane of soybean root nodules.
Mol Plant Microbe Interact 13, 325-333.
Paredez, A.R., Somerville, C.R., and Ehrhardt, D.W. (2006). Visualization
of cellulose synthase demonstrates functional association with
microtubules. Science 312, 1491-1495.
102
Peck, M.C., Fisher, R.F., and Long, S.R. (2006). Diverse flavonoids stimulate
NodD1 binding to nod gene promoters in Sinorhizobium meliloti. J
Bacteriol 188, 5417-5427.
Peskan, T., Westermann, M., and Oelmuller, R. (2000). Identification of
low-density Triton X-100-insoluble plasma membrane microdomains in
higher plants. Eur J Biochem 267, 6989-6995.
Peters, N.K., Frost, J.W., and Long, S.R. (1986). A plant flavone, luteolin,
induces expression of Rhizobium meliloti nodulation genes. Science 233,
977-980.
Pike, L.J. (2006). Rafts defined: a report on the Keystone Symposium on Lipid
Rafts and Cell Function. J Lipid Res 47, 1597-1598.
Pust, S., Dyve, A.B., Torgersen, M.L., van Deurs, B., and Sandvig, K.
(2010). Interplay between toxin transport and flotillin localization. PLoS
One 5, e8844.
Quandt, H.J., Pühler, A., and Broer, I. (1993). Transgenic root nodules of
Vicia hirsuta: A fast and efficient system for the study of gene
expression in indeterminate-type nodules. Mol Plant-Microbe Interact 6,
699-706.
Radutoiu, S., Madsen, L.H., Madsen, E.B., Felle, H.H., Umehara, Y.,
Gronlund, M., Sato, S., Nakamura, Y., Tabata, S., Sandal, N., and
Stougaard, J. (2003). Plant recognition of symbiotic bacteria requires
two LysM receptor-like kinases. Nature 425, 585-592.
Raffaele, S., Bayer, E., Lafarge, D., Cluzet, S., German Retana, S.,
Boubekeur, T., Leborgne-Castel, N., Carde, J.P., Lherminier, J.,
Noirot, E., Satiat-Jeunemaitre, B., Laroche-Traineau, J., Moreau,
P., Ott, T., Maule, A.J., Reymond, P., Simon-Plas, F., Farmer, E.E.,
Bessoule, J.J., and Mongrand, S. (2009). Remorin, a Solanaceae
103
protein resident in membrane rafts and plasmodesmata, impairs potato
virus X movement. Plant Cell 21, 1541-1555.
Reuter, A., Binkle, U., Stuermer, C.A., and Plattner, H. (2004). PrPc and
reggies/flotillins are contained in and released via lipid-rich vesicles in
Jurkat T cells. Cell Mol Life Sci 61, 2092-2099.
Riely, B.K., Lougnon, G., Ané, J.M., and Cook, D.R. (2007). The symbiotic
ion channel homolog DMI1 is localized in the nuclear membrane of
Medicago truncatula roots. Plant J 49, 208-216.
Riento, K., Frick, M., Schafer, I., and Nichols, B.J. (2009). Endocytosis of
flotillin-1 and flotillin-2 is regulated by Fyn kinase. J Cell Sci 122, 912-
918.
Rivera-Milla, E., Stuermer, C.A., and Malaga-Trillo, E. (2006). Ancient
origin of reggie (flotillin), reggie-like, and other lipid-raft proteins:
convergent evolution of the SPFH domain. Cell Mol Life Sci 63, 343-
357.
Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced
endocytosis of the pattern recognition receptor FLS2 in Arabidopsis.
Genes Dev 20, 537-542.
Robinson, P., Etheridge, S., Song, L., Armenise, P., Jones, O.T., and
Fitzgerald, E.M. (2010). Formation of N-type (Cav2.2) voltage-gated
calcium channel membrane microdomains: Lipid raft association and
clustering. Cell Calcium 48, 183-194.
Roche, P., Lerouge, P., Ponthus, C., and Promé, J.C. (1991a). Structural
determination of bacterial Nodulation Factors involved in the Rhizobium
meliloti-alfalfa symbiosis. J Biol Chem 266, 10933-10940.
Roche, P., Debellé, F., Maillet, F., Lerouge, P., Faucher, C., Truchet, G.,
Dénarié, J., and Promé, J.C. (1991b). Molecular basis of symbiotic
104
host specificity in Rhizobium meliloti: nodH and nodPQ genes encode
the sulfation of lipo-oligosaccharide signals. Cell 67, 1131-1143.
Saalbach, G., Erik, P., and Wienkoop, S. (2002). Characterisation by
proteomics of peribacteroid space and peribacteroid membrane
preparations from pea (Pisum sativum) symbiosomes. Proteomics 2,
325-337.
Saito, K., Yoshikawa, M., Yano, K., Miwa, H., Uchida, H., Asamizu, E.,
Sato, S., Tabata, S., Imaizumi-Anraku, H., Umehara, Y., Kouchi, H.,
Murooka, Y., Szczyglowski, K., Downie, J.A., Parniske, M., Hayashi,
M., and Kawaguchi, M. (2007). NUCLEOPORIN85 is required for
calcium spiking, fungal and bacterial symbioses, and seed production in
Lotus japonicus. Plant Cell 19, 610-624.
Sallstrom, B., and Andersson, S.G. (2005). Genome reduction in the alpha-
Proteobacteria. Curr Opin Microbiol 8, 579-585.
Schauser, L., Wieloch, W., and Stougaard, J. (2005). Evolution of NIN-like
proteins in Arabidopsis, rice, and Lotus japonicus. J Mol Evol 60, 229-
237.
Schauser, L., Roussis, A., Stiller, J., and Stougaard, J. (1999). A plant
regulator controlling development of symbiotic root nodules. Nature
402, 191-195.
Schauser, L., Handberg, K., Sandal, N., Stiller, J., Thykjaer, T., Pajuelo,
E., Nielsen, A., and Stougaard, J. (1998). Symbiotic mutants deficient
in nodule establishment identified after T-DNA transformation of Lotus
japonicus. Mol Gen Genet 259, 414-423.
Schneider, A., Rajendran, L., Honsho, M., Gralle, M., Donnert, G.,
Wouters, F., Hell, S.W., and Simons, M. (2008). Flotillin-dependent
clustering of the amyloid precursor protein regulates its endocytosis and
amyloidogenic processing in neurons. J Neurosci 28, 2874-2882.
105
Schulte, T., Paschke, K.A., Laessing, U., Lottspeich, F., and Stuermer, C.A.
(1997). Reggie-1 and reggie-2, two cell surface proteins expressed by
retinal ganglion cells during axon regeneration. Development 124, 577-
587.
Schultze, M., Staehelin, C., Röhrig, H., John, M., Schmidt, J., Kondorosi,
E., Schell, J., and Kondorosi, A. (1995). In vitro sulfotransferase
activity of Rhizobium meliloti NodH protein: lipochitooligosaccharide
nodulation signals are sulfated after synthesis of the core structure. Proc
Natl Acad Sci U S A 92, 2706-2709.
Schwab, R., Ossowski, S., Riester, M., Warthmann, N., and Weigel, D.
(2006). Highly specific gene silencing by artificial microRNAs in
Arabidopsis. Plant Cell 18, 1121-1133.
Shearman, C.A., Rossen, L., Johnston, A.W., and Downie, J.A. (1986). The
Rhizobium leguminosarum nodulation gene nodF encodes a polypeptide
similar to acyl-carrier protein and is regulated by nodD plus a factor in
pea root exudate. EMBO J 5, 647-652.
Smit, P., Raedts, J., Portyanko, V., Debellé, F., Gough, C., Bisseling, T.,
and Geurts, R. (2005). NSP1 of the GRAS protein family is essential
for rhizobial Nod Factor-induced transcription. Science 308, 1789-1791.
Smit, P., Limpens, E., Geurts, R., Fedorova, E., Dolgikh, E., Gough, C.,
and Bisseling, T. (2007). Medicago LYK3, an entry receptor in
rhizobial Nodulation Factor signaling. Plant Physiol 145, 183-191.
Solis, G.P., Hoegg, M., Munderloh, C., Schrock, Y., Malaga-Trillo, E.,
Rivera-Milla, E., and Stuermer, C.A. (2007). Reggie/flotillin proteins
are organized into stable tetramers in membrane microdomains. Biochem
J 403, 313-322.
Solomon, S., Masilamani, M., Rajendran, L., Bastmeyer, M., Stuermer,
C.A., and Illges, H. (2002). The lipid raft microdomain-associated
106
protein reggie-1/flotillin-2 is expressed in human B cells and localized at
the plasma membrane and centrosome in PBMCs. Immunobiology 205,
108-119.
Spaink, H.P., Kondorosi, A., and and Hooykaas, P.J.J., (eds). (1998). The
Rhizobiaceae: Molecular Biology of Model Plant-Associated Bacteria.
Kluwer Academic Publishers, Boston, MA, 387-402.
Starker, C.G., Parra-Colmenares, A.L., Smith, L., Mitra, R.M., and Long,
S.R. (2006). Nitrogen fixation mutants of Medicago truncatula fail to
support plant and bacterial symbiotic gene expression. Plant Physiol 140,
671-680.
Stracke, S., Kistner, C., Yoshida, S., Mulder, L., Sato, S., Kaneko, T.,
Tabata, S., Sandal, N., Stougaard, J., Szczyglowski, K., and
Parniske, M. (2002). A plant receptor-like kinase required for both
bacterial and fungal symbiosis. Nature 417, 959-962.
Stuermer, C.A. (2010). The reggie/flotillin connection to growth. Trends Cell
Biol 20, 6-13.
Stuermer, C.A., Lang, D.M., Kirsch, F., Wiechers, M., Deininger, S.O., and
Plattner, H. (2001). Glycosylphosphatidyl inositol-anchored proteins
and fyn kinase assemble in noncaveolar plasma membrane
microdomains defined by reggie-1 and -2. Mol Biol Cell 12, 3031-3045.
Stuermer, C.A., Langhorst, M.F., Wiechers, M.F., Legler, D.F., Von
Hanwehr, S.H., Guse, A.H., and Plattner, H. (2004). PrPc capping in
T cells promotes its association with the lipid raft proteins reggie-1 and
reggie-2 and leads to signal transduction. FASEB J 18, 1731-1733.
Sutter, J.U., Campanoni, P., Tyrrell, M., and Blatt, M.R. (2006). Selective
mobility and sensitivity to SNAREs is exhibited by the Arabidopsis
KAT1 K+ channel at the plasma membrane. Plant Cell 18, 935-954.
107
Suzuki, T., Du, F., Tian, Q.B., Zhang, J., and Endo, S. (2008).
Ca2+/calmodulin-dependent protein kinase IIα clusters are associated
with stable lipid rafts and their formation traps PSD-95. J Neurochem
104, 596-610.
Tirichine, L., Imaizumi-Anraku, H., Yoshida, S., Murakami, Y., Madsen,
L.H., Miwa, H., Nakagawa, T., Sandal, N., Albrektsen, A.S.,
Kawaguchi, M., Downie, A., Sato, S., Tabata, S., Kouchi, H.,
Parniske, M., Kawasaki, S., and Stougaard, J. (2006). Deregulation of
a Ca2+/calmodulin-dependent kinase leads to spontaneous nodule
development. Nature 441, 1153-1156.
Turner, G.L., Gibson, A.H. (1980). Measurement of nitrogen fixation by
indirect means. In Methods for evaluation biological nitrogen fixation,
F.J. Bergersen, ed (Chichester, UK: John Wiley & Sons), pp. 111-138.
Utrup, L.J., Cary, A.J., and Norris, J.H. (1993). Five Nodulation Mutants of
White Sweetclover (Melilotus alba Desr.) Exhibit Distinct Phenotypes
Blocked at Root Hair Curling, Infection Thread Development, and
Nodule Organogenesis. Plant Physiol 103, 925-932.
Van de Velde, W., Zehirov, G., Szatmari, A., Debreczeny, M., Ishihara, H.,
Kevei, Z., Farkas, A., Mikulass, K., Nagy, A., Tiricz, H., Satiat-
Jeunemaitre, B., Alunni, B., Bourge, M., Kucho, K., Abe, M.,
Kereszt, A., Maroti, G., Uchiumi, T., Kondorosi, E., and Mergaert,
P. (2010). Plant peptides govern terminal differentiation of bacteria in
symbiosis. Science 327, 1122-1126.
Wais, R.J., Keating, D.H., and Long, S.R. (2002). Structure-function analysis
of Nod Factor-induced root hair calcium spiking in Rhizobium-legume
symbiosis. Plant Physiol 129, 211-224.
Wais, R.J., Galera, C., Oldroyd, G., Catoira, R., Penmetsa, R.V., Cook, D.,
Gough, C., Dénarié, J., and Long, S.R. (2000). Genetic analysis of
108
calcium spiking responses in nodulation mutants of Medicago
truncatula. Proc Natl Acad Sci U S A 97, 13407-13412.
Wang, D., Griffitts, J., Starker, C., Fedorova, E., Limpens, E., Ivanov, S.,
Bisseling, T., and Long, S. (2010). A nodule-specific protein secretory
pathway required for nitrogen-fixing symbiosis. Science 327, 1126-
1129.
Watarai, M., Makino, S., Fujii, Y., Okamoto, K., and Shirahata, T. (2002).
Modulation of Brucella-induced macropinocytosis by lipid rafts
mediates intracellular replication. Cell Microbiol 4, 341-355.
Werner, D., and Newton, W.E., (eds). (2005). Nitrogen Fixation in
Agriculture, Forestry, Ecology, and the Environment. Springer,
Dordrecht, The Netherlands, 347 pp.
Winzer, T., Bairl, A., Linder, M., Linder, D., Werner, D., and Muller, P.
(1999). A novel 53-kDa nodulin of the symbiosome membrane of
soybean nodules, controlled by Bradyrhizobium japonicum. Mol Plant
Microbe Interact 12, 218-226.
Yang, Z. (2008). Cell polarity signaling in Arabidopsis. Annu Rev Cell Dev
Biol 24, 551-575.
Yano, K., Yoshida, S., Muller, J., Singh, S., Banba, M., Vickers, K.,
Markmann, K., White, C., Schuller, B., Sato, S., Asamizu, E.,
Tabata, S., Murooka, Y., Perry, J., Wang, T.L., Kawaguchi, M.,
Imaizumi-Anraku, H., Hayashi, M., and Parniske, M. (2008).
CYCLOPS, a mediator of symbiotic intracellular accommodation. Proc
Natl Acad Sci U S A 105, 20540-20545.
Yokota, K., Fukai, E., Madsen, L.H., Jurkiewicz, A., Rueda, P., Radutoiu,
S., Held, M., Hossain, M.S., Szczyglowski, K., Morieri, G., Oldroyd,
G.E., Downie, J.A., Nielsen, M.W., Rusek, A.M., Sato, S., Tabata, S.,
James, E.K., Oyaizu, H., Sandal, N., and Stougaard, J. (2009).
109
Rearrangement of actin cytoskeleton mediates invasion of Lotus
japonicus roots by Mesorhizobium loti. Plant Cell 21, 267-284.
Yokoyama, H., Fujii, S., and Matsui, I. (2008). Crystal structure of a core
domain of stomatin from Pyrococcus horikoshii illustrates a novel
trimeric and coiled-coil fold. Journal of Molecular Biology 376, 868-
878.
Zahran, H.H. (1999). Rhizobium-legume symbiosis and nitrogen fixation
under severe conditions and in an arid climate. Microbiol Mol Biol Rev
63, 968-989, table of contents.
Zappel, N.F., and Panstruga, R. (2008). Heterogeneity and lateral
compartmentalization of plant plasma membranes. Curr Opin Plant Biol
11, 632-640.