+ All Categories
Home > Documents > The structure of DNA · The structure of DNA

The structure of DNA · The structure of DNA

Date post: 23-Jun-2020
Category:
Upload: others
View: 16 times
Download: 0 times
Share this document with a friend
28
The structure of DNA http://ghr.nlm.nih.gov/handbook/illustrations/dnastructure.jpg
Transcript
Page 1: The structure of DNA · The structure of DNA

The structure of DNA

http://ghr.nlm.nih.gov/handbook/illustrations/dnastructure.jpg

Page 2: The structure of DNA · The structure of DNA

ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA!TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTACCCCATG!CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATC!CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGG!ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACT!TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATG!ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATA!GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC!TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT!CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTC!ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT!GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT!CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA!TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTAT!GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTAC!TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCAT!CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACA!TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA!CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA!CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTT!CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGC!ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCC!ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGA!CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTC!GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGAT!ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGC!CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTG

Page 3: The structure of DNA · The structure of DNA

DNA Fingerprinting (aka Genotyping)

Page 4: The structure of DNA · The structure of DNA

The structure of DNA

5’ ! 3’!

A ! T!

T ! A!

G ! C!

C ! G!

C ! G!

G ! C!

A ! T!

T ! A!

C ! G!

G ! C!

T ! A!

T ! A!

3’ ! 5’!

http://ghr.nlm.nih.gov/handbook/illustrations/dnastructure.jpg

Page 5: The structure of DNA · The structure of DNA

5’-ATGCCGATCGTT-3’!3’-TACGGCTAGCAA-5’!

5’ ! 3’!A ! T!T ! A!G ! C!C ! G!C ! G!G ! C!A ! T!T ! A!C ! G!T ! A!T ! A!T ! A!3’ ! 5’!

Humans can differ from each other by Single Nucleotide Polymorphisms (SNPs)

Human #1

Page 6: The structure of DNA · The structure of DNA

5’-ATGCCGATCGTT-3’!3’-TACGGCTAGCAA-5’!

5’ ! 3’!A ! T!T ! A!G ! C!C ! G!C ! G!G ! C!A ! T!T ! A!C ! G!T ! A!T ! A!T ! A!3’ ! 5’!

Humans can differ from each other by Single Nucleotide Polymorphisms (SNPs)

Human #1 Human #2

5’-ATGCCAATCGTT-3’!3’-TACGGTTAGCAA-5’!

Page 7: The structure of DNA · The structure of DNA

What is DNA Fingerprinting (Genotyping) used for?

Page 8: The structure of DNA · The structure of DNA

-- Paternity Testing

-- Forensics

-- Discovering the gene that, when mutated, leads to a disease!

What is DNA Fingerprinting (Genotyping) used for?

Page 9: The structure of DNA · The structure of DNA

5’-ATGCCGATCGTT-3’!3’-TACGGCTAGCAA-5’!

5’ ! 3’!A ! T!T ! A!G ! C!C ! G!C ! G!G ! C!A ! T!T ! A!C ! G!T ! A!T ! A!T ! A!3’ ! 5’!

Humans can differ from each other by Single Nucleotide Polymorphisms (SNPs)

Human #1 Human #2

5’-ATGCCAATCGTT-3’!3’-TACGGTTAGCAA-5’!

Page 10: The structure of DNA · The structure of DNA

5’-ATGCCGTGTGTGATCGTT-3’!3’-TACGGCACACACTAGCAA-5’!

Humans can differ from each other by Simple Sequence Repeats (SSRs)

Human #1 Human #2

5’-ATGCCGTGTGTGTGTGATCGTT-3’!3’-TACGGCACACACACACTAGCAA-5’!

Page 11: The structure of DNA · The structure of DNA

5’-ATGCCGTGTGTGATCGTT-3’!3’-TACGGCACACACTAGCAA-5’!

Humans can differ from each other by Simple Sequence Repeats (SSRs)

Human #1 Human #2

5’-ATGCCGTGTGTGTGTGATCGTT-3’!3’-TACGGCACACACACACTAGCAA-5’!

one DNA that is 22 nucleotides long one DNA that is 18 nucleotides long

Page 12: The structure of DNA · The structure of DNA

Gel Electrophoresis

-- A technique that allows pieces of DNA to be separated by size

-- A gel is a matrix that molecules can move through

-- DNA is negatively charged

Page 13: The structure of DNA · The structure of DNA

PCR - a way to copy one area of the DNA

Page 14: The structure of DNA · The structure of DNA

PCR - a way to copy one area of the DNA

Page 15: The structure of DNA · The structure of DNA

Using Gel Electrophoresis for Fingerprinting

1) Isolate the DNA from a person

2) Make copies of just the one region of DNA you want to study

3) Run the DNA through a gel

Page 16: The structure of DNA · The structure of DNA

Gel Electrophoresis

24 nt

10 nt

1 2 3

20 nt

ladder

Page 17: The structure of DNA · The structure of DNA

CCAGTACCTCCTCCTACGGA CCAGTACCTACGGA

Half my DNA is from mom and half is from dad

Page 18: The structure of DNA · The structure of DNA

Can these people be my parents?

Me “Mom” “Dad”

Are these my parents?

24 nt

10 nt

20 nt

ladder

Page 19: The structure of DNA · The structure of DNA

A mix up between 3 babies and 3 sets of parents

-- 3 babies in a maternity ward: A, B, C

-- 3 couples: Mom #1 & Dad #1 Mom #2 & Dad #2 Mom #3 & Dad #3

Page 20: The structure of DNA · The structure of DNA

A specific region of chromosome #15

5’…GCTAAGTATTGCTCAAGA…(TTAGGAT)n…GATAAATAACTGGCTAGTA…–3’ 3’…CGATTCATAACGAGTTCT…(AATCCTA)n…CTATTTATTGACCGATCAT…–5’

Page 21: The structure of DNA · The structure of DNA

n = 50

n = 45

n = 40

n = 35

n = 30

n = 25

n = 20

Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC

Examining a region of chromosome #15

Page 22: The structure of DNA · The structure of DNA

Questions to Answer

-- Given the data so far, which of the three babies can you already conclusively connect to a set of parents?

-- How did you conclude this?

-- Why can you not determine the parents of all of the babies at this point?

-- How do you think you would go about conclusively determining the parents of the remaining babies using DNA fingerprinting analysis?

Page 23: The structure of DNA · The structure of DNA

n = 50

n = 45

n = 40

n = 35

n = 30

n = 25

n = 20

Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC

Examining a region of chromosome #15

Page 24: The structure of DNA · The structure of DNA

A specific region of chromosome #4

5’…ACTGTAAACGCTAGCTGGTTCACTG…(CAG)n…CCTATAGCTAGCTTTACGGA…–3’ 3’…TGACATTTGCGATCGACCAAGTGAC…(GTC)n…GGATATCGATCGAAATGCCT…–5’

Page 25: The structure of DNA · The structure of DNA

n = 90

n = 80

n = 70

n = 60

n = 50

n = 40

n = 30

Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC

Examining a region of chromosome #4

Page 26: The structure of DNA · The structure of DNA

Questions to Answer

-- Given all the data in this problem, match the three sets of parents to the three babies.

-- Explain how this site on chromosome #4 allowed you to match parents #1 and parents #2 to the correct baby (B or C).

Page 27: The structure of DNA · The structure of DNA

Examining a region of chromosome #4

n = 90

n = 80

n = 70

n = 60

n = 50

n = 40

n = 30

Ladder dad#1 mom#1 dad#2 mom#2 dad#3 mom#3 BabyA BabyB BabyC

Page 28: The structure of DNA · The structure of DNA

Whose DNA was found at the crime scene?


Recommended