THE VECTOR POTENTIAL OF THE MOSQUITO AEDES KOREICUS Ciocchetta Thesis.pdf · The vector potential...

THE VECTOR POTENTIAL OF THE

MOSQUITO AEDES KOREICUS

Silvia Ciocchetta

BVSc, Masters Animal Health, Animal Farming & Animal Production

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy (PhD)

School of Biomedical Sciences

Faculty of Health

Queensland University of Technology

2018

The vector potential of the mosquito Aedes koreicus i

Keywords

Aedes koreicus, invasive mosquito species, laboratory colonisation, hatching

percentage, embryo dormancy, embryo development, fecundity index, pupae

differentiation, mosquito reproductive biology, mosquito mating biology, autogeny,

interspecific mating, mosquito sperm, competitive displacement, satyrization,

Wolbachia, fluctuating temperature, arbovirus, chikungunya, chikungunya virus

(CHIKV), vector competence, arthropod-borne disease, public health.

The vector potential of the mosquito Aedes koreicus ii

Abstract

The introduction and establishment of exotic mosquitoes have facilitated

outbreaks of arthropod-borne disease in new areas of the world. There is an urgent

need to understand the risk of disease outbreaks posed by invasive mosquitoes. Aedes

(Finlaya) koreicus [1] is an invasive mosquito species from South-East Asia recently

discovered in Europe. It has now colonised six European countries, including Italy

(Belluno province), where it was first reported in 2011. Between 2011 and 2012, Ae.

koreicus doubled its distribution in the Belluno province from 33.3% to 65.2% of

municipalities (n= 65) and increased its presence in the Treviso province from 2.1%

to 18.9 % of municipalities (n= 95). This invasive behaviour is similar to that of Aedes

albopictus, a major vector of chikungunya (CHIKV) and dengue (DENV) viruses, that

has become endemic in 22 European countries since introduction in 1991. Despite the

rapid spread and establishment of Ae. koreicus, the impact of this mosquito on native

ecosystems and public health remains unknown. This thesis provides the first detailed

insights into the biology of Ae. koreicus and its capacity to transmit CHIKV.

Field and laboratory work was conducted in Italy to evaluate trapping and

surveillance techniques for Ae. koreicus, along with the propensity of this species to

bite humans. None of the traps used returned high numbers of Ae. koreicus, either in

rural or urban settings. However, host-seeking Ae. koreicus were found to feed on

humans during late afternoon and evening.

Field-collected material was used to establish laboratory colonies of Ae.

koreicus, first in Italy, and then at QIMR Berghofer in Australia, and to confirm the

absence of the endosymbiont Wolbachia pipientis in specimens from field. Despite

few Ae. koreicus eggs (10.4 ± 2.1%) hatching and relatively long gonotrophic cycles

The vector potential of the mosquito Aedes koreicus iii

(blood-feeding to oviposition interval = 11.5 ± 3.5 days) the species proved suitable

for colonisation in the laboratory, providing an ideal opportunity to further study its

biology. Mosquitoes reared under artificial conditions were used to calculate a

fecundity-size relationship (Y = 88.51 * X – 239.6, P ˂ 0.0001, r2 = 0.6051; n=51) for

evaluating Ae. koreicus population fitness, to explore the species’ reproductive

behaviour and to determine the lack of autogeny in the colony.

The possibility of mating interference between Ae. albopictus and Ae. koreicus

was explored using a small-scale behavioural study. Ae. albopictus’ ability to disrupt

other mosquitos’ behaviours and to sterilise mosquito females of different species

through sperm transfer is well documented [2-6]. Repeated attempts of interspecific

mating of Ae. albopictus males with Ae. koreicus female were recorded, suggesting

that disruption/interference could occur in the field.

The Ae. koreicus colony proved highly suitable for laboratory-based vector

competence experiments, providing the first evidence to evaluate the risk of CHIKV

transmission by this species. The mosquitoes had high feeding rates on artificially

infected blood delivered via membranes (65.5%) and almost all (96.8%) of the colony

mosquitoes survived at day 14 post feeding. Infection rates post challenge with

CHIKV were low at two temperature regimes examined (13.8% at 23°C; 6.2% under

fluctuating temperature close to climatic conditions in the Ae. koreicus Italian range).

Dissemination of the virus to wings and legs occurred only in 6.1% mosquitoes and

only in those maintained at 23°C. Salivary infection occurred in just two of the blood

fed mosquitoes (n=129). No dissemination of the virus to the wings and legs or saliva

of mosquitoes occurred when they were maintained under fluctuating temperatures.

The vector potential of the mosquito Aedes koreicus iv

These findings deliver novel insights into the biology of Ae. koreicus and help

to elucidate the public health risk posed by this species in regards to the transmission

of arboviruses.

The vector potential of the mosquito Aedes koreicus vi

Table of Contents

Keywords .................................................................................................................................. i

Abstract .................................................................................................................................... ii

Table of Contents .................................................................................................................... vi

List of Figures ......................................................................................................................... ix

List of Tables ........................................................................................................................... xi

List of Abbreviations .............................................................................................................. xii

Statement of Original Authorship ......................................................................................... xiv

Acknowledgements ................................................................................................................ xv

Conference abstracts............................................................................................................. xvii

Publications arising from candidature .................................................................................. xvii

Publications included in this document ............................................................................... xviii

Chapter 1: Introduction ...................................................................................... 1

1.1 Background .................................................................................................................... 1

1.2 Context ........................................................................................................................... 7

1.3 Purposes ......................................................................................................................... 7

1.4 Significance, Scope and Definitions .............................................................................. 8

1.5 Thesis Outline ................................................................................................................ 9

Chapter 2: Literature review ............................................................................ 11

2.1 Introduction .................................................................................................................. 11

2.2 Major arboviruses and their public health impact ........................................................ 11

2.3 Major vectors of arboviruses and their invasive potential ........................................... 14

2.4 Invasive mosquito species in Europe ........................................................................... 16

2.5 Ae. koreicus: native range and biology ........................................................................ 20

2.6 Vector competence of Ae. koreicus .............................................................................. 20

2.7 Distinguishing Ae. koreicus from Ae. japonicus: morphological and genetic features 22

2.8 Ae. koreicus in Europe ................................................................................................. 26

2.9 Ae. koreicus monitoring: ECDC guidelines for invasive mosquito species ................. 27

2.10 Interspecies competition between invasive and native species: current knowledge .... 33

Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae.

koreicus in a variety of physiological states ........................................................... 36

3.1 Introduction .................................................................................................................. 36

3.2 Methods ........................................................................................................................ 37 3.2.1 Evaluation of the field performance of four trapping methods .......................... 37 3.2.2 Human landing ................................................................................................... 44

3.3 Results .......................................................................................................................... 46

The vector potential of the mosquito Aedes koreicus vii

3.3.1 Evaluation of the field performance of four trapping methods ..........................46 3.3.2 Human landing ...................................................................................................48

3.4 Discussion and conclusion ............................................................................................51

Chapter 4: Laboratory colonisation of Ae. koreicus ....................................... 54

4.1 Introduction ..................................................................................................................54

4.2 Methods ........................................................................................................................55 4.2.1 Effect of temperature on egg hatching and development ...................................55 4.2.2 Establishment of an Ae. koreicus colony ............................................................56 4.2.3 Egg storage and embryo development ...............................................................59 4.2.4 Sexual dimorphism in pupae ..............................................................................60 4.2.5 Fecundity-size relationship evaluation ...............................................................60 4.2.6 Data analysis .......................................................................................................62

4.3 Results and discussion ..................................................................................................63 4.3.1 Effect of temperature on egg hatching and development ...................................63 4.3.2 Establishment of an Ae. koreicus colony ............................................................64 4.3.3 Egg storage and embryo development ...............................................................65 4.3.4 Sexual dimorphism in pupae ..............................................................................66 4.3.5 Fecundity-size relationship evaluation ...............................................................67

4.4 Conclusions ..................................................................................................................68

Chapter 5: Characterisation of key aspects of Ae. koreicus mating biology 72

5.1 Introduction ..................................................................................................................72

5.2 Methods ........................................................................................................................74 5.2.1 Determination of autogeny in Ae. koreicus ........................................................74 5.2.2 Observing Ae. koreicus mating behaviour ..........................................................77 5.2.3 Preliminary observations on Ae. albopictus and Ae. koreicus mating

interaction ...........................................................................................................79 5.2.4 Wolbachia presence in field-collected Ae. koreicus ...........................................80

5.3 Results ..........................................................................................................................82 5.3.1 Lack of autogeny in Ae. koreicus .......................................................................82 5.3.2 Observing Ae. koreicus mating behaviour ..........................................................82 5.3.3 Preliminary observations of Ae. albopictus and Ae. koreicus mating

interaction ...........................................................................................................83 5.3.4 Wolbachia absent in field-collected Ae. koreicus ...............................................85

5.4 Discussion and conclusion ............................................................................................87

Chapter 6: Vector competence of Ae. koreicus for chikungunya virus ......... 92

6.1 Introduction ..................................................................................................................92

6.2 Methods ........................................................................................................................94 6.2.1 Ae. koreicus feeding through a porcine intestinal membrane with

defibrinated sheep blood.....................................................................................94 6.2.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’ ..................95

6.3 Results ..........................................................................................................................98 6.3.1 Ae. koreicus feeding through a porcine intestinal membrane with

defibrinated sheep blood.....................................................................................98 6.3.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’ ..................98

6.4 Discussion and conclusion ..........................................................................................102

Chapter 7: Concluding discussion .................................................................. 105

The vector potential of the mosquito Aedes koreicus viii

References ............................................................................................................... 112

Appendices .............................................................................................................. 138

The vector potential of the mosquito Aedes koreicus ix

List of Figures

Figure 1.1 Spread of Ae. koreicus and Ae. albopictus in Italy between 2011 and

2014 [17]. ....................................................................................................... 4

Figure 1.2 Map of municipalities infested with Ae. koreicus and Ae. albopictus

in northern Italy, 2011–2015 [19]. ................................................................. 5

Figure 1.3 Municipalities infested with Ae. koreicus, Ae. albopictus and Ae.

japonicus in northern Italy, 2017 [20]. .......................................................... 6

Figure 2.1 Distribution of invasive Aedes mosquito species in Europe and

locations and magnitude of autochthonous dengue and chikungunya

outbreaks in Europe from 2007 [133]. ......................................................... 19

Figure 2.2 Drawings of the main characteristics considered for the

identification of female Culicinae mosquito. .............................................. 24

Figure 2.3 Differences in hindtarsomere 5 patterns. .................................................. 25

Figure 2.4 The components of a New Jersey light trap.............................................. 28

Figure 2.5 The components of a Mosquito Magnet Trap. ......................................... 29

Figure 3.1 Area in Belluno province in which the evaluation of field

performance of four different trapping methods (BG-Sentinel traps

with and without CO2, Gravid Aedes Traps, and Ovitraps) was

performed. .................................................................................................... 37

Figure 3.2 Location of traps in the urban site. ........................................................... 38

Figure 3.3 Location of traps in the rural site. ............................................................. 39

Figure 3.4 BG-Sentinel trap. ...................................................................................... 40

Figure 3.5 BG-Sentinel trap baited with BG-Lure and CO2. ..................................... 41

Figure 3.6 Ovitrap. ..................................................................................................... 42

Figure 3.7 Gravid Aedes Trap. ................................................................................... 43

Figure 3.8 Human landing collection site. ................................................................. 45

Figure 3.9 Human landing collections during the day and during the night. ............. 45

Figure 3.10 Number and species of mosquitoes captured at the urban site. .............. 47

Figure 3.11 Number and species of mosquitoes captured at the rural site. ................ 48

Figure 3.12 Total number of Ae. albopictus and Ae. koreicus sampled at

different time intervals ................................................................................. 50

Figure 3.13 Mosquito species sampled at different time intervals, temperature,

and relative humidity at the sampling site. .................................................. 50

Figure 3.14 Ae. koreicus feeding on a human. ........................................................... 51

Figure 4.1 Masonite® sticks partially submerged in rainwater (IZS Belluno). .......... 56

Figure 4.2 Environmental chambers at the QIMR Berghofer Quarantine

Insectary containing Ae. koreicus colonies. ................................................. 58

The vector potential of the mosquito Aedes koreicus x

Figure 4.3 Masonite® sticks with Ae. koreicus eggs submerged in rain water. ......... 59

Figure 4.4 Ae. koreicus pupae. ................................................................................... 60

Figure 4.5 Ae. koreicus wing ...................................................................................... 61

Figure 4.6 Egg follicle development in mosquitoes [242]. ........................................ 62

Figure 4.7 Effect of temperature on the emergence of adult mosquitoes after 17

days from eggs water submersion. ............................................................... 63

Figure 4.8 Pupal development measured over 80 days of submersion across

four different trays. ...................................................................................... 64

Figure 4.9 Fully formed embryo of Ae. koreicus after egg clearing. ......................... 66

Figure 4.10 Ae. koreicus male and female genital lobe. ............................................ 67

Figure 4.11 Relationship between wing length and fecundity of Ae. koreicus. ......... 68

Figure 5.1 BugDorm® cages in the environmental chamber ...................................... 76

Figure 5.2 Egg collection tray with rain water and Masonite® sticks. ....................... 77

Figure 5.3 The environmental chamber used for the Ae. koreicus mating

experiment .................................................................................................... 79

Figure 5.4 Ae. koreicus and Ae. albopictus (a) pupae and (b) adult individuals

in Falcon® tubes. .......................................................................................... 80

Figure 5.5 Ae. koreicus sperm visible after spermatechae rupture. ............................ 83

Figure 5.6 No evidence of Ae. albopictus sperm in Ae. koreicus spermathaecae

(a) before and (b) after rupture. .................................................................... 84

Figure 5.7 Difference in size between Ae. koreicus female (left) and Ae.

albopictus male (right). ................................................................................ 84

Figure 5.8 PCR products produced by amplifying Ae. koreicus DNA with

oligonucleotide primers corresponding to Wolbachia gene wsp. ................ 85


oligonucleotide primers corresponding to Wolbachia gene 16S. ................. 86


oligonucleotide primers corresponding to the housekeeping gene

RsP17. .......................................................................................................... 87

Figure 5.11 Ae. koreicus male antennal hairs. ............................................................ 89

Figure 5.12 The reproductive system of female (in red) and male (in blue)

Aedes and the sperm transfer during copulation (represented by the

arrows) [297]. ............................................................................................... 90

Figure 6.1 Apparatus used to feed Ae. koreicus ......................................................... 95

Figure 6.2 Titres of CHIKV ‘La Reunion’ in Ae. koreicus measured three, 10,

and 14 days post-feeding in mosquitoes at 23°C and at fluctuating

temperature (75 ± 5% relative humidity, 12 hour light: 12 hour dark

cycle). ......................................................................................................... 101

The vector potential of the mosquito Aedes koreicus xi

List of Tables

Table 2.1 Comparison of adult morphological features in females of Ae.

koreicus from Belgium, Italy, the Korean peninsula and Jeju-do Island

with those of Ae. japonicus (Modified from Versteirt et al. [161]). ............ 26

Table 2.2 Efficacy of methods of collection of adult invasive mosquito species

and their eggs. .............................................................................................. 32

Table 3.1 Maximum, minimum, medium temperatures, precipitations

(measured in mm H20 per day) and wind speed (measured in m/s)

during the sampling period in Belluno ......................................................... 46

Table 3.2 Temperature measured at each time interval and the average

temperature during the five sampling days. ................................................. 49

Table 3.3 Precipitation levels (mm H20/day) and wind speed (measured in m/s)

during the sampling period in Belluno (Belluno airport meteorological

weather station, [216, 217]). ........................................................................ 49

Table 4.1 Development parameters for Ae. koreicus reared at a temperature of

23 ± 1°C ....................................................................................................... 64

Table 6.1 Daily fluctuating temperature regime under which Ae. koreicus was

maintained (75 ± 5% relative humidity, 12-hour light:12-hour dark

cycle). ........................................................................................................... 98

Table 6.2 CHIKV ‘La Reunion’ infection and dissemination to the wings/legs

and saliva in Ae. koreicus mosquitoes maintained at 23oC and

fluctuating temperature (75 ± 5% relative humidity, 12-hour light:12-

hour dark cycle). ........................................................................................ 100

The vector potential of the mosquito Aedes koreicus xii

List of Abbreviations

ARPAV Agenzia Regionale per la Prevenzione e Protezione Ambientale del

Veneto

BGS Biogents-Sentinel

CDC Centres for Disease Control and Prevention

CHIKV Chikungunya Virus

CO2 Carbon Dioxide

DENV Dengue Virus

ECDC European Centre for Disease Prevention and Control

ECSA West African, Asian and East/Central/South African

EFSA European Food Safety Authority

EIP Extrinsic Incubation Period

EtOH Ethanol

FBS Foetal Bovine Serum

GATs Gravid Aedes Traps

HCl Sodium Hypochlorite

HCL Human Landing Collection

IZSVe Istituto Zooprofilattico Sperimentale delle Venezie

JEV Japanese Encephalitis Virus

MALDI-TOF MS Matrix Assisted Laser Desorption Ionisation-time Of Flight Mass

Spectrometry

The vector potential of the mosquito Aedes koreicus xiii

MM Mosquito Magnet

PBS Phosphate-buffered Saline

PCR Polymerase Chain Reaction

PFA Paraformaldehyde

RH Relative Humidity

RRV Ross River Virus

TCID50 50% Tissue Culture Infective Dose

TMB 3,3′,5,5′-Tetramethylbenzidine Substrate System

YFV Yellow Fever Virus

ZIKV Zika Virus

The vector potential of the mosquito Aedes koreicus xiv

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the best

of my knowledge and belief, the thesis contains no material previously published or

written by another person except where due reference is made.

Signature:

Date: 04/06/2018

QUT Verified Signature

The vector potential of the mosquito Aedes koreicus xv

Acknowledgements

First and foremost, I would like to express my sincere gratitude to my

supervisors, Professor John Aaskov, Associate Professor Greg Devine, Dr. Francesca

Frentiu, and Dr. Jonathan Darbro for their guidance and support during my PhD

journey, and for their valuable time, comments, and recommendations in reviewing

my works and my thesis.

Thanks also to Dr. Leon Hugo, and Elise Kho for their assistance during the

vector competence experiments, and to all of the members of the Mosquito Control

Laboratory at QIMR Berghofer.

A special thank-you goes to Dr Natalie Prow for her time and patience in helping

me with my research project, and to the QIMR Berghofer Inflammation Biology Group

for their precious collaboration. Thanks in particular to Dr Wayne Schroder for his

encouragement and advice during my PhD candidature.

I also wish to thank Dr Gioia Capelli, Dr Fabrizio Montarsi, and all of the

members of the Diagnostic Services, Histopathology and Parasitology laboratory at

IZSVe for their time, collaboration, and friendship, and to all the member of the IZSVe

– SCT2 Belluno for their hospitality and for providing support and access to structures

and materials during my fieldwork in northern Italy.

My thanks also to IZSVe, QUT, and QIMRB for allowing me to undertake this

project and for providing my travel and research funding.

I am also grateful to Dr. Andrea Drago, from Entostudio S.r.l., for his help in

early stages of my PhD during the design of my research proposal, and for his

unconditional help and friendship.

The vector potential of the mosquito Aedes koreicus xvi

I would like to express my special gratitude to Dr. Brian Kay, former Lab Head

of the Mosquito Control Laboratory at QIMR Berghofer, for his encouragement and

help to start my PhD studies in Australia. Without his support this research journey

would never have begun.

I also thank professional editor, Kylie Morris, who provided copyediting and

proofreading services, according to university-endorsed guidelines and the Australian

Standards for editing research theses.

Thanks to all of my Italian and Australian friends, for their friendship, advice,

and help, and for sharing with me all the good moments and never abandoning me in

the hardship encountered.

Sincere and deep thanks go to Terry, who was always by my side, providing

endless support, love, and encouragement, especially during the hard times, when

difficulties seemed impossible to overcome. With all my heart, thank you.

Finally, from my heart also comes a special and earnest thanks to my parents,

Laura and Roberto, to my brother Marco, and to my grandmother Flora, for all of their

love and support, and for teaching me the strength and resilience to get through any

difficulty that I encountered. Without you, and without the love and support of my

uncles, aunties, and cousins, none of this would have been possible.

The vector potential of the mosquito Aedes koreicus xvii

Conference abstracts

Ciocchetta S, Prow NA, Darbro JM, et al. Aedes koreicus vector potential for

chikungunya virus: a threat to Europe? Poster session presented at: American Society

of Tropical Medicine and Hygiene 66th Annual Meeting; 2017 Nov 5-9; Baltimore,

Maryland USA. –conference poster presentation–

Ciocchetta S, Prow NA, Darbro JM, et al. Aedes koreicus: a new European

invader and its potential for chikungunya virus. Paper presented at: The American

Mosquito Control Association 83th Annual Meeting; 2017 Feb 13-17, San Diego,

California, USA. –conference oral presentation–

Publications arising from candidature

Ciocchetta S, Darbro JM, Frentiu FD, et al. Laboratory colonization of the

European invasive mosquito Aedes (Finlaya) koreicus. Parasit Vectors. 2017;10(1):74.

Montarsi F, Ciocchetta S, Devine G, et al. Development of Dirofilaria immitis

within the mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe.

Parasit Vectors. 2015;8(1):1-9.

Montarsi F, Drago A, Martini S, et al. Current distribution of the invasive

mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy. Parasit

Vectors. 2015;8(1):614.

The vector potential of the mosquito Aedes koreicus xviii

Publications included in this document

Ciocchetta S, Darbro JM, Frentiu FD, et al. Laboratory colonization of the

European invasive mosquito Aedes (Finlaya) koreicus. Parasit Vectors. 2017;10(1):74.

(Chapter 4) (Statement of Contribution of Co-Authors in Appendix II)

Ciocchetta S, Prow NA, Darbro JM, et al. The new European invader Aedes

(Finlaya) koreicus: A potential vector of chikungunya virus. Pathog Glob Health.

2018;112(3):107-114. (Results from Ae. koreicus vector competence experiment,

Chapter 6) * (Statement of Contribution of Co-Authors in Appendix II)

*The introductory part of Publication 2 is incorporated in the literature review.

Chapter 1: Introduction 1

Chapter 1: Introduction

This chapter presents the background (Section 1.1) and context (Section 1.2) of

the current research and describes its purpose (Section 1.3). Section 1.4 clarifies the

significance and scope of this work, and finally, Section 1.5 details the outline of the

thesis.

1.1 BACKGROUND

Globalisation of trade and travel has led to the introduction and establishment of

many invasive mosquito species into new territories [7-10]. The term “invasive” in

this instance refers to species that have spread from their original habitat with a

subsequent impact on newly colonised ecosystems or on human behaviour [11]. The

most infamous of these invaders, present in Europe since the 1990s, is the mosquito

Aedes albopictus. Among European countries, Italy has the biggest population of this

species, which is now established across the whole of the country. Since its

introduction, several entomological surveillance systems have been implemented to

monitor the expansion of this invader. In the Veneto region (north-eastern Italy)

monitoring activities sponsored by the public health service began in 1991, the year in

which the first established Ae. albopictus population was found in Padua.

A new mosquito invasion was discovered during routine surveys in areas free of

Ae. albopictus in the Belluno province in 2011 [12]. In May 2011, twelve larvae and

pupae were collected from a manhole in Sospirolo, in Belluno province (Veneto

region), at 447 m.a.s.l. [12]. Adults obtained from these samples were identified as

Aedes (Finlaya) koreicus [1], a species native to Southeast Asia. Following this initial


discovery, subsequent investigations confirmed the establishment of a population of

Ae. koreicus in the area [12].

The Belluno province has a sub-continental temperate climate, characterised by

cold winters and mild summers. For example, the average temperature in 2011 in

winter was 2.7°C and the average temperature in summer was 19.4°C (data obtained

from Agenzia Regionale per la Prevenzione e Protezione Ambientale del Veneto

(ARPAV) [13]). Between May 2011 and October 2012, Montarsi et al. [14] reported

that Ae. koreicus had spread over an area of 2,600 km2 in north-eastern Italy, between

the altitudes of 173 and 1,250 m. They also found that this mosquito had colonised

garden centres, urban areas (streets, squares, parking lots), and private gardens by

utilising a variety of man-made containers as oviposition sites. The most commonly

colonised areas were between altitudes of 400-600m, however, the species was also

well represented between 800-1,000m [14]. A subsequent study utilised temperature-

based models to determine whether areas up to 1,500m above sea level were suitable

for Ae. koreicus colonisation, with suitability peaking at approximately 400-500m

above sea level [15].

Although the first individuals were detected in 2011, the mosquito was likely

introduced earlier and seemed to have undergone limited establishment [12]. However,

between 2011 and 2012, Ae. koreicus increased its distribution rapidly in monitored

sites in Belluno (from 33.3% to 65.2%) and Treviso (from 2.1% to 18.9) [14]. This

rapid colonisation reflects the establishment patterns of Ae. albopictus, a major vector

of CHIKV and DENV, which was introduced into Italy in 1991 and is now endemic

in almost all Italian provinces [16].

Figure 1.1 illustrates the rapid spread of Ae. koreicus in the province of Trento

from east to west along the Valsugana valley over four consecutive years from 2011


to 2014 [17]. By July 2015, 73 municipalities in four regions out of 155 monitored

were positive for Ae. koreicus (47.1 %) (Figure 1.1) [18]. In only five years, this

species spread to 23 new municipalities (14.8 %), indicating the potential for this

species rapid dispersal (Figure 1.2). An unpublished map based on data collected by

the Istituto Zooprofilattico Sperimentale delle Venezie (IZSVe) (courtesy of Matteo

Mazzucato – GIS office database [14]) shows that Ae. koreicus continues to expand its

geographic range in north eastern Italy in the autonomous provinces of Trento and

Friuli-Venezia Giulia and in the Veneto province (Figure 1.3).

http://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-015-1208-4#Tab1


Figure 1.1 Spread of Ae. koreicus and Ae. albopictus in Italy between 2011 and 2014 [17].


Figure 1.2 Map of municipalities infested with Ae. koreicus and Ae. albopictus in northern Italy, 2011–2015 [19].


Figure 1.3 Municipalities infested with Ae. koreicus, Ae. albopictus and Ae. japonicus in northern Italy, 2017 [20].


1.2 CONTEXT

Despite the rapidity of the Ae. koreicus’ spread and establishment in Italy and

Europe [14, 18], its impact on native ecosystems and public health is unknown. The

study presented in this thesis arose from the need to clarify this impact: Ae. albopictus

has already provided a worrying example of how invasive mosquitoes can change

human recreational behaviours, affecting their ability to enjoy the outdoors [21] and

also leading to the spread of arboviruses in Europe [22].

1.3 PURPOSES

The biology and vectorial capacity of Ae. koreicus for arboviruses pose a risk to

public health. To test this hypothesis, this thesis aims to:

1. Evaluate the protocols for field collection of larval and adult Ae. koreicus in a

variety of physiological states (gravid, blood-fed, host-seeking). This will

identify suitable tools for surveillance, facilitate collections and contribute to

investigations on Ae. koreicus biology and behaviour.

2. Establish a colony of Ae. koreicus at the quarantine insectary facilities at QIMR

Berghofer and define the key conditions and parameters of Ae. koreicus

survival under laboratory conditions (e.g., development times, longevity,

fecundity, and egg hatching rates).

3. Examine biological factors relevant to Ae. koreicus establishment (rearing

temperature, gonotrophic cycle, hatching percentage, eggs viability, and

fecundity-size relationship) and characterise the key aspects of Ae. koreicus

biology, such as reproduction and competition with sympatric species (Ae.

albopictus).


4. Asses the vector competence of Ae. koreicus for arboviruses, evaluating the

effect of temperature on the species’ ability to transmit CHIKV.

1.4 SIGNIFICANCE, SCOPE AND DEFINITIONS

The absence of literature on Ae. koreicus biology and its ability to transmit

pathogens is a considerable barrier to evaluating the public health risk that it poses,

predicting the likelihood of its spread and designing suitable surveillance programmes.

This thesis combines field studies and laboratory-derived data to create a

comprehensive picture of the risks associated with Ae. koreicus in Europe. In

particular, this thesis assesses the vectorial capacity (the ability of a vector to transmit

a virus is determined by host, virus and vector interactions, the ecology and behaviour

of the vector and its innate vector competence [23]) of Ae. koreicus for chikungunya

virus (CHIKV). This research considers major aspects of Ae. koreicus biology, such

as the insect’s potential for human interaction, the length of its gonotrophic cycle, its

reproductive behaviour, and an evaluation of the vector competence of this mosquito

under temperature regimes similar to those representatives of its colonized areas in

Italy. Vector competence is described as the intrinsic susceptibility of a vector to

infection, replication, and transmission of a virus [24]. The choice of CHIKV for this

study is justified by the fact that this virus has been responsible for some of the largest

outbreaks of invasive arboviruses in Europe, and therefore presents a major public

health threat [25-29].


1.5 THESIS OUTLINE

This outline provides an overview of the study’s structure and corresponding

research activities.

Chapter 1 - Introduction: described the background, purposes, aims,

context and thesis outline.

Chapter 2 - Literature review: defines, in its first part, the impact on public

health of arboviruses, their main mosquito vectors, and the presence of these vectors

in Europe. The focus is then narrowed to a review of Ae. koreicus and what is known

about its native range and biology, introduction and spread in Europe, vectorial

capacity and interaction with other mosquito species.

Chapter 3 - Evaluation of mosquito traps for the field collection of adult

Ae. koreicus in a variety of physiological states: discusses the protocols for Ae.

koreicus field collection and the field performance of the most commonly used

trapping methods for collecting Aedes mosquito species in different physiological

states. Moreover, it presents an evaluation of the potential for Ae. koreicus / human

interactions.

Chapter 4 - Laboratory colonisation of Ae. koreicus: discusses the

establishment and characterisation of a colony of Ae. koreicus at QIMR Berghofer

Medical Research Institute. Data from Chapter 4 were published as: ‘Laboratory

colonization of the European invasive mosquito Aedes (Finlaya) koreicus’ in Parasites

& Vectors, 2017. 10(1): p. 74.

Chapter 5 - Characterisation of key aspects of Ae. koreicus mating

biology: evaluates key reproductive aspects of Ae. koreicus biology such as the display

of an autogenic phenotype, observations on mating behaviour and preliminary insights


on Ae. koreicus interactions with the invasive species Ae. albopictus. Finally, this

chapter describes the absence of Wolbachia pipientis in field-collected Ae. koreicus.

Chapter 6 - Vector competence of Ae. koreicus for chikungunya virus:

explores the capacity of Ae. koreicus to transmit CHIKV under laboratory conditions

at two temperatures: 23°C and a fluctuating temperature close to climatic conditions

of Belluno, Italy, where Ae. koreicus has recently established. Data from Chapter 6

were published as: ‘The new European invader Aedes (Finlaya) koreicus: A potential

vector of Chikungunya virus’, Pathogens and Global Health, 2018;112(3):107-114.

Chapter 7 - Concluding discussion: this chapter contains a discussion of

the results obtained in this study.

Chapter 2: Literature review 11

Chapter 2: Literature review

2.1 INTRODUCTION

During the past decades, several mosquito species have invaded and colonised

new areas, frequently with impacts on native mosquitoes, such as population decline

and range reduction [30]. For instance, the mosquito Ae. albopictus has expanded its

geographic range dramatically over the last 30 years, and although it originated in

Asia, is now present in Europe, the Middle East, Australasia, the Americas, and Africa

[31-33]. Ae. albopictus is considered one of the most invasive mosquitoes in the world

[31]. Aedes aegypti, another species of mosquito considered to be invasive, was

introduced from Africa into Europe and the Americas and has extended its presence to

tropical and sub-tropical regions worldwide [34, 35]. Its geographic range continues

to expand, and the mosquito has now colonised most of the southern United States

[36]. Invasive mosquitoes cause public health concerns due to their propensity to

transmit pathogenic viruses.

2.2 MAJOR ARBOVIRUSES AND THEIR PUBLIC HEALTH IMPACT

Arthropod-borne viruses (arboviruses) are ubiquitous pathogens that can affect

plants and animals, including humans. They require a host to replicate in and a vector,

such as mosquitoes, for transmission. With a few exceptions (e.g., African Swine

Fever virus), all arboviruses contain an RNA genome [37]. Some of the mosquito-

borne arboviruses that cause concern for humans belong to the Flaviviridae family,

genus Flavivirus, (dengue, West Nile, and Zika viruses) and to the Togaviridae family,

genus Alphavirus (chikungunya and Ross River viruses and Venezuelan Equine

Encephalitis virus) [37-44].


Most arboviral infections in humans are asymptomatic (inapparent) or present

with an influenza-like illness; however, a small proportion result in more severe

symptoms, and sometimes death [37]. Thus, arboviruses can cause a large number of

clinical cases worldwide every year, with a significant impact on public health and the

economy. A lack of effective vaccines [45, 46] for many of these viruses and the

inadequacy of current vector control methods [47] have exacerbated the situation. The

burden of dengue has increased dramatically in the past 50 years, while previously rare

diseases, such as Zika and chikungunya, have caused global pandemics in recent years.

Dengue, reported for the first time in 1779, is now a major threat to public health

globally [48]. Dengue virus (DENV) comprises four different serotypes (DENV-1 to

DENV-4) and is estimated to cause up to 96 million apparent dengue infections each

year, worldwide [38]. Bhatt et al. [38] also hypothesised that in the same year an

additional 294 (217–392) million inapparent dengue infections occurred globally,

although these cases were likely to not be detected by the public health surveillance

systems as they were ‘mild ambulatory or asymptomatic infections’. A study published

in The Lancet in 2017 reported that the number of dengue infections had increased by

50% in the decade prior to 2016 [49]. Dengue can lead to an estimated 21,000 deaths

per year, especially in underdeveloped countries, where resources to treat this illness

are scarce [38, 48]. Symptoms range from mild sickness to haemorrhagic fever, and in

some cases dengue shock syndrome, and the virus is now widespread in Asia, South

America, and the Caribbean. [48]. In Europe, the largest recent outbreak occurred in

2012 in Madeira (Portugal), with more than 2,000 cases [50]. Other minor outbreaks

were reported in 2010 in France and Croatia and in 2014 in France [26, 51] (Figure

2.1).


Zika virus (ZIKV) was first isolated from a sentinel rhesus macaque caged in the

canopy as part of a virus surveillance study in the Zika Forest, Uganda, in 1947 [52].

It is transmitted by arboreal mosquito species (Aedes africanus). Human infection was

sporadic until 2007 (only 14 cases reported [53]). The first major outbreak occurred

when the virus reached Micronesia (Yap Island) in 2007. The virus was most likely

introduced by an infected mosquito or a viremic traveller with asymptomatic infection

from Asia, where Zika human infection has previously been reported [54]. It is

hypothesised that the ancestral Asian virus lineage evolved to become better adapted

to humans [40, 55, 56], infecting approximately 73% of the population and leading to

approximately 18% of cases displaying symptomatic disease [54]. Symptoms are

similar to dengue, with rash, fever, and arthralgia, and the disease generally resolves

within a few weeks without sequelae. However, Zika infections can affect the nervous

system in adults and cause meningitis, meningoencephalitis, and Guillain-Barre

syndrome [57]. In human foetuses, it can cause congenital Zika virus syndrome, a

broad range of foetal neurologic damage when maternal infection occurs during

pregnancy [58].

Zika spread rapidly through the islands of the Pacific between 2012 and 2014

[59] and finally reached the Americas in 2015, where it caused a major epidemic, and

due to its potential association with microcephaly, the announcement of a public health

emergency by the World Health Organization in early 2016 [60]. Serosurveillance

studies in humans suggest that ZIKV is now widespread throughout Africa, Asia, and

Oceania [61].

Chikungunya is an arboviral disease caused by an alphavirus of the family

Togaviridae. Chikungunya virus (CHIKV) is characterised by acute febrile arthralgia

in symptomatic human patients [62]. Phylogenetic analysis has identified three


different genotypes of the virus: West African, Asian, and East/Central/South African

(ECSA) [63]. The virus was first isolated in 1953 in Tanzania [64] from the serum of

a patient initially suspected as having dengue fever due to clinical similarities between

the two diseases [65]. The virus was then isolated from sporadic human cases in

Central and Southern Africa and in South East Asia [66], and from urban areas of

Thailand and India during the 1960s [67-69].

Major outbreaks of CHIKV, involving millions of cases, began in Kenya in 2004

[70] and had spread to the Comoros, South Asia, and islands in the Indian Ocean by

2005. A new virus strain was detected on La Reunion in 2005–2006 (CHIKV ‘La

Reunion’), which belonged to the ECSA genotype and carried two mutations: a

mutation (A226V) in the E1 envelope protein gene and a mutation (I211T) in the E2

envelope protein gene. The synergic action of these two new mutations increased the

infectivity of the virus for Ae. albopictus [41, 71, 72] and facilitated the occurrence of

chikungunya outbreaks in the Indian Ocean [73, 74] and in Europe, France, and Italy

(Figure 2.1) [25-27, 75-78].

2.3 MAJOR VECTORS OF ARBOVIRUSES AND THEIR INVASIVE

POTENTIAL

The emergence and re-emergence of these arboviruses is partly a consequence

of the spread and establishment of their principal vectors [72, 79-81].

The principal vector of DENV is Ae. aegypti [82]. In Europe, the virus

disappeared for over 80 years after an outbreak in Athens in 1927-1928 (approximately

650,000 cases) [83]. This disappearance is undoubtedly linked to the fact that the

principal mosquito vector, Ae. aegypti, also began to vanish after 1935 [26], possibly

as a consequence of improvements in the hygiene of water supplies and the large scale

use of residual insecticide, especially DDT, to control malaria [84]. In more recent


decades, Ae. aegypti and a second competent vector for DENV, Ae albopictus, have

begun to invade or re-establish in Europe, partly driven by increasing global movement

and optimal urban habitats. Ae aegypti re-established in Madeira in 2005 [32] and in

2012 initiated the largest outbreak of dengue in Europe since the epidemic in Greece

during the 1920’s, where more than 2,000 cases were recorded [50] (Figure 2.1).

Globally, although the main vector of dengue remains Ae. aegypti, the invasive Ae.

albopictus also plays an increasing role [85]. Ae. albopictus was indicated as the vector

for dengue epidemics in Japan, Taipei, and Taiwan during World War II [86].

Subsequently, in 1977-78 the species was responsible for dengue outbreaks in La

Reunion Island and the Seychelles Islands [87, 88], for an epidemic in China in 1978

[89], Macao in 2001 [90], the Maldives Islands in 1981 [91], Hawaii in 2001 [92], and

more recently for an outbreak in Gabon in 2007 [93]. Ae. albopictus was responsible

for the re-emergence of dengue in Mauritius in 2009 [94]. Furthermore, the continued

expansion of Ae. albopictus across southern Europe led to autochthonous outbreaks of

dengue in France in 2010 and 2014 [26] (Figure 2.1).

The major vector of ZIKV in Asia [95] and French Polynesia [57] is Ae. aegypti.

Ae. albopictus is not thought to play a role in the transmission of ZIKV; with the

exception of the 2007 Gabon outbreak [96]. The continuing expansion of Ae.

albopictus and Ae. aegypti across the Americas [85, 97, 98] could cause further

outbreaks of ZIKV through South and Central America and the Caribbean [60]. ZIKV

has not yet been autochthonously transmitted in Europe and the role of Europe's most

wide-spread potential vector, Ae. albopictus, in maintaining circulation of this virus

among humans is unclear [99].

The primary vector of CHIKV in urban areas for most of the 20th century has

been Ae. aegypti. However, the importance of Ae. albopictus in the transmission of


CHIKV increased considerably during and after the outbreak of the CHIKV infection

on La Reunion Island in 2005–2006 [41, 71, 72, 100]. The first outbreak of CHIKV in

Europe occurred in 2007 in Italy and was mediated by this invasive vector, and the

introduction of CHIKV ‘La Reunion’ strain by a viraemic traveller from India going

to Italy to visit relatives. The high density of Ae. albopictus in the outbreak area

facilitated an epidemic involving more than 200 symptomatic human cases [72]. Three

years later, autochthonous transmission of CHIKV occurred in Fréjus in South-Eastern

France, and involved two people and a CHIKV strain of the Asian genotype without

the adaptive mutation for Ae. albopictus. Ae. albopictus was the only vector in the area

[101]. In 2014, Ae albopictus was responsible for transmitting CHIKV (E1-226V),

which resulted in 11 cases in Montpellier, Southern France [77]. In August 2017 eight

autochthonous cases of chikungunya were diagnosed in the Var department in the

Provence-Alpes-Côte d'Azur region, South-Eastern France, an area where Ae.

albopictus is established [102]. In the same month, an outbreak of CHIKV belonging

to the ECSA genotype, but lacking the adaptative mutations for Ae. albopictus, caused

more than 300 cases in the Lazio and Calabria regions of Italy (Figure 2.1). Ae.

albopictus is the only potential vector in these areas [27, 29, 103] (Figure 2.1). This

suggests that other unidentified mutations might be involved in enhancing the

infectivity of CHIKV virus for this mosquito species, as hypothesised by Tsetsarkin et

al. [100].

2.4 INVASIVE MOSQUITO SPECIES IN EUROPE

Colonisation and geographic spread of exotic mosquitoes in Europe has

increased significantly from 1990. Ae. albopictus is currently the most widespread

invasive mosquito species in Europe [104] (Figure 2.1). The first report of Ae.

albopictus in Europe was in 1979 in Albania [105]. It was then detected at the Genoa


docks in Italy in 1990, and one year later, had become established in Padua. Ae.

albopictus is presumed to have been introduced into Europe in used tires imported

from the United States [106, 107]. It is now established in almost all of the Italian

peninsula, with the exception of mountainous areas [108] and in 22 other European

countries [109] (Figure 2.1). The impact of invasive mosquito species on public health

is not only associated with pathogens transmission, but is also economic, as

demonstrated by the costs involved in the arbovirus outbreaks prevention following

the CHIKV epidemic caused by Ae. albopictus in Italy in 2007 [110]. Furthermore,

invasive mosquito species can become a nuisance for the population due to their

feeding habits. Ae. albopictus is known for its aggressive biting behaviour, with a

detrimental effect on outdoor human activities [111]. This mosquito has also been

captured inside human habitations, suggesting that its nuisance could potentially be

extended to indoors [111].

Ae. aegypti, the most important vector of arboviruses infecting humans [112],

was present in many southern European countries from the late 1700s to early 1900s.

The reasons for its subsequent disappearance from the region during the 1900s are

unclear, but it has since re-invaded Madeira (Portugal), European Russia, Georgia, and

North-East Turkey [113, 114] (Figure 2.1). Its presence in Europe is actively

monitored by European Centre for Disease Prevention and Control (ECDC) in

conjunction with European Food Safety Authority (EFSA) through the European-wide

monitoring and mapping for invasive mosquito species and potential mosquito vectors

[115].

Commercial trade in tires was also the most likely source of Aedes japonicus,

a mosquito originating in Asia that has become established in Europe [116]. These

mosquitoes have colonised almost all of Switzerland, large regions of Austria and


Germany, and are also present in Belgium, France, the Netherlands, Hungary,

Slovenia, Croatia, and Lichtenstein [117-119]. In 2016, it was found to have spread to

Italy [120] (Figure 2.1, 1.3) [121]. Ae. japonicus has an aggressive anthropophilic

behaviour [122], and although it is not an important vector of pathogens in Japan and

Korea [123], this species has shown vector competence for Japanese encephalitis virus

JEV [123], West Nile virus [124], DENV, and CHIKV [125] in laboratory.

Nonetheless, there is no field evidence it is an important vector of these viruses.

A new mosquito species, Ae. koreicus, has become established in Europe in

recent years (Figure 2.1), with the largest populations being found in Italy. More

recently, inhabitants have complained about mosquito bites during the daytime in areas

where Ae. koreicus was the only diurnal biting species [14], indicating that this species

could be a source of discomfort for the population living in its range of establishment.

Despite the rapid spread and anthropophilic habits of this mosquito [126, 127], the risk

that it poses as a vector of arboviruses infecting humans is unknown.


Figure 2.1 Distribution of invasive Aedes mosquito species in Europe and locations and magnitude of autochthonous dengue and chikungunya

outbreaks in Europe from 2007 [133].

Data collated from ECDC maps [128] and [29, 51, 72, 77, 78, 101-103, 129-132].


2.5 AE. KOREICUS: NATIVE RANGE AND BIOLOGY

Ae. (Finlaya) koreicus is native to the Korean peninsula and Jeju-do Island [134],

Japan, China, and Eastern Russia. This species is well adapted to urban settlements

[14, 134, 135]; however, little is known about its biology. It has been described as one

of the most common species of mosquito in Beijing, emerging in late spring [136] and

reaching peak activity in summer [137-139]. Known breeding sites include artificial

and natural containers close to human inhabited areas [134, 135], although larvae have

been reported to develop in coastal brackish pools [140] and rock pools on hillsides

[141]. Depending on the breeding site location, Ae. koreicus feed opportunistically on

humans, domestic mammals, and both domestic and sea birds [134, 135, 140] during

the day and night [135]. Overwintering occurs during the egg stage [135]. Colonisation

of urban areas, daytime biting, and human feeding increases the potential of this

species to be a public health risk [14].

2.6 VECTOR COMPETENCE OF AE. KOREICUS

Vector competence is defined as the ability of a vector to transmit a pathogen to

another susceptible host [23]. Members of the genus Aedes are known to transmit a

large number of viruses to humans (e.g., Yellow Fever virus (YFV), DENV, CHIKV

and ZIKV) [43, 72, 124, 142-145]; however, the role of Ae. koreicus as a vector of

arboviruses is still largely unknown.

Miles et al. (1964) [140] reported that JEV was isolated in wild-caught Ae.

koreicus mosquitoes breeding in the fishing villages on the seaside of the Far-Eastern

USSR in the 1960s. No empirical references were included [146] and presence of

virus, without evidence of transmission, is not sufficient to define the species as true

vector. JEV was not detected in Ae. koreicus during more recent monitoring activities


in Korea, although Ae. koreicus represented less than 0.1% of the total number of

mosquitoes examined [147-149]. These reports should therefore be viewed with

caution, as misidentification of this species as Ae. japonicus, a known vector of JEV

[104, 117, 123, 150, 151] can occur [135]. Few reports mention Ae. koreicus’ ability

to transmit JEV in laboratory and in the field [123, 140, 152]. A study in 1927 found

that Ae. koreicus could become infected with Wuchereria bancrofti microfilariae but

that the microfilariae did not develop [153]. Ae. koreicus is a vector for dog heartworm

Dirofilaria immitis [154, 155] in the laboratory; however, this parasite has not been

recovered from mosquitoes collected in the field [156]. It is unclear whether the

absence of Dirofilaria is due to insufficient sampling rather than lack of infection. A

more recent report has suggested that Ae. koreicus can act as an intermediate host (an

organism harbouring developmental stages of a parasites [157]) for Brugia malayi to

infect humans [158].

A key factor in assessing the risks of arbovirus transmission is the vector’s host

feeding preference. Humans, domestic mammals, and seabirds have been observed in

the field as hosts for Ae. koreicus [140]. More recently, an investigation of the feeding

preference and the host range of Ae. koreicus in laboratory and field conditions found

that it could be reared using blood from chickens, turkeys, sheep, or humans under

artificial conditions (a Hemotek® feeding system) or by directly feeding on blood from

human volunteers [126, 159]. The highest rates of mosquito engorgement were

observed when mosquitoes were fed on blood provided by human volunteers through

an artificial system (76.5% of mosquitoes fed), followed by chicken blood (65.4% of

mosquitoes fed). Mosquitoes engorged with any of the evaluated blood types

subsequently laid fertile eggs. Ninety-five percent of blood meals in wild-caught

mosquitoes were from humans and one mosquito contained bovine blood [126]. The


opportunistic or anthropophilic nature of this behaviour may depend on the relative

size and abundance of hosts and has not yet been examined. None the less, it clearly

shows that Ae. koreicus will readily feed on humans.

2.7 DISTINGUISHING AE. KOREICUS FROM AE. JAPONICUS:

MORPHOLOGICAL AND GENETIC FEATURES

The ecology and behaviour of Ae. koreicus, and the risk it poses for transmission

of arboviruses, are complicated by this species often being confused with its close

relative Ae. japonicus [12, 155, 160]. Ae. koreicus is a large mosquito (wing length

2.7-4.9 mm, [134]) and is characterised by a black and white pattern on the thorax and

abdomen common to other Aedes species. Colour patterns strongly resemble Ae.

japonicus (Table 2.1) [135]. Tanaka [134] stated that the two species show a range of

characteristic variations that overlap. Nevertheless, there are differences, for example,

pedicel (Figure 2.2) with usually more pale scales than dark scales in koreicus, while

usually more dark scales than pale scales in japonicus; posterior pronotal lobe (Figure

2.2) usually with dark scales in koreicus, but typically without them in japonicus;

postpiracular (Figure 2.2) area usually with a distinct patch of pale scales in koreicus,

but lacking these scales in japonicus samples; hindfemur (Figure 2.2) almost always

entirely pale basally in koreicus, and almost always with a complete or incomplete

dark subbasal band in japonicus; hind tarsomere 4 always with a distinct pale basal

band in koreicus, and usually entirely dark in Ae. japonicus (Figure 2.2; Table 2.1).

However, markings on the hind tarsi (Figure 2.2) and scaling of the postspiracular area

(Figure 2.2) are significant in distinguishing between the species [135, 160] (Table

2.2). The morphological similarity between the two species is supported by genetic

analyses of the ND4, COII, and D2 regions of mitochondrial DNA [161, 162].


Mosquitoes found in Belgium were morphologically distinct to specimens from

the Korean peninsula (reference material provided from the Smithsonian Institute

[163]) but not to those from Jeju-do Island. Following a detailed morphological

comparison, the pattern on hind tarsomere 5 led scientists to conclude that the Belgian

population originated from Jeju-do Island. Belgian specimens have a basal pale band

on the hind tarsomere similar to specimens from Jeju-do Island: the hind tarsomere 5

on specimens from the Korean peninsula is entirely dark, sometimes with a few pale

scales [160] (Figure 2.3).


Figure 2.2 Drawings of the main characteristics considered for the identification of

female Culicinae mosquito.

Note: a) general aspect of a female mosquito; b) dorsal and lateral view of thorax. The arrows point

only to the characteristics useful for the identification of Ae. koreicus and Ae. albopictus [164].


Figure 2.3 Differences in hindtarsomere 5 patterns.

Note: (a) Ae. koreicus from Belgium, (b) Ae. koreicus from peninsular Korea and (c) Ae. japonicus

from Belgium (Photo by Walter Reed Biosystematics Unit). The basal band is pale on Ae. koreicus

hindtarsomere 5 of specimens from Belgium while it is dark in other specimens [165].


Table 2.1 Comparison of adult morphological features in females of Ae. koreicus

from Belgium, Italy, the Korean peninsula and Jeju-do Island with those of Ae.

japonicus (Modified from Versteirt et al. [160]).

Characteristics Aedes koreicus Aedes japonicus

Belgium/Italy Korean

Peninsula

Jeju-do Island

Head/vertex With pale erected

forked scales

Erect forked

scales frequently

entirely dark, if

pale scale than

between 1-4

Erect forked

scales almost

always pale: 1-10

Numerous erect

forked scales, often

entirely dark,

otherwise with

variable numbers

of pale scales

Thorax/postpronotum Numerous pale

falcate scales

Covered with

broad pale

scales,

occasionally

falcate scales

present

Numerous pale

falcate scales

present, scales

narrower

Covered with

broad pale scales,

almost no dark

scales present

Abdomen Basomedian and

basolateral pale

areas; variation:

only basomedian or

only basolateral

pale areas present

Very thin

basomedian pale

band and always

basolateral pale

spots

Very thin

basomedian pale

band and white

basolateral spots

on anterior terga

Always

basomedian and

basolateral pale

areas

Hindtarsomere 4 Basal pale band Basal pale band Basal pale band Dark, sometimes

with some pale

scales*

Hindtarsomere 5 Basal pale band Entirely dark;

sometimes with

a few pale scales

Basal pale band Entirely dark*

Postbasal pale band of

hindfemur

Missing Missing Missing Present and mostly

complete*

Postspicular area 20-30 broad pale

scales

20-30 broad pale

scales

20-30 broad pale

scales

No pale scales*

*Main distinguishing features between Ae. japonicus and Ae. koreicus

2.8 AE. KOREICUS IN EUROPE

Ae. koreicus was found for the first time in Europe in 2008, near an industrial

area in Belgium. During the national mosquito survey campaign MODIRISK

(Monitoring of Mosquito Vectors of Disease: Project of Institute of Tropical Medicine,

Foundation of Public Utility, Belgium, [166]). In 2009, Ae. koreicus adults and larvae

were again detected in the same 6 km2 area, and in 2014, this species had become

established in Belgium [167, 168]. Following the first report in Belgium, this species

has been identified in five additional European countries: in north-eastern Italy,


Belluno province, in 2011 [12, 14]; in Sochi, Russia [169]; in the southernmost part of

the Ticino region, Switzerland; close to the Swiss border in Como province, Italy, in

2013 [170]; in Augsburg, Bavaria, Germany, in 2015 [171]; and in Pécs, southwest

Hungary, in 2016 [172] (Figure 2.1).

Specimens of Ae. koreicus were found in Mamaika, Sochi city, in Russia in early

July 2013. Samples were collected 400 m from the Black Sea coast, in water tanks

used for the collection of rain water. Morphological identification was confirmed by

sequencing the Internal Transcribed Spacer 2 (ITS2) region [169]. Swiss specimens

were morphologically identified by Francis Schaffner, and eggs were identified by

matrix assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-

TOF MS) [173]. The only specimen of Ae. koreicus from Germany was found in mid-

June 2015 in an urban area; however, the nearby surroundings were negative for adults

or immature stages [171]. Three females Ae. koreicus were captured in early July 2016

in Hungary, again in an urban area [172].

2.9 AE. KOREICUS MONITORING: ECDC GUIDELINES FOR INVASIVE

MOSQUITO SPECIES

Monitoring of Ae. koreicus has been complicated by insufficient information

about the efficacy of trapping methods for capturing the species. Mosquito collections

undertaken in Korea between 1999 and 2004 yielded a small number of Ae. koreicus

(not the major target of the collections): this species made up less than 0.1% of

mosquitoes collected with New Jersey light traps (unbaited or baited with dry ice)

(Figure 2.4). Mosquito Magnet Traps (Figure 2.5) and CDC-type light traps (baited

with dry ice) (CDC traps are described in Chapter 3) [137, 138, 174-176].


Figure 2.4 The components of a New Jersey light trap.

Note: The New Jersey light trap is a metal cylinder, covered by a rain shroud to protect the collection

chamber from water. Under the shroud is a light bulb to attract mosquitoes. Once attracted by the

light, a fan located in the bottom of the device over the collection chamber draws the mosquito into

the collection chamber [177].


Figure 2.5 The components of a Mosquito Magnet Trap.

Note: Mosquito magnet traps convert propane into carbon dioxide (CO2) and then emit a precise

combination of heat, moisture, and a secondary attractant to draw mosquitoes into a vacuum [178].

In 2012, a panel of experts from the European Union (ECDC) outlined the

principal guidelines to be applied in surveillance programmes for invasive mosquito

species, including Ae. koreicus, with special reference to the geographic area of Europe

[179]. A clear assessment of the biology and vector competence of invasive mosquito

species is critical to evaluating their potential social and economic impacts on public

health. The guidelines identified the steps required to organise and manage a

surveillance program depending on its scope. Three different scenarios were

identified:

Scenario 1 – no established invasive mosquito species are detected;

however, the risk of introduction is present. In this case, there are no reports

of the presence of a species or initial findings are not confirmed over time,

propane

carbon dioxide

heat

moisture

secondary attractant

vacuum system


but commercial trade and models show a risk of introduction. One example

is Ae. japonicus, which has not yet been detected in Italy, but is present in

nearby countries, such as Austria and Slovenia [180].

Scenario 2 – locally established invasive mosquito species. This scenario is

defined by the presence of the invasive species in a maximum area of 25

km2. This is the case of Ae. japonicus in Belgium [168].

Scenario 3 – widely established invasive mosquito species. In such a

scenario, the invasive mosquito species is found over an area of more than

25 km2. Ae. koreicus is placed in the third scenario of the colonisation

process [14].

These guidelines are essential to assessing the spread and establishment of

invasive mosquitoes, and potentially, the risks to public health [181]; however, no

specific tools have been validated for Ae. koreicus surveillance. From previous surveys

conducted in the provinces of Belluno, Vicenza, and Trento, northern Italy, following

the ECDC guidelines for the surveillance of invasive mosquitoes in Europe [179],

Ovitraps (described in Chapter 3) were found to be attractive for Ae. koreicus gravid

females, and effective for the collection of eggs. However, Biogents-Sentinel (BGS)

traps (recommended as a standard tool for the surveillance of invasive mosquitoes by

the ECDC [179], described in Chapter 3) baited only with BG-lure or with a

combination of CO2 and BG-lure (releasing lactic acid, ammonia, and fatty acids to

mimic human skin scents), caught only a few Ae. koreicus specimens [127] and the

optimal survey trap for Ae. koreicus was not defined. In a study with an experimental

design similar to the one used in this thesis, Baldacchino et al. [182] evaluated the

effectiveness of three trapping devices: a CO2-baited BGS trap, a CO2-baited Centres

for Disease Control and Prevention light trap (CDC trap), and a grass infusion-baited


gravid trap in an urban and a forested settlement. Over a total of 81 trapping nights,

only 303 Ae. koreicus were captured from all of the traps in both urban and rural sites.

The surveillance tools recommended by the ECDC [179] include BG-Sentinel

traps, Mosquito Magnets, and Ovitraps; however, their specific abilities to detect Ae.

koreicus are unknown (Table 2.2). The design of surveillance programs is also

informed by additional biological information, such as peak time of flying and host

seeking activity, anthropophilic behaviour, and optimum temperature for egg and

larval development and adult emergence. All of this information assists with

identifying the best surveillance protocols for this species.


Table 2.2 Efficacy of methods of collection of adult invasive mosquito species and their eggs.

Trap Models

Host-seeking females Oviposition-seeking females

Targeted species HLC CO2 traps MM (CO2) Light traps BG-Sentinel Gravid traps Sticky traps Ovitraps

Ae. aegypti +++ +/- + - ++ +/- ++ ++

Ae. albopictus +++ +/- + - ++ +/- ++ ++

Ae. atropalpus ++ + + - +/- - ? +

Ae. japonicus + +/- + + +/- ++ + +/-

Ae. koreicus ? ? ? ? ? - ? +

Ae. triseriatus +++ ++ ++ ? ++ + + ++

(HLC = human landing collection; CO2 traps = CO2-baited suction traps; MM = Mosquito Magnet, CO2-baited suction traps with chemical attractant; light traps = light-baited

suction traps; BG-Sentinel or Mosquitaire = odor-baited suction traps; gravid traps = infusion-baited suction traps; sticky traps = water/infusion-baited oviposition trap with

sticky element; Ovitraps = water/infusion-baited oviposition traps (only eggs are collected); - low efficacy; + fair efficacy in some situations; ++ good efficacy; +++ excellent

performance; ? not known ) [183].


2.10 INTERSPECIES COMPETITION BETWEEN INVASIVE AND

NATIVE SPECIES: CURRENT KNOWLEDGE

A major factor that drives the spread of an invasive species in a new territory is

their competitive interactions with native or pre-existing species that share the same

breeding sites and biological niches [184]. Interspecific cross-insemination

(satyrization) and larval competition are some of the most important interactions that

can help displace or retain native mosquito populations [185, 186].

In the case of satyrization (defined by Ribeiro & Spielman in 1986 [187]) the

males of one species can interfere with the reproductive fitness of females from a

different species by successfully mating with and sterilising them or decreasing their

receptivity to conspecific males. This effect is caused by the transfer of male accessory

gland proteins with sperm [188-190]. Satyrization can cause the displacement of one

population by another, as demonstrated with Ae. albopictus and Ae. aegypti [4, 5, 191-

195]. However, resistance to satyrization may evolve rapidly, although at a potential

cost [4]. Females of Ae. aegypti experimentally exposed to Ae. albopictus males

rapidly developed resistance to satyrization, although satyrization-resistant females

employed longer times to mate with conspecific partners [3]. More recent studies have

demonstrated how the transfer of males’ accessory gland proteins alone, without

depletion of females’ spermathecae with sperm from interspecific males, is sufficient

to induce mating interference [2]. Evidence of interference with mating activities by

male Ae. albopictus against females belonging to at least three other Stegomyia species

(Aedes polynesiensis, Aedes guamensis, and Aedes cretinus) was reviewed in

Bargielowski and Lounibos (2016) [3]. Laboratory experiments and field evidence

suggest that satyrisation by Ae. albopictus males could lead to the competitive

displacement and local extinction of endemic mosquitoes, especially on island settings


[3]. However, reproductive interference in the field seems to occur at very low rates

(1.12 - 3.73%) [196].

Ae. koreicus and Ae. albopictus are sympatric in many areas of Italy; however,

possible mating interference between the two species has never been investigated.

Moreover, no studies examining the mating interactions of Ae. koreicus or mating

biology are described in the literature. Competition between the larvae of different

species may also be important. Several studies have examined the mechanism of

displacement of different Aedine species (Ae. albopictus, Ae. notoscriptus, and Ae.

aegypti) that colonised the same ecological niche through larval competition. At

different larval densities and resource availability (food substrates) the species that

maintained a positive trend of population growth and higher chance of survival to

adulthood was considered able to displace other species [197-199]. Ae. albopictus

demonstrated a high competitiveness, but only in certain cases, and different species

had different grades of advantage in different conditions. Ae. aegypti was more

competitive towards Ae. notoscriptus when these larvae were reared in the laboratory

at lower temperatures. Moreover, Ae. albopictus and Ae. aegypti competition varied

for different experimental densities and resources availability. This result suggests

that, in nature, Ae. aegypti persists only at sites with less intense competition [197-

199].

Larval competition can also influence mosquito-virus interactions, leading to

relative enhancement of virus susceptibility and dissemination. Ae. albopictus larvae

developed in highly competitive conditions with Ae. aegypti resulted in smaller Ae.

albopictus adults. Smaller body sizes enhanced body titres and dissemination rate of

Sindbis virus [200]. Other evidence shows that competition with Ae. aegypti increases

susceptibility of Ae. albopictus to DENV infection [201]. The presence of Ae.


albopictus larvae in the same breeding site decreased the survival of Ochlerotatus

triseriatus larvae; however, in this case the survivors were larger and more likely to

develop midgut and disseminated infection with La Crosse virus [202].

To date, the only available information about Ae koreicus showed that, under

laboratory conditions, the species larval competition with Ae. albopictus from the same

geographical area was weak when the two larvae species were reared together, with a

small advantage of Ae. albopictus (significant reduction of Ae. koreicus survivorship

when 10 Ae. koreicus larvae were reared in presence of 20 Ae. albopictus larvae)

partially counterbalanced by the emergence of bigger Ae. koreicus females [203].

Chapter 3: Evaluation of mosquito traps for the field collection of adult Ae. koreicus in a variety of physiological

states 36

Chapter 3: Evaluation of mosquito traps for

the field collection of adult Ae.

koreicus in a variety of

physiological states

3.1 INTRODUCTION

Mosquito traps are essential tools for field collection and surveillance programs

[181]. The collection of Ae. koreicus in a variety of physiological states (gravid, blood-

fed, host-seeking) is critical to determining the mosquitoes’ presence, abundance,

ecology, and behaviour [204]. Trapped mosquitoes can be further characterised for the

presence of virus or host blood meal [205]. Information about the efficacy of trapping

methods for capturing Ae. koreicus is currently insufficient, and with the exception of

a ‘fair efficacy in some situations’ of Ovitraps reported by ECDC [182], the optimal

survey trap for Ae. koreicus has not yet been defined.

This thesis evaluates the performance of five different mosquito collection

methods commonly employed in mosquito surveillance programmes for trapping Ae.

koreicus. Ae. koreicus was collected from the field in northern Italy using protocols

described in Krökel et al. [206], to compare mosquito abundance between different

sites (e.g., urban or rural areas). The experiment was designed to identify the most

effective trapping method for non-gravid, gravid, and blood-fed Ae. koreicus by testing

BG-Sentinel (BG) traps with and without CO2, gravid Aedes traps (GATs) and

Ovitraps. Moreover, as part of the investigations into Ae. koreicus biology, human

landing catches with aspirators were used to quantify the mosquito-human contact

[204].


states 37

3.2 METHODS

3.2.1 Evaluation of the field performance of four trapping methods

Two different trials were conducted in two different sites in the Belluno

province, Italy, which were approximately five kilometres apart (Figure 3.1). One site

was considered ‘urban’ and was located in the city centre of Belluno (Figure 3.2). The

other site was considered ‘rural’ and was located in farmland (Figure 3.3). At each

location, a BG-Sentinel trap baited with BG-Lure (BioGents GmbH), a BG-Sentinel

trap baited with BG-Lure and CO2, a GAT trap, and an Ovitrap were separated by

approximately 50 m in a Latin square design. The traps were positioned at distances

three time greater than those applied in a study evaluating the performance of BG-

Sentinel traps in comparison to CO2 and Fay-Prince traps [206]. This was done to

reduce any potential interference between traps.

Figure 3.1 Area in Belluno province in which the evaluation of field performance of

four different trapping methods (BG-Sentinel traps with and without CO2, Gravid

Aedes Traps, and Ovitraps) was performed.


states 38

Note: The blue spot is the urban site and the red spot is the rural site (Image courtesy of Matteo

Mazzucato – GIS office database, IZSVe).

Figure 3.2 Location of traps in the urban site.

(Image courtesy of Matteo Mazzucato – GIS office database, IZSVe)


states 39

Figure 3.3 Location of traps in the rural site.

(Image courtesy of Matteo Mazzucato – GIS office database, IZSVe)


states 40

The BG-Sentinel trap consists of a white collapsible bucket capped by a white

gauze top. In the middle of the white gauze, a round hole connects to a black tube, a

black catch bag, and a 12-V DC fan. The fan creates a downward flow that causes any

mosquitoes in the vicinity of the opening to be sucked into one catch bag (Figure 3.4).

An attractant (the BG-Lure, BioGents GmbH) is added to the trap and releases a

combination of lactic acid, ammonia, and caproic acid, common components of human

skin exudates [206].

Figure 3.4 BG-Sentinel trap.


states 41

The BG-Sentinel trap baited with BG-Lure and CO2 is identical to the previous

design, except for a bucket containing dry ice, which is suspended above the trap, and

through sublimation, leads to the production of CO2, to resemble animal breath

(Figure3.5) [207].

Figure 3.5 BG-Sentinel trap baited with BG-Lure and CO2.


states 42

The Ovitrap consists of a black bucket filled at the bottom with rain water. For

this study, a Masonite® wooden stick (oviposition substrate) was fitted to the inside

wall of the upper half of the container (Figure 3.6) [208].

Figure 3.6 Ovitrap.


states 43

The gravid Aedes trap (GATs) was built following the design of Ritchie et al.

[209]. The standard GAT has a 10-liter black bucket filled with approximately three

litres of rain water, with a 5.1-liter translucent plastic top. The translucent top has an

opening into which a black matte funnel is inserted, with 7cm exposed above the top

of the translucent chamber. The bottom of the translucent plastic top and the water are

separated by a piece of insecticide-treated net (Olyset® Plus) (Figure 3.7).

Figure 3.7 Gravid Aedes Trap.


states 44

Mosquitoes were sampled every 24 hours at 6.00 pm. The position of the four

traps was rotated at the end of every 24-hour period. Twelve sampling days were

completed at both the rural and urban sites (August 5-9, 19-23, 26, 27, 2014).

Mosquitoes were identified using taxonomic keys [134, 210-214]. All of the trap

positions were geo-referenced using a GPS.

3.2.2 Human landing

Human landing collections were performed in the grounds of the Istituto

Zooprofilattico Sperimentale in Belluno (46.1477339° N 12.2046886° E) (Figure 3.8).

The investigator sat with her legs exposed (Figure 3.9). Host seeking mosquitoes

landing on the investigator’s legs were collected using a handheld aspirator (Hausherr's

Machine Works, Toms River, NJ) and identified [134, 210-214].

Five human landing collections were carried out at each site. Each collection

lasted 21 hours between 8.00am and 5.00am of the following day, except on September

16 and 17 when the collection lasted only until 1.00 am (Figure 3.9). Mosquitoes were

collected for one hour in every four-hour period (i.e., 08.00, 12.00, 16.00, 20.00, 00.00,

and 04.00). The collections were performed on July 22, 23, August 21, 22, August 26,

27, September 11, 12 and September 16, 17, 2014. Temperature and relative humidity

(RH) were recorded during each collection.


states 45

Figure 3.8 Human landing collection site.

Figure 3.9 Human landing collections during the day and during the night.


states 46

3.3 RESULTS

3.3.1 Evaluation of the field performance of four trapping methods

During the sampling period, minimum and maximum temperatures ranged

between 10.8-16.4°C and 17.2-28°C. Rain was registered on nine out of 12 sampling

days, with wind speeds between 0.5 and 1.3 m/s (Table 3.1).

Table 3.1 Maximum, minimum, medium temperatures, precipitations (measured in

mm H20 per day) and wind speed (measured in m/s) during the sampling period in

Belluno

Day T min (°C) T med (°C) T max (°C) mm H20 Wind speed

5 15.6 °C 19.6 °C 25.2 °C - 1.1

6 12 °C 19.8 °C 28 °C - 1.1

7 15.1 °C 19 °C 26.4 °C 15 1.3

8 12.7 °C 20 °C 27.6 °C 0.6 1

9 16.4 °C 20.5 °C 27.2 °C 2.6 1.1

19 13.4 °C 15.8 °C 18.6 °C 6 0.5

20 11.2 °C 16.6 °C 22.1 °C 12.8 0.9

21 13.6 °C 17.8 °C 23.3 °C 2.2 1.2

22 12.5 °C 17.3 C° 22.3 °C 1.4 0.6

23 10.8 °C 14.6 °C 17.2 °C ° 26.2 0.8

26 13.2 °C 15.8 °C 19.4 °C - 0.7

27 15.6 °C 19.8 °C 26.8 °C 0.2 1

Source: Belluno airport meteorological weather station, [215].

None of the trapping methods utilised in this assay yielded a consistent number

of target mosquitoes; thus, statistically robust analyses could not be performed. GAT


states 47

traps and Ovitraps were always negative. At the urban site, the BG-Sentinel CO2 trap

tended to capture more mosquitoes than the BG-Sentinel trap. In particular, Ae.

albopictus and Culex pipiens were captured in greater numbers than other species

(Figure 3.10). The number of mosquitoes captured at the rural site was generally lower

in comparison to the urban site (Figure 3.11). Consistent with the urban site, the BG-

Sentinel CO2 trap tended to attract more mosquitoes than BG-Sentinel trap. Cx. pipiens

was captured in greater numbers than other species (Figure 3.11). Statistical analysis

was not performed due to the small sample size of Ae. koreicus captured in both rural

(n= 1) and urban (n= 13) sites.

Figure 3.10 Number and species of mosquitoes captured at the urban site.

0

50

100

150

200

250

BG-Sentinel

BG-Sentinel CO₂

Mo

squ

ito

nu

mb

er

Species


states 48

Figure 3.11 Number and species of mosquitoes captured at the rural site.

3.3.2 Human landing

During the five-day sampling period, the temperature ranged between 14.1°C-

22.2°C (Table 3.2). Precipitation levels and wind speed recorded for the sampling

period are shown in Table 3.3. Relative humidity levels ranged between 51-74%. The

species caught most frequently in this survey was Ae. albopictus, which was active

throughout the day, with a peak of activity in the central hours of the day (12.00-13.00,

n= 19 and 16.00-17.00, n=17). Only three Ae. koreicus were caught during the evening

(time intervals 16.00-17.00, n=1 and 20.00-21.00, n=2) (Figures 3.12 and 3.13). Very

few other mosquito species (Anopheles plumbeus, Culex pipiens, Aedes vexans) were

captured (Figure 3.14).

0

5

10

15

20

25

30

BG-Sentinel

BG-Sentinel CO₂

Mo

squ

ito

nu

mb

er

Species


states 49

Table 3.2 Temperature measured at each time interval and the average temperature

during the five sampling days.

Time Temperature (°C) Average

22/07/2014 21/08/2014 26/08/2014 11/09/2014 16/09/2014

8.00-9.00 19.4°C

16.5°C 15.4°C 17.4°C 15.8°C

16.9 ±

0.6

12.00-

13.00

19.4°C

19.5°C 18°C 19°C 17.4°C

19.9 ±

1.2

16.00-

17.00

22.2°C

20.5°C 18.5°C 18.8°C 19.5°C

19.9 ±

0.5

20.00-

21.00

19.8°C

17°C 16.5°C 16°C 16.2°C

17.1 ±

0.6

00.00-

01.00

19°C

15.5°C 16.3°C 14.1°C 15.6°C

16.1 ±

0.6

4.00-5.00 18.4°C 15.2°C 16.3°C 14.1°C 16 ± 0.7

Table 3.3 Precipitation levels (mm H20/day) and wind speed (measured in m/s)

during the sampling period in Belluno (Belluno airport meteorological weather

station, [216, 217]).

Day mm H20 Wind speed

22-Jul 3.4 N/A*

21-Aug 2.2 1.2

26-Aug - 0.7

11-Sep 10.8 0.9

16-Sep 2.8 0.5

*= not available


states 50

Figure 3.12 Total number of Ae. albopictus and Ae. koreicus sampled at different

time intervals

Note: the shaded area represents the hours after sunset.

Figure 3.13 Mosquito species sampled at different time intervals, temperature, and

relative humidity at the sampling site.

Note: the shaded area represents the hours after sunset.


states 51

Figure 3.14 Ae. koreicus feeding on a human.

Very few Ae. koreicus were captured; thus, statistical tests were unable to be

performed to determine the correlations between abundance and environmental

variables.

3.4 DISCUSSION AND CONCLUSION

In this experiment, only the BG-Sentinel traps, already indicated as effective for

Aedes monitoring [218] and recommended as a standard device by the European

Centre for Disease Prevention and Control [179], were successful in trapping Ae.

koreicus. Mosquitoes were captured in very low numbers (Ae. koreicus captured at the

rural site = 1; Ae. koreicus captured at the urban site = 13). BG-Sentinels baited with

lure and CO2 captured the majority of mosquitoes at both sites (302/333). This trap

also collected the largest number of Ae. koreicus (13/14), suggesting that Ae. koreicus

might not display a strict anthropophilic behaviour (the combination of BG-lure and

CO2 baits attracts a variety of species, not only anthropophilic mosquitoes), or that the


states 52

species is more attracted to CO2 than other Aedes. The experiment was challenged by

the difficult meteorological conditions in the study area in 2014. Belluno is located in

a mountainous area at approximately 400 m. above sea level. Even during summer,

heavy precipitation and variable temperatures can significantly impact mosquito

activity.

The human landing evaluations performed over five days and nights were

affected by the same climatic conditions. The numbers of host seeking Ae. koreicus

captured (three samples collected over five trapping periods) were consistent with data

from a parallel study conducted by the IZSVe from 5.00 pm to 8.30 pm (a total of

twenty-one Ae. koreicus collected per night over twenty-six nights of trapping) in five

nearby municipalities [219]. The evaluation of a 24-hour timeframe as opposed as an

a priori selected one indicated that the preferred period of activity for Ae. koreicus was

late afternoon/evening.

Despite suboptimal conditions, the Ae. albopictus: Ae. koreicus ratio was 44:3

during five human landing collections in an urban area, and 36:13 during 12 BG-lure

and CO2 trap collections at the urban site. These data suggests that the two trapping

methods were effective in collecting both species, even when their presence was low,

and may provide indications about these species’ relative abundance. As Ae. koreicus

is a recently introduced mosquito in Italy, even though the population has been

established [12], mosquito density in the territory may not be high. When the study

was repeated one year later by Baldacchino et al. [182] with more favourable weather

conditions and more resources available, only 303 Ae. koreicus were captured in total

of 81 trapping nights. That study insisted that the low efficacy of the trapping methods

might be ascribed to a low mosquito density. The same study, comparing Ae. koreicus

and Ae. albopictus adult collections in 2014 and 2015, found that the number of


states 53

mosquitoes captured in 2015 was higher than in 2014, and that this increased

abundance may have been due to an increase in the mean temperature and/or a decrease

in precipitation during the sampling periods. In that study, a Latin square design

similar to the one described in this thesis chapter was used to evaluate the efficacy of

different traps (a modified version of the BG-Sentinel trap CO2-baited, a CO2-baited

CDC trap, and a grass infusion-baited gravid trap). Although the authors suggested

that these traps were effective for Ae. koreicus sampling, only 303 Ae. koreicus were

captured over a total of 81 trapping nights. Overall, 219 Ae. koreicus were sampled at

the forested site and 84 at the urban site. The BG-Sentinel trap CO2-baited yielded 59

and 30 Ae. koreicus for the two sites, respectively. The CO2-baited CDC trap collected

80 Ae. koreicus at the forested site but only four at the urban site. Finally, the grass

infusion-baited gravid trap collected the higher number of Ae. koreicus in total, with

80 sampled at the forested site and 50 at the urban site. The results suggest that there

is still a lack of tools for intensive monitoring of this species [182].

Chapter 4: Laboratory colonisation of Ae. koreicus 54

Chapter 4: Laboratory colonisation of Ae.

koreicus

4.1 INTRODUCTION

The establishment of a stable, healthy colony is a critical first step for subsequent

laboratory studies on mosquito ecology, behaviour, and virus-vector interactions. This

chapter describes the key conditions and parameters for rearing Ae. koreicus under

laboratory conditions and subsequent development times, survival, fecundity, and egg

hatching rates. Although colonies of other Aedes species are commonly maintained

under laboratory conditions [220-223], no Ae. koreicus colonies were reported in the

literature; and thus, no satisfactory method of rearing this species has yet been

described. The capacity to obtain virgin cohorts is of considerable utility when

designing experiments that investigate the competitive mating interference behaviours

between invasive and native mosquitoes [2, 4, 5, 191].

Wing length is often an accurate indicator of fecundity in mosquitoes [224-228],

and numerous studies have utilised this relationship to investigate mosquito ecology

and behaviour. For example, wing length has been used as one parameter in equations

that estimate population growth in cases of larval competition and competitive

displacement between different species [200, 201, 229, 230] or to evaluate the effect

of food substrates and larval density on mosquito population fitness [231, 232]. To

facilitate similar studies on Ae. koreicus, this chapter describes the fecundity-size

relationship of the colony established for this study.


4.2 METHODS

4.2.1 Effect of temperature on egg hatching and development

In an initial attempt to colonise Ae. koreicus at IZSVe, Italy, mosquitoes were

reared following the protocol of Williges et al. [233] due to the phylogenetic proximity

of this species to Ae. japonicus [161, 234]. The rearing conditions were as follows: 26

± 1°C temperature, 65 ± 5% relative humidity and a 16-hour light:8-hour dark cycle,

without crepuscular periods.

There were considerable rearing problems under these conditions (a lack of

oviposition and colony decline), and it was hypothesised that temperature was

affecting the colonisation success. Ae. koreicus egg development was then compared,

from hatching to adult, at two different rearing temperatures (23 ± 1°C and 26 ± 1°C).

The temperature choice of 23 ± 1°C was based on average summer temperatures in the

native range of Ae. koreicus in South Korea and in the mountainous area of Belluno,

Italy [14].

The effect of temperature on egg hatching was tested on eggs collected from the

field (IZS Belluno) (46.1477339° N 12.2046886° E) using Masonite® sticks (as

oviposition substrates) partially submerged in rainwater in 60L black bins (ABM Italia

S. p. A.) (Figure 4.1). Once collected, the eggs were hatched in rainwater in the

laboratory over 17 days (8th of July to 25th July, 2014). During hatching, 204 eggs were

held at the higher temperature range (26 ± 1°C), while 233 eggs were exposed to the

lower temperature range (23 ± 1°C). Hatched larvae were fed on an aqueous solution

of ground Tetramin® fish food (0.125 g/ml) ad libitum (dry Tetramin® fish food powder

directly added to the trays was observed to cause excessive bacterial scum and larval

death). Based on the results of this experiment, the Ae. koreicus colony was reared at

23 ± 1°C.


Figure 4.1 Masonite® sticks partially submerged in rainwater (IZS Belluno).

4.2.2 Establishment of an Ae. koreicus colony

Eggs from the Italian colony reared in the laboratory at IZSVe were used to

establish a new colony of Ae. koreicus at QIMR Berghofer Medical Research Institute

under import permit IP 14001574. Rearing conditions for the new colony of Ae.

koreicus were: 23 ± 1°C temperature, 75 ± 5% relative humidity and a 12-hour light:

12-hour dark cycle, with crepuscular periods (Figure 4.2). Larvae were reared in 45 x

40 x 5 cm white plastic trays that contained approximately 5 L of rain water or de-

chlorinated tap water and never exceeding a density of 500 larvae per tray (Figure 3.3).

They were fed on an aqueous solution (0.125 g/ml) of ground Tetramin® fish food

added to the trays, never exceeding the following amounts: 0.5 ml of Tetramin® fish


food solution for first and second instar larvae, 1 to 2 ml for third instar larvae, and 2

ml for fourth instar larvae. In the first stages of larval development (L1 and L2), the

aqueous food solution was provided every two days. Food was supplied daily during

the subsequent development stages (L3 and L4). Water levels were maintained by

adding fresh rain water or de-chlorinated tap water to the trays. Pupae were

individually ‘picked’ from larval trays using a 1.5 ml pipette and transferred to the egg

collection trays (© 2014 Genfac Plastics Pty Ltd, 18.3 x 15.2 x 6.5 cm). These trays

contained rain water and Masonite® sticks as oviposition substrates for the emerging

adults. Pupae density did not exceed 250 pupae per tray. Trays were placed inside adult

colony cages (BugDorm® Insect Rearing Cage, 30 x 30 x 30 cm) in preparation for

adult emergence, mating, and oviposition.

Once emerged, adult mosquitoes were provided with a 10% w/v sucrose solution

ad libitum and allowed to feed on the arm of a human volunteer (QIMR Berghofer

Human Research Ethics Committee permit QIMR HREC361) or defibrinated sheep

blood (Thermo Fisher Scientific® Aust Pty Ltd) supplied through glass membrane

feeders covered by a porcine intestinal membrane [235]. No forced mating was

required. Following oviposition, Masonite® sticks with Ae. koreicus eggs were

routinely placed on dry paper towels to absorb excess water for no longer than 10

minutes. The sticks were then stored in anti-leak plastic bags that were sealed to

prevent desiccation, as suggested by Crampton et al [236] and maintained at 23 ± 1°C.


Figure 4.2 Environmental chambers at the QIMR Berghofer Quarantine Insectary

containing Ae. koreicus colonies.


Figure 4.3 Masonite® sticks with Ae. koreicus eggs submerged in rain water.

4.2.3 Egg storage and embryo development

Unusually low hatch rates were observed during the process of building the

colony. It was unclear whether this was typical of Ae. koreicus populations or the result

of pre-hatch death caused by artificial rearing conditions. Embryo development and

viability in stored eggs was therefore examined. After 14 days of storage in a sealed

anti-leak plastic bag, one Masonite® stick holding 1,189 eggs was observed under a

stereoscope to assess damage or contamination by mould that could produce

mycotoxins and affect egg viability [237]. Following the evaluation of egg integrity

under a stereoscope, a segment of the Masonite® stick holding a total of 95 undamaged

eggs was then cleared for 30 minutes in a 50% v/v HCl solution modifying the method

used by Trpiš [238] and observed under a stereoscope to confirm the presence of an

intact embryo. The remaining 1,094 eggs were submerged in a hatching tray with 5 L


of rain water. Larvae were fed with the typical colony rearing food regimen and the

number of adults obtained was recorded.

4.2.4 Sexual dimorphism in pupae

Morphological features of the 10th abdominal segment (genital lobe) of Ae.

koreicus pupae were investigated as a means of distinguishing males from females.

Pupae were inspected in a water droplet on a slide under 20x magnification. Cover

slides were not used, as they damaged the pupae (Figure 4.4).

Figure 4.4 Ae. koreicus pupae.

4.2.5 Fecundity-size relationship evaluation

To determine whether wing length could be used as an indicator of fecundity in

Ae. koreicus, a batch of larvae was divided between four trays of 100 larvae each, three

days after hatching. The volume of water per tray was 5 L. Different feeding regimes

were applied in order to create mosquito cohorts of different sizes. One group was

provided with an aqueous solution of ground Tetramin® fish food (0.125 g/ml) ad

libitum, larvae from three other groups were fed with the same solution at various

ratios: first instar larvae were given respectively 0.05, 0.1, and 0.2 ml fish food solution

1 cm


per tray; second instar larvae were fed 0.1, 0.2, and 0.4 ml of food per tray; third instar

larvae were fed 0.15, 0.3, and 0.6 ml of food per tray, and fourth instar larvae were fed

0.2, 0.4, and 0.8 ml of food per tray daily.

Adults that emerged from these rearing trays were maintained at the colony

rearing conditions and blood-fed to repletion on a human host (QIMR Berghofer

Human Research Ethics Committee permit QIMR HREC361) approximately five days

after eclosion. Five days after blood feeding, female mosquitoes were removed from

the cage and killed (using CO2). The length from the arculus to the wing tip, excluding

the fringe scales, was measured as a proxy of body size (Figure 4.5). Both wings were

removed and dry mounted on a glass microscope slide, with a mean length calculated

in cases where the right and left wings differed in size [224-228].

Figure 4.5 Ae. koreicus wing

Ovaries were dissected in a drop of phosphate-buffered saline (PBS) on a glass

microscope slide under a stereoscope at a magnification of 10x, and the number of

mature follicles (stages IVb and V) were counted [224, 226]. Ovary development

Arculus Wing tip


stages were classified according to Clements and Boocock [239], modified from

Christophers [224, 226, 240, 241] (Figure 4.6).

Figure 4.6 Egg follicle development in mosquitoes [242].

4.2.6 Data analysis

Ae. koreicus egg development was compared at two different rearing

temperatures (23 ± 1°C and 26 ± 1°C) using the 𝜒2 test (GraphPad Prism Program,

GraphPad Software, San Diego, CA, USA). To determine the fecundity-size

correlation, a linear regression analysis (GraphPad Prism Program, GraphPad

Software, San Diego, CA, USA) was performed using the number of mature follicles

and wing length.


4.3 RESULTS AND DISCUSSION

4.3.1 Effect of temperature on egg hatching and development

From a total of 233 eggs reared at IZSVe laboratory in Italy at 23 ± 1°C, 39.4%

reached the adult stage (n=93: 37 males, 56 females). By contrast, the percentage of

adults obtained from the 204 eggs reared at 26 ± 1°C was just 3.4% (n=7: 3 males, 4

females), showing that significantly more Ae. koreicus adults developed at the lower

temperature than at the higher temperature (p<0.0001, 𝜒2= 82.04). These egg cohorts

emerged slowly, with a great deal of variation in emergence times (Figure 4.7).

Following this finding, the rearing temperature of the Ae. koreicus colony in Italy was

adjusted to 23 ± 1°C. After three months, 8,860 eggs had been collected, which were

then sent to QIMR Berghofer Medical Research Institute to start a new Ae. koreicus

colony for vector competence and behavioural studies.

Figure 4.7 Effect of temperature on the emergence of adult mosquitoes after 17 days

from eggs water submersion.


4.3.2 Establishment of an Ae. koreicus colony

The development times and hatching rates of the QIMR Berghofer colony at 23

± 1°C are reported in Table 4.1.

Table 4.1 Development parameters for Ae. koreicus reared at a temperature of 23 ±

1°C

Time to

pupation

(Days ± SE)

Time to pupae

eclosion

(Days ± SE)

Interval between blood

meal and oviposition

(Days ± SE)

Hatching

percentage

(%± SE)

9.29 ± 0.18 3.43 ± 0.3 11.5 ± 3.5 10.39 ± 2.09

This species showed a low percentage of hatching derived from the number of

pupae obtained after nine days of egg submersion in water. Subsequent observations

demonstrated that the eggs could remain submerged but viable for very long periods.

The cumulative proportion of pupae obtained from submerged eggs over a period of

80 days is shown in Figure 4.8.

Figure 4.8 Pupal development measured over 80 days of submersion across four

different trays.


The long viability of submerged eggs could be due to embryo dormancy, a

demonstrated survival strategy in other mosquitoes [243]. The emergence of adults

over a long period after water submersion could represent a mechanism that permits

coexistence with competing species. Another potential competitive advantage is

earlier hatching during the spring season, as observed when Ae. koreicus shares the

same breeding sites with Ae. albopictus [14].

4.3.3 Egg storage and embryo development

From the observation of 1,189 eggs at 14 days post storage, a total of five eggs

were found to be desiccated and three eggs were hatched. All of the other eggs

appeared normal. After clearing a portion of the eggs (n= 95) to determine the embryo

development status, a total of 83 mature intact embryos were observed under the

stereoscope (87.4%, n= 95). Each embryo was considered mature when eye spots and

thoracic and abdominal hair tufts were clearly visible, which is typical of a fully

developed embryo [244] (Figure 4.9). Twelve eggs were lost in the media during the

clearing process and were not evaluated. Although embryonation was confirmed, only

25 first instar larvae were observed after 36 hours of water submersion of the

remaining eggs (2.3%, n=1094). Pupation was observed from day nine onwards. After

14 days, only 20 of the 25 original larvae had reached adult stage. This study confirmed

that a low hatching rate does not appear to result from inadequate storage of eggs.


Figure 4.9 Fully formed embryo of Ae. koreicus after egg clearing.

4.3.4 Sexual dimorphism in pupae

The characteristic conformation of the 10th abdominal segment after dissection

and in live pupae allows for distinguishing of sex using the features shown in Figure

4.10. Following examination, pupae were individually placed in water containers and

the sex of the emerging adults was confirmed. Observation of the genital lobe in pupae

allowed for 100% successful separation between male and female Ae. koreicus. The

genital lobe is shield-shaped and bifurcate in both sexes. In males though, it is

obviously bigger and less pointed on its ends, compared to females.


Figure 4.10 Ae. koreicus male and female genital lobe.

(a) male genital lobe after dissection, (b) male pupae alive in a water drop. (c) female genital lobe

after dissection, (d) female pupae alive in a water drop.

4.3.5 Fecundity-size relationship evaluation

A strong relationship was detected between fecundity (number of eggs) and

female size (with wing length as a proxy) (Figure 4.11; P ˂ 0.0001, r2 = 0.6051; n=51):

the larger the female, the more likely it was to have more eggs. This indicates that the

size of the individuals collected from the field could be related to fecundity.

a

b

c d


2 .5 3 .0 3 .5 4 .0 4 .5 5 .0

0

5 0

1 0 0

1 5 0

2 0 0

2 5 0

W in g le n g th ( m m )

Fe

cu

nd

ity

(e

gg

s)

Figure 4.11 Relationship between wing length and fecundity of Ae. koreicus.

4.4 CONCLUSIONS

The establishment of a laboratory colony of Ae. koreicus was challenging. The

first attempts to establish Ae. koreicus in the laboratory were unsuccessful and required

significant adaptation. In particular, the temperature of 26°C suggested in Williges et

al. [233] had to be lowered to 23°C before Ae. koreicus developmental rates were

sufficient to create a stable colony.

The relatively low rearing temperature of this species may affect important

biological characteristics, such as development times and the length of the gonotrophic

cycle [245]. The length of this cycle in Ae. koreicus is indeed three to four times greater

than that in Ae. albopictus reared in the laboratory at 27°C [246]. This may be

advantageous for colony maintenance, as Ae. koreicus’ long development times permit

Y = 88.51*X - 239.6

R2 = 0.6051


more flexibility in routine rearing procedures. Moreover, it is a factor to be carefully

considered when designing experiments. An additional limitation when designing

experiments is the low hatching percentage in the laboratory (10.4 ± 2.1). Vector

competence experiments require a high number of mosquito females to be

synchronised in their development to standardise feeding and remove age-related bias

in infection or survival. As low numbers of pupae were obtained after nine days of

water submersion, it could be difficult to create cohorts for large scale experiments.

The low hatching rate after initial submersion and long viability of eggs

submerged in water may have been due to a phenomenon called ‘embryo dormancy’,

a demonstrated survival strategy for Anopheles gambiae to survive the dry season in

Kenya to resist adverse climatic conditions [243]. In the case of Ae. koreicus, this

species may utilise embryo dormancy to survive temperature drops typical of

mountainous areas during the summer season. Further studies will assist to clarify this

hypothesis.

The length of the gonotrophic cycle, limiting the number of new offspring

obtainable in a short time period, together with the low hatching percentage of Ae.

koreicus, emphasises the need to develop a method of sexing pupae. As part of this

investigation, a technique described by Moorefield [247] was adapted to successfully

differentiate Ae. koreicus males and females at the pupal stage, with the goal of being

able to separate the sexes prior to adult emergence, and therefore ensure the creation

of cohorts of virgin mosquitoes. The ability to separate the sexes at this stage provided

a far more efficient means of creating virgin cohorts for reproductive studies than

relying on size differences. Indeed, although differentiation of males and females

could be based on the pupae dimensions and development time (males of some species

are smaller and typically also develop before females [248-250]), these differences are


not applicable to all mosquito species [247]. With such a low hatching rate, a method

based on these differences was not appropriate for Ae. koreicus. Nevertheless, in cases

of high numbers of individuals available, differentiation based on pupal dimensions

and age rather than genital characteristics could be faster. In cohorts created using

pupal dimensions and age, male and female accidental mixes could easily occur, with

the entire cohort being discharged. Due to the low number of Ae. koreicus obtainable,

a more accurate differentiation method based on the observation of pupal genital lobe

conformation in live pupae allowed for the evaluation of the fecundity-size

relationship, to the demine presence of autogeny (Chapter 5) and to observe the mating

behaviour of this species (Chapter 5). This approach has been used in studies on Ae.

albopictus and Ae. aegypti, which can also be sexed by examining the genital lobe

differences under a dissecting microscope [5, 191].

The strong fecundity size relationship observed in this colony (Y = 88.51 * X –

239.6, P ˂ 0.0001, r2 = 0.6051; n=51) has previously been described in other mosquito

species [225, 251]. It is an important indication that the size of the individual collected

in the field relates to fecundity and can be used to assess population density and

identify whether a population is growing or decreasing. For instance, in Ae. albopictus

and Ae. aegypti, when the size of female mosquitoes in a population declines, the

number of eggs laid (fecundity) is also thought to decline in a linear regression

correlation [225, 251]. This has been shown to negatively impact the population

performance (e.g., decline of the population) [230]. Moreover, the equation calculated

for the Ae. koreicus laboratory colony is critical information when evaluating the

interactions of different larval populations. The effect of larval competition on body

size could be related to mosquito fecundity, and therefore population fitness. An initial

investigation recently published by Baldacchino et al. [203] on larval competition


between Ae. koreicus and Ae. albopictus used wing length as a proxy for fecundity

when estimating population growth. Baldacchino et al. [203] made no empirical

investigation of this relationship in Ae koreicus, instead basing their assumptions on a

previous study by Farjana et al. [252] on Ae. albopictus and Ae. aegypti. This thesis

proves the relationship between fecundity and wing length in Ae koreicus for the first

time and confirms the applicability of this correlation in evaluating the population

dynamics of the performance of Ae. koreicus.


Chapter 5: Characterisation of key aspects

of Ae. koreicus mating biology

5.1 INTRODUCTION

The mating biology of Ae. koreicus is mostly unknown, yet reproductive success

plays a fundamental role in mosquito establishment and population growth [11, 253,

254]. Many aspects may influence the mating biology and reproductive success of

mosquitoes, including autogeny, competitive mating between introduced and

autochthonous individuals, and the presence of the endosymbiont Wolbachia pipientis.

In hematophagous insects, such as mosquitoes, completion of an ovarian cycle

and the production of viable offspring can occasionally occur in the absence of a blood

meal (‘autogeny’: Roubaud 1929 [255]). Autogeny is hypothesised to allow the

persistence of a population when the presence of vertebrate hosts is low, or to allow

for rapid growth of a mosquito population at the start of a season [2, 3]. This allows

mosquitoes to persist in uncertain environments and rapidly exploit optimal

conditions; however, the number of eggs laid is considerably lower compared to eggs

laid after a blood meal [256, 257]. Furthermore, this behaviour may delay contact with

infected hosts, and could therefore impact virus transmission and human infections

early in the season [258, 259]. Autogeny may be facultative or obligate depending on

the species and environmental conditions [260].

The autogeny phenotype has been demonstrated in the Culicinae and

Anophelinae mosquitoes [261, 262]. Within these groups, autogeny is commonly

reported in the genus Culex [263-265], but it is rare in Anopheles [266] and Aedes

mosquitoes [256, 267, 268]. However, one of the main mosquito threats of this century,

the invasive Ae. albopictus, displays autogeny in some populations [268]. Autogeny


could be stimulated by a series of factors, such as environmental temperatures [269],

or selective pressure, such as lack of available hosts for blood feeding [270]. Another

important component of autogeny is the female mating status: egg development in

certain mosquito species does not initiate unless mating occurs, and male accessory

gland products can play a central role for oogenesis [271, 272].

The ability to identify sperm in the Ae. koreicus female reproductive tract not

only rules out the possible lack of autogeny due to the absence of male stimuli, but is

also a fundamental step in the evaluation of mating behaviour and its potential role in

the spread of invasive species in a new territory. The establishment of an exotic species

may be facilitated by the disruption of conspecific mating by the aggressive mating

behaviour of invading males of different species [5]. It may also be facilitated by

interspecific cross-insemination (satyrization) [185, 186]. Satyrization (Ribeiro 1986

[187]) is a form of sterility caused by interspecific mating. For example, the transfer

of Ae. albopictus male accessory gland product to Ae. aegypti females causes them to

become refractory to further mating (including with conspecific males) [5, 192-195].

In nature this can lead to the development of Ae. aegypti resistance to satyrization in

populations sympatric with Ae. albopictus [4, 191]. Although Ae albopictus males are

particularly efficient in satyrizing Ae. aegypti females, these behaviours are not a

peculiar characteristic of Ae. albopictus/Ae. aegypti interactions, but are also common

to other mosquito species [188-190].

Aspects of mosquito reproductive behaviour can also be influenced by the

presence of the endosymbiotic bacteria Wolbachia pipientis. Wolbachia are small

(0.5–1μm), intracellular, α‐proteobacteria originally identified from the ovaries of

Culex mosquitoes in 1924 [273] and known to infect the reproductive organs of 40-

60% of insect species [274, 275]. They can affect host reproduction by increasing the


reproductive success of infected females; thus, enhancing the bacteria’s maternal

transmission and changing male sperm structure such that only mating with a male

infected by the same bacterial strain will lead to progeny (a mechanism called

cytoplasmic incompatibility) [276]. In some cases, Wolbachia can induce

parthenogenesis [277], influence fecundity [278], or oogenesis [279, 280].

The following experiments investigated factors potentially involved with

reproductive biology of Ae. koriecus that have not previously been explored. In parallel

to the study to explore the presence of autogeny in Ae. koreicus, the mating behaviour

of mosquitoes was also observed to prove that insemination in artificial conditions

occurred and to detect the presence of sperm in the female mosquito spermathaecae.

Moreover, the potential for satyrization and disruption of Ae. koreicus mating by the

sympatric species Ae. albopictus, whose male aggressive mating behaviour towards

other interspecific females has been observed before [6], was also examined. To

complete the initial investigations into Ae. koreicus reproduction behaviour, testing

was performed for the presence of the endosymbiotic bacteria Wolbachia pipientis in

samples collected from the field in an area where Ae. koreicus is known to be endemic.

5.2 METHODS

5.2.1 Determination of autogeny in Ae. koreicus

Ae. koreicus larvae were obtained from colony eggs laid on Masonite® sticks on

the 3rd and 16th of May 2016 and 17th of June 2016 and submerged in rain water.

Collections were pooled to create a suitable number of individuals for the experiment,

due to the low hatching rate of this species [281]. Pupae developed after nine days and

were sexed using the method previously described in Ciocchetta et al. [281]. Male and


female pupae were confined together in three different cages (BugDorm® Insect

Rearing Cage, 30 x 30 x 30 cm) at the following initial numbers: cage 1, 161 males,

163 females; cage 2: 161 males, 174 females; cage 3: 161 males, 170 females.

The cages were maintained at the rearing colony conditions [281] in

environmental chambers (Panasonic, Osaka, Japan) (Figure 5.1). A 10% w/v sucrose

solution was provided ad libitum and each cage was equipped with one egg collection

tray (© 2014 Genfac Plastics Pty Ltd, 18.3 x 15.2 x 6.5 cm) with rain water and

Masonite® sticks as oviposition substrates (Figure 5.2). The position of the cages

within each environmental chamber was changed twice per week to minimise

positional bias. The number of adults obtained from pupae was counted. The cages

were checked daily for evidence of oviposition. After three weeks of caging, cage 2

was randomly chosen to proceed to blood feeding on human volunteers (QIMR

Berghofer Human Research Ethics Committee permit QIMR HREC361). The

percentage of fed mosquitoes was recorded. Two weeks after blood feeding, (seven

days from the start of oviposition in cage 2), eggs were collected, counted, and stored

in an anti-leak plastic bag. Additionally, five female mosquitoes from cage 2 and 10

female mosquitoes from cages 1 and 3 were killed (using CO2), and their ovaries were

dissected in a drop of phosphate-buffered saline (PBS) on a glass microscope slide

under a stereoscope at a magnification of 10x to observe for the presence of mature

follicle development (stage IVb and V) [224, 226, 239-241] (Figure 4.6). The number

of dead mosquitoes per cage was also recorded. The viability of a subsample of eggs

collected from cage 2 (n= 1189) was measured after 14 days of storage (refer to Section

4.2.3 Ae. koreicus egg storage and embryo development) to ensure the successful

completion of the gonotrophic cycle in cage 2. Observation of Masonite® sticks for


production of eggs in cages 1 and 3 continued until all adult mosquitoes had died to

ensure that no latent autogeny was displayed.

Figure 5.1 BugDorm® cages in the environmental chamber


Figure 5.2 Egg collection tray with rain water and Masonite® sticks.

5.2.2 Observing Ae. koreicus mating behaviour

Ae. koreicus pupae were derived from mosquito eggs laid on Masonite® sticks

(see Section 5.2.1). Pupae were sexed according to Ciocchetta et al. [281] and 190

males and 240 females were separated into two different BugDorm® cages (BugDorm®

Insect Rearing Cage, 30 x 30 x 30 cm) placed in an environmental chamber (Panasonic,

Osaka, Japan) for emergence, at the previously described colony rearing temperature

and relative humidity [281]. The light/dark cycle was reversed to observe mosquito

behaviour during the crepuscular period and at night in the course of the operator

daytime: Ae. koreicus have been observed to mate in the dark (Silvia Ciocchetta,

personal observation). The environmental chamber used for the experiment was

equipped with a video camera (Samsung SHC-735 1/3" High Resolution, Wide

Dynamic Range Camera) connected to a laptop (Dell Latitude E6540) and to infrared

lights (GANZ Infrared Light, IR50/30-850nm) for night-time recording (Figure 5.3).

The observation cage was a modified BugDorm® cage with transparent plexiglass used

on one side of the cage instead of mesh to allow for clearer images to be captured


during videorecording. Males were allowed a sufficient period for genitalia and sperm

development before mating [282], whereas females are usually ready for copula when

they emerge [253]; thus, six to seven-day old virgin males and two to three days old

virgin females ready for copula were caged together and mosquito behaviour recorded.

At twelve to thirteen-hour intervals, 25 females were aspirated from the experiment

cage, anaesthetised with CO2 and dissected in a drop of phosphate-buffered saline

(PBS) on a glass microscope slide under the stereoscope at a magnification of 10x. A

cover slip was placed over the spermatechae to allow for rupture and sperm

visualisation, and spermatechae content was then observed under a microscope at a

magnification of 40x.


Figure 5.3 The environmental chamber used for the Ae. koreicus mating experiment

5.2.3 Preliminary observations on Ae. albopictus and Ae. koreicus mating

interaction

Ae. koreicus larvae were reared as per Ciocchetta et al. [281]. Ae. albopictus

larvae (from a colony established from eggs collected on Hammond Island, Torres

Strait, Australia, in May 2014) were similarly reared, but at a temperature of 27 ± 1°C.

Mosquitoes of both species were synchronised to pupate at the same time. The pupae

were individually placed in Falcon® tubes containing 5 to 10 ml of rain water to emerge

(Figure 5.4) in order to allow for the creation of two different virgin cohorts. Three to

four days old Ae. albopictus males (n=27) ready for copula [282] were introduced in a


BugDorm® cage containing a solution of 10% w/v sucrose and two to three-day old

virgin Ae. koreicus females (n=22). The interaction between the two mosquito species

was recorded utilising a GoPro® Hero 3 camera. After five days, all female mosquitoes

were anesthetised with CO2 and the spermathaecae (three per female mosquito) were

dissected in a drop of saline buffer under the stereoscope and mounted on a slide to be

subsequently observed at a magnification of 40x to evaluate whether successful sperm

transfer had occurred.

Figure 5.4 Ae. koreicus and Ae. albopictus (a) pupae and (b) adult individuals in

Falcon® tubes.

5.2.4 Wolbachia presence in field-collected Ae. koreicus

Field-collected Ae. koreicus sampled during a survey carried out in north-eastern

Italy from 2011 to 2015 [18] were screened for the presence of Wolbachia pipientis.

Females (n=21) were collected in Belluno (46°08'44.3"N 12°12'38.0"E) in July 2014,

a

b


preserved in RNA (Invitrogen™), and stored at -80°C. DNA was extracted using

QIAGEN DNeasy® Blood and Tissue Kit. The extracted DNA was utilised as a

template for the polymerase chain reaction (PCR) targeting the Wolbachia-specific

wsp and 16s genes and the mosquito housekeeping RpS17 gene, which acted as a

positive control for the extraction:

(wsp F: 5´– TGGTCCAATAAGTGATGAAGAAAC–3´, R: 5´–

AAAAATTAAACGCTACTCCA–3´; 16s F: 5´–

TTGTAGCCTGCTATGGTATAACT–3´, R: 5´–

GAATAGGTATGATTTTCATGT–3´; RpS 17 F: 5´–

TCCGTGGTATCTCCATCAAGCT–3´, R: 5´–CACTTCCGGCACGTAGTTGTC–

3´) [283-285].

PCR with wps primers was performed using a Phusion® High-Fidelity PCR Kit

with initial denaturation at 98°C for 30 sec, followed by a 34 cycles consisting of 98°C

for 10 seconds, 59°C for 30 seconds, and 72°C for 30 seconds and a final extension

step at 72°C for 10 minutes. The same protocol was applied with 16s and RpS17

primers, but the annealing temperatures were 56°C for 16s primers and 58°C for RpS17

primers.

DNA for positive controls was extracted from four Ae. aegypti from a colony of

wMel-infected A. aegypti from QIMR Berghofer Insectary [286] using the same

extraction kit of the target samples. In each PCR, a sample from an Ae. aegypti

wildtype colony (QIMR Berghofer) that was negative for Wolbachia was also tested.

Culex sitiens mosquitoes (n=3) infected with Wolbachia (QIMR Berghofer) extracted

using QuickExtract™ DNA Extraction Solution (Epicentre Technologies Corporation)

were tested as an additional positive control.

http://www.sabiosciences.com/pathwaymagazine/pcrhandbook/qiagen-dneasy-blood-tissue-kits.php

https://www.neb.com/products/e0553-phusion-high-fidelity-pcr-kit

https://www.neb.com/products/e0553-phusion-high-fidelity-pcr-kit


5.3 RESULTS

5.3.1 Lack of autogeny in Ae. koreicus

Pupal emergence was completed in nine days. A total of 123 males and 134

females emerged in cage 1, 116 males and 146 females emerged in cage 2, and 103

males and 138 females emerged in cage 3. No eggs were observed in the oviposition

trays of the three cages of the experiment up to three weeks from the initial co-caging.

After this period, a volunteer fed the mosquitoes held in cage 2 (97.2% fed, n= 109)

and oviposition on Masonite® sticks occurred seven days post-feeding. Mature

follicles were observed in all five mosquitoes dissected from cage 2. No eggs were

observed on Masonite® sticks in cages 1 and 3, and no mature follicles were found in

the mosquitoes dissected from those cages. The percentage of male and female

mosquitoes still alive at the time of these observations were: cage 1= males 8.9% (n =

123), females 59.7% (n = 134); cage 2 = males 44.8% (n = 116), females 67.1% (n =

146); cage 3 = males 25.2% (n = 103), females 71.0% (n = 138). A total of 4,925 eggs

were counted under the stereoscope from the Masonite® sticks collected from cage 2

(average eggs/female = 50.25, consistent with a previously reported fecundity index

[281]).

5.3.2 Observing Ae. koreicus mating behaviour

No sperm was observed in spermatechae from female mosquitoes dissected 12

and 25 hours after co-caging. Video recording confirmed that no mating activities

occurred in this time window. Mating activity was observed after 25.5 hours showing

Ae. koreicus males and females in the act of copula [287].

Evidence of motile sperm in Ae. koreicus female spermatechae (Figure 5.5) was

found in 28% of females (n=25) sampled after 31 hours of co-caging with males


(females were sampled 5.5 hours after evidence of mating activity in the cage to allow

the sperm a sufficient period to reach the spermatechae [282]) [288].

Figure 5.5 Ae. koreicus sperm visible after spermatechae rupture.

5.3.3 Preliminary observations of Ae. albopictus and Ae. koreicus mating

interaction

Despite repeated interactions between Ae. koreicus female and Ae. albopictus

males [289], no sperm was detected in the 66 spermathaecae dissected (Figure 5.6).

Differences in the size of the mosquitoes (Ae. koreicus females were visibly bigger

than Ae. albopictus males; Figure 5.7) may have been a possible cause for the failure

in interspecific insemination.

Ae. koreicus sperm


Figure 5.6 No evidence of Ae. albopictus sperm in Ae. koreicus spermathaecae (a)

before and (b) after rupture.

Figure 5.7 Difference in size between Ae. koreicus female (left) and Ae. albopictus

male (right).

a

b


5.3.4 Wolbachia absent in field-collected Ae. koreicus

No Wolbachia was identified in the Ae. koreicus field samples. The DNA

extraction was validated by running a PCR analysis using RpS17 housekeeping gene

primers for mosquito DNA (Figure 5.8-5.10), and Wolbachia was detected by the wsp

and 16S primers in all positive controls.


oligonucleotide primers corresponding to Wolbachia gene wsp.

(a) positive controls indicated by the symbol + (Ae. aegypti Wolbachia infected, QIMR Berghofer),

Ae. koreicus samples lanes 84 to 96; (b) Ae. koreicus lanes 97 to 104, positive controls indicated by

the symbol + (Culex sitiens Wolbachia infected, Chen Wu, QIMR Berghofer), Ae. aegypti wildtype

Wolbachia-free, QIMR Berghofer.



oligonucleotide primers corresponding to Wolbachia gene 16S.


Ae. koreicus lanes 84 to 92; (b) Ae. koreicus lanes 93 to 104, positive controls indicated by the symbol

+ (Culex sitiens Wolbachia infected, Chen Wu, QIMR Berghofer), Ae. aegypti wildtype Wolbachia-

free, QIMR Berghofer.



oligonucleotide primers corresponding to the housekeeping gene RsP17.


Ae. koreicus lanes 84 to 95; (b) Ae. koreicus lanes 96 to 104, positive controls indicated by the symbol

+ (Culex sitiens Wolbachia infected, Chen Wu, QIMR Berghofer), Ae. aegypti wildtype Wolbachia-

free, QIMR Berghofer.


These studies explored the probability of an autogenic phenotype in the Ae.

koreicus QIMR colony. Autogenic behaviour may also affect vectorial capacity.

Defined as the possibility to produce offspring in the absence of a blood meal,

autogeny can influence the vector potential of a mosquito by affecting the abundance

or persistence of vectors, even in the absence of immediate hosts [258, 290].

Conversely, autogeny may limit contact with hosts [258, 259]. The results obtained

when exploring the autogenic behaviour of the established colony suggest that Ae.


koreicus did not display this phenotype under the conditions of this experiment. There

was no oviposition when mosquitoes were deprived of a blood source. In early studies

with the mosquito Aedes taeniorhynchus, O’Meara et al. [271] showed that mating

may increase the levels of autogeny and that the expression of autogeny is correlated

to the environmental conditions in which the larval stages develop and the

geographical origin of the population [269]. In this species, mating was necessary only

when larvae were exposed to conditions unfavourable to their development, and was

otherwise not required for the production of viable eggs [269]. The observation of Ae.

koreicus mating behaviour and the detection of sperm in Ae. koreicus spermathecae

confirmed that the absence of autogeny was not due to a lack of mosquito mating.

Moreover, autogenic populations of Ae. japonicus, a species phylogenetically close to

Ae. koreicus, have never been reported in the literature. It was hypothesised that Ae.

koreicus may be an anautogenous mosquito; however, although autogeny was not

present in the studied colony, the phenotype could still be present in different Ae.

koreicus populations, as previously found in Ae. albopictus [268, 291].

The delay of 25.5 hours being observed before mosquito mating could be due to

different factors. Although adult female mosquitoes are ready to be inseminated once

they emerge, male antennae and genitalia at the moment of imaginal stage emergence

are not in the correct morphological conformation to allow copula. Physical changes

must occur for the males to become sexually active [292]. These changes include the

erection of fibrillar hairs in the antennae (Figure 5.11), (important for female

localisation [293]), and the permanent 180° rotation of terminalia part of the genitalia

to correctly orient the male genital structure for mating (Figure 5.12) [294]. In

particular, the time required for this rotation varies among mosquito species and can

take up to four days, for example, as reported in the species Aedes provocans [295].


The time of Ae. koreicus male genitalia rotation is not known; which justifies the

choice to cage females with six to seven day old virgin males. Although unlikely, it is

still possible that males of this species require more time for sexual maturation.

Moreover, mating may be encouraged by behaviours displayed in the wild, such as

swarming [296], that are impossible to create in a laboratory colony due to limited

space in cages, which could be another factor explaining the delay observed from

mosquito co-caging to pairing.

Figure 5.11 Ae. koreicus male antennal hairs.


Figure 5.12 The reproductive system of female (in red) and male (in blue) Aedes and

the sperm transfer during copulation (represented by the arrows) [297].

The most recent information on Ae. koreicus distribution in Italy details the

expansion of this mosquito into the territory, and refers to its adaptation to

mountainous areas previously spared the invasion of Ae. albopictus [15]. Ae. koreicus

seems to not compete with Ae. albopictus in areas of sympatry, and the presence of the

latter therefore seems unlikely to have an impact in containing the spread of Ae.

koreicus. In most cases in the field, Ae. koreicus larvae are found alone and adults of

this species develop earlier compared to Ae. albopictus in areas were populations

overlap [14, 298]. This scenario is similar to that which occurred in the case of Ae.

japonicus in the United States [299, 300] and may facilitate the invasion success of

Ae. koreicus in Europe. Moreover, larval competition between the two species in

laboratory studies is reportedly very weak, reducing Ae. koreicus survivorship only in

one case, in 20 Ae. albopictus:10 Ae. koreicus combinations, at low level diet;

however, the surviving Ae. koreicus developed faster and were bigger [203].


In the preliminary study exploring Ae. koreicus and Ae. albopictus mating

interaction, Ae. albopictus males showed repeated and aggressive mating attempts

towards Ae. koreicus, but were unable to transfer sperm to Ae. koreicus. The different

sizes of the two species might be one explanation for how this has played a role in the

outcome of this experiment. This might be ascribed to the different temperature of

larval rearing (27°C for Ae. albopictus and 23°C for Ae. koreicus). Low rearing

temperatures generally yield adults of bigger sizes [301]. Yet, the lack of sperm does

not necessarily exclude a satyrization effect produced by Ae. albopictus males, due to

the fact that transfer of male accessory glands products (responsible for the satyrization

effect) may occur even in the absence of sperm in the spermathaecae, as demonstrated

by Carrasquilla and Lounibos [2]. Although satyrization between these two species

seems unlikely, the aggressive mating attempts shown by Ae. albopictus males towards

Ae. koreicus females could prevent less aggressive Ae. koreicus males from mating,

and therefore lead to a decrease in Ae. koreicus population. Moreover, these

continuous interaction attempts by Ae. albopictus males could interfere with the

feeding behaviour of Ae. koreicus females, as already demonstrated in the case of Ae.

aegypti [6].

Wolbachia was not detected in Ae. koreicus from the established field population

in Belluno from which the studied colony was derived; thus, the endosymbiont is not

affecting Ae. koreicus reproductive behaviour, nor the mosquitos’ ability to transmit

viruses through its pathogen-blocking action [302-305].

Chapter 6: Vector competence of Ae. koreicus for chikungunya virus 92

Chapter 6: Vector competence of Ae.

koreicus for chikungunya virus

6.1 INTRODUCTION

The vectorial capacity and vector competence of Ae. koreicus are largely

unknown. The species is known to vector dog heartworm Dirofilaria immitis under

laboratory conditions [154, 155]; however, this finding is not supported by field

evidence [156]. Ae. koreicus infection with Wuchereria bancrofti has also been

documented [153], and this mosquito may have a role as an intermediate host for

Brugia malayi to infect humans [158]. Few studies have mentioned Ae. koreicus’

ability to transmit JEV in the laboratory and in the field [123, 140, 152]; however, JEV

was not detected in Ae. koreicus collected in Korea during more recent monitoring

activities [147-149].

Vector competence is defined as the ability of a vector to transmit a pathogen (in

this case an arbovirus) to another susceptible host [23]. It is determined largely by the

ability of wild mosquitoes to acquire and transmit a virus in the field. This is influenced

by the ecology and behaviour of the mosquito (i.e., the probability of biting an infected

host) and the ability of the mosquito to incubate and then transmit that virus to another

host. [42].

The vectorial capacity model applied by Reisen [306] to describe arbovirus

transmission is expressed by the equation:

𝐶 =𝑚𝑎2𝑉𝑝𝑛

− l𝑛 𝑝

where C is the number of new infections of a mosquito-borne pathogen disseminated

by a mosquito feeding on a single infected case per day, m is the number of female


mosquitoes per person, a is the proportion of blood-meals taken from humans, V is the

vector competence (or the proportion of female mosquitoes feeding on an infected host

that subsequently transmit a pathogen to a secondary host), p is the daily survival rate

of the vector population, and n is the extrinsic incubation period (EIP) of the parasite

in the vector (the number of days between a mosquito's infection and when it can

transmit a pathogen [307]). In this equation the interaction between vectors and viruses

is represented by two parameters, the vector competence (V) and extrinsic incubation

period (n).

Temperature is known to greatly affect virus-vector interactions. Different

temperature regimens may affect the EIP [308-310], viruses infection, and viral

dissemination to different tissues [311]. Many of the studies published in the literature

were performed under constant temperature [125, 312-317], although this does not

reflect conditions in nature, where temperatures are subjected to daily fluctuations.

This study tested the ability of Ae. koreicus to feed under artificial conditions,

the survivorship rate of this species after artificial feeding, and the likelihood of Ae.

koreicus to transmit CHIKV ‘La Reunion’ under constant and fluctuating temperature

regimes in the laboratory.

This variant of CHIKV, more adapted to the infection of Ae. albopictus, was

chosen because, until 2017, the largest outbreaks of CHIKV in Europe were caused by

strains belonging to the same clade [25]. The fluctuating temperatures mimicked those

occurring during a typical summer in Belluno, Italy, an area where there are

established and thriving populations of the Ae. koreicus mosquito. This temperature

regimen was introduced to aid the transposition of the experimental results to the ‘real

world’.


The model employed to perform the vector competence experiments under

quarantine conditions in the QC3 security level laboratories was based on a

preliminary experimental protocol established utilising Ae. albopictus mosquitoes

from the quarantine colony already established at QIMR Berghofer Insectary QC2

facility (Appendix I).

6.2 METHODS

6.2.1 Ae. koreicus feeding through a porcine intestinal membrane with

defibrinated sheep blood

Ae. koreicus feeding through a porcine intestinal membrane was performed to

test the percentage of mosquitoes feeding and surviving in order to design future vector

competence studies. Mosquitoes obtained at QIMR Berghofer Insectary were blood

fed following the same protocol applied for Ae. albopictus. A Petri® dish containing

dry ice was added near the feeding cups to produce CO2 to increase the feeding rate

(Figure 6.1).


Figure 6.1 Apparatus used to feed Ae. koreicus

6.2.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’

Mosquitoes sourced from Belluno were reared in the quarantine insectary at

QIMR Berghofer Medical Research Institute (QIMR Berghofer) as per Ciocchetta et

al. [281]. Infected Ae. albopictus mosquitoes sourced from Hammond Island, Torres

Strait (Australia) (also reared at QIMR Berghofer: Hugo et al. [70]) were used as

validation of the infection technique. Ae. albopictus are known to be susceptible and

easily infected with CHIKV ‘La Reunion’ [318, 319]. Mosquito infection and sample

processing were performed in a biosafety level 3 quarantine facility at QIMR

Berghofer.

After a 24-hour starvation period (in which the standard 10% w/v sucrose

solution was substituted with distilled water only), 342 adult female mosquitoes that

were three to five days old were transferred to 750 ml plastic containers (ca. 100


individuals per container) covered with gauze lids. The mosquitoes were allowed to

feed for one hour through glass membrane feeders (37°C) covered by a porcine

intestinal membrane filled with an infectious blood meal [235]. The infectious blood

meal was obtained by adding 1 ml of stock virus CHIKV ‘La Reunion’ strain (LR2006-

OPY1; GenBank KT449801 [320]) to 24 mL of defibrinated sheep blood (Life

Technologies, Mulgrave, VIC, Australia) at a final titre of 108 TCID50/mL. TCID50 is

the dilution ratio of the virus required to cause 50% mortality of cells used as a

substrate for inoculation: in this experiment these were C6/36 Ae. albopictus cells. The

infectious blood meal was sampled before and after feeding to ensure that there was

no degradation of virus titre over the feeding period. During feeding, a tube containing

dry ice generated a small amount of CO2 to encourage feeding activity (Ciocchetta,

unpublished observations). After feeding, mosquitoes were anesthetised with CO2 and

sorted on a cold Petri® dish. Males and non-engorged females were discarded.

Engorged females were transferred to a fresh container and maintained for 14 days in

environmental chambers (Panasonic, Osaka, Japan) at two temperature regimes: 1)

constant temperature of 23°C, with a 12 hour light:12 hour dark cycle and 75 ± 5%

relative humidity; 2) fluctuating temperature based on the average temperatures

registered during summer in Belluno (Italy) (Table 6.1) (data from Belluno Airport

Meteorological Station, code 264, 46°42′00″N-12°07′48″E, May to October 2011-

2014 [321]). Mosquitoes were kept under a 12-hour light:12-hour dark cycle and 75 ±

5% relative humidity. Mosquitoes were provided with 10% w/v sucrose ad libitum

during the holding period.

At three, 10, and 14 days post-feeding, Ae koreicus females were anesthetised

using CO2, and dissected (25 mosquitoes per each day). The Ae. albopictus controls

were included to validate the infection technique and were maintained at the constant


temperature regimen. Dissection occurred at day 10 only. Mosquitoes were dissected

and allowed to salivate for 20 minutes in collecting medium (RPMI 1640, 2% v/v

Foetal Bovine Serum (FBS), 1% v/v Penicillin-streptomycin, 0.25 μg/ml

Amphotericin B) (Gibco; Thermo Scientific, Waltham, MA, USA) as described in

Appendix I [322] before being stored at -80°C. The body and wings/legs and saliva of

each mosquito were placed in separate tubes (Appendix I). All samples were stored at

-80°C until processing.

Each mosquito body was placed in collecting medium, homogenised and

inoculated onto C6/36 cells cultured in 5% CO2 atmosphere at 27°C [319]. Wings and

legs were combined and processed in the same way as the body. Inoculations with

saliva and infected blood followed the same procedure, with the exception of the initial

homogenisation step: 10µL of collecting medium with the mosquito saliva were

directly inoculated to the plates after thawing. After a three-day incubation period, all

plates were assayed using the ELISA technique described in Appendix I. Detection of

CHIKV was performed using in house monoclonal antibodies (Hybridoma, clone D7)

that were diluted 1:200 in blocking buffer, with 50 µL added to each well. Cells

infected with CHIKV ‘La Reunion’ provided a positive control for the assay. The final

chromogenic substrate added to the plates consisted of 50µL/well of TMB (3,3′,5,5′-

Tetramethylbenzidine Substrate System, Sigma-Aldrich®). The plates were then

incubated in the dark for 30 minutes. A 50µL/well stop solution (Stop Reagent for

TMB Substrate, Sigma-Aldrich®) was added and the absorbency at 450 nm was

measured in a microplate reader (BioTek™ Synergy™ H4 Hybrid Microplate Reader).

Wells were scored as positive for virus when the optical density (OD) was greater than

twice the mean OD of the uninfected control wells [314]. The virus titres of individual

mosquitoes were determined by calculating 50% end points [323] expressed as the


log10 TCID50/mL. CHIKV ‘La Reunion’ infection was first tested in mosquito bodies.

Wings, legs, and saliva were processed only if the body samples were positive for the

virus.

Table 6.1 Daily fluctuating temperature regime under which Ae. koreicus was

maintained (75 ± 5% relative humidity, 12-hour light:12-hour dark cycle).

Phase Degrees (°C) Light step (Illuminance)

1 (0.15 h) 12 1 (1,667 Lx)

2 (0.15 h) 12 2 (3,334 Lx)

3 (2.30 h) 12 3 (5,000 Lx)

4 (3 h) 17 3 (5,000 Lx)

5 (3 h) 22 3 (5,000 Lx)

6 (2.30 h) 27 3 (5,000 Lx)

7 (0.15 h) 27 2 (3,334 Lx)

8 (0.15 h) 27 1 (1,667 Lx)

9 (3 h) 27 0 (0 Lx)

10 (3 h) 22 0 (0 Lx)

11 (3 h) 17 0 (0 Lx)

12 (3 h) 12 0 (0 Lx)

6.3 RESULTS

6.3.1 Ae. koreicus feeding through a porcine intestinal membrane with

defibrinated sheep blood

The preliminary artificial feeding of Ae. koreicus with defibrinated sheep blood

lead to 47.7% of mosquitoes fed (n=287). After six days, the percentage of mosquitoes

surviving was 98.5% (n=137).

6.3.2 Experimental infection of Ae. koreicus with CHIKV ‘La Reunion’

All Ae. albopictus (n=4) were positive for CHIKV at values consistent with

previous experiments (106 TCID50/mL, n=1; 106.5 TCID50/mL, n=3) [319] (Figure 6.2).


This expected result indicated that the infection protocols were robust. Ae. koreicus

demonstrated a high survivorship after 14 days at both constant and fluctuating

temperatures (95.8%, n=71; 98.1%, n=53) and high feeding rates (65.5%, n=342).

Virus titres in the blood before and after the feeding period (1 hour) were: 108

TCID50/mL and 106.5 TCID50/mL, respectively. Despite these very favourable

infection conditions, CHIKV ‘La Reunion’ was subsequently detected in a very small

percentage of mosquito bodies: in mosquitoes maintained at 23°C, positive bodies

were 13.8% (n=65), while in mosquitoes maintained at the fluctuating regimen, this

percentage was only 6.2% (n=64). Titres ranged from 102 -104.5 TCID50/mL (at 23°C)

and 102 -102.5 TCID50/mL (at the fluctuating temperature) (Figure 6.2).

Dissemination to wings and legs was observed in just four mosquitoes at days

three and 10 post-feeding (102 - 107 TCID50/mL, Figure 6.2) and salivary dissemination

occurred in two of those four individuals: 102.5 TCID50/mL at day three post-feeding

and 103 TCID50/mL at day 10 post-feeding (Figure 6.2). CHIKV ‘La Reunion’

disseminated to the wings and legs and reached the saliva of Ae. koreicus only when

held at a constant temperature (Table 6.2).


Table 6.2 CHIKV ‘La Reunion’ infection and dissemination to the wings/legs and saliva in Ae. koreicus mosquitoes maintained at 23oC and

fluctuating temperature (75 ± 5% relative humidity, 12-hour light:12-hour dark cycle).

Treatment Days post feeding N. engorged mosquitoes N. infected (n. tested) N. with virus in

wings/legs (n tested)

N. with virus in

saliva (n. tested)

23 °C 3 21 3 (21) 2 (3) 1 (3)

10 19 3 (19) 2 (3) 1 (3)

14 25 3 (25) 0 (3) 0 (3)

Fluctuating 3 21 4 (21) 0 (4) 0 (4)

T °C 10 21 0 (21) NT* NT*

14 22 0 (22) NT* NT*

NT*= Not tested as bodies were negative


Figure 6.2 Titres of CHIKV ‘La Reunion’ in Ae. koreicus measured three, 10, and 14 days post-feeding in mosquitoes at 23°C and at fluctuating

temperature (75 ± 5% relative humidity, 12 hour light: 12 hour dark cycle). The validation of the technique, using a small number of Ae.

albopictus, is also shown.



Effective feeding of mosquitoes under artificial conditions is essential to the

success of vector competence studies. When the feeding behaviour of Ae. koreicus

under experimental condition was evaluated, this species proved to be highly suitable

for vector competence studies due to the high percentage of fed females obtained and

the relatively long lifespan. This favourable result was facilitated by the introduction

of a CO2 source during feeding, a tool often utilised in the trapping of host seeking

mosquitoes [324].

The difference in infection and dissemination between temperature treatments

when the mosquitoes were infected with CHIKV may have resulted from either the

temperature fluctuation itself, or the difference in mean temperature (19.5°C in the

case of the fluctuating regime). Although mosquitoes were not held at a

constant 19.5°C to compare, it is hypothesised that the difference arose from the

temperature fluctuation itself. For example, Zouache et al. [325] investigated the

infection of Ae. albopictus and dissemination to salivary glands by a CHIKV strain

isolated from Reunion (E1-226V mutation) at day six post-exposure. Their

experiments, conducted at 20 and 28°C, showed that salivary dissemination rates were

similar at both temperatures [325]. Whatever the cause, it is clear that artificially

constant temperatures (23°C) yield different results to experiments that reflect ‘real

world’ temperature fluctuations.

In some instances, fluctuation at low temperatures can even shorten the EIP

(estimated in experimental studies as the time the virus is first detected in the salivary

glands). For example, for DENV 1 in Ae. aegypti [326], large fluctuation (18.6°C) at

a mean of 20°C is shown to reduce the EIP50 (defined in this study as the ‘time taken

for 50% of infected individuals to complete the EIP’) by approximately 36%, from


29.6 to 18.9 days compared to a constant temperature of 20°C. The impact of

fluctuating temperatures on EIP has been relatively poorly studied compared to

constant temperatures, therefore a clear prediction was difficult to make a priori in

these experiments. Sampling at days 10 and 14 post infection was expected to provide

ample time for salivary dissemination to occur at both temperature regimens. No

dissemination was observed for the fluctuating temperature at any time point. The

virus did reach salivary glands in one mosquito at three days post virus exposure when

held at a constant temperature.

Ae. aegypti and Ae. albopictus are the main vectors of CHIKV [327-332] with

Ae. albopictus being responsible for all CHIKV outbreaks in Europe [29, 333-336].

The average temperature in European cities experiencing CHIKV outbreaks is 20°C

or above [334], although maximum transmission potential is realised between 26–

29°C [337]. A number of other Aedes species are effective vectors of CHIKV under

laboratory conditions. CHIKV E1-A226V (the same mutation exhibited by the strain

used in this study) has been found to disseminate to the saliva of Aedes vigilax, Aedes

procax, and Aedes notoscriptus from Australia at rates ranging from 20% to 76% [312]

and to Ae. japonicus [125]. The latter species is phylogenetically close to Ae. koreicus

and showed a rate of 38.5% salivary dissemination of CHIKV [161, 234] at 14 days

post exposure, after incubation at 28°C. Consistent with this, Ae. koreicus also showed

vector potential under laboratory conditions. Its increasing range in Italy (Figure 1.3),

its human biting habit in some environments [126], and its capacity to incubate CHIKV

in its salivary glands after just three days suggests that the possibility of CHIKV

transmission by this species should not be disregarded.

These results indicate that only a small proportion of Ae. koreicus from the

studied laboratory colony could vector CHIKV under optimal rearing temperatures.


No impact was found on Ae. koreicus survival when simulating ‘real world’

temperature fluctuations typical of northern Italy; however, an even smaller number

of mosquitoes showed CHIKV infection and no virus was detected in the saliva. It

appears that realistic temperature fluctuations may mitigate the risks of transmission.

This is consistent with studies on dengue virus, in which mosquitoes exposed to

constant temperatures showed higher midgut infection levels [311] and higher

dissemination [338] rates compared with mosquitoes maintained at fluctuating

temperatures. A statistical comparison of the data for the two different temperature

regimens was not possible due to the low number of positive samples; however, the

results stress the importance of introducing ‘real world’ conditions when evaluating

transmission risks.

Relative humidity was a constant parameter in the temperature regimens used in

this study, although it may also be a variable that could affect Ae. koreicus vector

competence. It is therefore recommended that further studies also mimic the relative

humidity fluctuations that may impact virus dynamics and mosquito survival in the

field [339].

Chapter 7: Concluding discussion 105

Chapter 7: Concluding discussion

Ae. koreicus has shown its invasive potential in Europe over the past decade,

having extended its geographic range to several other countries [167, 169-172, 340]

since its initial discovery in Belgium in 2008 [167]. Despite this invasion, the ecology,

life history traits, and mating behaviour of this mosquito remain largely unknown. No

information has been reported regarding the potential for Ae. koreicus to vector

arboviruses, with the exception of early and limited observations on Japanese

encephalitis virus [123, 140, 152]. The data presented in this thesis elucidates some

of the biology of this mosquito and its capacity to vector human pathogenic viruses,

and also provides the first indication of susceptibility of Ae. koreicus to infection with

CHIKV, allowing better understanding of the public health risk this mosquito poses.

North-eastern Italy currently hosts the biggest established population of Ae.

koreicus in the European Union, with most of the municipality in the Veneto Region

already colonised [18]. However, the invasive ability of the mosquito necessitates

evaluation of effective surveillance techniques for the development of monitoring

programs in the field. With ovitraps showing limited utility for the collection of Ae.

koreicus eggs [179], the efficacy of additional tools such as BG-Sentinel, CO2, gravid

traps, and human landing catches was tested. None of these trapping tools returned

high numbers of Ae. koreicus, either in rural or urban settings. However, BG-Sentinel

traps baited with lure and CO2 captured the highest number of Ae. koreicus. The recent

establishment of the species in the study area [14] and the unfavourable weather

conditions during the sampling period (low temperatures and frequent precipitation)

may have negatively impacted the number of samples captured. The ability of the BG-

Sentinels baited with lure and CO2 to capture Ae. koreicus, even in conditions of low


densities, may be some measure of the efficiency of this trap. The human landing

experiment demonstrated that host-seeking Ae. koreicus feed on humans during the

late afternoon and evening. This species could therefore become a nuisance for the

population living in the area and impact on outdoor behaviours.

Ae. koreicus proved to be suitable for laboratory colonisation at the QIMR

Berghofer Quarantine Insectary. The mosquito develops at a lower temperature

compared to the closely related Ae. japonicus [233] and to other Aedes species

colonised at the QIMR Berghofer Insectary (Ae. aegypti and Ae. albopictus, both

reared at 27°C). The rearing temperature of 23°C may also explain its long gonotrophic

cycle [246]. Low but continuous hatching may represent an adaptive strategy

favouring the survival of Ae. koreicus at lower temperatures compared to Ae.

albopictus, and its presence in mountainous areas. The description of the sexual

dimorphism in Ae. koreicus pupae and the method of creating virgin cohorts of

individuals allowed for the evaluation of the species’ fecundity-size relationship and

reproductive behaviour. These results will facilitate further investigations into the

ecology, competition, and vectorial capacity of Ae. koreicus in laboratory and field

studies.

Prior to the work presented here, very little was known about the reproductive

biology of Ae. koreicus. Autogeny was not detected in the colony at QIMR Berghofer.

Observations of successful mating (validated by presence of sperm in Ae. koreicus

female spermathecae) confirmed that this was not due to a lack of mosquito mating

under laboratory conditions [271, 272]. These findings suggest that Ae. koreicus likely

does not display this phenotype, although different populations of the same mosquito

species can exhibit an autogenic phenotype when exposed to different environments

[268]. The observations of Ae. koreicus and Ae. albopictus reproductive interactions


provide the first indications of possible mating interference between these species. The

distribution of Ae. koreicus often overlaps with Ae. albopictus in northern Italy. Ae.

albopictus males display aggressive mating behaviour and are known to mate with

females of other species to sterilise them (satyrization) [3]. The experiment in this

study explored the willingness of Ae. albopictus males to copulate with Ae. koreicus

females, and the receptiveness of Ae. koreicus females to interspecific mating.

Although repeated insemination attempts by Ae. albopictus males were observed, no

sperm was transferred to Ae. koreicus females spermathecae. This might be a result of

the different sizes between the two species, as Ae. albopictus males are significantly

smaller than Ae. koreicus females. Further experiments are required to clarify whether

satyrization could occur between Ae. koreicus males and Ae. albopictus females.

A key aspect that could potentially influence Ae. koreicus reproduction and

vectorial capacity is the presence of the endosymbiont Wolbachia pipientis in

populations of Ae. koreicus. Transinfection of mosquitoes with one strain of

Wolbachia (wMelPop) has been proposed for arbovirus biocontrol due to its pathogen-

blocking activity [302-305, 341, 342]. This form of biocontrol could be applied to

reduce the vectorial capacity of Ae. koreicus in the field if the mosquito was proven to

be naturally Wolbachia-free. However, there was no evidence of Wolbachia in the

samples collected during the 2014 field activities.

An additional outcome of this study was the validation of primers targeting the

housekeeping gene RpS17 (designed based on the reference gene of Ae. aegypti [285])

for use in Ae. koreicus, a species for which genomic information is extremely limited.

The primers can now serve as a positive reference to test the quality of the genetic

material extractions and during gene expression studies.


Some information exists regarding the ability of Ae. koreicus to transmit JEV

and the parasite Wuchereria bancrofti [123, 140, 152, 153]. More recently, a study

confirmed the possibility of Ae. koreicus acting as a vector for a parasitic worm

Dirofilaria immitis [154, 155]. Using the information on Ae. koreicus development

time and percentage of hatching obtained from the colony in this study, a protocol was

designed to test the vector competence of Ae. koreicus for a major arbovirus threat to

Europe. Mosquitoes were challenged with CHIKV ‘La Reunion’ at high virus titres,

and maintained at 23°C, as well as a fluctuating temperature close to the climatic

conditions of the established population of Ae. koreicus in Italy. This virus strain (a

variant of CHIKV more adapted to the infection of Ae. albopictus) was chosen

because, until 2017, the largest outbreaks of CHIKV in Europe were caused by strains

belonging the same clade [25]. Virus was detected in the saliva of just two out of 65

(3.1%) exposed mosquitoes from the experimental group maintained at 23°C, one at

three and one at ten days post-feeding. No dissemination of the virus to wings, legs, or

saliva was noted under the fluctuating temperature regime. Infection of Ae. koreicus

indicates that a very small proportion of exposed mosquitoes will vector CHIKV.

When simulating real world temperatures in northern Italy, an even smaller proportion

of mosquitoes showed CHIKV infection, and no virus was detected in the saliva. These

results suggest that ‘real world’ temperature fluctuations may further mitigate the risk

of arbovirus transmission.

Temperature is known to affect both the EIP (arrival of virus in the salivary

glands) and the proportion of infected mosquitoes following virus ingestion.

Carrington et al. (2013) recently demonstrated that large temperature fluctuations

(18.6°C) at a low mean temperature (20°C) shortened the EIP in Ae. aegypti infected

with DENV 1 [326]. Large daily fluctuations (26 ± 8°C) also reduced DENV 1 and


DENV 2 midgut infection in Ae. aegypti from two Thailand provinces, with results

similar between mosquito populations and DENV strains [311].

In the current study, the EIP of mosquitoes maintained at 23°C was only three

days. However, when mosquitoes were maintained at a fluctuating temperature, the

virus was not detected in the saliva, suggesting that fluctuating temperatures may

lengthen EIPs in Ae. koreicus.

Similar to the results found in this study, Ae. aegypti exposed to DENV at

constant temperatures have shown a higher rate of midgut infection [311] and higher

salivary dissemination rates compared to mosquitoes maintained at fluctuating diurnal

temperatures [338].

Temperature fluctuations can have mixed effects on EIP and infection rates,

depending on the species studied. Alto et al. (2017) found that the degree of

temperature fluctuation mattered to infection outcome in populations of Ae. albopictus

and Ae. aegypti from several geographical areas in Florida and infected with an Asian

strain of CHIKV. A fluctuation in temperature of 8°C led to higher viral dissemination

in Ae. Aegypti, but significantly lowered dissemination in Ae. albopictus. However, a

constant temperature (27°C) and low temperature variations (fluctuating range of 4°C)

did not have any effect on virus dissemination and salivary infection. Moreover,

mosquitoes from populations in other geographic areas showed minimal changes in

infection rates when exposed to the same fluctuation ranges [343]. The current study

only investigated Ae. koreicus populations from Italy, and populations established

elsewhere could be impacted differently by CHIKV infection when exposed to

fluctuating temperatures. The physiological mechanisms driving the differences

observed between constant and fluctuating temperatures remain to be elucidated but

may include differential expression of RNAi pathway under cold temperatures [344].


Regardless of the biological basis, the results of this study stress the importance of

introducing real world conditions when evaluating transmission risks. These results

indicate that transmission of CHIKV ‘La Reunion’ strain by Ae. koreicus in temperate

areas is possible, but unlikely.

The results presented here suggest that the risk of transmission of CHIKV ‘La

Reunion’ strain by Ae. koreicus is low in regions with temperatures similar to those

used in these experiments. The already low risk could be further mitigated by the low

abundance of Ae. koreicus in areas where this mosquito is now established and by its

biological characteristics. The duration of the gonotrophic cycle observed in the

laboratory at 23°C (up to 15 days from blood meal to oviposition) suggests a long

interval between subsequent feedings on hosts for Ae. koreicus in the field in northern

Italy (average summer temperature of 19.4°C). Even under a scenario of rapid CHIKV

dissemination to Ae. koreicus saliva at 23°C, the risk of Ae. koreicus engaging in

subsequent feeding three days after a blood meal is low. Conversely, Myles et al. [345]

showed that low vector competence (as low as 1% of infected mosquitoes) coupled

with a high population survival (as shown in these experiments) will lead to higher

vectorial capacity compared to species with high vector competence but where the

virus negatively impacts mosquito survivorship.

The persistence of Ae. koreicus in already invaded geographic areas is likely to

continue, facilitated by its continual spread [167, 169-172, 340], adaptation to low

temperature climates [18, 127] enabled by strategies such as embryo dormancy and

potential resistance to satyrization by Ae. albopictus. Overall, considering

spatial/temporal niche segregation from Ae. albopictus [127] and weak larval

competition between species [203], these results suggest that Ae. albopictus and Ae.

koreicus are not likely to displace each other.


In conclusion, this thesis delivers novel information about Ae. koreicus, by:

• providing an assessment of the strengths and weaknesses of available

mosquito trapping methods when used to target the mosquito;

• confirming the anthropophilic behaviour of the species;

• providing the first guideline for laboratory rearing;

• establishing key biological aspects of laboratory reared mosquitoes, such as

a long gonotrophic cycle, unusually low hatching percentage, a clear

fecundity-size relationship, lack of autogeny, and the absence of Wolbachia

endosymbiont;

• illustrating an easily implemented method for pupal sex differentiation to

create virgin mosquito cohorts for further studies;

• offering a protocol to evaluate vector competence for arboviruses; and

• providing the first evidence of rapid salivary dissemination of CHIKV in a

small proportion of mosquito females.

These findings aid to define the relative public health risks of Ae. koreicus

invasion in comparison with the existing threats posed by Ae. albopictus and will guide

efforts directed at surveillance and/or control initiatives.

References 112

References

1. Edwards F. Notes on Culicidae, with descriptions of new species. Bull Entomol

Res. 1917;7(3):201-229.

2. Carrasquilla MC, Lounibos LP. Satyrization without evidence of successful

insemination from interspecific mating between invasive mosquitoes. Biol Lett.

2015;11(9):20150527.

3. Bargielowski IE, Lounibos LP. Satyrization and satyrization‐resistance in

competitive displacements of invasive mosquito species. Insect Sci.

2016;23(2):162-174.

4. Bargielowski I, Lounibos LP. Rapid evolution of reduced receptivity to

interspecific mating in the dengue vector Aedes aegypti in response to

satyrization by invasive Aedes albopictus. Evol Ecol. 2014;28(1):193-203.

5. Tripet F, Lounibos LP, Robbins D, et al. Competitive reduction by satyrization?

Evidence for interspecific mating in nature and asymmetric reproductive

competition between invasive mosquito vectors. Am J Trop Med Hyg.

2011;85(2):265.

6. Soghigian J, Gibbs K, Stanton A, et al. Sexual harassment and feeding inhibition

between two invasive dengue vectors. Environ Health Insights. 2014;8(Suppl

2):61.

7. Meyerson LA, Mooney HA. Invasive alien species in an era of globalization.

Front Ecol Environ. 2007;5(4):199-208.

8. Hulme PE. Biological invasions in Europe: drivers, pressures, states, impacts

and responses. Biodiversity under threat. Hester R and Harrison RM (Eds).

Cambridge, UK: Cambridge University Press; 2007. p. 56-80.

9. Early R, Bradley BA, Dukes JS, et al. Global threats from invasive alien species

in the twenty-first century and national response capacities. Nat Commun.

2016;7.

10. Rabitsch W, Essl F, Schindler S. The rise of non-native vectors and reservoirs of

human diseases. Impact of Biological Invasions on Ecosystem Services:

Springer; 2017. p. 263-275.

11. Juliano SA, Philip Lounibos L. Ecology of invasive mosquitoes: effects on

resident species and on human health. Ecol Lett. 2005;8(5):558-574.

12. Capelli G, Mathis A, Di Luca M, et al. First report in Italy of the exotic

mosquito species Aedes (Finlaya) koreicus, a potential vector of arboviruses and

filariae. Parasit Vectors. 2011;4(1):188-188.

13. ARPAV. Dipartimento Regionale per la Sicurezza del Territorio Servizio

Meteorologico [Regional Department for Territory Security Meteorological

Service][Internet] Italy: Agenzia Regionale per la Prevenzione e Protezione

References 113

Ambientale del Veneto; 2011 [cited 2018 29 Jan]; [about 3 screens]. Available

from: www.arpa.veneto.it/bollettini/storico/2011/0264_2011_TEMP.htm

14. Montarsi F, Ravagnan S, Ciocchetta S, et al. Distribution and habitat

characterization of the recently introduced invasive mosquito Aedes koreicus

[Hulecoeteomyia koreica], a new potential vector and pest in north-eastern Italy.


15. Marcantonio M, Metz M, Baldacchino F, et al. First assessment of potential

distribution and dispersal capacity of the emerging invasive mosquito Aedes

koreicus in Northeast Italy. Parasit Vectors. 2016;9(1):1.

16. Ciocchetta S, Martini S, Drago A, et al., editors. Status of Asian tiger mosquito

(Aedes albopictus) population in areas of North Eastern Italy recently colonized.

11th Arbovirus Research in Australia and the 10th Mosquito Control

Association of Australia Symposium 2012; Surfers Paradise, Queensland,

Australia.

17. Mazzucato M, cartographer. Spread of Ae. koreicus and Ae. albopictus in Italy

between 2011 and 2014 [map]. Italy: GIS office database, IZS Ve; 2014. 1

sheet; 11.27 X 15.92 cm; color.

18. Montarsi F, Drago A, Martini S, et al. Current distribution of the invasive

mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy.


19. Mazzucato M, cartographer. Map of municipalities infested with Ae. koreicus

and Ae. albopictus in northern Italy, 2011–2015 Italy: GIS office database, IZS

Ve; 2015. 1 sheet; 13.36 x 18.86 cm; color.

20. Mazzucato M, cartographer. Municipalities infested with Ae. koreicus, Ae.

albopictus and Ae. japonicus in northern Italy, 2017. Italy: GIS office database,

IZS Ve; 2017. 1 sheet; 9.64 x 13.64 cm; color.

21. Halasa YA, Shepard DS, Fonseca DM, et al. Quantifying the impact of

mosquitoes on quality of life and enjoyment of yard and porch activities in New

Jersey. PLoS One. 2014;9(3):e89221.

22. Tomasello D, Schlagenhauf P. Chikungunya and dengue autochthonous cases in

Europe, 2007–2012. Travel Med Infect Dis. 2013;11(5):274-284.

23. Allaby M. A dictionary of ecology. Oxford University Press; 2010.

24. Hardy JL, Houk EJ, Kramer LD, et al. Intrinsic factors affecting vector

competence of mosquitoes for arboviruses. Annu Rev Entomol. 1983;28(1):229-

262.

25. Amraoui F, Failloux A-B. Chikungunya: an unexpected emergence in Europe.

Curr Opin Virol. 2016;21:146-150.

26. Rezza G. Dengue and chikungunya: long-distance spread and outbreaks in naïve

areas. Pathog Glob Health. 2014;108(8):349-55.

27. Venturi G, Di Luca M, Fortuna C, et al. Detection of a chikungunya outbreak in

Central Italy, August to September 2017. Euro Surveill. 2017;22(39).

References 114

28. Angelini R, Finarelli A, Angelini P, et al. An outbreak of chikungunya fever in

the province of Ravenna, Italy. Euro Surveill. 2007;12(9):E070906.

29. Manica M, Guzzetta G, Poletti P, et al. Transmission dynamics of the ongoing

chikungunya outbreak in Central Italy: from coastal areas to the metropolitan

city of Rome, summer 2017. Euro Surveill. 2017;22(44).

30. Lounibos LP. Invasions by Insect Vectors of Human Disease. Annu Rev

Entomol. 2002;47(1):233-266.

31. Kraemer MU, Sinka ME, Duda KA, et al. The global distribution of the

arbovirus vectors Aedes aegypti and Ae. albopictus. Elife. 2015;4:e08347.

32. Kraemer MU, Sinka ME, Duda KA, et al. The global compendium of Aedes

aegypti and Ae. albopictus occurrence. Scientific Data. 2015;2:sdata201535.

33. ECDC. Aedes albopictus - Factsheet for experts[Internet] European Union:

European Centre for Disease Prevention and Control 2018 [updated 20 Dec

2016; cited 2018 Jan 29]; [about 3 screens]. Available from:

https://ecdc.europa.eu/en/disease-vectors/facts/mosquito-factsheets/aedes-

albopictus

34. Tabachnick WJ. Evolutionary Genetics and Arthropod-borne Disease: The

Yellow Fever Mosquito. Am Entomol. 1991;37(1):14-26.

35. Mattingly PF. Genetical aspects of the Aedes aegypti problem. I. Taxonom: and

bionomics. Ann Trop Med Parasitol. 1957 Dec;51(4):392-408.

36. Hahn MB, Eisen RJ, Eisen L, et al. Reported distribution of Aedes (Stegomyia)

aegypti and Aedes (Stegomyia) albopictus in the United States, 1995-2016

(Diptera: Culicidae). J Med Entomol. 2016;53(5):1169-1175.

37. Vasilakis N. Arboviruses. Caister Academic Press; 2016.

38. Bhatt S, Gething PW, Brady OJ, et al. The global distribution and burden of

dengue. Nature. 2013;496(7446):504-507.

39. Mackenzie JS, Gubler DJ, Petersen LR. Emerging flaviviruses: the spread and

resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med.

2004;10:S98-S109.

40. Musso D, Gubler DJ. Zika virus. Clin Microbiol Rev. 2016;29(3):487-524.

41. Pialoux G, Gaüzère B-A, Jauréguiberry S, et al. Chikungunya, an epidemic

arbovirosis. Lancet Infect Dis. 2007;7(5):319-327.

42. Harley D, Sleigh A, Ritchie S. Ross River virus transmission, infection, and

disease: a cross-disciplinary review. Clin Microbiol Rev. 2001;14(4):909-932.

43. Jacups SP, Whelan PI, Currie BJ. Ross River virus and Barmah Forest virus

infections: A review of history, ecology, and predictive models, with

implications for tropical northern Australia. Vector Borne Zoonotic Dis.

2008;8(2):283-298.

44. Weaver SC, Ferro C, Barrera R, et al. Venezuelan equine encephalitis. Annu

Rev in Entomol. 2004;49(1):141-174.

References 115

45. Whitehead SS, Durbin AP, Pierce KK, et al. In a randomized trial, the live

attenuated tetravalent dengue vaccine TV003 is well-tolerated and highly

immunogenic in subjects with flavivirus exposure prior to vaccination. PLoS

Negl Trop Dis. 2017;11(5):e0005584.

46. Dans AL, Dans LF, Lansang MAD, et al. Review of a licensed dengue vaccine:

Inappropriate subgroup analyses and selective reporting may cause harm in

mass vaccination programs. J Clin Epidemiol. 2017.

47. Benelli G, Mehlhorn H. Declining malaria, rising of dengue and Zika virus:

insights for mosquito vector control. Parasitol Res. 2016;115(5):1747-1754.

48. Guzman MG, Gubler DJ, Izquierdo A, et al. Dengue infection. Nat Rev Dise

prime. 2016;2:16055.

49. Abajobir AA, Abate KH, Abbafati C, et al. Global, regional, and national

disability-adjusted life-years (DALYs) for 333 diseases and injuries and healthy

life expectancy (HALE) for 195 countries and territories, 1990–2016: a

systematic analysis for the Global Burden of Disease Study 2016. The Lancet.

2017;390(10100):1260-1344.

50. Wilder-Smith A, Quam M, Sessions O, et al. The 2012 dengue outbreak in

Madeira: Exploring the origins. Euro Survell. 2014;19(8):20718.

51. Giron S, Rizzi J, Leparc-Goffart I, et al. New occurrence of autochthonous cases

of dengue fever in Southeast France, August-September 2014. Bull Epidemiol

Hebd (Paris). 2015:13-14.

52. Dick G, Kitchen S, Haddow A. Zika virus (I). Isolations and serological

specificity. Trans R Soc Trop Med Hyg. 1952;46(5):509-520.

53. Faye O, Freire CC, Iamarino A, et al. Molecular evolution of Zika virus during

its emergence in the 20th century. PLoS Negl Trop Dis. 2014;8(1):e2636.

54. Duffy MR, Chen T-H, Hancock WT, et al. Zika virus outbreak on Yap Island,

federated states of Micronesia. N Engl J Med. 2009;360(24):2536-2543.

55. Weaver SC, Costa F, Garcia-Blanco MA, et al. Zika virus: History, emergence,

biology, and prospects for control. Antiviral Res. 2016;130:69-80.

56. de Melo Freire CC, Iamarino A, de Lima Neto DF, et al. Spread of the pandemic

Zika virus lineage is associated with NS1 codon usage adaptation in humans.

BioRxiv. 2015:032839.

57. Oehler E, Watrin L, Larre P, et al. Zika virus infection complicated by Guillain-

Barre syndrome–case report, French Polynesia, December 2013. Euro Surveill.

2014;19(9):20720.

58. Malinger G, Timor-Tritsch IE, Herrera M. Congenital Zika Virus Syndrome.

Obstetric Imaging: Fetal Diagnosis and Care (Second Edition): Elsevier; 2018.

p. 681-684. e1.

59. Roth A, Mercier A, Lepers C, et al. Concurrent outbreaks of dengue,

chikungunya and Zika virus infections–an unprecedented epidemic wave of

References 116

mosquito-borne viruses in the Pacific 2012–2014. Euro Surveill.

2014;19(41):20929.

60. Fauci AS, Morens DM. Zika virus in the Americas—yet another arbovirus

threat. N Engl J Med. 2016;374(7):601-604.

61. Plourde AR, Bloch EM. A literature review of Zika virus. Emerg Infect Dis.

2016;22(7):1185.

62. Couderc T, Lecuit M. Focus on Chikungunya pathophysiology in human and

animal models. Microbes Infect. 2009;11(14):1197-1205.

63. Volk SM, Chen R, Tsetsarkin KA, et al. Genome-scale phylogenetic analyses of

chikungunya virus reveal independent emergences of recent epidemics and

various evolutionary rates. J Virol. 2010;84(13):6497-6504.

64. Mason P, Haddow A. An epidemic of virus disease in Southern Province,

Tanganyika Territory, in 1952–1953: An additional note on Chikungunya virus

isolations and serum antibodies. Trans R Soc Trop Med Hyg. 1957;51(3):238-

240.

65. Carey DE. Chikungunya and dengue: A case of mistaken identity? J Hist Med

Allied Sci. 1971;26(3):243.

66. Powers AM, Logue CH. Changing patterns of chikungunya virus: Re-emergence

of a zoonotic arbovirus. J Gen Virol. 2007;88(9):2363-2377.

67. Nimmannitya S, Halstead SB, Cohen SN, et al. Dengue and chikungunya virus

infection in man in Thailand, 1962–1964. Am J Trop Med Hyg. 1969;18(6):954-

971.

68. Shah KV, Gibbs Jr C, Banerjee G. Virological investigation of the epidemic of

haemorrhagic fever in Calcutta: Isolation of three strains of Chikungunya Virus.

Indian J Med Res. 1964;52:676-683.

69. Myers R, Carey D, Reuben R, et al. The 1964 epidemic of dengue-like fever in

South India: Isolation of chikungunya virus from human sera and from

mosquitoes. Indian J Med Res. 1965;53(8).

70. Sergon K, Njuguna C, Kalani R, et al. Seroprevalence of chikungunya virus

(CHIKV) infection on Lamu Island, Kenya, October 2004. Am J Trop Med

Hyg. 2008;78(2):333-337.

71. Schwartz O, Albert ML. Biology and pathogenesis of chikungunya virus. Nat

Rev Microbiol. 2010;8(7):491-500.

72. Rezza G, Nicoletti L, Angelini R, et al. Infection with chikungunya virus in

Italy: An outbreak in a temperate region. The Lancet. 2007;370(9602):1840-

1846.

73. Ng LC, Hapuarachchi HC. Tracing the path of Chikungunya virus—evolution

and adaptation. Infect Genet Evol. 2010;10(7):876-885.

References 117

74. Njenga MK, Nderitu L, Ledermann J, et al. Tracking epidemic chikungunya

virus into the Indian Ocean from East Africa. J Gen Virol. 2008;89(11):2754-

2760.

75. Angelini P, Macini P, Finarelli A, et al. Chikungunya epidemic outbreak in

Emilia-Romagna (Italy) during summer 2007. Parassitologia. 2008;50(1-2):97-

98.

76. European Centre for Disease Prevention and Control. Cluster of autochtonous

chikungunya cases in France – 23 August 2017. Stockholm: ECDC. 2017.

77. Delisle E, Rousseau C, Broche B, et al. chikungunya outbreak in Montpellier,

France, September to October 2014. Euro Surveill. 2015;20(17):21108.

78. Gould E, Gallian P, De Lamballerie X, et al. First cases of autochthonous

dengue fever and chikungunya fever in France: From bad dream to reality! Clin

Microbiol Infect. 2010;16(12):1702-1704.

79. Mayer SV, Tesh RB, Vasilakis N. The emergence of arthropod-borne viral

diseases: A global prospective on dengue, chikungunya and zika fevers. Acta

Trop. 2017;166:155-163.

80. Kindhauser MK, Allen T, Frank V, et al. Zika: The origin and spread of a

mosquito-borne virus. Bull World Health Organ. 2016;94(9):675-686C.

81. Failloux A-B, Bouattour A, Faraj C, et al. Surveillance of arthropod-borne

viruses and their vectors in the Mediterranean and Black Sea Regions within the

MediLabSecure Network. Curr Trop Med Rep. 2017;4(1):27-39.

82. Guzman MG, Harris E. Dengue. Lancet. 2015 Jan 31;385(9966):453-65.

83. Theiler M, Casals J, Moutousses C. Etiology of the 1927-28 epidemic of dengue

in Greece. Proc Soc Exp Biol Med. 1960;103(1):244-246.

84. Holstein M. Dynamics of Aedes aegypti distribution, density and seasonal

prevalence in the Mediterranean area. Bull World Health Organ.

1967;36(4):541.

85. Lambrechts L, Scott TW, Gubler DJ. Consequences of the expanding global

distribution of Aedes albopictus for dengue virus transmission. PLoS Negl Trop

Dis. 2010;4(5):e646.

86. Hotta S. Dengue vector mosquitoes in Japan: The role of Aedes albopictus and

Aedes aegypti in the 1942-1944 dengue epidemics of Japanese Main Islands.

Med Entomol Zool. 1998;49:267-274.

87. Metselaar D, Grainger C, Oei K, et al. An outbreak of type 2 dengue fever in the

Seychelles, probably transmitted by Aedes albopictus (Skuse). Bull World

Health Organ. 1980;58(6):937.

88. Paupy C, Girod R, Salvan M, et al. Population structure of Aedes albopictus

from La Reunion Island (Indian Ocean) with respect to susceptibility to a

dengue virus. Heredity (Edinb). 2001;87(3):273-283.

References 118

89. Qiu F-X, Gubler DJ, Liu J-C, et al. Dengue in China: a clinical review. Bull

World Health Organ. 1993;71(3-4):349.

90. Almeida APG, Baptista SSSG, Sousa CAGC, et al. Bioecology and vectorial

capacity of Aedes albopictus (Diptera: Culicidae) in Macao, China, in relation to

dengue virus transmission. J Med Entomol. 2005;42(3):419-428.

91. Gubler DJ. Epidemic dengue and dengue hemorrhagic fever: A global public

health problem in the 21st century. Emerging infections 1: American Society of

Microbiology; 1998. p. 1-14.

92. Effler PV, Pang L, Kitsutani P, et al. Dengue fever, hawaii, 2001–2002. Emerg

Infect Dis. 2005;11(5):742.

93. Leroy EM, Nkoghe D, Ollomo B, et al. Concurrent chikungunya and dengue

virus infections during simultaneous outbreaks, Gabon, 2007. Emerg Infect Dis.

2009;15(4):591.

94. Issack MI, Pursem VN, Barkham TM, et al. Reemergence of dengue in

Mauritius. Emerg Infect Dis. 2010;16(4):716.

95. Olson J, Ksiazek T. Zika virus, a cause of fever in Central Java, Indonesia.

Trans R Soc Trop Med Hyg. 1981;75(3):389-393.

96. Grard G, Caron M, Mombo IM, et al. Zika virus in Gabon (Central Africa)–

2007: a new threat from Aedes albopictus? PLoS Negl Trop Dis.

2014;8(2):e2681.

97. Hawley WA, Reiter P, Copeland RS, et al. Aedes albopictus in North America:

Probable introduction in used tires from northern Asia. Science. 1987;236:1114-

1117.

98. Pless E, Gloria-Soria A, Evans BR, et al. Multiple introductions of the dengue

vector, Aedes aegypti, into California. PLoS Negl Trop Dis.

2017;11(8):e0005718.

99. Heitmann A, Jansen S, Lühken R, et al. Experimental transmission of Zika virus

by mosquitoes from central Europe. Euro Surveill. 2017;22(2).

100. Tsetsarkin KA, McGee CE, Volk SM, et al. Epistatic roles of E2 glycoprotein

mutations in adaption of chikungunya virus to Aedes albopictus and Ae. aegypti

mosquitoes. PLoS One. 2009;4(8):e6835.

101. Grandadam M, Caro V, Plumet S, et al. Chikungunya virus, southeastern

France. Emerg Infect Dis. 2011;17(5):910.

102. Calba C, Guerbois-Galla M, Franke F, et al. Preliminary report of an

autochthonous chikungunya outbreak in France, July to September 2017. Euro

Surveill. 2017;22(39).

103. Cella E, Riva E, Salemi M, et al. The new Chikungunya virus outbreak in Italy

possibly originated from a single introduction from Asia. Pathog Glob Health.

2017 (just-accepted):1-8.

References 119

104. Schaffner F, Medlock JM, Van Bortel W. Public health significance of invasive

mosquitoes in Europe. Clin Microbiol Infect. 2013;19(8):685-692.

105. Adhami J, Reiter P. Introduction and establishment of Aedes (Stegomyia)

albopictus skuse (Diptera: Culicidae) in Albania. J Am Mosq Control Assoc.

1998;14(3):340-343.

106. Sabatini A, Raineri V, Trovato G, et al. Aedes albopictus in Italy and possible

diffusion of the species into the Mediterranean area. Parassitologia.

1990;32(3):301-304.

107. Dalla Pozza G, Majori G. First record of Aedes albopictus establishment in Italy.

J Am Mosq Control Assoc. 1992;8(3):318-320.

108. Dutto M, Mosca A. Preliminary considerations about the presence of Aedes

albopictus (Skuse 1897)(Diptera: Culicidae) during winter in the Northwestern

Italy. Annali di Igiene: Medicina preventiva e di comunita’. 2017;29(1):86-90.

109. ECDC. Ae. albopictus - current known distribution in Europe, September

2017[Internet] European Union: European Centre for Disease Prevention and

Control 2017 [updated 10 Oct 2017; cited 2018 Jan 29]; [about 1 screen].

Available from: https://ecdc.europa.eu/en/publications-data/aedes-albopictus-

current-known-distribution-september-2017

110. Canali M, Rivas-Morales S, Beutels P, et al. The Cost of Arbovirus Disease

Prevention in Europe: Area-Wide Integrated Control of Tiger Mosquito, Aedes

albopictus, in Emilia-Romagna, Northern Italy. Int J Environ Res Public Health.

2017;14(4):444.

111. Valerio L, Marini F, Bongiorno G, et al. Host-feeding patterns of Aedes

albopictus (Diptera: Culicidae) in urban and rural contexts within Rome

province, Italy. Vector-Borne and Zoonotic Diseases. 2010;10(3):291-294.

112. Lindsay SW, Wilson A, Golding N, et al. Improving the built environment in

urban areas to control Aedes aegypti-borne diseases. Bull World Health Organ.

2017.

113. Dallimore T, Hunter T, Medlock JM, et al. Discovery of a single male Aedes

aegypti (L.) in Merseyside, England. Parasit Vectors. 2017;10(1):309.

114. Akiner MM, Demirci B, Babuadze G, et al. Spread of the invasive mosquitoes

Aedes aegypti and Aedes albopictus in the Black Sea region increases risk of

chikungunya, dengue, and Zika outbreaks in Europe. PLoS Negl Trop Dis.

2016;10(4):e0004664.

115. ECDC/EFSA. VectorNet[Internet] European Union: European Food Safety

Authority (EFSA) and the European Centre for Disease Prevention and Control

(ECDC); 2018 [cited 2018 Jan 29]. Available from:

https://vectornet.ecdc.europa.eu/

116. Schaffner F, Kaufmann C, Hegglin D, et al. The invasive mosquito Aedes

japonicus in Central Europe. Med Vet Entomol. 2009;23(4):448-451.

117. Kaufman MG, Fonseca DM. Invasion biology of Aedes japonicus japonicus

(Diptera: Culicidae). Annu Rev Entomol. 2014;59:31.

References 120

118. Krebs T, Bindler P, L'Ambert G, et al. First establishment of Aedes japonicus

japonicus (Theobald, 1901) (Diptera: Culicidae) in France in 2013 and its

impact on public health. J Vector Ecol. 2014;39(2):437-440.

119. Zielke DE, Ibáñez-Justicia A, Kalan K, et al. Recently discovered Aedes

japonicus japonicus (Diptera: Culicidae) populations in The Netherlands and

northern Germany resulted from a new introduction event and from a split from

an existing population. Parasit Vectors. 2015;8(1):40.

120. Seidel B, Montarsi F, Huemer HP, et al. First record of the Asian bush

mosquito, Aedes japonicus japonicus, in Italy: invasion from an established

Austrian population. Parasit Vectors. 2016;9(1):284.

121. ECDC. Ae. japonicus - current known distribution in Europe, September

2017[Internet] European Union: European Centre for Disease Prevention and

Control 2017 [updated 10 Oct 2017; cited 2018 Jan 29]; [about 1 screen].

Available from: https://ecdc.europa.eu/en/publications-data/aedes-japonicus-

current-known-distribution-september-2017

122. Schaffner F, Chouin S, Guilloteau J. First record of Ochlerotatus (Finlaya)

japonicus japonicus (Theobald, 1901) in metropolitan France. J Am Mosq

Control Assoc. 2003;19(1):1-5.

123. Takashima I, Rosen L. Horizontal and vertical transmission of Japanese

encephalitis virus by Aedes japonicus (Diptera: Culicidae). J Med Entomol.

1989;26(5):454-458.

124. Sardelis MR, Turell MJ. Ochlerotatus j. japonicus in Frederick County,

Maryland: discovery, distribution, and vector competence for West Nile virus. J

Am Mosq Control Assoc. 2001;17(2):137-141.

125. Schaffner F, Vazeille M, Kaufmann C, et al. Vector competence of Aedes

japonicus for chikungunya and dengue viruses. Eur Mosq Bull. 2011;29:141-

142.

126. Ciocchetta S, Luca T, Camuffo S, et al., editors. Indications on the host

preference of Aedes koreicus [Hulecoeteomyia koreica], a new invasive

mosquito to Italy. 9th CVBD symposium; 2014; Lisbon, Portugal.

127. Montarsi F, Drago A, Dal Pont M, et al. Current knowledge on the distribution

and biology of the recently introduced invasive mosquito Aedes koreicus

(diptera: Culicidae) Accademia Nazionale Italiana di Entomologia. 2014:169-

174.

128. ECDC. Mosquito maps[Internet] European Union: European Centre for Disease

Prevention and Control 2018 [updated 10 Oct 2017; cited 2018 Jan 29]; [about 1

screen]. Available from: https://ecdc.europa.eu/en/disease-vectors/surveillance-

and-disease-data/mosquito-maps

129. Wilder-Smith A, Quam M, Sessions O, et al. The 2012 dengue outbreak in

Madeira: exploring the origins. Euro Surveill. 2014 Feb 27;19(8):20718.

References 121

130. Succo T, Leparc-Goffart I, Ferré J-B, et al. Autochthonous dengue outbreak in

Nîmes, south of France, July to September 2015. Euro Surveill.

2016;21(21):30240.

131. Gjenero-Margan I, Aleraj B, Krajcar D, et al. Autochthonous dengue fever in

Croatia, August-September 2010. Euro Surveill. 2011;16(9):19805.

132. Marchand E, Prat C, Jeannin C, et al. Autochthonous case of dengue in France,

October 2013. Euro Surveill. 2013;201:18-50.

133. Savino S, Ciocchetta S, cartographers. Distribution of invasive Aedes mosquito

species in Europe. Australia: QIMR Berghofer Medical Research Institute &

University of Padua; 2017. 1 sheet; 13.36 x 18.86 cm; color.

134. Tanaka K, Saugstad ES, Mizusawa K. A revision of the adult and larval

mosquitoes of Japan (including the Ryukyu Archipelago and the Ogasawara

Islands) and Korea (Diptera: Culicidae). Army Medical Lab, San Francisco;

1979.

135. Knight KL. The Aedes (Finlaya) chrysolineatus group of mosquitoes (Diptera:

Culicidae). Ann Entomol Soc Am. 1947;40(4):624-649.

136. Ho Ci. Study of the adult Culicidae of Peiping. Bull Fan Mem Inst Biol.

1931;11.

137. Kim HC, Chong ST, O’Brien LL, et al. Seasonal prevalence of mosquitoes

collected from light traps in the Republic of Korea in 2003. Entomol Res.

2006;36(3):139-148.

138. Kim HC, Chong ST, Collier BW, et al. Seasonal prevalence of mosquitoes

collected from light traps with notes on malaria in the Republic of Korea, 2004.

Entomol Res. 2007;37(3):180-189.

139. Kim HC, Chong ST, Collier BW, et al. Seasonal prevalence of mosquitoes

collected from light traps in the Republic of Korea, 2005. Entomol Res.

2009;39(1):70-77.

140. Miles J. Some ecological aspects of the problem of arthropod-borne animal

viruses in the Western Pacific and South-East Asia regions. Bull World Health

Organ. 1964;30(2):197-210.

141. Feng L-C. A critical review of literature regarding the records of mosquitoes in

China. 1 Part I. Subfamijy Culicinae, Tribe Anophelini. Peking Nat Hist Bull.

1938;12(pt. 3).

142. Ye Y, Ng TS, Frentiu FD, et al. Comparative susceptibility of mosquito

populations in North Queensland, Australia to oral infection with Dengue virus.

Am J Trop Med Hyg. 2014.

143. Horwood P, Bande G, Dagina R, et al. The threat of chikungunya in Oceania.

Western Pacific surveillance and response journal: WPSAR. 2013;4(2):8.

144. Kelly-Hope LA, Purdie DM, Kay BH. Ross River virus disease in Australia,

1886-1998, with analysis of risk factors associated with outbreaks. J Med

Entomol. 2004;41(2):133-150.

References 122

145. Watson TM, Kay BH. Vector competence of Aedes notoscriptus (Diptera:

Culicidae) for Ross River virus in Queensland, Australia. J Med Entomol.

1998;35(2):104-106.

146. Petriščeva PA. Course on Natural Foci of Infection. USSR Acad Med Sci &

WHO; 1962.

147. Kim HC, Wilkerson RC, Pecor JE, et al. New Records and Reference Collection

of Mosquitoes (Diptera: Culicidae) on Jeju Island, Republic of Korea. Entomol

Res. 2005;35(1):55-66.

148. Kim HC, Turell MJ, O’Guinn ML, et al. Historical review and surveillance of

Japanese encephalitis, Republic of Korea, 2002–2004. Entomol Res.

2007;37(4):267-274.

149. Gutsevich A, Monchadskii A, Stackelberg A. Fauna of the USSR. Diptera. Vol.

3, Issue 4. Mosquitoes of the Family Culicidae. Nauka, Leningrad; 1970.

150. Kampen H, Werner D. Out of the bush: The Asian bush mosquito Aedes

japonicus japonicus (Theobald, 1901)(Diptera, Culicidae) becomes invasive.

Parasit Vectors. 2014;7(1):59.

151. van den Hurk AF, Ritchie SA, Mackenzie JS. Ecology and geographical

expansion of Japanese encephalitis virus. Annu Rev Entomol. 2009;54:17-35.

152. Gutsevich A, Monchadskii A, Shtakel’berg A. Fauna SSSR Vol. 3.(4). Family

Culicidae. 1971.

153. Yamada S. An experimental study on twenty-four species of Japanese

mosquitoes regarding their suitability as intermediate hosts for Filaria bancrofti

Cobbold. Sci Rep Gov Inst Inf Dis. 1927;6:559-622.

154. Feng L-C. Experiments with Dirofilaria immitis and local species of mosquitoes

in Peiping, North China. Ann Trop Med Parasitol. 1930;24:347-366.

155. Montarsi F, Ciocchetta S, Ravagnan S, et al. Laboratory evidence on vector

competence of the invasive mosquito Aedes koreicus [Hulecoeteomyia koreica]

for Dirofilaria immitis. Parasit Vectors. 2014;7(Suppl 1):O34.

156. Lee S-E, Kim H-C, Chong S-T, et al. Molecular survey of Dirofilaria immitis

and Dirofilaria repens by direct PCR for wild caught mosquitoes in the

Republic of Korea. Vet Parasitol. 2007;148(2):149-155.

157. Woolhouse ME, Gowtage-Sequeria S. Host range and emerging and reemerging

pathogens. Emerg Infect Dis. 2005;11(12):1842.

158. Korean Centre for Disease Control. Elimination of Lymphatic filariasis in

Korea. National document for certification. Republic of Korea: National

Institute of Health. Centres for Disease Control and Prevention, Ministry of

Health and Welfare, 2007.

159. Cosgrove J, Wood R, Petrić D, et al. A convenient mosquito membrane feeding

system. J Am Mosq Control Assoc. 1994;10(3):434-436.

References 123

160. Versteirt V, Pecor JE, Fonseca DM, et al. Confirmation of Aedes koreicus

(Diptera: Culicidae) in Belgium and description of morphological differences

between Korean and Belgian specimens validated by molecular identification.

Zootaxa. 2012;3191:21-32.

161. Cameron EC, Wilkerson RC, Mogi M, et al. Molecular phylogenetics of Aedes

japonicus, a disease vector that recently invaded Western Europe, North

America, and the Hawaiian islands. J Med Entomol. 2010 Jul;47(4):527-35.

162. Widdel AK, McCuiston LJ, Crans WJ, et al. Finding needles in the haystack:

Single copy microsatellite loci for Aedes japonicus (Diptera: Culicidae). Am J

Trop Med Hyg. 2005 Oct;73(4):744-8.

163. Unit Walter Reed Biosystematics. Aedes koreicus specimens. Washington, DC,

USA: Smithsonian Institution.

164. Montarsi F, Ravagnan S, Ciocchetta S, et al. Distribution and habitat

characterization of the recently introduced invasive mosquito Aedes koreicus

[Hulecoeteomyia koreica], a new potential vector and pest in north-eastern Italy.

Parasit Vectors. 2013;6(1):292-292. Electronic supplementary material:

Additional file 3, Drawings of the main characteristics considered for the

identification of female Culicinae mosquito.

165. Versteirt V, Pecor JE, Fonseca DM, et al. Confirmation of Aedes koreicus

(Diptera: Culicidae) in Belgium and description of morphological differences

between Korean and Belgian specimens validated by molecular identification.

Zootaxa. 2012;3191:21-32. Figure 4, Differences in hindleg ornamentation of

(a) Aedes koreicus from Belgium, (b) Aedes koreicus from peninsular Korea and

(c) Aedes j. japonicus from Belgium; p. 27.

166. Takken W. Mosquito vectors of disease: Spatial biodiversity, drivers of change

and risk “MODIRISK”. 2009.

167. Versteirt V, De Clercq E, Fonseca D, et al. Bionomics of the established exotic

mosquito species Aedes koreicus in Belgium, Europe. J Med Entomol.

2012;49(6):1226-1232.

168. Deblauwe I, Sohier C, Schaffner F, et al. Implementation of surveillance of

invasive mosquitoes in Belgium according to the ECDC guidelines. Parasit

Vectors. 2014;7(1):201.

169. Bezzhonova OV, Patraman IV, Ganushkina LA, et al. [The first finding of

invasive species Aedes (Finlaya) koreicus (Edwards, 1917) in European Russia].

Med Parazitol (Mosk). 2014 Jan-Mar(1):16-9. russian.

170. Suter T, Flacio E, Fariña BF, et al. First report of the invasive mosquito species

Aedes koreicus in the Swiss-Italian border region. Parasit Vectors. 2015;8(1):1-

4.

171. Werner D, Zielke D, Kampen H. First record of Aedes koreicus (Diptera:

Culicidae) in Germany. Parasitol Res. 2015 2015/11/28:1-4.

References 124

172. Kurucz K, Kiss V, Zana B, et al. Emergence of Aedes koreicus (Diptera:

Culicidae) in an urban area, Hungary, 2016. Parasitol Res. 2016;115(12):4687-

4689.

173. Schaffner F, Kaufmann C, Pflüger V, et al. Rapid protein profiling facilitates

surveillance of invasive mosquito species. Parasit Vectors. 2014;7(1):142.

174. Kim HC, Chong ST, Pike JG, et al. Seasonal Prevalence of Mosquitoes

Collected from Light Traps in the Republic of Korea, 2002. Entomol Res.

2004;34(3):177-186.

175. Kim HC, Friendly OS, Pike JG, et al. Seasonal Prevalence of Mosquitoes

Collected from Light Traps in the Republic of Korea, 2001. Entomol Res.

2003;33(3):189-201.

176. Kim HC, Lee KW, Richards RS, et al. Seasonal Prevalence of Mosquitoes

Collected from Light Traps in Korea (1999‐2000). Entomol Res. 2003;33(1):9-

16.

177. CCMCP. New Jersey Light Trap Massachusetts (USA): Central Massachusetts

Mosquito Control; 2007 [cited 2018 Jan 29]; [about 1 screen]. Available from:

http://www.cmmcp.org/njtrap.htm

178. MosquitoMagnet. CO2 Mosquito Traps By Mosquito Magnet® USA: Mosquito

Magnet; 2017 [cited 2018 Jan 29]; [about 3 screens]. Available from:

http://www.mosquitomagnet.com/store/mosquito-magnet-trap

179. European Centre for Disease Prevention and Control. Guidelines for the

surveillance of invasive mosquitoes in Europe. Stockholm: ECDC; 2012.

180. Melaun C, Werblow A, Cunze S, et al. Modeling of the putative distribution of

the arbovirus vector Ochlerotatus japonicus japonicus (Diptera: Culicidae) in

Germany. Parasitol Res. 2015:1-11.

181. Schaffner F, Bellini R, Petric D, et al. Development of guidelines for the

surveillance of invasive mosquitoes in Europe. Parasit Vectors. 2013;6:209.

182. Baldacchino F, Montarsi F, Arnoldi D, et al. A 2-yr mosquito survey focusing

on Aedes koreicus (Diptera: Culicidae) in Northern Italy and implications for

adult trapping. J Med Entomol. 2017;54(3):622-630.

183. European Centre for Disease Prevention and Control. Guidelines for the

surveillance of invasive mosquitoes in Europe. Stockholm: ECDC; 2012. Table

5, Methods of collection of IMS adult or detection by egg collection and their

efficacy according to mosquito species; p 16.

184. Williamson M. Biological invasions. Vol. 15. Springer; 1996.

185. Alto BW, Lounibos LP. Vector competence for arboviruses in relation to the

larval environment of mosquitoes. Ecology of parasite-vector interactions:

Springer; 2013. p. 81-101.

186. Lounibos L. Competitive displacement and reduction. J Am Mosq Control

Assoc. 2007;23(2 Suppl):276.

References 125

187. Ribeiro J, Spielman A. The satyr effect: A model predicting parapatry and

species extinction. Am Nat. 1986;128(4):513-528.

188. Ali SR, Rozeboom LE. Cross-insemination frequencies between strains of Aedes

albopictus and members of the Aedes scutellaris group. J Med Entomol.

1971;8(3):263-265.

189. Ali SR, Rozeboom LE. Cross-mating between Aedes (S.) polynesiensis Marks

and Aedes (S.) albopictus Skuse in a large cage. Mosquito News. 1971;31(1):80-

4.

190. Gubler DJ. Induced sterility in Aedes (Stegomyia) polynesiensis Marks by cross-

insemination with Aedes (Stegomyia) albopictus Skuse. J Med Entomol.

1970;7(1):65-70.

191. Bargielowski IE, Lounibos LP, Carrasquilla MC. Evolution of resistance to

satyrization through reproductive character displacement in populations of

invasive dengue vectors. Proceedings of the National Academy of Sciences.

2013;110(8):2888-2892.

192. Nazni W, Lee H, Dayang H, et al. Cross-mating between Malaysian strains of

Aedes aegypti and Aedes albopictus in the laboratory. Southeast Asian J Trop

Med Public Health. 2009;40(1):40-6.

193. Lima-Camara TN, Codeco CT, Honorio NA, et al. Male accessory gland

substances from Aedes albopictus affect the locomotor activity of Aedes aegypti

females. Mem Inst Oswaldo Cruz. 2013;108:18-25.

194. Black WC, Rai KS, Turco BJ, et al. Laboratory study of competition between

United States strains of Aedes albopictus and Aedes aegypti (Diptera:

Culicidae). J Med Entomol. 1989;26(4):260-271.

195. Nasci R, Hare S, Willis F. Interspecific mating between Louisiana strains of

Aedes albopictus and Aedes aegypti in the field and laboratory. J Am Mosq

Control Assoc. 1989;5(3):416-421.

196. Bargielowski I, Lounibos L, Shin D, et al. Widespread evidence for interspecific

mating between Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in

nature. Infect Genet Evol. 2015;36:456-461.197. Juliano SA. Species

introduction and replacement among mosquitoes: Interspecific resource

competition or apparent competition? Ecology. 1998;79(1):255-268.

197. Juliano SA. Species introduction and replacement among mosquitoes:

Interspecific resource competition or apparent competition? Ecology.

1998;79(1):255-268.

198. Russell RC. Larval competition between the introduced vector of dengue fever

in Australia, Aedes aegypti (L), and a native container-breeding mosquito, Aedes

notoscriptus (Skuse)(Diptera, Culicidae). Aust J Zool. 1986;34(4):527-534.

199. Barrera R. Competition and resistance to starvation in larvae of container-

inhabiting Aedes mosquitoes. Ecol Entomol. 1996;21(2):117-27.

200. Alto BW, Lounibos LP, Higgs S, et al. Larval competition differentially affects

arbovirus infection in Aedes mosquitoes. Ecology. 2005;86(12):3279-3288.

References 126

201. Alto BW, Lounibos LP, Mores CN, et al. Larval competition alters susceptibility

of adult Aedes mosquitoes to dengue infection. Proceedings of the Royal Society

B: Biological Sciences. 2008;275(1633):463-471.

202. Bevins SN. Invasive mosquitoes, larval competition, and indirect effects on the

vector competence of native mosquito species (Diptera: Culicidae). Biol

Invasions. 2008;10(7):1109-1117.

203. Baldacchino F, Arnoldi D, Lapère C, et al. Weak Larval Competition Between

Two Invasive Mosquitoes Aedes koreicus and Aedes albopictus (Diptera:

Culicidae). J Med Entomol. 2017:tjx093.

204. Focks DA. A review of entomological sampling methods and indicators for

dengue vectors. Geneva: WHO. 2004.

205. Silver JB. Mosquito ecology: field sampling methods. Springer Science &

Business Media; 2007.

206. Kroeckel U, Rose A, Eiras ÁE, et al. New tools for surveillance of adult yellow

fever mosquitoes: Comparison of trap catches with human landing rates in an

urban environment. J Am Mosq Control Assoc. 2006;22(2):229-238.

207. Bhalala H, Arias JR. The Zumba™ mosquito trap and BG-Sentinel™ trap:

Novel surveillance tools for host-seeking mosquitoes. J Am Mosq Control

Assoc. 2009;25(2):134-139.

208. Carrieri M, Albieri A, Angelini P, et al. Surveillance of the chikungunya vector

Aedes albopictus (Skuse) in Emilia‐Romagna (northern Italy): organizational

and technical aspects of a large scale monitoring system. J Vector Ecol.

2011;36(1):108-116.

209. Ritchie SA, Buhagiar TS, Townsend M, et al. Field Validation of the Gravid

Aedes Trap (GAT) for Collection of Aedes aegypti (Diptera: Culicidae). J Med

Entomol. 2014;51(1):210-219.

210. Miyagi I. Notes on the Aedes (Finlaya) chrysolineatus subgroup in Japan and

Korea (Diptera: Culicidae). 熱帯医学 Tropical medicine. 1971;13(3):141-151.

211. Romi R, Pontuale G, Sabatinelli G. Le zanzare italiane: Generalità e

identificazione degli stadi preimaginali (Diptera, Culicidae) [Italian mosquitoes:

Generality and identification of the preimaginal stages (Diptera, Culicidae)].

Vol. 29. Università degli Studi di Roma" La Sapienza", Dipartimento di

Biologia Animale e dell'Uomo; 1997. Italian.

212. Severini F, Toma L, Di Luca M, et al. Italian mosquitoes: Generality and

identification of adults (Diptera, Culicidae). Fragmenta entomologica.

2009;41:213-372.

213. Ree HI. Taxonomic Review and Revised Keys of the Korean Mosquitoes

(Diptera: Culicidae). Entomol Res. 2003;33(1):39-52.

214. Becker N. Mosquitoes and their control. Heidelberg: Springer; 2010.


Meteorologico[Internet] [Regional Department for Territory Security

References 127

Meteorological Service]. Italy: Agenzia Regionale per la Prevenzione e

Protezione Ambientale del Veneto; 2014 [cited 2018 29 Jan]; [about 3 screens].

Available from:

http://www.arpa.veneto.it/bollettini/storico/2014/0264_2014_TEMP.htm




Protezione Ambientale del Veneto; 2014 [cited 2018 29 Jan]; [about 2 screens].

Available from:

http://www.arpa.veneto.it/bollettini/storico/2014/0264_2014_PREC.htm




Protezione Ambientale del Veneto; 2014 [cited 2018 29 Jan]; [about 1 screen].

Available from:

http://www.arpa.veneto.it/bollettini/storico/2014/0264_2014_VVENTO.htm

218. Drago A, Marini F, Caputo B, et al. Looking for the gold standard: Assessment

of the effectiveness of four traps for monitoring mosquitoes in Italy. J Vector

Ecol. 2012;37(1):117-123.

219. Montarsi F, Tripepi L, Drago A, et al., editors. Host preference and

anthropophilic behaviour of the invasive mosquito Aedes koreicus. European

Society for Vector Ecology E-SOVE 2014; 2014; Thessaloniki (Greece).

220. Fay RW. The biology and bionomics of Aedes aegypti in the laboratory. Mosq

News. 1964;24(3):300-308.

221. Hartberg W, Gerberg E. Laboratory colonization of Aedes simpsoni (Theobald)

and Eretmapodites quinquevittatus Theobald. Bull World Health Organ.

1971;45(6):850.

222. Deshmukh P, Guttikar S, Guru P, et al. Colonization of two species of

mosquitoes, Aedes novalbopictus and Aedes w-albus. Indian J Med Res.

1973;61(4):503-505.

223. Choochote W. A note on laboratory colonization of Aedes (Muscidus)

quasiferinus Mattingly 1961, Amphur Muang Chiang Mai, Northern Thailand.

1987. Southeast Asian J Trop Med Public Health. 1987;18(1):128.

224. Hugo L, Kay B, Ryan P. Autogeny in Ochlerotatus vigilax (Diptera: Culicidae)

from Southeast Queensland, Australia. J Med Entomol. 2003;40(6):897-902.

225. Blackmore MS, Lord CC. The relationship between size and fecundity in Aedes

albopictus. J Vector Ecol. 2000;25:212-217.

226. Armbruster P, Hutchinson RA. Pupal mass and wing length as indicators of

fecundity in Aedes albopictus and Aedes geniculatus (Diptera: Culicidae). J Med

Entomol. 2002;39(4):699-704.

References 128

227. Lyimo EO, Takken W. Effects of adult body size on fecundity and the pre‐gravid rate of Anopheles gambiae females in Tanzania. Med Vet Entomol.

1993;7(4):328-332.

228. Lounibos L, Larson V, Morris C. Parity, fecundity and body size of Mansonia

dyari in Florida. J Am Mosq Control Assoc. 1990;6(1):121-126.

229. Reiskind M, Lounibos L. Effects of intraspecific larval competition on adult

longevity in the mosquitoes Aedes aegypti and Aedes albopictus. Med Vet

Entomol. 2009;23(1):62-68.

230. Kesavaraju B, Leisnham PT, Keane S, et al. Interspecific competition between

Aedes albopictus and A. sierrensis: potential for competitive displacement in the

Western United States. PLoS One. 2014;9(2):e89698.

231. Leonard PM, Juliano SA. Effect of leaf litter and density on fitness and

population performance of the hole mosquito Aedes triseriatus. Ecol Entomol.

1995;20(2):125-136.

232. Lounibos LP, Nishimura N, Escher RL. Fitness of a treehole mosquito:

Influences of food type and predation. Oikos. 1993:114-118.

233. Williges E, Farajollahi A, Scott JJ, et al. Laboratory colonization of Aedes

japonicus japonicus. J Am Mosq Control Assoc. 2008;24(4):591-593.

234. Versteirt V, Nagy Z, Roelants P, et al. Identification of Belgian mosquito

species (Diptera: Culicidae) by DNA barcoding. Mol Ecol Resour.

2015;15(2):449-457.

235. Rutledge L, Ward R, Gould D. Studies on the feeding response of mosquitoes to

nutritive solutions in a new membrane feeder. Mosq News. 1964;24(4):407-9.

236. Crampton J, Beard C, Louis C. The molecular biology of insect disease vectors:

a methods manual. Springer; 1997.

237. Russell B, Kay B, Shipton W. Survival of Aedes aegypti (Diptera: Culicidae)

eggs in surface and subterranean breeding sites during the northern Queensland

dry season. J Med Entomol. 2001;38(3):441-445.

238. Trpiš M. A new bleaching and decalcifying method for general use in zoology.

Can J Zool. 1970;48(4):892-893.

239. Clements A, Boocock M. Ovarian development in mosquitoes: Stages of growth

and arrest, and follicular resorption. Physiol Entomol. 1984;9(1):1-8.

240. Itina VI, Noutcha MAE, Okiwelu SN. Wuchereria bancrofti Infection Rates in

Humans (Vertebrata: Hominidae) and Mosquitoes (Diptera: Culicidae), Akwa

Ibom State, Nigeria. Res Zool. 2014;4(1):1-7.

241. Christophers SR. The development of the egg follicle in anophelines. Paludism.

1911;2:73-88.

242. Itina VI, Noutcha MAE, Okiwelu SN. Wuchereria bancrofti Infection Rates in

Humans (Vertebrata: Hominidae) and Mosquitoes (Diptera: Culicidae), Akwa

References 129

Ibom State, Nigeria. Res Zool. 2014;4(1):1-7. Figure 2, Egg Follicle

development in mosquitoes; p 4.

243. Minakawa N, Githure JI, Beier JC, et al. Anopheline Mosquito Survival

Strategies During the Dry Period in Western Kenya. J Med Entomol. 2001

2001-05-01 00:00:00;38(3):388-392.

244. Decoursey JD, Webster A. A method of clearing the chorion of Aedes sollicitans

(Walker) eggs and preliminary observations on their embryonic development.

Ann Entomol Soc Am. 1952;45(4):625-632.

245. Alto BW, Juliano SA. Temperature Effects on the Dynamics of Aedes

albopictus (Diptera: Culicidae) Populations in the Laboratory. J Med Entomol.

2001;38(4):548-556.

246. Delatte H, Gimonneau G, Triboire A, et al. Influence of temperature on

immature development, survival, longevity, fecundity, and gonotrophic cycles

of Aedes albopictus, vector of chikungunya and dengue in the Indian Ocean. J

Med Entomol. 2009;46(1):33-41.

247. Moorefield H. Sexual dimorphism in mosquito pupae Mosquito News.

1951;11(3):175-177.

248. Haddow AJ, Gillett JD, Corbet PS. Laboratory Observations on Pupation and

Emergence in the Mosquito Aëdes (Stegomyia) Aegypti (Linnaeus). Ann Trop

Med Parasitol. 1959 1959/06/01;53(2):123-131.

249. Scott JJ. The ecology of the exotic mosquito Ochlerotatus (Finlaya) japonicus

japonicus (Theobald 1901)(Diptera: Culicidae) and an examination of its role in

the West Nile virus cycle in New Jersey. 2003; 4171.

250. Lounibos LP, Rey JR, Frank JH, editors. Ecology of mosquitoes. Proceedings of

a Workshop. Florida Medical Entomology Laboratory, Vero Beach, Florida,

USA; 1985.

251. Briegel H. Metabolic relationship between female body size, reserves, and

fecundity of Aedes aegypti. J Insect Physiol. 1990;36(3):165-172.

252. Farjana T, Tuno N, Higa Y. Effects of temperature and diet on development and

interspecies competition in Aedes aegypti and Aedes albopictus. Med Vet

Entomol. 2012;26(2):210-217.

253. Takken W, Costantini C, Dolo G, et al. Mosquito mating behaviour. Bridging

laboratory and field research for genetic control of disease vectors. 2006:183-

188.

254. Clements A. The biology of mosquitoes. Vol. I. Development, nutrition and

reproduction. Chapman and Hall; 1992.

255. Roubaud E. Cycle autogene d'attente et generations hivernales suractives

inapparentes chez le moustique commun, Culex pipiens L. [Autogenic waiting

cycle and inapparent overactive winter generations in the common mosquito,

Culex pipiens L.] CR Acad Sci, Paris. 1929;188:735-738. French.

References 130

256. Thomas Va, Leng Y. The inheritance of autogeny in Aedes (Finlaya) togoi

(Theobald) from Malaysia and some aspects of its biology. Southeast Asian J

Trop Med Public Health. 1972;3(2):163-74.

257. Mulla T. Selection-dependent trends of autogeny and blood feeding in an

autogenous strain of Culex tarsalis (Diptera: Culicidae). J Am Mosq Control

Assoc. 1997;13(2):145-149.

258. Reisen WK, Milby MM. Studies on autogeny in Culex tarsalis: 3. Life table

attributes of autogenous and anautogenous strains under laboratory conditions. J

Am Mosq Control Assoc. 1987;3(4):619-625.

259. Spadoni R, Nelson R, Reeves W. Seasonal Occurrence, Egg Production, and

Blood-feeding Activity of Autogenous Culex tarsalis 1, 2. Ann Entomol Soc

Am. 1974;67(6):895-902.

260. Corbet P. Facultative autogeny in Arctic mosquitoes. Nature. 1967;215:662-3.

261. Spielman A. Studies on autogeny in natural populations of Culex pipiens II.

Seasonal abundance of autogenous and anautogenous populations. J Med

Entomol. 1971;8(5):555-561.

262. Clements AN. The Physiology of Mosquitoes: International Series of

Monographs on Pure and Applied Biology: Zoology. Vol. 17. Elsevier; 2013.

263. Spielman A. The inheritance of autogeny in the Culex pipiens complex of

mosquitoes. American journal of hygiene. 1957;65(3).

264. Tveten M, Meola R. Autogeny in Culex salinarius from Texas, Florida and New

Jersey. J Am Mosq Control Assoc. 1988;4(4):436-441.

265. Provost‐Javier KN, Chen S, Rasgon JL. Vitellogenin gene expression in

autogenous Culex tarsalis. Insect Mol Biol. 2010;19(4):423-429.

266. Sweeney A, Russell R. Autogeny in Anopheles amictus hilli. Mosquito News.

1973;33(3):467-8.

267. O'Meara GF, Larson VL, Mook DH. Blood feeding and autogeny in the

peridomestic mosquito Aedes bahamensis (Diptera: Culicidae). J Med Entomol.

1993;30(2):378-383.

268. Mori A, Romero-Severson J, Black IV W, et al. Quantitative trait loci

determining autogeny and body size in the Asian tiger mosquito (Aedes

albopictus). Heredity (Edinb). 2008;101(1):75.

269. O'Meara GF. Variable expressions of autogeny in three mosquito species. Int J

Invertebr Reprod. 1979;1(4):253-261.

270. Lea AO. Selection for Autogeny in Aedes aegypti (Diptera: Culicidae. Ann

Entomol Soc Am. 1964;57(5):656-657.

271. O'Meara GF, Evans DG. The influence of mating on autogenous egg

development in the mosquito, Aedes taeniorhynchus. J Insect Physiol.

1976;22(4):613-617.

References 131

272. O'Meara GF, Evans DG. Autogeny in saltmarsh mosquitoes induced by a

substance from the male accessory gland. Nature. 1977;267(5609):342-344.

273. Hertig M, Wolbach SB. Studies on rickettsia-like micro-organisms in insects. J

Med Res. 1924;44(3):329.

274. Hilgenboecker K, Hammerstein P, Schlattmann P, et al. How many species are

infected with Wolbachia?–A statistical analysis of current data. FEMS

Microbiol Lett. 2008;281(2):215-220.

275. Jeyaprakash A, Hoy MA. Long PCR improves Wolbachia DNA amplification:

wsp sequences found in 76% of sixty‐three arthropod species. Insect Mol Biol.

2000;9(4):393-405.

276. Werren JH, Baldo L, Clark ME. Wolbachia: Master manipulators of invertebrate

biology. Nat Rev Microbiol. 2008;6(10):741.

277. Stouthamer R, Breeuwer JA, Hurst GD. Wolbachia pipientis: microbial

manipulator of arthropod reproduction. Annu Rev Microbiol. 1999;53(1):71-

102.

278. Alexandrov I, Alexandrova M, Goryacheva I, et al. Removing endosymbiotic

Wolbachia specifically decreases lifespan of females and competitiveness in a

laboratory strain of Drosophila melanogaster. Russ J Genet. 2007;43(10):1147-

1152.

279. Dedeine F, Bandi C, Boulétreau M, et al. Insights into Wolbachia obligatory

symbiosis. Insect Symbiosis. 2003;1:267-282.

280. Dedeine F, Vavre F, Fleury F, et al. Removing symbiotic Wolbachia bacteria

specifically inhibits oogenesis in a parasitic wasp. Proceedings of the National

Academy of Sciences. 2001;98(11):6247-6252.

281. Ciocchetta S, Darbro JM, Frentiu FD, et al. Laboratory colonization of the

European invasive mosquito Aedes (Finlaya) koreicus. Parasit Vectors.

2017;10(1):74.

282. Oliva CF, Damiens D, Benedict MQ. Male reproductive biology of Aedes

mosquitoes. Acta Trop. 2014;132:S12-S19.

283. O'Neill SL, Giordano R, Colbert A, et al. 16S rRNA phylogenetic analysis of

the bacterial endosymbionts associated with cytoplasmic incompatibility in

insects. Proceedings of the National Academy of Sciences. 1992;89(7):2699-

2702.

284. Braig HR, Zhou W, Dobson SL, et al. Cloning and Characterization of a Gene

Encoding the Major Surface Protein of the Bacterial Endosymbiont Wolbachia

pipientis. J Bacteriol. 1998;180(9):2373-2378.

285. Cook PE, Hugo LE, Iturbe-Ormaetxe I, et al. The use of transcriptional profiles

to predict adult mosquito age under field conditions. Proceedings of the National

Academy of Sciences. 2006;103(48):18060-18065.

286. Ulrich JN, Beier JC, Devine GJ, et al. Heat Sensitivity of wMel Wolbachia

during Aedes aegypti Development. PLoS Negl Trop Dis. 2016;10(7):e0004873.

References 132

287. Ciocchetta S. Ae. koreicus mating [Internet]. Australia: QUT Media Warehouse,

Ciocchetta S, editor and producer; 2016; [1 video: 8 sec., color, 720x1280].

Available from:

https://mediawarehouse.qut.edu.au/QMW/player/?dID=59523&dDocName=Q

MW_049598

288. Ciocchetta S. Ae. koreicus sperm[Internet]. Australia: QUT Media Warehouse,

Ciocchetta S, editor and producer; 2016; [1 video: 11 sec., color, 720x1280].

Available from:


MW_049599

289. Ciocchetta S. Ae. albopictus/Ae. koreicus interaction [Internet]. Australia: QUT

Media Warehouse, Ciocchetta S, editor and producer; 2016; [1 video: 11 sec.,

color, 480x854]. Available from:


MW_049600

290. Tsuji N, Okazawa T, Yamamura N. Autogenous and anautogenous mosquitoes:

a mathematical analysis of reproductive strategies. J Med Entomol.

1990;27(4):446-453.

291. Chambers GM, Klowden MJ. Nutritional reserves of autogenous and

anautogenous selected strains of Aedes albopictus (Diptera: Culicidae). J Med

Entomol. 1994;31(4):554-560.


mosquitoes. Acta Trop. 2014;132:S12-S19.

293. Roth LM. A study of mosquito behavior. An experimental laboratory study of

the sexual behavior of Aedes aegypti (Linnaeus). Am Midl Nat. 1948;40(2):265-

352.

294. Lamb C. The geometry of insect pairing. Proceedings of the Royal Society of

London Series B, Containing Papers of a Biological Character. 1922;94(656):1-

11.

295. Smith S, Gadawski R. Swarming and mating in Aedes provocans (Diptera:

Culicidae). Great Lakes Entomol. 1994;27(3):175.

296. Cabrera M, Jaffe K. An aggregation pheromone modulates lekking behavior in

the vector mosquito Aedes aegypti (Diptera: Culicidae). J Am Mosq Control

Assoc. 2007;23(1):1-10.


mosquitoes. Acta Trop. 2014;132:S12-S19. Figure 1, The reproductive system

of female (in red) and male (in blue) Aedes and the sperm transfer during

copulation (represented by the arrows). Adapted from Clements (1999) and

Jones (1968); p. 2.

298. Montarsi F, Drago A, Martini S, et al. Current distribution of the invasive

mosquito species, Aedes koreicus [Hulecoeteomyia koreica] in northern Italy.

Parasit Vectors. 2015;8(1):614.

References 133

299. Armistead JS, Nishimura N, Arias JR, et al. Community ecology of container

mosquitoes (Diptera: Culicidae) in Virginia following invasion by Aedes

japonicus. J Med Entomol. 2014;49(6):1318-1327.

300. Armistead J, Arias J, Nishimura N, et al. Interspecific larval competition

between Aedes albopictus and Aedes japonicus (Diptera: Culicidae) in northern

Virginia. J Med Entomol. 2008;45(4):629.

301. Mohammed A, Chadee DD. Effects of different temperature regimens on the

development of Aedes aegypti (L.)(Diptera: Culicidae) mosquitoes. Acta Trop.

2011;119(1):38-43.

302. Aliota MT, Peinado SA, Velez ID, et al. The wMel strain of Wolbachia Reduces

Transmission of Zika virus by Aedes aegypti. Sci Rep. 2016;6:28792.

303. Frentiu FD, Zakir T, Walker T, et al. Limited dengue virus replication in field-

collected Aedes aegypti mosquitoes infected with Wolbachia. PLoS Negl Trop

Dis. 2014;8(2):e2688.

304. Walker T, Johnson P, Moreira L, et al. The wMel Wolbachia strain blocks

dengue and invades caged Aedes aegypti populations. Nature.

2011;476(7361):450.

305. Blagrove MS, Arias-Goeta C, Failloux A-B, et al. Wolbachia strain wMel

induces cytoplasmic incompatibility and blocks dengue transmission in Aedes

albopictus. Proceedings of the National Academy of Sciences. 2012;109(1):255-

260.

306. Reisen W. Estimation of vectorial capacity, Palm Springs CA, November 16,

1988. Bull Soc Vector Ecolog. 1989;14(1):39-70.

307. Chan M, Johansson MA. The incubation periods of dengue viruses. PLoS One.

2012;7(11):e50972.

308. Dohm DJ, O’Guinn ML, Turell MJ. Effect of environmental temperature on the

ability of Culex pipiens (Diptera: Culicidae) to transmit West Nile virus. J Med

Entomol. 2002;39(1):221-225.

309. Reisen W, Meyer R, Presser S, et al. Effect of temperature on the transmission

of western equine encephalomyelitis and St. Louis encephalitis viruses by Culex

tarsalis (Diptera: Culicidae). J Med Entomol. 1993;30(1):151-160.

310. Davis NC. The Effect of Various Temperatures in modifying the Extrinsic

Incubation Period of the Yellow Fever Virus in Aedes aegypti. Am J Hyg.

1932;16(1).

311. Lambrechts L, Paaijmans KP, Fansiri T, et al. Impact of daily temperature

fluctuations on dengue virus transmission by Aedes aegypti. Proceedings of the

National Academy of Sciences. 2011;108(18):7460-7465.

312. van den Hurk AF, Hall-Mendelin S, Pyke AT, et al. Vector competence of

Australian mosquitoes for chikungunya virus. Vector Borne Zoonotic Dis.

2010;10(5):489-495.

References 134

313. van den Hurk AF, Higgs S, McElroy K, et al. Vector competence of Australian

mosquitoes for yellow fever virus. Am J Trop Med Hyg. 2011;85(3):446-451.

314. Knox T, Kay B, Hall R, et al. Enhanced vector competence of Aedes aegypti

(Diptera: Culicidae) from the Torres Strait compared with mainland Australia

for dengue 2 and 4 viruses. J Med Entomol. 2003;40(6):950-956.

315. van den Hurk A, Nisbet D, Hall R, et al. Vector competence of Australian

mosquitoes (Diptera: Culicidae) for Japanese encephalitis virus. J Med Entomol.

2003;40(1):82-90.

316. Jeffery JA, Ryan PA, Lyons SA, et al. Vector competence of Coquillettidia

linealis (Skuse)(Diptera: Culicidae) for Ross River and Barmah Forest viruses.

Aust J Entomol. 2002;41(4):339-344.

317. Ryan P, Kay B. Vector competence of mosquitoes (Diptera: Culicidae) from

Maroochy Shire, Australia, for Barmah Forest virus. J Med Entomol.

1999;36(6):856-860.

318. Vazeille M, Moutailler S, Coudrier D, et al. Two Chikungunya isolates from the

outbreak of La Reunion (Indian Ocean) exhibit different patterns of infection in

the mosquito, Aedes albopictus. PLoS One. 2007;2(11):e1168.

319. Hugo LE, Prow NA, Tang B, et al. Chikungunya virus transmission between

Aedes albopictus and laboratory mice. Parasit Vectors. 2016;9(1):555.

320. Poo YS, Rudd PA, Gardner J, et al. Multiple immune factors are involved in

controlling acute and chronic chikungunya virus infection. PLoS Negl Trop Dis.

2014;8(12):e3354.




Protezione Ambientale del Veneto; 2018 [cited 2018 29 Jan]. Available from:

http://www.arpa.veneto.it/bollettini/storico/Mappa_2017_TEMP.htm

322. Ciocchetta S. WP 20150825 017 [Internet]. Australia: YouTubeAu, Ciocchetta

S, editor and producer; 2015; 1 video: 35 sec., color, 720x1280]. Available

from: https://www.youtube.com/watch?v=We7f10tPnKU

323. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints.

Am J Epidemiol. 1938;27(3):493-497.

324. Takken W. The role of olfaction in host-seeking of mosquitoes: a review. Int J

Trop Insect Sci. 1991;12(1-2-3):287-295.

325. Zouache K, Fontaine A, Vega-Rua A, et al. Three-way interactions between

mosquito population, viral strain and temperature underlying chikungunya virus

transmission potential. Proceedings of the Royal Society of London B:

Biological Sciences. 2014;281(1792):20141078.

326. Carrington LB, Armijos MV, Lambrechts L, et al. Fluctuations at a low mean

temperature accelerate dengue virus transmission by Aedes aegypti. PLoS Negl

Trop Dis. 2013;7(4):e2190.

References 135

327. Delatte H, Paupy C, Dehecq J, et al. Aedes albopictus, vector of chikungunya

and dengue viruses in Reunion Island: biology and control. Parasite (Paris,

France). 2008;15(1):3-13.

328. Paupy C, Delatte H, Bagny L, et al. Aedes albopictus, an arbovirus vector: from

the darkness to the light. Microbes Infect. 2009;11(14):1177-1185.

329. Paupy C, Ollomo B, Kamgang B, et al. Comparative role of Aedes albopictus

and Aedes aegypti in the emergence of Dengue and Chikungunya in central

Africa. Vector Borne Zoonotic Dis. 2010;10(3):259-266.

330. Charrel RN, de Lamballerie X, Raoult D. Chikungunya outbreaks-the

globalization of vectorborne diseases. N Engl J Med. 2007;356(8):769.

331. Thavara U, Tawatsin A, Pengsakul T, et al. Outbreak of chikungunya fever in

Thailand and virus detection in field population of vector mosquitoes, Aedes

aegypti (L.) and Aedes albopictus Skuse (Diptera: Culicidae). Southeast Asian J

Trop Med Public Health. 2009;40(5):951.

332. Pagès F, Peyrefitte CN, Mve MT, et al. Aedes albopictus mosquito: The main

vector of the 2007 Chikungunya outbreak in Gabon. PLoS One.

2009;4(3):e4691.

333. Fischer D, Thomas SM, Suk JE, et al. Climate change effects on Chikungunya

transmission in Europe: Geospatial analysis of vector’s climatic suitability and

virus’ temperature requirements. Int J Health Geogr. 2013;12(1):51.

334. Tilston N, Skelly C, Weinstein P. Pan-European Chikungunya surveillance:

designing risk stratified surveillance zones. Int J Health Geogr. 2009;8(1):61.

335. Sigfrid L, Reusken C, Eckerle I, et al. Preparing clinicians for (re-) emerging

arbovirus infectious diseases in Europe. Clin Microbiol Infect. 2017.

336. Erguler K, Chandra NL, Proestos Y, et al. A large-scale stochastic

spatiotemporal model for Aedes albopictus-borne chikungunya epidemiology.

PLoS One. 2017;12(3):e0174293.

337. Mordecai EA, Cohen JM, Evans MV, et al. Detecting the impact of temperature

on transmission of Zika, dengue, and chikungunya using mechanistic models.

PLoS Negl Trop Dis. 2017;11(4):e0005568.

338. Yixin HY, Carrasco AM, Dong Y, et al. The effect of temperature on

Wolbachia-mediated dengue virus blocking in Aedes aegypti. Am J Trop Med

Hyg. 2016;94(4):812-819.

339. Thu HM, Aye KM, Thein S. The effect of temperature and humidity on dengue

virus propagation in Aedes aegypti mosquitos. Southeast Asian J Trop Med

Public Health. 1998 Jun;29(2):280-4.

340. Kalan K, Šušnjar J, Ivović V, et al. First record of Aedes koreicus (Diptera,

Culicidae) in Slovenia. Parasitol Res. 2017:1-4.

341. McMeniman CJ, Lane RV, Cass BN, et al. Stable introduction of a life-

shortening Wolbachia infection into the mosquito Aedes aegypti. Science.

2009;323(5910):141-144.

References 136

342. Sinkins S, O'Neill S. Wolbachia as a vehicle to modify insect populations. In:

Handler AF, James AA, editors. Insect Transgenesis: Methods and Applications.

New York: CRC Press. pp. 271–287.

343. Alto BW, Wiggins K, Eastmond B, et al. Diurnal Temperature Range and

Chikungunya Virus Infection in Invasive Mosquito Vectors. J Med Entomol.

2017;55(1):217-224.

344. Adelman ZN, Anderson MA, Wiley MR, et al. Cooler temperatures destabilize

RNA interference and increase susceptibility of disease vector mosquitoes to

viral infection. PLoS Negl Trop Dis. 2013;7(5):e2239.

345. Myles KM, Wiley MR, Morazzani EM, et al. Alphavirus-derived small RNAs

modulate pathogenesis in disease vector mosquitoes. Proceedings of the

National Academy of Sciences. 2008;105(50):19938-19943.

346. Carver S, Bestall A, Jardine A, et al. Influence of hosts on the ecology of

arboviral transmission: potential mechanisms influencing dengue, Murray

Valley encephalitis, and Ross River virus in Australia. Vector Borne Zoonotic

Dis. 2009 Feb;9(1):51-64.

347. Edwards A. An unusual epidemic. Med J Aust. 1928;1:664-665.

348. Nimmo J. An unusual epidemic. Med J Aust. 1928;1:549-550.

349. Glass K. Ecological mechanisms that promote arbovirus survival: A

mathematical model of Ross River virus transmission. Trans R Soc Trop Med

Hyg. 2005 Apr;99(4):252-60.

350. Jones A, Lowry K, Aaskov J, et al. Molecular evolutionary dynamics of Ross

River virus and implications for vaccine efficacy. J Gen Virol. 2010 Jan;91(Pt

1):182-8.

351. Suhrbier A, La Linn M. Clinical and pathologic aspects of arthritis due to Ross

River virus and other alphaviruses. Curr Opin Rheumatol. 2004 Jul;16(4):374-9.

352. Mylonas AD, Brown AM, Carthew TL, et al. Natural history of Ross River

virus-induced epidemic polyarthritis. Med J Aust. 2002 Oct 7;177(7):356-60.

353. Lau C, Aubry M, Musso D, et al. New evidence for endemic circulation of Ross

River virus in the Pacific Islands and the potential for emergence. Int J Infect

Dis. 2017;57:73-76.

354. Reusken C, Cleton N, Melo MM, et al. Ross river virus disease in two Dutch

travelers returning from Australia, February to April 2015. Euro Surveill.

2015;20(31).

355. Mitchell C, Miller B, Gubler D. Vector competence of Aedes albopictus from

Houston, Texas, for dengue serotypes 1 to 4, yellow fever and Ross River

viruses. J Am Mosq Control Assoc. 1987;3(3):460-465.

356. Nicholson J, Ritchie S, Van Den Hurk A. Aedes albopictus (Diptera: Culicidae)

as a Potential Vector of Endemic and Exotic Arboviruses in Australia. J Med

Entomol. 2014;51(3):661-669.

References 137

357. Aaskov J, Fokine A, Liu W. Ross River virus evolution: Implications for

vaccine development. Future Virol. 2012;7(2):173-178.

Appendices 138

Appendices

Appendix A: Development of a protocol for vector competence using Ae.

albopictus as a model

Introduction

In Australia, experiments involving CHIKV and Ae. koreicus must be performed

in a PC3/QC3 insectary. In order to design protocols to evaluate the potential of Ae,

koreicus to vector CHIKV, preliminary experiments were performed with Ross River

virus (RRV) and Ae. albopictus. A vector competence study (Experiment 1 and 2) was

designed for and performed on Ae. albopictus from a colony maintained at QIMR

Berghofer to verify the validity of the protocol in assessing the vector competence of

this species for RRV.

Ae. albopictus were infected with RRV belonging to two different strains: a

human strain (ORG), and a bird strain (2982B) in consideration of the possible

differences of these two subtypes in the mosquito infection. This is an alphavirus

belonging to the family Togaviridae, which is endemic in Australia, and it presents

fewer restrictions in its experimental use than CHIKV. It is transmitted by a variety of

mosquitoes and several vertebrate species are suspected to play a role as reservoirs

[42], with a major role of marsupials as amplifying hosts [346]. The first reports linked

to this virus date back to 1928 [347, 348], and to date, three different strains of RRV

have been identified [346, 349, 350]. In humans, although in some cases the infection

could be asymptomatic [42], the clinical manifestation is usually associated with skin

rash, fever, and polyarthritis, with sequelae in some cases lasting over six months post

infection [351, 352]. Outside Australia, the virus has been repeatedly reported from

the Pacific Island Countries and Territories [353]; however, due to the variety of

Appendices 139

vectors involved and globalisation of travel, European outbreaks cannot be excluded

[354].

The role of Ae. albopictus as a vector for RRV was demonstrated for the first

time by the experimental infection of mosquito populations from Houston, Texas

infected with a RRV isolate from the Cook Islands [355]. Its role as a vector was

confirmed years later, with the experimental infection with RRV of Ae. albopictus

from a field population established in the Torres Strait region [356].

The aim of this experiment was to subsequently apply this model to the study of

Ae. koreicus.

After this model proved to be effective in evaluating the infection of the

mosquitoes and the dissemination of the virus to the saliva, the protocol was applied

to assess the risk of transmission of chikungunya associated with Ae. koreicus.

Methods

Mosquito rearing

Ae. albopictus originated from the QIMR Berghofer Quarantine colony

established in May 2014 from eggs collected on Hammond Island (Torres Strait,

Australia – Quarantine Import Permit Number 6-2104). The colony was maintained at

27 °C, 70 % relative humidity and 12:12 hour light:dark cycling, with 30 minute

crepuscular periods. Eggs were hatched by flooding dried eggs on paper with

rainwater. Larvae were reared in 45 x 40 x 5 cm white plastic trays in approximately

5 litres of rain water at densities of ≈ 500 larvae per tray. Larvae were fed ground

Tetramin® fish food solution in distilled water as per Table A1 to produce adults of

similar sizes (Table A1). Pupae were collected and placed in rainwater white trays (©

2014 Genfac Plastics Pty Ltd, 18.3 x 15.2 x 6.5 cm) inside a 30 × 30 × 30 cm cage

Appendices 140

(BugDorm®, MegaView Science Education Services Co., Taichung, Taiwan). Once

emerged, adult mosquitoes were provided with a 10% w/v sucrose solution ad libitum.

Table A.1: Volume of 0.125 g/ml Tetramin® fish food solution diluted in distilled

water administered daily to different instar larvae during rearing.

Oral infection with virus

After a 24-hour period of starvation in which 10% w/v sucrose solution in

distilled water was substituted with distilled water only, a bottle of hot water was

placed beside one of the cage walls. Females (five to six days old) that probed against

the bottle were aspirated and transferred to 750 ml plastic containers with gauze lids

(approximately 100 mosquitoes per container) and allowed to feed for one hour on

glass membrane feeders covered by a porcine intestinal membrane filled with an

infectious blood meal [235]. Infectious blood meals consisted of either one of two

strains of RRV (2982B-bird strain isolate from an infected bird [350] and ORG -human

strain isolate from a patient in north Queensland in 1989). The virus was added to

defibrinated sheep blood (Thermo Fisher Scientific® Aust Pty Ltd) at the final titers of

108.7 and 108.8 CCID50 per mL, respectively for the first experiment and106.8 CCID50

per mL for both strains in the second experiment.

Day Predominant Instar Tetramin® fish food solution

Volume per tray (mL)

0 I 0.5

1 I 0.5

2 I 0.5

3 II 1

4 III 1.5

5 III 1.5

6 IV 2

7 IV 2

8 3/4 IV, 1/4 Pupae 1.5

9 1/2 IV, 1/2 Pupae 1

10 Mostly Pupae 0

Appendices 141

The core of the glass membrane feeder was surrounded by a chamber that

contained water circulating from a 37°C bath to warm the blood. Cups of mosquitoes

were exposed to one of each of the above dilutions of viruses. As a control, one cup of

mosquitoes was fed under the same conditions on blood without virus. The infectious

blood provided was sampled before and after the feeding to quantify any degradation

of the virus titre over the feeding period.

After feeding, mosquitoes were anesthetised with CO2 and sorted on a cold table

(4°C). Non-engorged females were discarded, while engorged females were

transferred to a clean container. A count of engorged and total mosquito numbers was

made to determine the proportion of feeding. The mosquitoes were maintained in

environmental chambers (Panasonic, Osaka, Japan) at 27 C, 70% relative humidity

and 12:12 hour light:dark cycling, with 30 minute crepuscular periods and provided

with 10% w/v sucrose as a food source.

Processing mosquitoes

Mosquito processing was carried out in a Perspex® glove box. In Experiment 1

mosquitoes were dissected at day six post-feeding. Based on the results obtained, RRV

virus dissemination in Ae. albopictus was evaluated in Experiment 2 at days three, six,

and 10 post-feeding.

The mosquitoes were anesthetised using CO2 and samples were dissected on a

cold table at 4°C. The legs and wings were removed from each mosquito and

transferred to a 1.5 mL microfuge tube containing four glass beads and then transferred

to dry ice, followed by storage at -80°C. Mosquitoes deprived of wing and legs were

placed on double-sided sticky tape on a glass plate and allowed to salivate for 20

minutes by inserting their proboscis into a P200 micropipette tip previously loaded

with 50 µL of collecting medium (RPMI 1640 with 3% v/v Foetal Bovine Serum

Appendices 142

(FBS), 1% v/v L-Glutamine, 1% v/v Penicillin Streptomycin, 0.25 μg/ml

Amphotericin B) (Gibco; Thermo Scientific, Waltham, MA, USA). Mosquitoes were

observed under a stereoscope and peristaltic movements of the abdomen and labellae

indicated that saliva was ejected. After 20 minutes, P200 tips were emptied into a 1.5

mL microfuge tube and the bodies were placed in a separate tube. All samples were

then stored at -80°C.

Detection of virus infection

Mosquito bodies were added to 500 µL of collecting medium and centrifuged at

10,000 rpm for 10 minutes at 4°C. Supernatants were tested for RRV in C6/36 plates

seeded two days before the inoculation at a density of 2.25×105cells/mL, in replicates

of two.

C6/36 (ATCC # CRL-1660) were cultured in 5% CO2 atmosphere at 27°C, with

15 ml of cell culture medium composed of RPMI 1640 added with 10% v/v Foetal

Bovine Serum (FBS), 1% v/v L-Glutamine, 1% v/v Penicillin Streptomycin (Gibco;

Thermo Scientific, Waltham, MA, USA). Cells were transferred every three to four

days after removing the medium, washing the cell monolayer three times with 5 ml of

phosphate buffered saline (PBS), then incubating with 0.5 ml of 0.05% v/v Trypsin-

EDTA, phenol red (Gibco; Thermo Scientific, Waltham, MA, USA) at 37°C for five

minutes to allow cells to detach from the tissue culture flasks lower wall. 96-well plates

were seeded with 200µL per well of cells in culture medium.

After two days, medium (180µL) was removed from the seeded plates and

replaced with 130µL fresh 3% FBS medium (RPMI 1640 with 3% v/v FBS, 1% v/v

L-Glutamine, 1% v/v Penicillin Streptomycin). On clean 96-well plates, 108µL of

collecting medium was added from well 1 to well 11 and 12µL of sample (mosquito

bodies or legs added of collecting medium) were added to the first well and mixed by

Appendices 143

resuspension. Then 12µL of this first undiluted solution were removed from the first

well and placed into the second well of the same row, making a tenfold dilution (10-

1). The procedure was repeated from well 1 to well 11 giving serial dilutions from 10-

1 to 10-10. 50µL of the final mosquito grind dilution obtained was added to a C6/36

plate in duplicate from well 2 to 12, well 1 was added of 50µL undiluted mosquito

bodies or legs added of collecting medium. The same protocol was applied for saliva

samples, with the exception of the quantity of the sample added to the first C6/36 well,

which was 10µL of undiluted sample. Plates were then incubated at 27°C for three

days.

After the three-day incubation period, plates were assayed using an ELISA. The

protocol of Jeffery et al. [316] was followed, except that the conjugate solution

(horseradish peroxidase-labelled affinity purified goat-antimouse immunoglobulin G,

DAKO Corporation, Carpinteria, CA, USA) was diluted at 1:1000 instead of 1:2000.

The final chromogenic substrate added to the plates consisted of 50µL/well of TMB

(3,3′,5,5′-tetramethylbenzidine, SIGMA®). The plates were then incubated in the dark

overnight.

Infectious titers of individual mosquitoes were determined using a formula for

calculating 50% end points [323] and expressed as the log10 TCID50/mosquito

(TCID50 is defined as dilution ratio of the virus to generate 50% mortality of the cells).

Immunohistochemistry assay

For Experiment 1, ten mosquitoes exposed to ORG RRV and eight mosquitoes

exposed to 2982B RRV were processed for immunohistochemistry. Samples were

deprived of wings and legs and submerged in a solution of 4% paraformaldehyde

(PFA) containing 0.5% Triton-X (v/v). After two hours mosquitoes were transferred

to 70% EtOH and stored at 4°C until processing. Paraffin sections were stained with a

Appendices 144

monoclonal antibody (D7 from hybridoma [357]) and an Alexa Fluor 488 donkey anti-

mouse secondary antibody (green), with DNA stained using DAPI (blue) as described

more recently by Hugo, Prow et al. [319]. Stained sections were scanned with Aperio

eSlide Manager and ImageScope Viewer software (Aperio).

Statistical analysis

Mosquito feeding rates were analysed using a 𝜒2 test. The infectivity (n of

positive mosquito bodies/total mosquito n) of the two virus strains was tested with

Fisher’s exact test. Statistically significant differences in virus titres in mosquito

bodies between strains were tested performing Mann-Whitney test. All the statistical

tests were performed with GraphPad Prism Program (GraphPad Software, San Diego,

CA, USA).

Results

RRV infection was initially tested in mosquito bodies. Saliva was processed only

from virus-positive body samples. The percentage of engorged mosquitoes obtained

from the two experiments is shown in Table A2.

TableA.2: Proportion of Ae. albopictus obtained after artificial feeding from

Experiment 1 and Experiment 2.

Experiment 1

Treatment

Group N. mosquitoes N. Fed % Fed

Control 140 31 22.1

ORG 584 99 16.9

2982B 460 66 14.3

Experiment 2

Treatment Group N. mosquitoes N. Fed % Fed

Control 191 36 18.8

ORG 396 105 26.5

2982B 347 95 27.4

For both experiments (Experiment 1 and 2), the feeding rates for mosquitoes fed

with blood infected with ORG RRV or 2982B RRV were not significantly different

Appendices 145

when compared to those fed with plain sheep blood (𝜒2 test, Experiment 1: P = 0.0883,

df= 4.853, 2; Experiment 2: P = 0.0702, df= 5.313, 2).

In the first experiment (Experiment 1), the infectivity for mosquitoes fed with

blood infected with ORG virus (86.2%, n=29) was not significantly different when

compared to mosquitoes fed with blood infected with 2982B RRV (90%, n=30)

(Fisher’s exact test, P = 0.7065) (Table A3). A statistical analysis was not applied to

the salivary dissemination (13% salivary dissemination for ORG RRV, 19.2% salivary

dissemination for 2982B; Table A4) due to the low number of samples. Titres for the

saliva samples ranged from100.8 TCID50/mL to104.8 TCID50/mL for ORG RRV (n=

3) and from 100.8 TCID50/mL to103.8 TCID50/mL for 2982B RRV (n= 5).

Table A3: Proportion of Ae albopictus bodies infected with ORG RRV and 2982B

RRV six days post-feeding.

Virus Total Positive Infectivity (%)

ORG 29 25 86.2

2982B 30 27 90.0

Table A4: Proportion of Ae albopictus with virus in the saliva for ORG RRV and

2982B RRV six days post-feeding.

Virus Total Positive Dissemination (%)

ORG 23 3 13

2982B 26 5 19.2

A Mann-Whitney test found a significant difference between the two strains in

titres, as assayed using mosquito bodies for Experiment 1 (P= 0.0222, U= 219.5,

Median of ORG= 5.8, n=25, Median of 2982B= 6.8, n=27) (FigureA.1).

Appendices 146

Figure A1: Box-Plot of virus titers in bodies of Ae. albopictus infected with ORG

RRV and 2982B RRV at Day six post-feeding (p< 0.05, Experiment 1).

Interestingly, the total percentage of infected bodies obtained with 2982B RRV

strain (76%, n=75) in the second experiment (Experiment 2) performed was

significantly different from the total percentage of body infected obtained with ORG

RRV strain (25.3%, n= 75) (Fisher’s exact test, P= 0.0003). Table A5 reports the

number of infected body for the two different virus strains per each time points and

the salivary dissemination of the virus.

Table A.5: Ae. albopictus body infection and saliva dissemination after feeding on

blood meal at final titers of 106.8 TCID50/mL of 2982B RRV and ORG RRV

(Experiment 2).

RRV strain Days post feeding Body infection (n) Saliva dissemination (n)

ORG 3 6 (25) 0 (6)

6 5 (25) 0 (5)

10 8 (25) 1 (8)

2982B 3 19 (25) 1 (19)

6 17 (25) 1 (17)

10 21 (25) 5 (21)

Appendices 147

Virus titres in Ae. albopictus bodies ranged from 102.8 to 107.8 TCID50/mL in

mosquitoes infected with ORG RRV (n= 19) and from 104.6 to 107.8 TCID50/mL (n=

57) in mosquitoes infected with 2982B RRV (Figure A2). Only one sample of Ae.

albopictus saliva was positive for ORG RRV at day 10 post feeding (104.8

TCID50/mL); one saliva sample was positive for 2982B RRV at both days three and

six post feeding (102.8 TCID50/mL in both samples), whereas saliva titres for 2982B

RRV at day 10 post feeding ranged from 101.8 TCID50/mL to 103.8 TCID50/mL (n=

5) (Figure A3).

Figure A2: Box-Plot of virus titers of mosquito bodies infected with ORG RRV and

2982B RRV at days six, 10, and 14 post-feeding (Experiment 2).

Appendices 148

Figure A3: Box-Plot of virus titers of mosquito saliva infected with ORG RRV and

2982B RRV at days six, 10 and 14 post-feeding (Experiment 2).

No statistical difference was found at day three post infection between mosquito

bodies infected with either virus strains (P= 0 0.0561, U= 28.5, Median of ORG= 3.8,

n=6, Median of 2982B= 5.8, n=19, Figure A4) when performing a Mann-Whitney test

for separate time points. At days six and 10 post infection, the titres of mosquito bodies

infected with 2982B RRV were significantly higher than ORG RRV (P= 0.0002, U=

1.5, Median of ORG= 4.8, n=5, Median of 2982B= 6.8, n=17, Figure A5; P= 0.0152,

U= 36.5, Median of ORG= 4.8, n=8, Median of 2982B= 6.8, n=21, Figure A6).

Appendices 149

Figure A4: Box-Plot of titers of RRV in mosquito bodies at day 3 post-feeding

(Experiment 2).

Figure A5: Box-Plot of titers of RRV in mosquito bodies at day 6 post-feeding (p<

0.0005, Experiment 2).

***

Appendices 150

Figure A6: Box-Plot of titers of RRV in mosquito bodies at day 10 post-feeding (p<

0.05, Experiment 2).

Of the samples analysed with immunohistochemistry, six mosquitoes showed

signs of 2982B RRV infection (n=8) and five mosquitoes showed signs of ORG RRV

infection (n=10). Infection had disseminated beyond the midgut in two of the six

mosquitoes infected with RRV 2982B and four of the five mosquitoes that showed

signs of RRV ORG (Figure A7).

*

Appendices 151

Figure A7: Indirect immunofluorescence on a section Ae. albopictus infected with

2982B RRV (a), demonstrating dissemination to the foregut (b) and to the midgut (c)

(Experiment 1).

Discussion and conclusion

The model proposed using the invasive mosquito Ae. albopictus to test Ae.

koreicus vector competence was successful. Low salivary dissemination rate of ORG

RRV and 2982B RRV obtained after the first experiment, although with some high

titres, led to a further evaluation of the possible role of Ae. albopictus in RRV

transmission by designing a second experiment to assess the virus dissemination at

different time points. This experiment confirmed previous results (Table A5).

Appendices 152

The results revealed that Ae. albopictus is susceptible to RRV infection and

dissemination, as confirmed by the indirect immunofluorescence assay (Figure A7)

and might still transmit the virus with a lower impact as a vector (ORG RRV higher

saliva titre of 104.8 TCID50/mL and 2982B RRV higher saliva titre of 103.8

TCID50/mL).

Appendices 153

Appendix B

Appendices 154

Appendices 155

Appendices 156

Appendices 157

Appendix C: Publications included in this document

Appendices 158

Appendices 159

Appendices 160

Appendices 161

Appendices 162

Appendices 163

Appendices 164

Appendices 165

Appendices 166

Appendices 167

Appendices 168

Appendices 169

Appendices 170

Appendices 171

Date post:	06-Jun-2020
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

THE VECTOR POTENTIAL OF THE MOSQUITO AEDES KOREICUS Ciocchetta Thesis.pdf · The vector potential...

Documents