doi:10.1016/j.jmb.2005.06.025 J. Mol. Biol. (2005) 351, 923–935

The Structure of Sif2p, aWDRepeat Protein Functioningin the SET3 Corepressor Complex

David Cerna and David K. Wilson*

Section of Molecular andCellular Biology, University ofCalifornia, Davis, CA 95616USA

0022-2836/$ - see front matter q 2005 E

Abbreviations used: HAT, histoneHDAC, histone deacetylase; N-CoRcorepressor; SET3C, Set3p complexmediator for retinoid and thyroid remean-square deviation; TBL1, transTBLR1, TBL1-related protein; MADdispersion; DLS, dynamic light-scatthione-S-transferase.E-mail address of the correspond

dave@alanine.ucdavis.edu

In Saccharomyces cerevisiae, the SIF2 gene product is an integral componentof the Set3 complex (SET3C), an assembly of proteins with some homologyto the human SMRTand N-CoR corepressor complexes. SET3C has histonedeacetylase activity that is responsible for repressing a set of meiotic genes.We have determined the X-ray crystal structure of a 46 kDa C-terminaldomain of a SET3C core protein, Sif2p to 1.55 A resolution and acrystallographic R-factor of 19.0%. This domain contains an unusualeight-bladed b-propeller structure, which differs from other transcriptionalcorepressor structures such as yeast Tup1p and human groucho (Gro)/TLE1, which have only seven. We have demonstrated intact Sif2p is atetramer and the N-terminal LisH (Lis-homology)-containing domainmediates tetramerization and interaction with another component ofSET3C, Snt1p. Multiple sequence alignments indicate that a surface on the“top” of the protein is conserved among species, suggesting that it mayplay a common role in binding partner proteins. Since Sif2p appears to bethe yeast homolog of human TBL1 and TBLR1, which function in theN-CoR/SMRT complexes, its structural and oligomeric properties arelikely to be very similar.

q 2005 Elsevier Ltd. All rights reserved.

Keywords: crystal structure; corepressor; WD repeat; protein–proteininteraction

*Corresponding author

Introduction

During cell growth and proliferation, the nuclearreceptor family regulates gene expression bysequence-specific binding of target genes andspecific ligand binding. Receptors, bound orunbound to ligands or hormones, modulate thefunction of transcription factors, which activate orrepress critical developmental, physiological, andmetabolic processes. These proteins translate thepresence of hormones such as steroids, retinoids,thyroid hormones, and vitamin D3 into modulationof transcriptional activity. Often, the effects ontranscriptional activity are a result of histone

lsevier Ltd. All rights reserve

acetyl transferase;, nuclear receptor; SMRT, silencingceptors; r.m.s.d., root-ducin b-like protein 1;, multiple anomaloustering; GST, gluta-

ing author:

modification through histone acetyltransferase(HAT) or histone deacetylase (HDAC) activitiesassociated with the corepressor complex.1–3 Manyhuman disorders can result from improperlyregulated transcriptional activity.In S. cerevisiae, the Set3 complex (SET3C) has been

found to function as a meiotic-specific repressor ofearly/middle sporulation genes by controllingexpression of the meiotic regulators Ime2p andNdt80p.4 The complex derives its name from a coreprotein, Set3p which contains a conserved SETmotif. This motif is common in proteins involved inhistone modification and was originally identifiedin three Drosophila genes: position effect variegationsuppressor Su(Var)3-9, Enhancer of zeste andTrithorax.5–7 Copurification experiments of taggedproteins have yielded a model of SET3C involvingthe proteins Set3p, Sif2p, Snt1p, YIL112w, Cpr1p,and two histone deacetylases, Hos2p and Hst1p.4

The most similar human complex appears to be thesilencing mediator for retinoid and thyroid receptor(SMRT).4 The SET3C and SMRT complexes haveelements in common such as proteins containingSANT domains, histone deacetylase activities, andparticipation of WD repeat-containing proteins.

d.

924 The Crystal Structure of Sif2p

Studies of S. cerevisiae SET3C proteins can thereforeyield insights into the function of this and otherhuman corepressor complexes such as N-CoR, thenuclear receptor corepressor.

Sif2p (Sir4p Interacting Factor) is a 59 kDa WDrepeat protein that functions as an integral scaffoldfor SET3C formation. Since Sif2p possesses hom-ology to the human SMRT components TBL1 andTBLR1, which are known to bind histones, a similarfunction is implied.4,8–10 This sequence homologyextends from the N-terminal region, which containsa Lissencephaly type-1 homology motif (LisHdomain) through the C-terminal region containingtandem WD repeats. LisH domains have beenshown to function in protein dimerization.11,12

Tandem WD repeats are generally known tocombine to form specific protein-binding domains.TBL1 interacts with N-CoR and SMRT, while TBLR1is known to associate with N-CoR.8,10,13 Theseproteins have been shown to bind histones H2Band H4, putatively providing substrate recognitionfor the complex.10

In Xenopus oocytes, unliganded thyroid hormonereceptor (TR) interacts with TBLR1 and recruits thecomplex to chromosomal T3 targets, and exhibitshistone deacetylation and gene repression activity.14

Disruption of the N-CoR/SMRT–TBLR1 complexesinhibited gene repression by the unliganded TR, istherefore strong evidence for the role of N-CoR/SMRT–TBLR1 complex in development. Recently,the exclusive function of TBL1 and TBLR1 ascorepressors has been questioned, since TBL1 ispresent in complexes of the estrogen receptor andthe androgen receptor that lead to transcriptionalactivation.15 TBL1 has been suggested to function inactivated nuclear receptor turnover by mediatingthe degradation of the nuclear receptors in a ligand-dependent manner. In the same study, TBLR1functions in nuclear receptor activation by mediat-ing the exchange of N-CoR/SMRT corepressors forcoactivator complexes by targeting the corepressorfor degradation by the proteasome.16

C-terminal regions of Sif2p, TBL1, and TBLR1have been reported to contain a domain composedof various numbers of tandem WD repeats. WDrepeats (known also as WD40 or b-transducinrepeats) are divergent sequences of approximately40 amino acid residues with a Trp-Asp dipeptidethat is sometimes found at the C-terminal end.Structurally, they fold into a four-stranded b sheetsubstructure resembling a propeller blade. Tandemcopies of a WD repeat then generate a multi-bladedpropeller structure. Members of the WD proteinsuperfamily appear almost exclusively ineukaryotes and are involved in such diversemechanisms as signal transduction, RNA splicing,RNA degradation, cytoskeletal dynamics, nuclearexport, chromosomal modification, and transcrip-tional regulation.17–20 Although their physiologicalroles are dissimilar, most function by facilitatingprotein–protein interactions in multicomponentprotein complexes. Protein–protein interactionswith WD repeat proteins are usually mediated by

contacts with the variable regions composed of thetop and, to a lesser extent, sides of the protein(described below). Members of the WD proteinfamily have been found to vary in the number ofidentifiable WD sequences from four to 16 copies.20

Identification of the repeats is often complicated bya low level of sequence homology and sequenceinsertions, making the determination of the numberof WD repeats difficult. Crystal structures haverevealed the presence of extra repeats not predictedby current algorithms. Examples of “missing”repeats are found in the recent structures ofAip1p, Bub3p, Groucho and Ski8p, in which five,three, one and two missing repeats are revealed,respectively.18,21–23 In all cases to date, WD domainsare composed of seven or rarely, six or eight repeats,which is consistent with the prediction that sevenblades are preferred in these structures.24

The crystal structure of Sif2p is important inunderstanding its role in transcriptional repression.It offers clues to the function of its human homologsTBL1 and TBLR1 and the mutations or deletions inTBL1 that have been observed in X-linked ocularalbinism/late-onset sensorineural deafness.25 TheN-terminal LisH domain, while not present inthe structure, has been functionally characterized.The results demonstrate that the protein is com-posed of a LisH tetramerization domain that isresponsible for interacting with the SET3C com-ponent Snt1p and a C-terminal domain consistingof eight WD repeats.

Results

Overall structure

Initial purification of full-length Sif2p was doneusing the IMPACT system (New England Biolabs)and yielded approximately 0.5 mg of pure proteinper liter of culture. Crystallization of Sif2p typicallytook three months and SDS/polyacrylamide gels ofdissolved crystals indicated a discrete 46 kDa bandrather than the expected 59 kDa protein, suggestinga slow but specific cleavage. The predominantpeaks from N-terminal sequencing correspondedto the sequence SESNKA, which matched aminoacid residues 113–118 in the full-length primarysequence of Sif2p. These initial crystals were thenderivatized with thimerosal and used for multipleanomalous dispersion (MAD) phasing. Interpret-ation of the map showed the protein folded into aneight-bladed b-propeller corresponding to the eightWD repeats (Figure 1). Crystallographic refinementyielded amodel of the mercury-derivatized protein,which had an Rcryst of 0.20 and an Rfree of 0.24 at2.4 A resolution.

The final refinement of the wild-type proteinstructure was done with 1.55 A data collected froman expressed truncated form of the proteincomposed of amino acid residues 113 through 535(Sif2p113–535), which formed isomorphous crystalsof much higher quality. The final conventional Rcryst

Figure 1. Stereo view of the C-terminal domain of S. cerevisiae Sif2p (a) looking down the central axis of the eight WDblades at the “top” surface. The N and C termini are labeled. Main-chain disordered regions are marked by the lasttraceable residue number with black spheres. (b) Rotated 908 on the x-axis relative to the previous orientation. These arecolored progressing from blue at the N terminus to red at the C terminus. This Figure was generated withMOLSCRIPT47

and Raster3D.48

The Crystal Structure of Sif2p 925

for the high-resolution dataset was 0.190 and Rfree

was 0.203 (Table 1). The model begins at residue 146and ends at residue 535. There are four internaldisordered regions located at residues 191–196,213–219, 303–317, and 477–490. Although they arepresent in the protein, no interpretable electrondensity was observed for the N-terminal residues113–145. The Sif2p113–535 WD domain is approxi-mately 47 A wide and 28 A in thickness, giving it adisk-like shape. The central cavity has a volume of34 A3 as calculated using GRASP.26 All residues liein the most-favored or additionally allowed regionsof the Ramachandran plot as determined by theprogram PROCHECK.27

The eight WD repeat motifs within Sif2p113–535

each generate a blade-like, four-stranded, anti-parallel b-sheet as seen in other WD proteinstructures. By convention, each strand is labeled Athrough D starting with the A strand as theinnermost of each blade. The order of the strandsin the WD repeat sequence is D-A-B-C, such thatone sequence repeat composes the D strand of oneblade and the A, B and C strand of the succeedingblade. The D strand serves also to close thepropeller with the N-terminal D strand cappingthe final blade to stabilize the closed structure

(Figure 1). The four disordered regions in thestructure occur in loops: (1) the junction betweenstrand C of repeat 1 and strand D of repeat 2; (2) theD-A loop in repeat 2; (3) the D-A loop of repeat 4;and (4) the C-D junction between repeats 7 and 8.These blades are arranged around a pseudo-8-

fold axis with a central pore filled with orderedsolvent molecules and a sulfate ion that may havebeen retained from purification. The “top” of thepropeller has been defined as the surface composedof the D-A and B-C loops, and has been found toparticipate in partner protein binding in other WDproteins.28,29 Each of the eight blades is structurallysimilar to the others with an r.m.s.d. ranging from0.36 A to 1.09 A when superimposing each bladeonto blade 5. Blade 5 of Sif2p superimposes onblade 4 of Gb, a representative structure, with anr.m.s.d. of 0.62 A (Figure 2(a)). All eight of the Sif2pblades are therefore composed of structurallyauthentic WD repeats.The WD repeat length varies from 38 in the

smallest repeat to 56 residues at the largest. Thegreatest source of variability in these repeats is dueto the insertions in the loops connecting the strandsand not in the b-strands themselves, whichcompose the core of the protein. Prior to the

Table 1. Final data collection, phasing and refinement statistic

Native Sif2 p113–535Thimerosal (peak)

lZ1.003 AThimerosal (remote)

lZ1.530 AThimerosal (inflection)

LZ1.008 A

A. Data collectionResolution (A) 30–1.55 (1.58–1.55) 29–2.4 (2.46–2.4) 29–2.4 (2.46–2.4) 29–2.4 (2.46–2.4)Unique observations 77,807 20,578 20,507 2052Total observations 288,212 152,469 149,519 151,690Completeness (%) 99.9 (99.8) 98.9 (88.4) 98.3 (84.1) 98.6 (86.1)Rsym

a 0.041 (0.358) 0.109 (0.322) 0.108 (0.325) 0.125 (0.428)hI/si 26.5 (3.17) 11.3 (2.2) 12.3 (2.2) 9.71 (2.1)

B. PhasingNo. sites 2Figure of merit 0.57 (29–2.8 A)

C. RefinementResolution (A) 30–1.55No. reflections 75,148Rcryst

b 0.190Rfree (5% omitted) 0.203No. protein, non-hydrogen atoms

2726

No. water molecules 305No. sulfate atoms 10

r.m.s.d. from idealBond lengths (A) 0.004Bond angles (deg.) 1.4

Average B-value (A2)Main chain 14.7Side chain 17.4

Values in parentheses are for the highest-resolution shells: 1.58–1.55 A for native Sif2p.a RsymZSjIobsKIavgj/SIobs.b RcrystZSjFobsKFcalcj/SFobs.

926 The Crystal Structure of Sif2p

structure determination, seven of the eight WDrepeats had been predicted.4 The current version ofSwiss-Prot (version 47.1) identifies all but theeighth. Structural alignments of the eighth repeatwith the others (Figure 2(a)) generated a plausiblesequence alignment (Figure 2(b)). The inter-bladecontacts are typical for WD proteins, consistingprimarily of interlocking hydrophobic interactions.Surface representations of the electrostatic potentialof the both top and bottom surface of the C terminusof Sif2 are predominantly negatively-charged withscattered positively charged residues. The solvent-filled center channel is also negatively charged, andis lined with the residues Asp323, Glu325, Glu366,and Asp511.

Sequence comparisons and the protein-bindingsurface

Sequence comparisons using CLUSTAL W indi-cate full-length Sif2p shares sequence homologyover the entire length of the protein with at least 11different known or putative co-repressors fromCandida glabrata (Q6FLZ9), Ashbya gossypii(Q75B92), Kluyveromyces lactis (Q6CNM9), Homosapiens (O60907, Q9BQ87, and Q9BZK7), Musmusculus (Q9QXE7 and Q8BHJ5), Xenopus(Q7SZM9, Q6GPC6) and a partial sequence fromthe Anopheles gambiae sequencing project (Q7Q371)(Figure 3(a); and Supplementary Data).30 A veryhigh level of sequence homology is observed in the

N-terminal region (residues 1–67), which includesthe LisH domain (residues 3–36 in Sif2p) then fallsoff sharply until the beginning of the WD domain atresidue 146, suggesting a variable linker region.Many of the identical residues lay in the structuralcore of the WD domain, suggesting they areresponsible for proper folding and/or stability.However, there are continuous surface patches ofresidues that are conserved on the top and side ofthe protein that may be used to interact with acomplex in a similar manner (Figure 3(b)). Thesepatches are not as apparent when conservedsequences on the bottom are examined (Figure 3(c)).A similar analysis of the Tup1p corepressor proteinimplicates the top of the propeller in protein–protein interaction.31 Various experiments andanalyses of a number of other functionallyunrelated WD proteins suggest that the top and/or sides of the protein form the partner binding site.

Sif2p structural neighbors

Sif2p is the first eight-bladed WD repeatcorepressor component protein to be described.This result was surprising, since the corepressorsTup1p and Groucho are composed of seven blades,and Sif2p was predicted to contain seven blades aswell. Sif2p is similar to these proteins with respectto tetramerization properties that utilize anN-terminal tetramerization domain. Interestingly,Cdc4, a functionally unrelated component of a

Figure 2. Structural and sequenceconservation in Sif2p WD repeats.(a) Stereo view of all eight main-chain residues aligned with blade 5.Repeats are colored ranging frompurple for repeat 1 to red for repeat8. TheWD repeat colored in black isblade 5 from the structure of Gb.49

This Figure was generated withMOLSCRIPT47 and Raster3D.48

(b) WD repeat consensus aminoacid sequence (adapted fromSmith et al.20) aligned to the Sif2pWD repeats.

The Crystal Structure of Sif2p 927

ubiquitin ligase complex also adopts this fold and isthe nearest structural neighbor.32 The r.m.s.d.between 247 residues of Sif2p and the Cdc4 WDdomain (residues 372–744) structures are only1.78 A. A similar alignment of 297 residues betweenTup1p (residues 332–710) and Groucho (residues472–770) yields an r.m.s.d. of 1.69 A.

Oligomeric state

Full-length Sif2p possesses a LisH domain thathas been shown to mediate dimerization in otherproteins such as Lis1.12 To determine the estimatedmolecular mass of the purified Sif2p, samples wereloaded onto a Superdex 200 HR sizing column andfractions were collected. Retention times are indi-cated relative to the time of injection (Figure 4(a))Sif2p1–535 eluted at an estimated mass of 236 kDa.Two other smaller peaks were detected and wereestimated to be 117 kDa and 46 kDa. This suggeststhe presence of a tetramer, dimer, and degradedmonomer in the sample. The expressed truncationmutant Sif2p113–535 eluted at a mass of 46 kDa,indicating a monomer. Finally, Sif21–145 eluted at amass of 64 kDa, although it has a calculated mass of

16 kDa. This led to the conclusion that theN-terminal 112 amino acid residues were respon-sible for the formation of a tetramer in solution,since the C-terminal fragment Sif2p113–535 wasmonomeric.The masses of the various Sif2p fragments were

confirmed using dynamic light-scattering (DLS)experiments using the Superdex-purified fractions.The full-length Sif2p had an experimental mass of202 kDa, consistent with the calculated value of236 kDa for a tetramer. The hydrodynamic radiuswas 46.4 A and the polydispersity was 27.2 A,indicating that there was likely to be a mixture ofoligomeric states. Since the sample was purified as atetramer using gel-filtration chromatography, itappears that there is a slow equilibrium betweenthe oligomers. DLS results for Sif2p1–145 andSif2p113–535 were 66 kDa and 45.5 kDa, respectively,and were both relatively monodisperse. Based uponthe calculated mass of 16 kDa, Sif2p1–145 thereforeappears to be tetrameric and Sif2p113–535 is mono-meric. Taken together, these results demonstratethat residues contained in the region 1–113 areresponsible for tetramerization.Native and SDS gels are consistent with these

Figure 3. Conservation of sequence between Sif2 homologs. (a) A sequence alignment of Sif2, TBL1, and TBLR1 WDdomains is condensed from a large multiple sequence alignment described in the text (also see Supplementary Data).Disordered regions (described in the text) are underlined. Secondary structural elements derived from Sif2p113–535 aredesignated under the sequences. Sequence identity throughout all 12 is indicated in red, high level of homology inorange and weak level of homology in yellow. Sequences were aligned and homologies defined using CLUSTALW 1.8.30

(b) Mapping this sequence conservation (using the same color coding as in (a) and green to indicate non-conservedresidues) to the top of the propeller identifies a relatively continuous conserved region that may be involved in contactswith other corepressor components. (b) and (c) were produced using Pymol (http://pymol.sourceforge.net/). (c) Theorientation is rotated 1808 about the vertical axis relative to (b). No continuous region of sequence conservation isobserved on the bottom face of the protein.

928 The Crystal Structure of Sif2p

conclusions. To compare the full-length Sif2p toSif2p113–535, each was subjected to SDS-PAGE andmigrated according to expected mass (Figure 4(b)).The same samples were then run on native gels.Three bands were observed for full-length Sif2p,

plausibly corresponding to a monomer, dimerand tetramer with the majority of the proteinmigrating as a tetramer (Figure 4(c)). Sif2p113–535

exhibited a single band, in agreement with it being amonomer.

Figure 4. Oligomerization of Sif2p is dependent on the N-terminal LisH-containing domain. (a) Gel-filtrationchromatography shows E. coli expressed full-length Sif2p is predominantly a tetramer in solution with a mass of236 kDa. The N-terminal and C-terminal portions of Sif2p elute with a mass of 64 kDa and 46 kDa, respectively. Allsamples were run separately on a Superdex 200 column. Molecular mass standards used for calibration are shown.(b) SDS/polyacrylamide gel showing two dilutions of full-length Sif2p (lanes 1 and 2) with an apparent molecular massof w59 kDa and the C-terminal portion (two dilutions shown in lanes 3 and 4) with an apparent molecular mass ofw43 kDa. Molecular mass standards are labeled in lane 5. (c) A native 8–25% PAGE gel shows full-length Sif2p hasdifferent oligomeric states as a monomer, dimer and tetramer (lane 1). Sif2113–535 runs as a monomer in lane 2.

The Crystal Structure of Sif2p 929

Interactions between Sif2p and Snt1p

Glutathione-S-transferase (GST) pulldownexperiments were used to determine whichregion of Sif2p was responsible for the inter-action with Snt1p. Plasmids were designed toexpress GST fusions with the full-length Sif2p,Sif2p1–145, and the WD domain found in thestructure (Sif2p145–535). Full-length Snt1p(138 kDa) fused to an HA3 tag was also co-expressed under the GAL1 promoter (Figure 5(a)).All protein fragments were expressed in yeastwhen induced with galactose (Figure 5(b)).Repeated Western blots of the GST pulldownexperiments demonstrated that the Snt1p-HA3interacted with GST-Sif2 (full-length) and theLisH-containing GST-Sif2p1–145 (Figure 5(c)). Thisshows that the fragment 1–145 is necessary forSnt1p interaction but does not exclude thepossibility that the WD domain potentiatesbinding.

Discussion

Sif2p sequence homologs

Sequence identities between Sif2p113–535 andTBL1 and TBLR1 are 24% and 25%, respectively,over the WD domain. The structures of TBL1 andTBLR1 have not been determined, so the structureof Sif2p is the most plausible model for the study ofits human homologs in yeast. When aligned withthe human homologs TBL1 and TBLR1, thesequence of Sif2p113–535 indicates that both areeight-bladed propellers as well (Figure 3(a)). Thereare some divergences, however. Sif2p113–535 hasthree loops inserted at positions 195–201 (the D1strand), 307–321 (the D3-A4 loop), and 476–495 (theC7-D7 loop). Similarly, TBL1 and TBLR1 have fiveresidues inserted in the D8-A1 loop and tenresidues that appear in the AB loop in repeat 6.Some of these may affect specificity, since D-A loops

Figure 5. Snt1p interacts with the Sif2p N-terminal LisH domain. (a) Schematics of the constructs used. All expressionwas controlled by the GAL1 promoter. pJN58 and pYES3C/T contain the LEU and TRP nutrient marker respectively.(b) Western blot analysis of expression of Snt1-HA and GST fused Sif2 constructs. Whole cell extracts (20 mg, 1% of inputused for pull-down assay) was separated by SDS-PAGE and probed with anti-HA and anti-GST antibodies. Expressionof Snt1-HAwas in all lanes except for the wild type CRY1 cell lysates (lane 6). Lysates in lanes 1–4 have the pYES/Snt1plasmid and the plasmid indicated at the top of the blot. The presence of each construct is indicated by triangles on theleft. Mock (lane 5) is yeast lysates from cells with the pYES/Snt1 vector only. (c) N-terminal Sif2p interacts with Snt1p.Western blot analysis using anti-HA (Snt1-HA) and anti-GST anti-bodies for GST pull-down of 2 mg extracts from theyeast lysates with pYES/Snt1 and various GST-Sif2p constructs indicated at the top. Mock is the yeast cell extractscontaining only pYES/Snt1p incubated with glutathione-Sepharose beads. The results are representative of threeseparate experiments.

930 The Crystal Structure of Sif2p

and D strands are mainly responsible for partnerprotein binding in other WD proteins. Mapping thesequence homology found between Sif2p and 11other proteins, including TBL1 and TBLR1,revealed a convincing contiguous surface areaover the top of the protein that may be involvedin protein–protein interactions (Figure 3(b) and (c))as was done for Tup1p.31

N-terminal domain of Sif2p

The N-terminal region of Sif2p contains a LisHdomain that has been found to function in

dimerization in the Lis1 protein, suggesting thatSif2p also was a dimer.11,12 Copurification experi-ments showed that Sif2p stoichiometry wasapproximately twice that of most of the othercomponents, which suggested a dimer but did notexclude the possibility of a tetramer.4 On the otherhand, the nearest functional homologs, Tup1p andhTLE1, had been shown to be tetramers.22,31

Pijnappel et al. have noted that the Sif2p/Snt1pcomplex may form a “tetrameric chromatin inter-action module” for SET3C.4 Gel-filtration chroma-tography and dynamic light-scattering experimentson intact Sif2p, the N-terminal fragment (Sif2p1–145)

The Crystal Structure of Sif2p 931

and the C-terminal fragment (Sif2p113–535) consist-ently indicate that the protein is tetrameric and theN-terminal LisH domain of Sif2p is responsible forthis. A recent purification of a shorter construct ofthe N terminus (Sif2p1–112) demonstrates tetramer-ization, on the basis of size-exclusion chromato-graphy and DLS analysis (Erin Chew, unpublisheddata). The region between residues 113 and 145 cantherefore be excluded for tetramer formation and itis the segment 1–112 that forms the tetramer. Sincethe LisH domain occupies residues 3–36, it ispossible that it mediates a dimeric interface andresidues outside of this domain lead to theformation of a dimer of dimers.

These characteristics of the N-terminal domain ofSif2p are similar to those found in the N-terminaldomains of Tup1p33 and Groucho,34 despite acomplete lack of sequence homology. Jabet et al.showed that the N-terminal domain is primarilyhelical in structure and forms a stable tetrameriza-tion domain, the Tup1p coiled coil domain.33 Thearrangement of four Tup1p for every one Ssn6pforms a repression complex. However, no sequencehomology is observed between the N termini ofTup1p or Groucho when compared to Sif2p. TheLisH domain is present in TBL1 and TBLR1, andmay fulfil a function in the tetramerization of theseproteins. Whether this oligomerization is requiredfor formation of stable SMRT/N-CoR complexes isunknown.

Sif2p function

Sif2p involvement in SET3C may be similar toTBL1 and TBLR1 components in the N-CoR andSMRT complexes.8,9,13 All three complexes (SET3C,N-CoR, and SMRT) share histone deacetylaseactivity (HDAC3 in humans and Hst1p andHos2p in yeast), and have other homologouscomponents. Yoon et al. have recently describedinteractions of the N termini of TBL1 and TLBR1with core histones using HeLa nuclear extracts andwhole-cell extracts.10 Similar results have beenobtained with N termini of Groucho and Tup1p.34,35

Experiments attempting to measure Sif2p bindingto histone tails were unsuccessful, however (datanot shown). This could suggest that histoneinteractions might require more than just the tailsin the case of Sif2p or that one of the other proteinsin SET3C is responsible for this interaction.

Interactions between residues 1 and 225 of N-CoRto TBL1 (1–142) have been characterized by twogroups.8,13 Zhang et al. showed binding of GPS2(G-protein pathway suppressor 2) to the same TBL1N-terminal domain that might provide an alterna-tive mechanism for receptor-mediated signaling.When these experiments were repeated by Yoonet al. using fragments of N-CoR, they found thatregion 1496–1965 also interacted with the TBL1/TBLR1 WD domain in vitro.10 Thus, the N-CoRinteracts with TBL1 and TBLR1 using both theN-terminal segment and the WD domain of theproteins. In addition, they identified a WD binding

domain as the fourth repression domain in N-CoR,which partially blocked repression activity byco-expression of TBL1/TBLR1 of the WD repeatdomain.Hypothesizing that the interactions found in

N-CoR are analogous to those found in the yeastcomplex, we attempted to detect interactionsbetween the N terminus and the C terminus ofSif2p with Snt1p. Pijnappel et al. have describedcopurification of Snt1p with Sif2p in a DSET3 strainthat have determined that the two proteins interactdirectly.4 After overexpressing these two proteins, itwas surprising to find that Snt1p bound to theN-terminal fragment and not the C-terminal frag-ment of Sif2p. This is in contrast to the humanhomolog, which binds N-CoR using both the WDand N-terminal domains. It would be of interest toanalyze fragments of Snt1p. Although both theN-terminal domain and the C-terminal WD domainare sufficient for interactions with N-CoR, studieshave shown that only the N-terminal domainTBL1/TBLR1, through a GAL4 DNA-bindingdomain fusion protein, is capable of repressingtranscription in mammals and in Xenopus.10 Thesestudies have not been performed on any of theSET3C components.

Experimental procedures

Yeast strain

The CRY1 yeast strain was used with the genotypeMATa can1-100 ade2-1 trp1-1 leu2-3,112 his3-11,15 ura3-1.Yeast media, growth conditions, stock solutions, andmolecular techniques were as described.36,37

SIF2 cloning

Full-length Sif2p (residues 1–535) was expressedinitially as an intein-chitin binding domain fusion proteinusing the IMPACT system according to the manu-facturer’s instructions (New England Biolabs). SIF2 wasamplified using VENT polymerase (New EnglandBiolabs), yeast genomic DNA as a template and the SIF2forward primer 5 0-GCTAGTGCATATGAGTATAACAAGTGAAGA (NdeI site underlined) and the SIF2reverse primer 5 0-ACTGCCCGGGTATGGCTACAACTGAACCTTC (SmaI site underlined). The N-terminaldomain (Sif21–145) was similarly amplified using theSIF2 forward primer and 5 0-ATATCCCGGGGTCTAGGTCATCACTACTGTCAATAGAATTAG (SmaI site under-lined). The C-terminal fragment of Sif2p (Sif2113–535) wasgenerated using primers 5 0 CTAGTGCATATGTCCGAGAGTAATAAAGCAGGTGAAGATGGCGC3 0 and theSIF2 reverse primer. The resulting fragments wereinserted into the pTYB2 vector for expression inEscherichia coli (New England Biolabs).

Purification and crystallization of E. coli expressedSif2p

All constructs were expressed in E. coli. BL21-Codon-Plus (Stratagene) cells by growing to anA600 of 0.5 at 37 8Cin LB and then incubating for 30 minutes at 15 8C and

932 The Crystal Structure of Sif2p

inducing with 1 mM IPTG for 12 hours. Cells were lysedby two passes through a microfluidizer (Microfluidics,Inc.) at 15,000 psi (1 psi z6.9 kPa) in binding buffer(500 mM NaCl, 20 mM Tris–HCl (pH 8.0), 0.1% (v/v)Triton X-100) and clarified by centrifugation for30 minutes at 39,000g and 4 8C. Lysates were loaded ontoa chitin column and washed extensively with bindingbuffer. Triton X-100 was removed from the column byflushing with binding buffer without Triton X-100.Theprotein was cleaved off the column by an overnightincubation in binding buffer containing 100 mMb-mercaptoethanol. Intein binding and elution were allperformed at 4 8C. Sif2p was eluted after incubation andconcentrated to 16 mg/ml in 10 mM Hepes (pH 7.2).Further purification of full-length and Sif2p113–535 wasaccomplished on a 1.46 ml Poros HQ anion-exchangecolumn in 50 mM Bis-Tris–propane (pH.6.0) and elutedwith a 0.0–1.5 M NaCl gradient. Samples were concen-trated by ultrafiltration to 12–16 mg/ml.Crystals grew over a well containing 100 mM Mes

(pH 6.5), 0.2 M ammonium sulfate and 30% (w/v) PEGmonomethylether 5000 with wild-type Sif2p at 23 8C bythe hanging-drop method with equal volumes ofprecipitant and protein solution. After two months,hexagonal crystals appeared and reached a maximumsize of 300 mm!50 mm!50 mm. Crystals harvested fromdrops were subjected to SDS PAGE, which revealedthat Sif2p had been cleaved, as a band shift from 59 kDato w43 kDa was apparent. Crystals were washed inwell buffer, dissolved in 10 mM Tris–HCl (pH 7.7)then sequenced at the UC Davis Protein StructureFacility.

Data collection, phasing and refinement

A single crystal of the cleaved Sif2p was used for MADphasing by soaking for four hours at 23 8C in motherliquor with 0.5 mM thimerosal with ethylene glycoladded to 5% (v/v). A final concentration of 10% (v/v)ethylene glycol was used as a cryoprotectant and thecrystal was flash-cooled at 110 K. Data were collected atbeamline 1–5 at Stanford Synchrotron Radiation Labora-tory (SSRL) using an ADSC CCD detector to a resolutionof 2.4 A and reduced using MOSFLM.38 The unit celldimensions were aZbZ106.9 A, cZ82.4 A, aZbZ908,and gZ1208 and the space group was P65. Assuming one43 kDa molecule in the asymmetric unit, the Matthews’coefficient is 3.16 A3 DaK1.39 SOLVE was used to locatethe mercury positions,40 and the resulting initial phaseshad a figure of merit of 0.53 to 2.8 A resolution. Thesephases were improved using the maximum-likelihood,solvent-flattening algorithm implemented in RESOLVE,giving a final figure of merit of 0.57–2.4 A.41 The model ofthe mercury-derivatized protein was built using cycles ofmanual fitting in O,42 alternating with positional andB-factor refinement in CNS.43

Sif2p113–535 crystals were grown by the hanging-drop,vapor-diffusion method, suspending a drop containing1 ml of protein solution at 12 mg/ml and 1 ml of wellsolution (100 mM cacodylate, 1.26 M ammonium acetate)over the well at 23 8C. Crystals were harvested stepwiseinto well solution containing 5%, 10% and finally 15%(v/v) glycerol before cooling in liquid nitrogen. Thenative dataset was collected at SSRL beam line 7-1 at110 K using a Mar 345 imaging plate detector to 1.55 Aand reduced using DENZO.44 The native cell dimensionswere aZbZ107.1 A, cZ82.7 A, aZbZ908, and gZ1208and the space group was P65 as before. The high-resolution native structure was determined by molecular

replacement using the program AMoRe with the mercuryderivative structure as the search model.45 The Rfree

was used to monitor the progress of model building.Water molecules were added to densities greater than 3sin FoKFc maps within appropriate hydrogen bondingdistance.

Native gel electrophoresis

Native gel electrophoresis was performed to determinethe different oligomerization states of recombinantlyexpressed Sif2p fragments. Solutions of 1 mg/ml ofSif2p1–535, and 1 mg/ml of Sif2p113–535 in buffer containing10 mM Hepes (pH 7.7), 150 mM NaCl, 1 mM DTT, wereloaded separately onto an 8–25% gradient Phast nativePAGE gel (Pharmacia).

Size-exclusion chromatography

Size-exclusion chromatography was used to estimatethe molecular mass of each of the intein-purified Sif2pconstructs. Solutions of 1 mg/ml of full-length Sif2p1–535,Sif2p1–112, and Sif2p113–535 were loaded separately onto agel-filtration chromatography column, Superdex 200 HR10/30 (Pharmacia), and eluted with 10 mM Hepes(pH 7.7), 150 mM NaCl, 1 mM DTT. Column elutionwas monitored by measuring the absorbance at 280 nm.BioRad size-exclusion molecular mass standards wereused to calibrate the sizing column.

Dynamic light-scattering analysis

As another method of estimating the oligomerizationstate of Sif2p, samples of Sif2p1–535, Sif2p1–112 andSif2p113–535 at a concentration of 1 mg/ml were examinedby dynamic light-scattering (DLS) analysis in 10 mMHepes (pH 7.7), 150 mM NaCl. DLS experiments wereperformed with a Protein Solution Dynapro 99 (ProteinSolutions, Inc.) at 20 8C. Prior to data collection, sampleswere spun for 20 minutes at 4 8C in a microcentrifuge at14,000g to remove large aggregates.

Yeast GST constructs

In order to assay the binding properties of full-length,N-terminal, and C-terminal Sif2p to Snt1p, GST yeastexpression constructs weremade. GST-Sif2pwasmade byPCR incorporation of restriction sites for cloning into theyeast expression vector pJN58. The vector pJN58 waskindly provided by Vladimir I. Bashkirov. The full-lengthconstruct contains residues 1–535 of Sif2p. The LisH andresidues (1–145) just prior to the WD domain areN-terminally fused to GST in pGST/N. The pGST-C(terminus) contains residues 145–535 (WD domain),which starts at one residue prior to the start of thecrystallographically observable residues. Finally, theSnt1p ORF was cloned into pYES3C/T (Invitrogen) andan HA3 epitope was fused to the end of Snt1p forimmunodetection (pYES/SNT1) (Figure 5(a)).The CRY1 strain was transformed with the pYES3C

vector as described.46 Transformants were selected on-Trpdrop-out plates. Once the strain was verified by Westernblot for the presence of Snt1-HA, the remaining GSTvectors were transformed into the Snt1-HA harboringstrain. Clones containing both plasmids were selected byplating on-Trp and-Leu plates.

The Crystal Structure of Sif2p 933

Purification of GST-Sif2p and interactions with Snt1p

To determine the region of Sif2p responsible forbinding to Snt1p, we employed GST purification ofSif2p and Snt1p-HA interactions in yeast lysates. TheCRY1 yeast strain containing pYES/Snt1 alone and witheach of the four pJN58 (GST only, pGST-Sif2p1–535, pGST-Sif2p1–145 and pGST-Sif2p145–535) constructs wereinoculated in 12 ml in synthetic medium with dextrose-Ura-Trp (SD-Ura-Trp) (0.17% (w/v) yeast nitrogenbase, 0.5% (w/v) ammonium sulfate, 2% (w/v) dextrose,1.4 g/l of amino acid mix without uracil and tryptophan)and grown overnight at 30 8C. These were transferred to100 ml of SD-Ura-Trp and again grown to an A600 of 2.0 at30 8C. Cultures were pelleted at 5000g and washed oncewith synthetic medium -Ura -Trp without a carbonsource. Resuspended cells were centrifuged again andresuspended in the same medium. These cells were thenused to inoculate 250 ml of SR-Ura-Trp (2% (w/v)raffinose is used instead of dextrose) medium to an A600

of 0.4.After ten hours at 30 8C, the cells reached an A600 of1.0 and were induced by the addition of 2% (w/v)galactose. The cultures were harvested by centrifugationsix hours after induction, frozen in liquid nitrogen, andstored at K80 8C. Yeast pellets were resuspended in 1:1(v/v) mixtyre of HNGT buffer (20 mM Hepes (pH 7.4),350 mM NaCl, 10% glycerol, 0.1% (v/v) Tween-20),protease inhibitors (1X protease cocktail, Roche) and1 mM phenylmethanesulfonyl fluoride (Sigma) and lysedby grinding under liquid nitrogen. Lysates were clarifiedby centrifugation, assayed by Bio-Rad protein determi-nation using bovine serum albumin as a standard andstored at K80 8C.To perform GST pull-downs, 2 mg of total cell lysate

was incubated with 30 ml of 50% (v/v) GST beadspreviously washed in HNGT buffer, and incubated forthree hours at 4 8C with slow mixing. After incubation,the beads were pelleted, transferred to a new tube andwashed four times with 1.5 ml of HNGT buffer. Finally,beads were resuspended in 30 ml of 2!SDS-PAGE bufferwith 3% (v/v) b-mercaptoethanol and subjected to SDS-PAGE (12% (w/v) polyacrylamide). After electrophoresis,gels were washed in transfer buffer (0.192 M glycine,25 mM Tris base, 20% (v/v) methanol) and Western blotanalysis was performed with anti-HA (Sigma) or anti-GST (Santa Cruz Biotechnology) as described. Westernblots were visualized using enhanced chemiluminescencereagents (ECL plus, Amersham).

Protein Data Bank accession codes

Model coordinates have been deposited in the RCSBProtein Data Bank with the accession code 1R5M.

Acknowledgements

Thanks are due to Dr Vladimir I. Bashkirov, ErinChew, Dr Walter Voegtli and an anonymous refereefor helpful discussions and suggestions. This workwas funded by NIH grant GM66135 to D.K.W. Thedata collection facilities at Stanford SynchrotronRadiation Laboratory are funded by the USDepartment of Energy and by the NationalInstitutes of Health.

Supplementary Data

Supplementary data associated with thisarticle can be found, in the online version, atdoi:10.1016/j.jmb.2005.06.025

References

1. Grozinger, C. M. & Schreiber, S. L. (2002). Deacetylaseenzymes: biological functions and the use of small-molecule inhibitors. Chem. Biol. 9, 3–16.

2. Chen, J. D. & Evans, R. M. (1995). A transcriptional co-repressor that interacts with nuclear hormonereceptors. Nature, 377, 454–457.

3. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J.,Gloss, B., Kurokawa, R. et al. (1995). Ligand-indepen-dent repression by the thyroid hormone receptormediated by a nuclear receptor co-repressor. Nature,377, 397–404.

4. Pijnappel, W. W., Schaft, D., Roguev, A., Shevchenko,A., Tekotte, H., Wilm, M. et al. (2001). The S. cerevisiaeSET3 complex includes two histone deacetylases,Hos2 and Hst1, and is a meiotic-specific repressor ofthe sporulation gene program. Genes Dev. 15,2991–3004.

5. Jones, R. S. & Gelbart, W. M. (1993). The DrosophilaPolycomb-group gene Enhancer of zeste contains aregion with sequence similarity to trithorax. Mol. Cell.Biol. 13, 6357–6366.

6. Tschiersch, B., Hofmann, A., Krauss, V., Dorn, R.,Korge, G. & Reuter, G. (1994). The protein encoded bythe Drosophila position-effect variegation suppressorgene Su(var)3-9 combines domains of antagonisticregulators of homeotic gene complexes. EMBO J. 13,3822–3831.

7. Stassen, M. J., Bailey, D., Nelson, S., Chinwalla, V. &Harte, P. J. (1995). The Drosophila trithorax proteinscontain a novel variant of the nuclear receptor typeDNA binding domain and an ancient conservedmotiffound in other chromosomal proteins. Mech. Dev. 52,209–223.

8. Guenther, M. G., Lane, W. S., Fischle, W., Verdin, E.,Lazar, M. A. & Shiekhattar, R. (2000). A core SMRTcorepressor complex containing HDAC3 and TBL1, aWD40-repeat protein linked to deafness. Genes Dev.14, 1048–1057.

9. Li, J., Wang, J., Nawaz, Z., Liu, J. M., Qin, J. &Wong, J.(2000). Both corepressor proteins SMRT and N-CoRexist in large protein complexes containing HDAC3.EMBO J. 19, 4342–5430.

10. Yoon, H. G., Chan, D. W., Huang, Z. Q., Li, J., Fondell,J. D., Qin, J. & Wong, J. (2003). Purification andfunctional characterization of the human N-CoRcomplex: the roles of HDAC3, TBL1 and TBLR1.EMBO J. 22, 1336–1346.

11. Ahn, C. & Morris, N. R. (2001). Nudf, a fungalhomolog of the human LIS1 protein, functions as adimer in vivo. J. Biol. Chem. 276, 9903–9909.

12. Kim, M. H., Cooper, D. R., Oleksy, A., Devedjiev, Y.,Derewenda, U., Reiner, O. et al. (2004). Lis1 and itsfunctional importance. Structure, 12, 987–998.

13. Zhang, J., Kalkum, M., Chait, B. T. & Roeder, R. G.(2002). The N-CoR-HDAC3 nuclear receptorcorepressor complex inhibits the JNK pathwaythrough the integral subunit GPS2. Mol. Cell. 9,611–623.

14. Tomita, A., Buchholz, D. R. & Shi, Y. B. (2004).

934 The Crystal Structure of Sif2p

Recruitment of N-CoR/SMRT-TBLR1 corepressorcomplex by unliganded thyroid hormone receptorfor gene repression during frog development. Mol.Cell. Biol. 24, 3337–3346.

15. Perissi, V., Aggarwal, A., Glass, C. K., Rose, D. W. &Rosenfeld, M. G. (2004). A corepressor/coactivatorexchange complex required for transcriptional acti-vation by nuclear receptors and other regulatedtranscription factors. Cell, 116, 511–526.

16. Hong, S. H. & Privalsky, M. L. (2000). The SMRTcorepressor is regulated by a MEK-1 kinase pathway:inhibition of corepressor function is associated withSMRT phosphorylation and nuclear export. Mol. Cell.Biol. 20, 6612–6625.

17. Neer, E. J. & Smith, T. F. (1996). G protein hetero-dimers: new structures propel new questions. Cell, 84,175–178.

18. Madrona, A. Y. & Wilson, D. K. (2004). The structureof Ski8p, a protein regulating mRNA degradation:implications for WD protein structure. Protein Sci. 13,1557–1565.

19. van Nocker, S. & Ludwig, P. (2003). The WD-repeatprotein superfamily in Arabidopsis: conservation anddivergence in structure and function. BMC Genomics,4, 50.

20. Smith, T. F., Gaitatzes, C., Saxena, K. & Neer, E. J.(1999). The WD repeat: a common architecture fordiverse functions. Trends Biochem. Sci. 24, 181–185.

21. Voegtli, W. C., Madrona, A. Y. & Wilson, D. K. (2003).The structure of Aip1p, A WD repeat protein thatregulates cofilin-mediated actin depolymerization.J. Biol. Chem. 278, 34373–34379.

22. Pickles, L. M., Roe, S. M., Hemingway, E. J., Stifani, S.& Pearl, L. H. (2002). Crystal structure of theC-terminal WD40 repeat domain of the humanGroucho/TLE1 transcriptional corepressor. Structure(Camb), 10, 751–761.

23. Wilson, D. K., Cerna, D. & Chew, E. (2005). The 1.1 Astructure of the spindle checkpoint protein Bub3preveals functional regions. J. Biol. Chem. 280, 13944–13951.

24. Murzin, A. G. (1992). Structural principles for thepropeller assembly of beta-sheets: the preference forseven-fold symmetry. Proteins: Struct. Funct. Genet. 14,191–201.

25. Bassi, M. T., Ramesar, R. S., Caciotti, B., Winship, I. M.,De Grandi, A., Riboni, M. et al. (1999). X-linked late-onset sensorineural deafness caused by a deletioninvolving OA1 and a novel gene containing WD-40repeats. Am. J. Hum. Genet. 64, 1604–1616.

26. Nicholls, A., Sharp, K. A. & Honig, B. (1991). Proteinfolding and association: insights from the interfacialand thermodynamic properties of hydrocarbons.Proteins: Struct. Funct. Genet. 11, 281–296.

27. Laskowski, R. A., MacArthur, M. W., Moss, D. S. &Thornton, J. M. (1993). PROCHECK: a program tocheck the stereochemical quality of protein structures.Appl. Crystallog. 26, 283–291.

28. Gaudet, R., Bohm, A. & Sigler, P. B. (1996). Crystalstructure at 2.4 angstroms resolution of the complex oftransducin betagamma and its regulator, phosducin.Cell, 87, 577–588.

29. Robinson, R. C., Turbedsky, K., Kaiser, D. A.,Marchand, J.-B., Higgs, H. N., Choe, S. & Pollard, T. D.(2001). Crystal structure of Arp2/3 complex. Science,294, 1679–1684.

30. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994).CLUSTALW: improving the sensitivity of progressive

multiple sequence alignment through sequenceweighting, position-specific gap penalties and weightmatrix choice. Nucl. Acids Res. 22, 4673–4680.

31. Sprague, E. R., Redd, M. J., Johnson, A. D. &Wolberger, C. (2000). Structure of the C-terminaldomain of Tup1, a corepressor of transcription inyeast. EMBO J. 19, 3016–3027.

32. Orlicky, S., Tang, X., Willems, A., Tyers, M. & Sicheri,F. (2003). Structural basis for phosphodependentsubstrate selection and orientation by the SCFCdc4ubiquitin ligase. Cell, 112, 243–256.

33. Jabet, C., Sprague, E. R., VanDemark, A. P. &Wolberger, C. (2000). Characterization of theN-terminal domain of the yeast transcriptionalrepressor Tup1. Proposal for an association model ofthe repressor complex Tup1!Ssn6. J. Biol. Chem. 275,9011–9908.

34. Flores-Saaib, R. D. & Courey, A. J. (2000). Analysis ofGroucho-histone interactions suggests mechanisticsimilarities between Groucho- and Tup1-mediatedrepression. Nucl. Acids Res. 28, 4189–4196.

35. Edmondson, D. G., Smith, M. M. & Roth, S. Y. (1996).Repression domain of the yeast global repressor Tup1interacts directly with histones H3 and H4. Genes Dev.10, 1247–1259.

36. Guthrie, C. & Fink, G. R. (1991). Guide to yeastgenetics and molecular biology.Methods Enzymol. 194,1–933.

37. Hardwick, K. G. & Murray, A. W. (1995). Mad1p, aphosphoprotein component of the spindle assemblycheckpoint in budding yeast. J. Cell. Biol. 131, 709–720.

38. Leslie, A. G. W. (1992). Recent changes to the MOSFLMpackage for processing film and image plate data. JointCCP4C ESF-EAMCB Newsletter on Protein Crystallo-graphy, vol. 26, Daresbury Laboratory, Warrington,UK.

39. Matthews, B. W. (1968). Solvent content of proteincrystals. J. Mol. Biol. 33, 491–497.

40. Terwilliger, T. C. & Berendzen, J. (1999). AutomatedMAD andMIR structure solution. Acta Crystallog. sect.D, 55, 849–861.

41. Terwilliger, T. C. (2002). Automated structuresolution, density modification and model building.Acta Crystallog. sect. D, 58, 1937–1940.

42. Jones, T. A., Zou, J. Y., Cowan, S. W. & Kjeldgaard, M.(1991). Improved methods for building proteinmodels in electron density maps and the location oferrors in these models. Acta Crystallog. sect. A, 47,110–119.

43. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W.L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998).Crystallography &NMR system: a new software suitefor macromolecular structure determination. ActaCrystallog. sect. D, 54, 905–921.

44. Otwinowski, Z. & Minor, W. (1997). Processing ofX-ray diffraction data collection in oscillation mode.Methods Enzymol. 276, 307–326.

45. Navaza, J. (2001). Implementation of molecularreplacement in AMoRe. Acta Crystallog. sect. D, 57,1367–1372.

46. Longtine, M. S., McKenzie, A., III, Demarini, D. J.,Shah, N. G., Wach, A., Brachat, A. et al. (1998).Additional modules for versatile and economicalPCR-based gene deletion and modification inSaccharomyces cerevisiae. Yeast, 14, 953–961.

47. Kraulis, P. J. (1991). MOLSCRIPT: a program toproduce both detailed and schematic plots of proteinstructures. J. Appl. Crystallog. 25, 946–950.

The Crystal Structure of Sif2p 935

48. Merritt, E. A. & Bacon, D. J. (1997). Raster3D:photorealistic molecular graphics. Methods Enzymol.277, 505–524.

49. Lambright, D. G., Sondek, J., Bohm, A., Skiba, N. P.,

Hamm, H. E. & Sigler, P. B. (1996). The 2.0 A crystalstructure of a heterotrimeric G protein. Nature, 379,311–319.

Edited by K. Morikawa

(Received 9 March 2005; received in revised form 7 June 2005; accepted 9 June 2005)Available online 7 July 2005