Degradation of 2,3-dihydroxybenzoateby a novel meta-cleavage pathway.

Item Type Article

Authors Marín, Macarena; Plumeier, Iris; Pieper, Dietmar H

Citation Degradation of 2,3-dihydroxybenzoate by a novel meta-cleavagepathway. 2012, 194 (15):3851-60 J. Bacteriol.

DOI 10.1128/JB.00430-12

Journal Journal of bacteriology

Rights Archived with thanks to Journal of bacteriology

Download date 05/06/2018 13:16:37

Link to Item http://hdl.handle.net/10033/252493

This is a pre- or post-print of an article published inMarín, M., Plumeier, I., Pieper, D.H.

Degradation of 2,3-dihydroxybenzoate by a novel meta-cleavage pathway

(2012) Journal of Bacteriology, 194 (15), pp. 3851-3860.

1

Degradation of 2,3-dihydroxybenzoate by a novel meta-cleavage 1

pathway 2

3

Macarena Marín1, Iris Plumeier, and Dietmar H. Pieper* 4

5

Microbial Interactions and Processes Research Group, HZI – Helmholtz Centre for 6

Infection Research Inhoffenstr. 7, 38124 Braunschweig, Germany 7

8

Running title: Degradation of 2,3-dihydroxybenzoate 9

10

1Present address: Institute of Genetics, LMU-University of Munich, 82152 11

Martinsried, Germany 12

13

*To whom correspondence should be addressed: Dietmar H. Pieper, Microbial 14

Interactions and Processes Research Group, HZI – Helmholtz Centre for Infection 15

Research, Inhoffenstraße 7, 38124 Braunschweig, Germany. Phone: +49 (531) 16

61814200, Fax: +49 (531) 61814499. E-mail: dpi@helmholtz-hzi.de 17

18

19

Keywords: biodegradation; 2,3-dihydroxybenzoate; Pseudomonas reinekei 20

21

2

ABSTRACT 22

23

2,3-Dihydroxybenzoate is the precursor in the biosynthesis of several siderophores 24

and an important plant secondary metabolite that in bacteria can be degraded via 25

meta-cleavage of the aromatic ring. The dhb cluster of Pseudomonas reinekei MT1 26

encodes a chimeric meta-cleavage pathway involved in the catabolism of 2,3-27

dihydroxybenzoate. While the first two enzymes, DhbA and DhbB, are 28

phylogenetically related to those involved in 2,3-dihydroxy-p-cumate degradation, the 29

subsequent steps are catalyzed by enzymes related to those involved in catechol 30

degradation (DhbCDEFGH). Characterization of kinetic properties of DhbA extradiol 31

dioxygenase identified 2,3-dihydroxybenzoate as the preferred substrate. Deletion of 32

the encoding gene impedes growth of P. reinekei MT1 on 2,3-dihydroxybenzoate. 33

DhbA catalyzes a 3,4-dioxygenation with 2-hydroxy-3-carboxymuconate as product, 34

which is then decarboxylated by DhbB to 2-hydroxymuconic semialdehyde. This 35

compound is then subject to dehydrogenation and further degraded to citrate cycle 36

intermediates. Transcriptional analysis revealed genes of the dhB gene cluster to be 37

highly expressed during growth with 2,3-dihydroxybenzoate, whereas a downstream 38

localized gene encoding 2-hydroxymuconic semialdehyde hydrolase, dispensable for 39

2,3-dihydroxybenzoate metabolism but crucial for 2,3-dihydroxy-p-cumate 40

degradation, was only marginally expressed. This is the first report describing a 41

gene cluster encoding enzymes for the degradation of 2,3-dihydroxybenzoate. 42

43

3

INTRODUCTION 44

45

Bacteria synthesize small iron chelating molecules, called siderophores, in order 46

to facilitate iron uptake. As the availability of this element in many environments is 47

limited, siderophores are crucial for bacterial fitness and virulence (12). One of the 48

best-studied siderophores is enterobactin, which is produced by enterobacteria such 49

as Salmonella enterica and E. coli (43). A central intermediate in the synthesis of this 50

siderophore is 2,3-dihydroxybenzoate (2,3-DHB), which is also a precursor in the 51

synthesis of anguibactin and vibriobactin (12). Moreover, 2,3-DHB is recognized as 52

an important plant secondary metabolite (5), However, despite its similarity to central 53

intermediates of bacterial aromatic degradative pathways such as 3,4-54

dihydroxybenzoate (protocatechuate), only limited information is available on 2,3-55

DHB degradation. 56

It has previously been shown that P. fluorescens 23D-1 can degrade this 57

compound (44) and that metabolism is initiated by an extradiol dioxygenase, 58

probably cleaving the substrate between the C3 and C4 carbon atoms (45). Extradiol 59

(meta-) cleavage of 2,3-DHB has also been observed in a Pseudomonas putida 60

strain (3). However, whether the observed subsequent decarboxylation of the ring-61

cleavage product to yield 2-hydroxymuconic semialdehyde was spontaneous or 62

enzyme catalyzed has not yet been elucidated. Alternative pathways have been 63

described in fungi such as Trichosporum cutaneum, where 2,3-DHB degradation is 64

initiated by a decarboxylase (2) or in plants such as Tecoma stans, where 65

degradation proceeds via intradiol cleavage (49). In the current report, we elucidated 66

the degradation of 2,3-DHB by Pseudomonas reinekei MT1 and were able to identify 67

a gene cluster involved in this metabolic route. 68

69

4

MATERIALS AND METHODS 70

71

Bacterial strains, plasmids and growth conditions. The bacterial strains and 72

plasmids used in this study are listed in Table 1. P. reinekei strain MT1 was grown in 73

minimal medium as previously described (39), with 2 mM 2,3-dihydroxybenzoate as 74

the sole carbon source. Luria-Bertani (LB) medium was used as rich medium for 75

Escherichia coli and P. reinekei strains. For selection of mutants, ABC medium (AB 76

medium (11) supplemented with trace metals (17) and 20 mM citrate was used. 77

Antibiotics were used at the following concentrations: for E. coli; ampicillin (Ap, 200 78

µg/ml), carbenicillin (Cb, 100 µg/ml), gentamycin (Gm, 10 µg/ml) and tetracycline 79

(Tc, 10 µg/ml), and for P. reinekei; Gm (200 µg/ml) and Tc (15 µg/ml). 80

81

Sequencing and sequence analysis. The dhb gene cluster was localized by 82

sequencing downstream of the previously described sal cluster of P. reinekei MT1, 83

which is harbored on a fosmid from a previously constructed fosmid library (9). Direct 84

sequencing was performed using the ABI PRISM BigDye Terminator v1.1 Ready 85

Reaction Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and an ABI 86

PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Raw 87

sequence data from both strands were assembled manually. DNA and protein 88

similarity searches were performed using BLASTX and BLASTP programs from the 89

NCBI website (1). Translated protein sequences were aligned with MUSCLE using 90

default values (19). Phylogenetic trees were constructed with MEGA5 (53) using the 91

neighbor-joining algorithm (47) with p-distance correction and pairwise deletion of 92

gaps and missing data. A total of 100 bootstrap replications were performed to test 93

for branch robustness. 94

5

95

Nucleotide sequence accession number. The nucleotide sequence reported in 96

this study has been deposited in the GenBank database under GenBankAccession 97

Number JN638999. 98

Construction of a dhbA deletion mutant. A deletion mutant of the dhbA gene 99

encoding 2,3-dihydroxybenzoate 3,4-dioxygenase was constructed with the 100

previously described Flp-FTR recombination strategy (29). PCR fragments were 101

amplified using primer pairs upstream (KOC23OAF and KOC23OAR, Table 2) and 102

downstream (KOC23OBF and KOC23OBR3, Table 2) of the targeted gene (∼700 103

bp) carrying PstI-BamHI and BamHI-Acc65l restriction sites, respectively. 104

Subsequently, they were cloned into the PstI-Acc65l restriction site of the pEX18Ap 105

vector, forming plasmid pABdhbA (Table 1). A 1.8 kb BamHI fragment from pS858 106

plasmid carrying a GmR-GFP cassette was cloned into the BamHI restriction site 107

formed, resulting in the pAGBdhbA suicidal plasmid (Table 1). This suicide plasmid 108

was transferred to P. reinekei MT1 by biparental mating using E. coli S17λpir as 109

donor strain. The transconjugants generated by single crossover were selected on 110

ABC medium supplemented with Gm and merodiploids were resolved by additional 111

plating on ABC medium supplemented with 5% sucrose. Deletion of the GmR-GFP 112

cassette was achieved by conjugation of the Flp-expressing pBBFLP plasmid into 113

the resulting strains by biparental mating using E. coli CC118λpir as donor and 114

selection on ABC medium containing Tc. Plasmid pBBFLP was cured by streaking 115

strains on ABC medium supplemented with 5% sucrose. Integrity of the mutant was 116

verified by growth on ABC medium supplemented with different antibiotics, PCR 117

amplification and sequencing of regions flanking the deleted gene. 118

119

6

Cloning of the dhbA gene and expression of the encoded protein. A 995 bp 120

region harboring the dhbA gene was PCR amplified using primers pGC23OR and 121

pGC23OF (Table 2) and cloned in the pGEM-T Easy vector (Promega, Germany) 122

generating plasmid pGC23O. The plasmid was used to transform E. coli JM109 and 123

positive clones were selected by resistance to ampicillin. A clone termed E. coli 124

JM109 (pGC23O) was selected and the integrity of the insert verified by sequencing. 125

E. coli JM109 (pGC23O) was grown at 37ºC in LB medium containing 200 mg 126

ampicillin ml-1. For induction IPTG (0.5 mM) was added when cultures reached an 127

A600nm= 0.6. Cells were harvested after 2 h incubation at 37ºC and the cell pellet 128

resuspended in 50 mM phosphate buffer pH 8.0. 129

130

Real-time-PCR. P. reinekei MT1 was grown overnight in minimal medium with 10 131

mM gluconate or 2 mM 2,3-DHB as a carbon source. During exponential growth 132

(A600nm= 0.8 in case of growth with gluconate and 70% of 2,3-DHB depletion, as 133

followed by HPLC analysis during growth on 2,3-DHB), three 2 ml aliquots were 134

pelleted and supplemented with 1 ml of RNAprotect (QIAGEN). Total RNA was 135

isolated using the RNeasy minikit (Qiagen), according to the manufacturer’s 136

instructions. The resulting RNA was treated with the Turbo DNase kit (Ambion, 137

Austin, TX) to remove any DNA contamination and quantified using a Nanodrop 138

2000c (Peqlab). cDNA was synthesized from 230 - 580 ng total RNA using 139

SuperScript III reverse transcriptase (Invitrogen) according to the procedure from the 140

manufacturer, followed by purification of cDNA using a Qiaquick PCR purification kit 141

(Qiagen). 142

Transcripts of dhbA, dhbE, dhbH, dhbI, mmlL and orf4 were quantified with 143

primer pairs given in Table 2 and the ribosomal rpsL gene was chosen as a 144

7

housekeeping reference gene (9). Each reaction was performed in duplicate in a 145

final volume of 20 μl containing 2.5 µl of each primer (10 pmol), 10 µL QuantiTect 146

SYBR Green PCR Master Mix (Qiagen) and 5 μl of cDNA template (corresponding to 147

1 – 10 ng). Amplification was carried out in a LightCycler® 480 Real-Time PCR 148

System programmed to hold at 95 °C for 10 min, and to complete 50 cycles of 94 °C 149

for 15 s, 57 °C for 40 s and 72 °C for 40 s. The PCR results were analysed by the 150

LightCycler® 480 Software (Roche Applied Science, USA). Standard curves were 151

generated from serial dilutions of known concentrations of P. reinekei MT1 genomic 152

DNA (containing between 2 and 2X106 copies of the target gene µl-1) by plotting 153

threshold cycles (CT values) versus copy number assuming that 1 ng of DNA 154

contains 9.8 x 105 copies of the entire P. reinekei MT1 genome (estimated as 6 Mbp 155

based on reported genome sizes of sequenced Pseudomonas strains) where the 156

target genes are assumed to be present as a single copy. 157

Enzymatic assays. Cell extracts of P. reinekei MT1 and of E. coli JM109 158

(pGC23O) were prepared as previously described (39). Catalytic activities were 159

recorded at 25ºC in 50 mM air-saturated phosphate buffer pH 8.0 on a UV 2100 160

spectrophotometer (Shimadzu Corporation). 2,3-DHB 3,4-dioxygenase activity was 161

followed by measuring transformation of catechol or 3-methylcatechol to 2-162

hydroxymuconic semialdehyde (HMS, ε375nm= 36000 M-1 cm-1) or 2-hydroxy-6-oxo-163

2,4-heptadienoate (HOPDA, ε388nm= 13800 M-1 cm-1), respectively. Extinction 164

coefficients of the ring-cleavage products of 2,3-DHB or 2,3-dihydroxy-p-cumate 165

were determined as ε343nm= 31600 M-1cm-1 or ε347= 27400 M-1cm-1, respectively, after 166

incubation of 25 - 50 µM of substrate with cell free extract until complete turnover. 167

Activities with protocatechuate and pyrogallol were followed by recording changes in 168

UV-visible spectra (250 - 400nm) after addition of cell extract for up to 30 min. 169

8

Catalytic activities of 2-hydroxy-3-carboxymuconic semialdehyde (HCMS) 170

decarboxylase were recorded at 375 nm based on the difference in extinction at 171

λ=375 nm of the substrate (ε375nm= 16400 M-1 cm-1) and the HMS product. HMS 172

hydrolase activity was measured by determining the NAD+-independent decrease in 173

concentration of HOPDA at 388 nm. HMS dehydrogenase activity was measured by 174

determining the NAD+-dependent decrease in concentration of HMS at 375 nm. 175

NAD+ was added to a final concentration of 0.5 mM. Specific activities are expressed 176

as units per gram of protein. Vmax and Km values were determined using 1–100 μM 177

(2,3-DHB dioxygenase) or 0.2 - 10 μM of substrate (2-hydroxy-3-carboxymuconic 178

semialdehyde decarboxylase and HMS dehydrogenase) in air-saturated buffer and 179

kinetic data were calculated from the initial velocities using the Michaelis-Menten 180

equation by non-linear regression (KaleidaGraph, Synergy Software). 181

182

Analytical methods. Transformation of 2,3-DHB was monitored by HPLC 183

analysis. Aliquots of 10 ml of cell-free supernatants were analysed with a Shimadzu 184

HPLC system (LC-10AD liquid chromatograph, DGU-3 A degasser, SPD-M10A 185

diode array detector and FCV-10AL solvent mixer) equipped with a Lichrospher RP8 186

column (125 mm by 4.6 mm, Bischoff, Leonberg, Germany) using an aqueous 187

solvent system (flow rate, 1 ml min-1) containing 0.01% (v/v) H3PO4 (87%) and 40% 188

(v/v) methanol, where 2,3-DHB exhibited a retention volume of 3.0 ml. 189

For 1H NMR analysis, the 2,3-DHB ring-cleavage product was prepared by 190

quantitative transformation of 1 mM 2,3-DHB in 50 mM phosphate buffer (pH 8.0) 191

with cell extract of E. coli JM109 (pGC23O) preinduced for the induction of DhbA. 192

After complete substrate transformation as evidenced by HPLC 0.56 ml of the 193

reaction mixture were supplemented with 0.14 ml of D2O. One-dimensional and two-194

9

dimensional correlation spectroscopy (COSY) 1H NMR spectra were recorded at 300 195

K on an AVANCE DMX 600 NMR spectrometer (Bruker, Rheinstetten, Germany). 196

The center of the suppressed water signal (δ = 4.80 ppm) was used as an internal 197

reference. 198

199

Chemicals. 2,3-dihydroxy-p-cumate was a kind gift from Richard Eaton (18). 2-200

Hydroxy-3-carboxymuconic semialdehyde and 2-hydroxy-3-carboxy-6-oxo-7-201

methylocta-2,4-dienoate were prepared in situ by incubation of a solution containing 202

0.1 mM 2,3-dihydroxybenzoate or 2,3-dihydroxy-p-cumate in 50 mM phosphate 203

buffer (pH 8.0) with cell extract of E. coli JM109 (pGC23O) preinduced for the 204

induction of DhbA, whereas HMS and HOPDA (0.1 mM) were prepared with cell 205

extracts of E. coli JM109 (pC23Ohis218) expressing catechol 2,3-dioxygenase (32). 206

207

10

RESULTS 208

209

Identification and analysis ORFs involved in 2,3-dihydroxybenzoate 210

degradation in P. reinekei MT1. P. reinekei MT1 is able to grow on 2,3-DHB as the 211

sole carbon source. Analysis of a 20.2 kb region of the P. reinekei MT1 genome 212

revealed the presence of 19 hitherto unknown ORFs. This region is framed by the 213

previously described mmlI and sal gene clusters and is located upstream of a 214

previously identified ORF encoding a putative HMS hydrolase (9, 38) (Fig. 1, Table 215

3) now termed dhbI. Eight of the identified ORFs can be assumed to encode proteins 216

homologous to those involved in the degradation of dihydroxylated aromatics via 217

meta-cleavage. The first ORF identified in this cluster termed dhbR is transcribed in 218

the opposite direction to the following structural genes and encodes a putative LysR-219

type transcriptional regulator. The following gene, dhbA encodes an extradiol 220

dioxygenase belonging to the type I extradiol dioxygenase family (DhbA). DhbA is 221

homologous to PsbC2, the 2,3-dihydroxy-p-cumate-3,4-dioxygenase from R. 222

palustris (56% identity) (42), and is also related to other proteins previously identified 223

as 2,3-dihydroxy-p-cumate-3,4-dioxygenases (18) (Table 3, Fig. 2A). dhbB encodes 224

a protein of the aldolase II superfamily (cl00214) homologous to CmtD proteins from 225

B. xenovorans LB400 (YP_557489, 55% identity) and P. putida F1 (AAB62290, 54% 226

identity), which catalyze the decarboxylation of the 2,3-dihydroxy-p-cumate ring-227

cleavage product (2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate) to 2-228

hydroxy-6-oxo-7-methylocta-2,4-dienoate (18). DhbB is distantly related to 3,4-229

dihydroxyphthalate 2-decarboxylases (18) (Table 3, Fig. 2B). The putative functions 230

and phylogenetic relationship of DhbA and DhbB suggest that these enzymes are 231

11

involved in the degradation of a carboxylated catechol, which is subject to ring-232

cleavage followed by decarboxylation. 233

The following ORFs (dhbCDEFGH) encode enzymes homologous to those 234

involved in catechol meta-cleavage pathways and evidently encode HMS 235

dehydrogenase (DhbC), 2-oxopent-4-enoate hydratase (DhbD), 4-oxalocrotonate 236

decarboxylase (DhbE), 4-oxalocrotonate tautomerase (DhbF) acetaldehyde 237

dehydrogenase (DhbG) and 4-hydroxy-2-ketovalerate aldolase (DhbH), respectively 238

(Table 3, Fig. 2C and D). Such enzymes are necessary to achieve degradation of 239

catechols via the so-called dehydrogenase branch of the meta-cleavage pathway, 240

which channels catechol via HMS, 2-hydroxymuconate and 4-oxalocrotonate to 2-241

oxopent-4-enoate (Fig. 3) (25). 242

This is in contrast to the organization of the gene clusters for 2,3-dihydroxy-p-243

cumate degradation of P. putida F1 (18) and B. xenovorans LB400 (CP000270: 244

Bxe_A3546-Bxe_A3554), where genes encoding HMS dehydrogenase, 4-245

oxalocrotonate decarboxylase and 4-oxalocrotonate tautomerase were absent (Fig. 246

1). The alternative branch of catechol degradation involves a HMS hydrolase (25). 247

Degradation via this branch is necessary for the degradation of 3-alkylsubstituted 248

catechols, where the ring-cleavage product is a ketone, which cannot be subjected 249

to dehydrogenation, as in 2,3-dihydroxy-p-cumate degradation (Fig. 3) (18). 250

A gene encoding a putative HMS hydrolase (DhbI) was localized 10.7 kb 251

downstream of dhbH (Fig. 1). DhbI is clearly distinct from other hydrolases, such as 252

CmtE involved in the transformation of 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate 253

(24-27% identity) (18), BphD transforming 2-hydroxy-6-phenylhexa-2,4-dienoate (33) 254

or MhpC transforming 2-hydroxy-6-ketonona-2,4-dienedioic acid (up to 35% identity) 255

12

(16). It is however related to HMS hydrolases of catechol meta-cleavage pathways, 256

such as XylF of P. putida mt2 (>50% identity) (31) (Table 3, Fig. 2D). 257

The ten ORFs localized between dhbH and dhbI exhibited no evident function 258

related to aromatic degradation. Interestingly, genes similar to orf4-6 were observed 259

in an identical arrangement in the genomes of Agrobacterium radiobacter K84 260

(NC_011983: Arad_7275-Arad_7279), while genes related to orf7-10 are present in 261

Methylibium petroliphilum PM1 (YP_001020161: Mpe_A0964-Mpe_A0967) and 262

Leptothrix choldni SP-6 (YP_001791193: Lcho_2162-Lcho_2165). Nevertheless, 263

they are separated from the meta-pathway gene clusters harbored in these strains 264

(Table 3, Fig. 1). 265

266

The dhbA gene is essential for growth of P. reinekei MT1 on 2,3-267

dihydroxybenzoate. Based on the putative function and the phylogeny of the 268

enzymes encoded by the dhb cluster, as well as on the gene cluster organization, it 269

was deduced that this cluster could be involved in both 2,3-dihydroxy-p-cumate and 270

also 2,3-DHB degradation. As P. reinekei MT1 is not capable of growing on p-271

cumate, the role of the dhb cluster in the degradation of 2,3-DHB was analyzed. 272

Directed deletion of dhbA, the gene encoding a putative 2,3-DHB 3,4-dioxygenase, 273

was performed. MT1ΔdhbA was unable to grow on 2,3-DHB as the only carbon 274

source, confirming the crucial role of DhbA for degradation of this compound. 275

276

DhbA catalyzes ring-cleavage of 2,3-dihydroxybenzoate. The transformation 277

of 2,3-DHB by cell extracts of 2,3-DHB degrading Pseudomonas strains has 278

previously been described to result in the formation of HMS by ring-cleavage and 279

subsequent decarboxylation (3, 45). Transformation of 2,3-DHB by recombinant 280

13

DhbA resulted in the formation of a product with an absorption maximum of λmax=343 281

nm (Fig. 4), which is clearly different from that of HMS (λmax=375 nm), but similar to 282

that of 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate formed by extradiol 283

ring-cleavage of 2,3-dihydroxy-p-cumate (λmax=346 nm) (18). This indicates that 284

decarboxylation of the 2,3-DHB ring-cleavage product does not occur 285

spontaneously, but is most probably catalyzed by DhbB. 286

To identify its structure, the reaction product formed by recombinant DhbA was 287

analyzed by 1H NMR analysis (Fig. 4). Only two coupled olefinic protons (δ = 6.69 288

ppm and δ = 7.52 ppm) were present in the product, excluding that a 1,2-289

dioxygenation with 2-hydroxy-6-oxohepta-2,4-dienoate as product had occurred. The 290

vicinal coupling of 14.5 Hz observed for the olefinic unit is characteristic of a trans 291

configuration in an open-chain system (46). An aldehydic proton resonates at 9.03 292

ppm and shows a coupling of 8.9 Hz with the olefinic proton at 6.69 ppm. These 293

characteristics are in accordance with the 2-hydroxy-3-carboxymuconate structure 294

and proof that DhbA catalyzes a 3,4-dioxygenation, and a decarboxylation of the 295

ring-cleavage product does not occur spontaneously. 296

297

DhbA is specialized in 2,3-dihydroxybenzoate ring-cleavage. The activity of 298

recombinant DhbA was assessed against different dihydroxylated aromatic 299

compounds (Table 4). The highest activity was observed with 2,3-DHB. 2,3-300

Dihydroxy-p-cumate was also transformed at a rate of approximately 30% to that of 301

2,3-DHB. Of the other substrates tested, only catechol was transformed. Analysis of 302

kinetic parameters revealed a Km for 2,3-DHB of 2.9 μM, roughly half of that for 2,3-303

dihydroxy-p-cumate. Accordingly, comparison of specificity constants (Vmax/Km) 304

showed 2,3-DHB to be the preferred substrate (Table 4). 305

14

Transformation of 2,3-DHB by cell extracts of 2,3-DHB grown cells of P. reinekei 306

MT1 showed transformation into a product with an absorption maximum λmax=375 307

nm, without any indication of accumulation of 2-hydroxy-3-carboxymuconic 308

semialdehyde (λmax=343 nm, see above). In accordance, 2-hydroxy-3-309

carboxymuconic semialdehyde was transformed rapidly by the extract with a Vmax of 310

731 ± 17 U/g protein into the product with an aborption maximum at 375 nm, 311

indicating decarboxylation of the product to form HMS. Thus, the observed rate of 312

formation of HMS from 2,3-DHB of 37 U/g protein by cell extracts seems to be 313

limited by 2,3-DHB dioxygenase and indicate the activity of this protein in the cell 314

extract. Whereas the activity of HMS hydrolase was below the detection limit, HMS 315

dehydrogenase was active in cell extracts (Table 5). 316

317

Real-time-PCR analysis of MT1 transcripts. To confirm that the dhb genes are 318

specifically transcribed during 2,3-DHB degradation, accumulation of transcripts of 319

dhbA, dhbE and dhbH obviously localized in the same catabolic gene cluster was 320

measured during growth on 2,3-DHB as well as on gluconate as a noninducing 321

negative control. To analyze how far genes downstream of the dhb gene cluster 322

were transcribed, orf4 and dhbI were also included in the analysis. mmlL encoding 4-323

methyl-3-oxoadipate enol-lactone hydrolase, a key enzyme in the degradation of 324

methylaromatics by P. reinekei MT1 (38) was used as negative control. Transcript 325

levels during growth on gluconate were generally low (<100/ng of cDNA, Fig. 5) for 326

all genes of the dhb gene cluster, and only mmlL showed slightly higher transcript 327

levels. Significantly elevated dhbA, dhbE and dhbH transcript levels were observed 328

in 2,3-DHB grown cells. When the relative expression levels between the target and 329

the reference gene (rpsL) were compared to those under noninducing conditions (at 330

15

a ratio of 1), approximately 500 - 1500 fold higher amounts of transcripts were 331

observed (Fig. 5). In contrast, expression levels of orf4 and dhbI were only increased 332

approximately 15-fold, whereas mmlL was not induced (Fig. 5). 333

334

16

DISCUSSION 335

336

Throughout this study, we have been able to demonstrate that P. reinekei MT1 is 337

able to degrade 2,3-DHB using a meta-cleavage pathway encoded by the dhb 338

cluster. DhbA catalyzes the ring-cleavage of 2,3-DHB and is a type I extradiol 339

dioxygenase of the vicinal oxygen chelate family (21). This family is composed of 340

enzymes which are well known for being involved in the degradation of catechol or 341

alkylsubstituted catechols and of bicyclic dihydroxylated aromatics like 2,3-342

dihydroxybiphenyl (25). Enzymes acting on carboxylated catechols such as CmtC of 343

P. putida F1 (18) or DhbA described here evidently form novel branches in the 344

phylogeny of type I extradiol dioxygenases (20). If enzymes of this branch are 345

generally of broad substrate specificity and accept differently substituted 3-346

carboxycatechols as substrates as indicated for an enzyme of p-cymene grown P. 347

putida PL-W as well as shown here for DhbA, remains to be elucidated (15). The 348

channeling of the ring-cleavage products of 2,3-DHB and 2,3-dihydroxy-p-cumate 349

into well documented meta-cleavage pathways is catalyzed by decarboxylases of the 350

class II aldolase family forming HMS or 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate, 351

respectively. The exploration of currently published genomes revealed that at least 352

A. radiobacter K84, R. solanacearum GMI1000, Achromobacter xylosoxidans A8 and 353

Cupriavidus necator N-1 also harbor both genes (Fig. 2) and may thus, also be 354

capable of degrading carboxysubstituted catechols. 355

After extradiol cleavage, the ring-cleavage products are typically processed by 356

one of two distinct meta-cleavage pathway branches. If the ring-cleavage product is 357

an aldehyde (HMS in case of 2,3-DHB), the pathway proceeds via the 358

dehydrogenase branch via dehydrogenation, isomerization and decarboxylation (Fig. 359

17

3), leading to the formation of 2-oxopenta-4-enoate as the central intermediate. In 360

contrast, if the ring cleavage product is a ketone (2-hydroxy-6-oxo-7-methylocta-2,4-361

dienoate in case of 2,3-dihydroxy-p-cumate metabolism) the pathway proceeds via 362

the hydrolytic branch, where the ketone is hydrolyzed to give 2-oxopenta-4-enoate, 363

and an acid. Further transformation of 2-oxopenta-4-enoate, the common 364

intermediate of the hydrolytic and dehydrogenase branches, proceeds by a 2-365

oxopent-4-enoate hydratase leading to the formation of 4-hydroxy-2-oxovalerate, 366

which is subsequently converted into pyruvate and acetaldehyde by a 4-hydroxy-2-367

oxovalerate aldolase (51). Finally, these products can enter the citrate cycle (Fig. 3). 368

Various meta-cleavage pathway gene clusters have been described in the 369

literature. The most extensively studied meta-cleavage pathway is the one encoded 370

on the TOL plasmid pWW0 (8, 23), which harbors genes encoding a ferredoxin 371

(xylT), a catechol 2,3 dioxygenase (C23O) (xylE), and both the hydrolytic (xylF) and 372

the dehydrogenase (xylG, xylH, and xylI) branch of the meta-cleavage pathway (22, 373

50). Although a similar structure is maintained in various catechol meta-cleavage 374

pathway gene clusters, several others such as those involved in the degradation of 375

biphenyl, which require the hydrolytic branch, are devoid of genes encoding the 376

dehydrogenase branch (30). Similarly both the 2,3-dihydroxy-p-cumate degradation 377

gene clusters of P. putida F1 and of B. xenovorans LB400 are devoid of genes 378

encoding enzymes of this branch, and are thus not appropriate to ensure 2,3-DHB 379

degradation (CP000270: Bxe_A3546-Bxe_A3554) (18). The fact that, like CmtC-like 380

extradiol dioxygenases (Fig. 2A), CmtE-like hydrolases constitute a separate branch 381

in their phylogeny (Fig. 3E) indicates co-evolution of genes of the cmt gene clusters 382

for the degradation of p-cumate. 383

18

In contrast, the dhb cluster described here more likely represents a chimeric gene 384

cluster composed of genes encoding enzymes specialized for channeling 2,3-DHB 385

into the meta-cleavage route clustered with genes closely resembling those of 386

archetype meta-cleavage pathway gene clusters. While DhbC, DhbD and DhbE are 387

most closely related to proteins encoded by meta-cleavage pathway clusters 388

involved in phenol degradation by Burkholderiales bacteria, specifically C. necator 389

H16 (h16_B0546- h16_B0552), Verminephrobacter eiseniae EF01-2 (Veis_2781-390

Veis_2787), Leptothrix cholodnii SP-6 (Lcho_3340-Lcho_3356) or Methylibium 391

petrophilum PM1 (Mpe_A2266-Mpe_A2277) (Fig. 2C), DhbG and DhbH are more 392

closely related to enzymes encoded by 2,3-dihydroxyphenylpropionate catabolic 393

gene clusters (Fig. 2D), possibly indicating different origins of these genes too. 394

Investigation of bacterial genomes showed that catabolic gene clusters of a 395

structure identical to that of the dhb gene cluster structure are present in R. 396

solanaecaerum GMI1000 (RSp0888- RSp0895) and C. necator N-1 397

(CNE_BB1p13310-13240 and CNE_p112030-12140) A. radiobacter K84 398

(Arad_7255- Arad_7275). As in P. reinekei MT1 both these gene clusters are devoid 399

of a gene encoding a HMS hydrolase. Similar gene clusters are also present in the 400

genomes of Achromobacter xylosooxidans A8 and Agrobacterium radiobacter K84. It 401

can thus be speculated that these strains have the capability of mineralizing 2,3-DHB 402

and that the dhb type gene cluster may be highly appropriate for 2,3-DHB 403

mineralization and thus wide spread among bacteria. 404

Although a gene encoding a HMS hydrolase is not present in the P. reinekei MT1 405

dhb gene cluster, such a gene termed dhbI was located in its proximity, and 406

expression was observed during growth on 2,3-DHB. If DhbI encodes a functional 407

hydrolase which may serve to extend the range of substrates that can be used by P. 408

19

reinekei MT1 from which source it may have been recruited and if orf4 through orf10 409

may form a transcriptional unit together with dhbI is currently under investigation. 410

The observed gene organization of P. reinekei MT1 may thus still be in evolution to 411

ensure the degradation of various environmentally relevant carboxylated aromatics. 412

413

414

ACKNOWLEDGEMENTS 415

416

We thank Dr. R. Eaton for kindly supplying 2,3 dihydroxy-p-cumate, Dr. V. Wray for 417

support in interpretation of 1H NMR spectra, C. Kakoschke, and B. Jaschok-Kentner 418

for meticulous technical assistance, and Dr R. Vilchez-Vargas and Dr. M Wos-Oxley 419

for support in real-time PCR experiments. This work was supported by the DFG-420

European Graduate College 653. 421

422

423

424

20

REFERENCES 425

426

1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, 427

Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of 428

protein database search programs. Nucleic Acids Res. 25:3389-3402. 429

2. Anderson JJ, Dagley S. 1981. Catabolism of tryptophan, anthranilate, and 430

2,3-dihydroxybenzoate in Trichosporon cutaneum. J. Bacteriol. 146:291-297. 431

3. Andreoni V, Canonica L, Galli E, Gennari C, Treccani V. 1981. 2,3-432

Dihydroxybenzoate pathway in Pseudomonas putida. 1H n.m.r. study on the 433

ring-cleavage site. Biochem. J. 194:607-610. 434

4. Arai H, Ohishi T, Chang MY, Kudo T. 2000. Arrangement and regulation of 435

the genes for meta-pathway enzymes required for degradation of phenol in 436

Comamonas testosteroni TA441. Microbiology 146:1707-1715. 437

5. Bartsch M, Bednarek P, Vivancos P, Schneider B, von Roepenack-Lahay 438

E, Foyer C, Kombrink E, Scheel D, Parker J. 2010. Accumulation of 439

isochorismate-derived 2,3-dihydroxybenzoic 3-O-β-D-xyloside in Arabidopsis 440

resistance to pathogens and ageing of leaves. J. Biol. Chem. 285:25654-441

25665. 442

6. Bosch R, Garcia-Valdes E, Moore ER. 2000. Complete nucleotide sequence 443

and evolutionary significance of a chromosomally encoded naphthalene-444

degradation lower pathway from Pseudomonas stutzeri AN10. Gene 245:65-445

74. 446

7. Brickman TJ, McIntosh MA. 1992. Overexpression and purification of ferric 447

enterobactin esterase from Escherichia coli. Demonstration of enzymatic 448

21

hydrolysis of enterobactin and its iron complex. J. Biol. Chem. 267:12350-449

12355. 450

8. Burlage RS, Hooper SW, Sayler GS. 1989. The TOL (pWW0) catabolic 451

plasmid. Appl. Environ. Microbiol. 55:1323-1328. 452

9. Camara B, Bielecki P, Kaminski F, dos Santos VM, Plumeier I, Nikodem 453

P, Pieper DH. 2007. A gene cluster involved in degradation of substituted 454

salicylates via ortho cleavage in Pseudomonas sp. strain MT1 encodes 455

enzymes specifically adapted for transformation of 4-methylcatechol and 3-456

methylmuconate. J. Bacteriol. 189:1664-1674. 457

10. Camara B, Strompl C, Verbarg S, Sproer C, Pieper DH, Tindall BJ. 2007. 458

Pseudomonas reinekei sp. nov., Pseudomonas moorei sp. nov. and 459

Pseudomonas mohnii sp. nov., novel species capable of degrading 460

chlorosalicylates or isopimaric acid. Int. J. Syst. Evol. Microbiol. 57:923-931. 461

11. Clark J, Maaloe O. 1967. DNA replication and the division cycle in 462

Escherichia coli. J. Mol. Biol. 23:99-112. 463

12. Crosa JH, Walsh CT. 2002. Genetics and assembly line enzymology of 464

siderophore biosynthesis in bacteria. Microbiol. Mol. Biol. Rev. 66:223-249. 465

13. de las Heras A, Carreno CA, de Lorenzo V. 2008. Stable implantation of 466

orthogonal sensor circuits in Gram-negative bacteria for environmental 467

release. Environ. Microbiol. 10:3305-3316. 468

14. de Lorenzo V, Timmis KN. 1994. Analysis and construction of stable 469

phenotypes in gram-negative bacteria with Tn5- and Tn10-derived 470

minitransposons. Methods Enzymol. 235:386-405. 471

22

15. DeFrank JJ, Ribbons DW. 1977. p-Cymene pathway in Pseudomonas 472

putida: ring cleavage of 2,3-dihydroxy-p-cumate and subsequent reactions. J. 473

Bacteriol. 129:1365-1374. 474

16. Diaz E, Ferrandez A, Prieto MA, Garcia JL. 2001. Biodegradation of 475

aromatic compounds by Escherichia coli. Microbiol. Mol. Biol. Rev. 65:523-476

569. 477

17. Dorn E, Hellwig M, Reineke W, Knackmuss H-J. 1974. Isolation and 478

characterization of a 3-chlorobenzoate degrading pseudomonad. Arch. 479

Microbiol. 99:61-70. 480

18. Eaton RW. 1996. p-Cumate catabolic pathway in Pseudomonas putida F1: 481

Cloning and characterization of DNA carrying the cmt operon. J. Bacteriol. 482

178:1351-1362. 483

19. Edgar RC. 2004. MUSCLE: a multiple sequence alignment method with 484

reduced time and space complexity. BMC Bioinformatics 5:113. 485

20. Eltis LD, Bolin JT. 1996. Evolutionary relationships among extradiol 486

dioxygenases. J. Bacteriol. 178:5930-5937. 487

21. Gerlt JA, Babbitt PC. 2001. Divergent evolution of enzymatic function: 488

Mechanistically diverse superfamilies and functionally distinct suprafamilies. 489

Annu. Rev. Biochem. 70:209-246. 490

22. Ghosal D, You IS, Gunsalus IC. 1987. Nucleotide sequence and expression 491

of gene nahH of plasmid NAH7 and homology with gene xylE of TOL pWWO. 492

Gene 55:19-28. 493

23. Greated A, Lambertsen L, Williams PA, Thomas CM. 2002. Complete 494

sequence of the IncP-9 TOL plasmid pWW0 from Pseudomonas putida. 495

Environ. Microbiol. 4:856-871. 496

23

24. Greenwood KT, Luke RK. 1978. Enzymatic hydrolysis of enterochelin and its 497

iron complex in Escherichia coli K-12. Properties of enterochelin esterase. 498

Biochim. Biophys. Acta 525:209-218. 499

25. Harayama S, Mermod N, Rekik M, Lehrbach PR, Timmis KN. 1987. Roles 500

of the divergent branches of the meta-cleavage pathway in the degradation of 501

benzoate and substituted benzoates. J. Bacteriol. 169:558-564. 502

26. Harayama S, Rekik M. 1993. Comparison of the nucleotide sequences of the 503

meta-cleavage pathway genes of TOL plasmid pWW0 from Pseudomonas 504

putida with other meta-cleavage genes suggests that both single and multiple 505

nucleotide substitutions contribute to enzyme evolution. Mo.l Gen. Genet. 506

239:81-89. 507

27. Herrero M, de Lorenzo V, Timmis KN. 1990. Transposon vectors containing 508

non-antibiotic resistance selection markers for cloning and stable 509

chromosomal insertion of foreign genes in gram-negative bacteria. J. 510

Bacteriol. 172:6557-6567. 511

28. Hickey WJ, Sabat G, Yuroff AS, Arment AR, Perez-Lesher J. 2001. 512

Cloning, nucleotide sequencing, and functional analysis of a novel, mobile 513

cluster of biodegradation genes from Pseudomonas aeruginosa strain JB2. 514

Appl. Environ. Microbiol. 67:4603-4609. 515

29. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. A 516

broad-host-range Flp-FRT recombination system for site-specific excision of 517

chromosomally-located DNA sequences: application for isolation of unmarked 518

Pseudomonas aeruginosa mutants. Gene 212:77-86. 519

24

30. Hofer B, Backhaus S, Timmis KN. 1994. The biphenyl/poychlorinated 520

biphenyl-degradation locus (bph) of Pseudomonas sp. LB400 encodes four 521

additional metabolic enzymes. Gene 144:9-16. 522

31. Horn JM, Harayama S, Timmis KN. 1991. DNA sequence determination of 523

the TOL plasmid (pWWO) xylGFJ genes of Pseudomonas putida: implications 524

for the evolution of aromatic catabolism. Mol. Microbiol. 5:2459-2474. 525

32. Junca H, Plumeier I, Hecht HJ, Pieper DH. 2004. Difference in kinetic 526

behaviour of catechol 2,3-dioxygenase variants from a polluted environment. 527

Microbiology 150:4181-4187. 528

33. Kimbara K, Hashimoto T, Fukuda M, Koana T, Takagi M, Oishi M, Yano 529

K. 1989. Cloning and sequencing of two tandem genes involved in 530

degradation of 2,3-dihydroxybiphenyl to benzoic acid in the polychlorinated 531

biphenyl- degrading soil bacterium Pseudomonas sp. strain KKS102. J. 532

Bacteriol. 171:2740-2747. 533

34. Kunze M, Zerlin KF, Retzlaff A, Pohl JO, Schmidt E, Janssen DB, Vilchez-534

Vargas R, Pieper DH, Reineke W. 2009. Degradation of chloroaromatics by 535

Pseudomonas putida GJ31: assembled route for chlorobenzene degradation 536

encoded by clusters on plasmid pKW1 and the chromosome. Microbiology 537

155:4069-4083. 538

35. Lal R, Dogra C, Malhotra S, Sharma P, Pal R. 2006. Diversity, distribution 539

and divergence of lin genes in hexachlorocyclohexane-degrading 540

sphingomonads. Trends Biotechnol. 24:121-130. 541

36. Liang Q, Takeo M, Chen M, Zhang W, Xu Y, Lin M. 2005. Chromosome-542

encoded gene cluster for the metabolic pathway that converts aniline to TCA-543

25

cycle intermediates in Delftia tsuruhatensis AD9. Microbiology 151:3435-544

2446. 545

37. Loper JE, Henkels MD. 1999. Utilization of heterologous siderophores 546

enhances levels of iron available to Pseudomonas putida in the rhizosphere. 547

Appl. Environ. Microbiol. 65:5357-5363. 548

38. Marín M, Pérez-Pantoja D, Donoso R, Wray V, González B, Pieper DH. 549

2010. Modified 3-oxoadipate pathway for the biodegradation of 550

methylaromatics in Pseudomonas reinekei MT1. J. Bacteriol. 192:1543-1552. 551

39. Nikodem P, Hecht V, Schlomann M, Pieper DH. 2003. New bacterial 552

pathway for 4-and 5-chlorosalicylate degradation via 4-chlorocatechol and 553

maleylacetate in Pseudomonas sp strain MT1. J. Bacteriol. 185:6790-6800. 554

40. Park W, Padmanabhan P, Padmanabhan S, Zylstra GJ, Madsen EL. 2002. 555

nahR, encoding a LysR-type transcriptional regulator, is highly conserved 556

among naphthalene-degrading bacteria isolated from a coal tar waste-557

contaminated site and in extracted community DNA. Microbiology 148:2319-558

2329. 559

41. Poole K, McKay GA. 2003. Iron acquisition and its control in Pseudomonas 560

aeruginosa: many roads lead to Rome. Front. Biosci. 8:d661-686. 561

42. Puskas LG, Inui M, Kele Z, Yukawa H. 2000. Cloning of genes participating 562

in aerobic biodegradation of p-cumate from Rhodopseudomonas palustris. 563

DNA Seq. 11:9-20. 564

43. Raymond KN, Dertz EA, Kim SS. 2003. Enterobactin: an archetype for 565

microbial iron transport. Proc. Natl. Acad. Sc.i U S A 100:3584-3588. 566

44. Ribbons DW. 1966. Bacterial oxydation of 2,3-dihydroxybenzoic acid - a new 567

oxygenase. Biochem. J. 99:30P-31P. 568

26

45. Ribbons DW, Senior PJ. 1970. 2,3-Dihydroxybenzoate 3,4-oxygenase from 569

Pseudomonas fluorescens: determination of the site of ring cleavage with a 570

substrate analogue. Biochem. J. 117:28P-29P. 571

46. Riegert U, Heiss G, Fischer P, Stolz A. 1998. Distal cleavage of 3-572

chlorocatechol by an extradiol dioxygenase to 3-chloro-2-hydroxymuconic 573

semialdehyde. J. Bacteriol. 180:2849-2853. 574

47. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for 575

reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425. 576

48. Screen J, Moya E, Blagbrough IS, Smith AW. 1995. Iron uptake in 577

Pseudomonas aeruginosa mediated by N-(2,3-dihydroxybenzoyl)-L-serine 578

and 2,3-dihydroxybenzoic acid. FEMS Microbiol. Lett. 127:145-149. 579

49. Sharma HK, Vaidyanathan CS. 1975. A new mode of ring cleavage of 2,3-580

dihydroxybenzoic acid in Tecoma stans (L.). Partial purification and properties 581

of 2,3-dihydroxybenzoate 2,3-oxygenase. Eur. J. Biochem. 56:163-171. 582

50. Shingler V, Franklin FC, Tsuda M, Holroyd D, Bagdasarian M. 1989. 583

Molecular analysis of a plasmid-encoded phenol hydroxylase from 584

Pseudomonas CF600. J. Gen. Microbiol. 135:1083-1092. 585

51. Shingler V, Powlowski J, Marklund U. 1992. Nucleotide sequence and 586

functional analysis of the complete phenol/3,4-dimethylphenol catabolic 587

pathway of Pseudomonas sp. strain CF600. J. Bacteriol. 174:711-724. 588

52. Smith MG, Gianoulis TA, Pukatzki S, Mekalanos JJ, Ornston LN, 589

Gerstein M, Snyder M. 2007. New insights into Acinetobacter baumannii 590

pathogenesis revealed by high-density pyrosequencing and transposon 591

mutagenesis. Genes Dev. 21:601-614. 592

27

53. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular 593

Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 594

24:1596-1599. 595

54. Zhu M, Valdebenito M, Winkelmann G, Hantke K. 2005. Functions of the 596

siderophore esterases IroD and IroE in iron-salmochelin utilization. 597

Microbiology 151:2363-2372. 598

599

600

28

TABLE 1. Strains and plasmids used in this work 601

Bacterial strains or plasmids

Relevant genotype Source / reference

E. coli JM109 e14–(McrA–) recA1 endA1 gyrA96 thi-1 hsdR17 (rK– mK+)

supE44 relA1 Δ(lac-proAB) [F´ traD36 proAB lacIqZΔM15] Stratagene

S17λpir Tpr Smr recA thi pro rK- mK+ RP4:2-Tc:MuKm Tn7 pir (14) CC118λpir (ara-leu) araD lacX74 galE galK phoA20 thi-1 rpsE rpoB

argE(Am) recA1 pir (27)

P. reinekei MT1 Wild Type (10) MT1ΔdhbA Deletion mutant with a 872 bp excision in gene dhbA. This study Plasmids pEX18Ap ApR; oriT+sacB+, gene replacement vector with MCS from

pUC18 (29)

pPS858 ApR, GmR;blunt-ended pPS747 PstI-XbaI fragment ligated into the blunt-ended EcoRI site of pPS856. This plasmid carries a GmR-GFP cassette

(29)

pBBFLP TcR, source of inducible FLP recombinase (13, 29)

pABdhbA ApR; pEX18Ap derivative with PCR-amplified regions flanking the dhbA gene (696 bp upstream and 660 bp downstream) cloned in Acc65l/PstI restriction site.

This study

pAGBdhbA ApRGmR; pABmmlC derivative with GmR-GFP cassette cloned between PCR-amplified regions flanking the dhbA gene

This study

pGEM-T Easy ApR; cloning vector Promega pC23Ohis218 pGEM-T Easy derivative containing the catechol 2,3-

dioxygenase encoding gene from Pseudomonas veronii 1YdBTEX2

(32)

pGC23O ApR; pGEM-T Easy derivative with a 995 bp PCR-amplified region containing the dhbA gene cloned in the T-overhangs.

This study

602

603

29

TABLE 2. Primers used in this study. 604

Primer Sequence Product size

Target

KOC23OAF GGAGACTGCAGGCGCACTTGTACATGTT 718 dhbR KOC23OAR GAGAGGGATCCGCGGCCTCGAACGTTAT KOC23OBF GGAGAGGATCCGTGACCGCCACGGC 682 dhbB KOC23OBR3 GAGAGGGTACCGGCAGTGAGGTAATCCC pGC23OR TCACGCCACTCACGAACGG 995 dhbA pGC23OF TCAGATCGGTTTTCATGGG RT_rpsL_F ATGGCAACTATCAACCAGCTG 280 rpsL RT_rpsL_R ACCCGGAAGGTCTTTTACAC RT_mmlL_F CCAGATGCAGTAACCGGAGT 400 mmlL RT_mmlL_R GGTCATCACCCACCTTCACT RT_dhbI_F AGGTGTTCGCCTATGACCAG 199 dhbI RT_dhbI_R CGTCACGACCATGAATCAAC RT_orf4_F TCTATCGTCAACACGGCATC 205 orf4 RT_orf4_R TTGGCAAAGTTGTCTTCCTG RT_dhbE_F TTGAGGTCGAAGCGAAAGTT 395 dhbE RT_dhbE_R GTGGCCGTGACCAAAATAAC RT_dhbH_F CGGAGTAAGTCGCTCGTTGT 392 dhbH RT_dhbH_R GCAGATCTATCAGCGTCGTG RT_dhbA_F CATGATGTCATCGACGGTTT 389 dhbA RT_dhbA_R CGCAGGTGCTCGAAGATAAT

605 606

30

TABLE 3. Open reading frames (ORFs) and genes of the dhb gene cluster of P. 607 reinekei MT1 and surrounding regions. 608

Related gene

products a

Gene Gene

product (aa)

Putative function of gene product

Name/ size (aa)

Organism %aa

identity Accession nº (reference)

dhbR 320 LysR-type transcriptional regulator

CNE_BB1p12040 (301) C. necator N-1 55 YP_004688643

NahR (300) P. fluorescens Cg5 33 AAM09546 (40)

dhbA 287 2,3-DHB 3,4-dioxygenase

AXYL_02525 (313) A. xylosoxidans A8 71 YP_003978561

PsbC2 (283) R. palustris nº7 56 BAA82122 (42)

dhbB 233

2-Hydroxy-3-carboxy-muconic semialdehyde

decarboxylase

AXYL_02526 (236) A. xylosoxidans A8 65 YP_003978562

CmtD (243) P. putida F1 54 AAB62290 (18)

dhbC 489 2-Hydroxymuconic semialdehyde

dehydrogenase

H16_B0547 (492) C. necator H16 80 YP_728709

NahI (486) P. stutzeri AN10 70 AAD02149 (6)

dhbD 260 2-Oxopent-4-enoate hydratase

H16_B0548 (260) C. necator H16 77 YP_728710

AphE (260) C. testosteroni TA441

68 BAA88502 (4)

dhbE 266 4-Oxalocrotonate decarboxylase

H16_B0549 (262) C. necator H16 82 YP_728711

XylI (264) P. putida mt2 63 AAA25693 (26)

dhbF 63 4-Oxalocrotonate tautomerase

CNE_BB1p11970 (63) C. necator N-1 75 YP_004688636

NahJ (63) P. stutzeri AN10 58 Q9ZI54 (6)

dhbG 312 Acetaldehyde dehydrogenase

MhpF1 (312) P. putida GJ31 78 Q49KG0 (34)

dhbH

345 4-Hydroxy-2-ketovalerate aldolase

Avin_42120 (340) A. vinelandii DJ 88 YP_002801314

XylK (345) P. putida mt2 86 P51019 (26)

orf1 130 Hypothetical protein SrosDRAFT_45540 (120)

S. roseum DSM 43021

39 ZP_04473974

orf2 302 LysR-type transcriptional regulator

SalR1 (308) Pseudomonas reinekei MT1

66 ABH07018 (9)

HybH (231) P. aeruginosa JB2 52 AAC69490 (28)

orf3 312 LysR-type transcriptional regulator

Mmc1_0773 (315) Magnetococcus sp. MC-1

51 YP_864700

A1S_2405 (306) A. baumannii ATCC17978

36 ABO12824 (52)

orf4 253 Short chain dehydrogenase

Arad_7279 (254) A. radiobacter K84 51 YP_002540411

LinC (250) S. paucimobilis 49 AAZ14097 (35)

orf5 152 Hypothetical protein Arad_7278 (151) A. radiobacter K84 39 YP_002540410

orf6 254 Short chain dehydrogenase

Arad_7275 (256) A. radiobacter K84 57 YP_002540408

orf7 563 Hypothetical protein CNE_BB2p00960 (549) C. necator N-1 61 YP_004682758

orf8 458 Hypothetical protein CNE_BB2p00970 (460) C. necator N-1 65 YP_004682759

orf9 366 Hypothetical protein PRK13684 (360) P. fluorescens 49 BAD11010

orf10 831 RND family transporter CNE_BB2p00990 (813) C. necator N-1 68 YP_004682761

dhbI 276 2-Hydroxymuconic semialdehyde

hydrolase

Daro_3786 (274) D. aromatica RCB 65 YP_286985

TadF (286) D. tsuruhatensis AD9 62 AAX47253 (36) a The gene product with the highest amino acid sequence identity, as well as the 609 most closely related gene product of validated function, are given. 610 611

612

31

TABLE 4. Substrate specificity of DhbA. 613

Substrate Activity

(U/g protein)

Km

(μM)

Vmax

(U/g protein)

Vmax/Km

(relative)

2,3-DHB 93.8 2.9 ± 0.2 96.3 ± 2.0 1

2,3-DH-p-cumate 32.7 5.9 ± 0.7 32.7 ± 1.0 0.167

Catechol 6.8 n.d.b n.d.b n.d.b

3-Methylcatechol <1 n.d.b n.d.b n.d.b

Protocatechuate <1 n.d.b n.d.b n.d.b

Pyrogallol <1 n.d.b n.d.b n.d.b

a The specific activity was determined at a concentration of 100 µM of substrate in 614

phosphate buffer (50 mM, pH 8) 615

b n.d.: not determined 616

617

32

TABLE 5. Enzyme activities in cell extracts of P. reinekei MT1 grown on 2,3-DHB. 618

Enzyme Substrate Activity

(U/g protein)

Km

(μM)

Vmax

(U/g protein)

2,3-DHB

dioxygenase

2,3-DHB 37 n.d.b n.d.b

HCMS

decarboxylase

HCMS 640 0.74 ± 0.05 731 ± 17

HMS

dehydrogenase

HMS 141 1.2 ± 0.2 170 ± 7

HMS hydrolase HOPDA <5 n.d.b n.d.b

a The specific activity were determined in phosphate buffer (50 mM, pH 8) at a 619

concentration of 100 µM of 2,3-DHB and 5 µM of HCMS or HMS. 620

b n.d.: not determined 621

622

33

FIGURE LEGENDS 623

624

FIG.1. Chimeric organization of the dhb gene cluster. 625

Organization and comparison of the dhb gene cluster of P. reinekei MT1 with the cmt 626

cluster of P. putida F1 and the phenol catabolic gene cluster comprising meta-627

cleavage pathway genes of C. necator H16. Genes with high similarity to those of 628

the dhb gene cluster are framed in bold. HMS, 2-hydroxymuconic semialdehyde, 629

HCOMODA, 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate. 630

631

FIG. 2. Dendrograms showing the relatedness Dhb enzymes. 632

A. Extradiol dioxygenases 633

B. decarboxylases of the class II aldolase family acting in aromatic metabolism 634

C. 2-oxopent-4-enoate hydratase and 4-oxocrotonate decarboxylase 635

D. acetaldehyde dehydrogenase and 636

E. 2-hydroxymuconic semialdehyde hydrolases. 637

The evolutionary history was inferred using the Neighbor-joining method and the p-638

distance model after alignment of sequences using MUSCLE (19). All positions 639

containing alignment gaps and missing data were eliminated only in pairwise 640

sequence comparisons. Phylogenetic analysis were conducted in MEGA5 (53). 641

642

643

34

FIG. 3. Proposed pathway for 2,3-DHB degradation by P. reinekei MT1. A putative 644

route for 2,3-dihydroxy-p-cumate metabolism is also shown. 645

Enzymes: DhbA, 2,3-DHB 3,4-dioxygenase; DhbB, 2-hydroxy-3-carboxymuconic 646

semialdehyde decarboxylase; DhbC, 2-hydroxymuconic semialdehyde 647

dehydrogenase; DhbD, 2-oxopent-4-enoate hydratase; DhbE, 4-oxalocrotonate 648

decarboxylase; DhbF, 4-oxalocrotonate isomerase; DhbG, acetaldehyde 649

dehydrogenase; DhbH, 4-hydroxy-2-oxovalerate aldolase; DhbI, 2-hydroxymuconic 650

semialdehyde hydrolase. 651

652

FIG 4. Conversion of 2,3-DHB by extracts of E. coli JM109 (pGC23O) and structure 653

of the ring-cleavage product as deduced by 1H NMR analysis. 654

The sample for photometric analysis contained 50 mM phosphate buffer (pH 8.0) 655

and 50 µM 2,3-DHB. Spectra were recorded before the addition of 15 µL of cell 656

extract for 20 min at 2 min intervals. 1H NMR analysis was performed after 657

transformation of 1 mM 2,3-DHB in 50 mM phosphate buffer (pH 8.0). 658

659

660

35

FIG. 5. Absolute (top) and relative (bottom) expression levels of catabolic genes in 661

2,3-DHB-grown cells of P. reinekei MT1 as determined by quantitative real-time-662

PCR. The number of transcripts/ng of cDNA in gluconate (light grey bars) and 2,3-663

DHB-grown cells (dark grey bars) is shown (top). The error bars indicate standard 664

deviations. Relative expression values (bottom) represent n-fold change in the ratio 665

of gene expression between the target gene and the reference gene (rpsL) 666

compared to expression under noninducing conditions (for rpsL this ratio was set as 667

1). 668