Click here to load reader
Date post: | 15-Sep-2016 |
Category: |
Documents |
Upload: | jessica-boyd |
View: | 222 times |
Download: | 1 times |
Click here to load reader
Plasmid 50 (2003) 131–144
www.elsevier.com/locate/yplas
Three small, cryptic plasmids from Aeromonas salmonicidasubsp. salmonicida A449
Jessica Boyd,* Jason Williams, Bruce Curtis, Catherine Kozera, Rama Singh,and Michael Reith
National Research Council Institute for Marine Biosciences, 1411 Oxford Street, Halifax, NS, Canada B3H 3Z1
Received 21 February 2003, revised 2 June 2003
Abstract
The nucleotide sequences of three small (5.2–5.6 kb) plasmids from Aeromonas salmonicida subsp. salmonicida A449
are described. Two of the plasmids (pAsa1 and pAsa3) use a ColE2-type replication mechanism while the third (pAsa2)
is a ColE1-type replicon. Insertions in the Rep protein and oriV region of the ColE2-type plasmids provide subtle
differences that allow them to be maintained compatibly. All three plasmids carry genes for mobilization (mobABCD),
but transfer genes are absent and are presumably provided in trans. Two of the plasmids, pAsa1 and pAsa3, carry
toxin–antitoxin gene pairs, most probably to ensure plasmid stability. One open reading frame (ORF), orf1, is con-
served in all three plasmids, while other ORFs are plasmid-specific. A survey of A. salmonicida strains indicates that
pAsa1 and pAsa2 are present in all 12 strains investigated, while pAsa3 is present in 11 and a fourth plasmid, pAsal1, is
present in 7.
Crown Copyright � 2003 Published by Elsevier Inc. All rights reserved.
Keywords: Furunculosis; Plasmid addiction; ColE1-type replicon; ColE2-type replicon
1. Introduction
Aeromonas salmonicida subsp. salmonicida is the
aetiological agent of the salmonid disease furun-
culosis, a disease with both high mortality andmorbidity (Smith, 1997). Furunculosis is a signifi-
cant cause of economic loss in salmonid aquacul-
ture throughout the world. Furunculosis is a
complex disease and exists in different forms
* Corresponding author. Fax: +902-426-9413.
E-mail address: [email protected] (J. Boyd).
0147-619X/$ - see front matter. Crown Copyright � 2003 Published
doi:10.1016/S0147-619X(03)00058-1
depending on the health, age, and species of fish
and the conditions of their environment, particu-
larly temperature. The acute form is characterized
by rapid onset of general septicaemia, melanosis,
inappetence, lethargy, and haemorrhage at thebase of the fins. The chronic form is characterized
by slow-onset with low mortality, affected animals
often have raised skin lesions called furuncles
which are considered pathognomic for the disease.
Conversion from the chronic to the acute form can
be caused by environmental stressors.
Aeromonas salmonicida belongs to the fam-
ily Aeromonadaceae of the c proteobacteria.
by Elsevier Inc. All rights reserved.
132 J. Boyd et al. / Plasmid 50 (2003) 131–144
A. salmonicida is further subdivided into typical(A. salmonicida subsp. salmonicida) and atypical
strains. Many groups have surveyed plasmid car-
riage in both typical and atypical A. salmonicida
(Bast et al., 1988; Belland and Trust, 1989; Han-
ninen et al., 1995; Pedersen et al., 1996). A. sal-
monicida carries multiple plasmids of various sizes:
small, multi-copy plasmids ranging from 1 to 6 kb,
and larger low-copy plasmids from 11 to 150 kb.Most strains of A. salmonicida carry at least four
plasmids, and some, as many as six. The variation
in the number and size of plasmids is greater for
atypical than for typical strains. Some of the large
plasmids are known to carry antibiotic resistance
genes, but other than this no correlation can be
drawn between plasmid carriage and virulence
(Brown et al., 1997).Most typical A. salmonicida strains carry a
group of three small plasmids of 5.0, 5.2, and
5.4 kb. In the typical A. salmonicida strain A449,
their copy number has been estimated to be very
high, between 50 and 55 per cell (Belland and
Trust, 1989). Further characterization of these
plasmids demonstrated that they expressed very
few genes and, despite great effort, it was notpossible to cure the strain of any of these three
plasmids (Belland and Trust, 1989). In addition to
the three small plasmids, Belland and Trust (1989)
identified a large, 145 kb plasmid in A. salmonicida
A449.
As part of the process of sequencing the entire
genome of A. salmonicida A449, which is estimated
to be 4.6 Mb (Umelo and Trust, 1998), we have
Table 1
Aeromonas salmonicida subsp. salmonicida strains used in this study
Strain Characteristics and origin
A449 Virulent, Brown trout, Eure, France
A450 Virulent, Brown trout, Tarn, France
A450-1 Lab-derived avirulent variant of A450
A450-3 Lab-derived avirulent variant of A450
80204 Virulent, Atlantic salmon, New Brunswick, Can
80204-1S Lab-derived avirulent variant of 80204
SS70.1 Lab-derived avirulent, originally from Coho salm
NG10 Virulent, Atlantic salmon, New Brunswick, Can
97132 Virulent, Atlantic salmon, New Brunswick, Can
84222-S Lab-derived avirulent, originally from Atlantic s
OAR Virulent, oxolinic acid resistant, Atlantic salmon
MT004 Lab-derived avirulent, originally from Atlantic s
identified contigs corresponding to the three smallplasmids. This paper describes the complete se-
quence and annotation of these plasmids from
A. salmonicida A449.
2. Materials and methods
2.1. Bacterial strains
Aeromonas salmonicida subsp. salmonicida
strains used were kindly donated by Dr. Gilles
Olivier of the Department of Fisheries and Oceans
(DFO) in Moncton, N.B., Dr. Trevor Trust, Mi-
crotek International, Saanichton, B.C., and by Dr.
Rafael Garduno at Dalhousie University, Halifax,
N.S. They are described in Table 1. A. salmonicida
strains were grown in Tryptic Soy broth (TSB,
Difco) for 3 days at 17 �C with shaking. Plasmids
were isolated from A. salmonicida using the Nu-
cleobond Mini Prep kit (Clontech, Palo Alto, CA).
Genomic DNA was isolated using the PureGene
DNA isolation kit (Gentra Systems, Minneapolis,
MN).
2.2. DNA sequencing
Aeromonas salmonicida plasmid DNA was di-
gested with BamHI and BamHI/EcoRI and cloned
into pre-digested and dephosphorylated pTrue-
Blue vector (Genomics One, Laval, PQ) and
transformed into Escherichia coli XL-1 Blue MRF�(Stratagene, La Jolla, CA). E. coli clones were
Source
T. Trust
R. Garduno
R. Garduno
R. Garduno
ada G. Olivier
G. Olivier
on, Oregon, USA G. Olivier
ada G. Olivier
ada G. Olivier
almon, New Brunswick, Canada G. Olivier
, New Brunswick, Canada G. Olivier
almon, Scotland G. Olivier
J. Boyd et al. / Plasmid 50 (2003) 131–144 133
grown and plasmid DNA isolated using standardtechniques. Clones containing the appropriate-
sized inserts were sequenced from both ends. These
end-sequences were used as a tag to identify con-
tigs from the main A. salmonicida genome assem-
bly that had been generated by sequencing random
clones and assembled using the Staden package
(Bonfield et al., 1995). Primer-walking on the
plasmid clones was done to fill any gaps in therespective contigs as well as to confirm the se-
quences. Total sequencing coverage on these
plasmids is approximately 12-fold. These se-
quences have been deposited in GenBank under
Accession Nos.: pAsa1, AY301063; pAsa2,
AY301064; and pAsa3, AY301065.
2.3. PCR primers and methods
PCR conditions to amplify specific regions of
the plasmids were: 45 s at 94 �C; 30 cycles of 45 s at
94 �C, 45 s at 55 �C, and 90 s at 72 �C; followed by
a 10min extension at 72 �C. The reaction mix
contained 100 ng genomic DNA, 0.3mM each
primer and 1.25U of rTaq (Amersham–Pharmacia
Biotech, Uppsala, Sweden). Primers used were:pAsa1F, 50GGACGATTAACCTTCGCATC 30;
pAsa1R, 50 GTATCGCCCAACTTCTTCCA 30;
pAsa2F, 50AAAAGAGCGTGCAACCCTAA 30;
pAsa2R, 50 GCGATGCTACTTCATTCACC 30;
pAsa3F, 50TCATGGAGAATGTTCGCAAG 30;
pAsa3R, 50 GCCCAATTATCACAGCAACA 30;
pAsal1F, 50TAACATGGGTGAGTCAGGA30;
and pAsal1R, 50 TGCATGTTTGTAAAAAGTAGGTG 30.
1 Abbreviations used: ORF, open reading frame; DFO,
Department of Fisheries and Oceans; TSB, Tryptic Soy broth;
rm, restriction/modification system.
3. Results and discussion
3.1. General description of plasmids
The restriction patterns of the completed plas-mid sequences were compared to those generated
by Belland and Trust (1989) who characterized but
did not sequence three small plasmids from the
same strain of A. salmonicida. The restriction maps
of our plasmids were very similar to those previ-
ously reported, so we chose to use their nomen-
clature. The maps are not identical in size (pAsa1
and pAsa3) and restriction site pattern (pAsa2 andpAsa3) but this can be explained by the simulta-
neous mapping of all three plasmids by these au-
thors, while we were able to sequence them
individually.
Plasmids pAsa1, pAsa2, and pAsa3 (Fig. 1) are
5424, 5247, and 5616 bp in length, respectively,
with G+C contents of 57, 52, and 55%. The G+C
content of the A. salmonicida chromosome is58.3% (unpublished data). pAsa1 and pAsa3 ap-
pear to be ColE2-type replicons while pAsa2 is a
ColE1-type plasmid. Both pAsa1 and pAsa3 carry
toxin–antitoxin genes and all three plasmids en-
code genes for plasmid mobilization. Other than
genes for plasmid replication, stability, and mo-
bilization, each plasmid contains only one to three
other open reading frames (ORFs)1 that encodeproteins of unknown function.
During the preparation of this manuscript,
three A. salmonicida plasmid sequences were de-
posited in GenBank by D. Fehr, S.E. Burr, and
J. Frey. One of these sequences, pAsal2 (Accession
No: NC_004339.1), is identical to the pAsa1 se-
quence while pAsal3 (NC_004340.1) differs from
the pAsa2 sequence at 4 positions and has 2 ad-ditional bases. Plasmid pAsal1 (NC_004338.1),
another ColE2 plasmid, is not present in A. sal-
monicida A449, while pAsa3 was apparently not
sequenced by Fehr et al.
3.2. Replication of plasmids pAsa1 and pAsa3
On the basis of similarity to other rep genes inthe GenBank database, those of plasmids pAsa1
and pAsa3 are members of the ColE2 family
(Table 2). Plasmids with ColE2-type replicons are
usually small, have a high copy-number and
replicate using the theta mechanism (del Solar
et al., 1998; Espinosa et al., 2000). The minimum
replicating unit consists of the rep gene; a short
antisense RNA, RNAI, that is complementary tothe 50 untranslated region of rep; and a cis acting
origin, oriV, where the Rep protein binds. ColE2-
type Rep proteins are primases and thus they
Fig. 1. Maps of plasmids pAsa1, pAsa2, and pAsa3. Gene position and direction of transcription are indicated by arrows.
134 J. Boyd et al. / Plasmid 50 (2003) 131–144
both bind to their cognate origin and synthesizea small primer RNA, ppApGpA, that is required
for initiation of the leading-strand DNA synthe-
sis by the chromosomally encoded DNA poly-merase I. The RNAI antisense RNA negatively
regulates rep expression post-transcriptionally,
Table 2
Percent similarity (lower left) and identity (upper right) of the Rep proteins
pAsa1 pAsa3 pAsal1 ColE2 ColE3 ColE5
pAsa1 — 73 72 38 39 38
pAsa3 82 — 90 38 36 36
pAsal1 82 94 — 39 36 36
ColE2 49 50 51 — 88 75
ColE3 49 47 48 91 — 83
ColE5 48 47 46 82 88 —
Similarity was calculated using the BLOSUM 62 matrix. GenBank Accession Nos. are as follows: pAsal1 (A. salmonicida),
23897236; ColE2-P9 (Shigella sp.), 808894; ColE3-CA38 (Escherichia coli), 808865; and ColE5-099 (Shigella sonnei), 809524.
J. Boyd et al. / Plasmid 50 (2003) 131–144 135
although the exact mechanism of the regulation
is unclear.
ColE2-type plasmids are often mutually com-
patible, thus allowing some bacteria, including
A. salmonicida, to carry more than one suchplasmid. Incompatibility among ColE2-type plas-
mids is controlled by two factors: the RNAI
molecule which specifically binds to its own sense
transcript and controls copy number (Takechi
et al., 1994) and the Rep protein which specifically
binds to its cognate origin. Subtle variations in
the sequence of the Rep protein and the origin of
replication provide the possibility for mutualcompatibility among ColE2-type plasmids (Hiraga
et al., 1994; Shinohara and Itoh, 1996).
Fig. 2 shows the predicted position of the an-
tisense RNAI between the rep promoter and start
codon in the A. salmonicida plasmids pAsa1,
pAsa3, pAsal1, and three ColE2-type plasmids
from E. coli and Shigella species. In the latter
ColE2-type plasmids the RNAI promoters overlapthe rep start codon on the opposite strand (grey
boxes). The aligned sequences of the A. salmoni-
cida plasmids are quite dissimilar from those of E.
coli and Shigella and do not seem to carry RNAI
promoter sequences in the same position. Instead
putative )10 and )35 regions appear to reside
about 30 bp upstream of the rep start codon (also
shown with grey boxes). The difference in the po-sition of the promoters reflects the different sizes of
the A. salmonicida and ColE2 RNAI molecules.
The RNAI molecules from the A. salmonicida
plasmids are shorter and appear to form only a
single stem–loop structure (solid arrows in Fig. 2),
as does that of ColE5-099 and other ColE2 RNAI
molecules (Hiraga et al., 1994). In contrast, the
RNAI molecules of ColE2-P9 and ColE3-CA38
form two stem–loop structures (solid and dashed
arrows). The conserved stem–loop is very similar
in all six plasmids, except that the loop sequences
in the A. salmonicida plasmids are exactly com-plementary to those of the other ColE2 plasmids.
A run of thymidines at the 50 end of the repmRNA
likely acts as a rho-independent transcriptional
terminator for RNAI.
In addition to the RNAI molecule, incompati-
bility among members of the ColE2 group has
been shown to be controlled by three insertions in
the C-terminal region of the Rep protein andcorresponding insertions in the oriV sequence
(Hiraga et al., 1994; Shinohara and Itoh, 1996).
The three insertions in the Rep protein, termed A,
B, and C are 9, 2, and 4–6 amino acids in length,
respectively, and occur in the C-terminal 50 amino
acids of the protein. Each is associated with a
single nucleotide insertion in the origin region, a,b, and c; that occur at positions 5, 20, and 9 bpupstream of the ppApGpA primer, respectively.
Chimeric rep and origin constructs (Shinohara and
Itoh, 1996) demonstrate the specificity of these
Rep/oriV insertions and their involvement in
plasmid incompatibility.
Alignment of the A. salmonicida pAsa1, pAsa3
and pAsal1 Rep, and oriV sequences with those of
other ColE2 plasmids (Fig. 3A) reveals the pres-ence of all three types of Rep/oriV insertions in the
A. salmonicida plasmids. All three plasmids appear
to have the B/b insertions, while pAsa1 addition-
ally has the A/a insertions and pAsa3 has the C/cinsertions. This variation in Rep/oriV type be-
tween the three A. salmonicida ColE2-type plas-
mids demonstrates how Rep/oriV specificity is
Fig. 2. Alignment of the DNA sequences upstream of the rep genes of three sequenced A. salmonicida ColE2-type plasmids and three
ColE2-type plasmids from E. coli and Shigella species. The rep-35 and rep-10 promoter region is indicated by boxes and is approx-
imately 160 bases upstream from the rep start codon. Two sets of grey boxes indicate the most likely promoters for the antisense RNAI
molecules. The promoters for the A. salmonicida RNAI molecules are not the same as those for the E. coli and Salmonella plasmids.
Arrows indicate stem–loop structures formed in the RNAI molecule with the conserved loop region boxed. Dashed arrows indicate the
second stem–loop structure found only in plasmids ColE2-P9 and ColE3-CA38. The RNAI terminator is likely the run of A�s indicatedby the solid line. Accession Nos. are: pAsal1, NC_004338.1; ColE2-P9, 487322; ColE3-CA38, 487267; and ColE5-099, 487324.
136 J. Boyd et al. / Plasmid 50 (2003) 131–144
determined for each plasmid and indicates that all
three ColE2-type plasmids would be compatible in
a single strain. In addition, the A. salmonicida Rep
proteins, while overall very similar to other ColE2-type Rep proteins, have several conserved inser-
tions throughout the length of the protein, as well
as a single insertion unique to pAsa1 (Fig. 3A).
The A. salmonicida Rep proteins thus appear to be
a distinct subgroup of the ColE2-type Rep family.
3.3. Replication of pAsa2
On the basis of similarity to other plasmids,
pAsa2 is a member of the ColE1-type group, andthus is a theta replicating, DNA polymerase de-
pendent plasmid (Chan et al., 1985; del Solar et al.,
1998; Espinosa et al., 2000). ColE1-type replication
requires no plasmid-encoded proteins; instead
it uses two RNA molecules. RNAII acts as the
Fig. 3. (A) Alignment of the Rep proteins from the three sequenced A. salmonicida ColE2-type plasmids and three ColE2-type
plasmids from E. coli and Shigella species. The conserved leucine zipper and helix–turn–helix motifs are boxed and shaded. The three
insertions that determine compatibility are labeled A, B, and C. (B) Alignment of the origin of replication (oriV) of the three sequenced
A. salmonicida ColE2-type plasmids and three ColE2-type plasmids from E. coli and Shigella species. The Rep stop codons are boxed
and the ppApGpA primer site is indicated by a box and an arrow. The three insertions that determine compatibility are labeled a, b,and c. Rep protein Accession Nos. are: pAsal1, NP_710167.1;ColE2-P9, 808894; ColE3-CA38, 808865; and ColE5-099, 809524.
J. Boyd et al. / Plasmid 50 (2003) 131–144 137
138 J. Boyd et al. / Plasmid 50 (2003) 131–144
primer for DNA synthesis while RNAI is a shorter,antisense RNA complementary to the 50 end of
RNAII. RNAI is constitutively expressed, but is
rapidly turned over, resulting in tight control of
plasmid copy number. RNAI is also the main in-
compatibility determinant of ColE1-type plasmids
(Tomizawa and Itoh, 1981). RNAI and RNAII
molecules have both been predicted to form three
stem–loop structures. RNAI forms structures I, II,and III, while RNAII forms the complementary
structures of I and II, and a different larger struc-
ture, IV (Tamm and Polisky, 1983; Tomizawa,
1990). The initial interactions between RNAI and
RNAII takes place at these loops. Alignment of the
origin region of pAsa2 with those of other ColE1-
type plasmids shows a high degree of similarity
(Fig. 4). Furthermore, as predicted by m-fold(Mathews et al., 1999; Zuker et al., 1999) the RNA
molecules from pAsa2 also form similar stem–loop
structures, (indicated by inverted arrows in Fig. 4).
The stem structures are very highly conserved while
the loop structures, which are responsible for the
initial binding interactions and therefore incom-
patibility, are quite variable.
Some ColE1-type plasmids encode a smallprotein, Rom or Rop that stabilizes the interaction
between RNAI and RNAII; however pAsa2 does
not appear to encode a Rom homologue.
We have been able to show that pAsa2 can
replicate stably in E. coli (data not shown). It is
also interesting that cloning vectors based on
E. coli ColE1 can replicate in A. salmonicida for a
few generations only. Indeed we have successfullyused pBluescript (Stratagene, La Jolla, CA) de-
rivatives as suicide vectors in A. salmonicida. We
have no information about whether the other two
A. salmonicida plasmids can replicate in E. coli.
3.4. Mobilization and oriT of pAsa1, pAsa2, and
pAsa3
All three A. salmonicida plasmids carry genes,
mobABCD, encoding proteins similar to those of
ColE1 that are involved in plasmid mobilization.
MobA proteins are relaxases that nick the double-
stranded plasmid DNA at a specific site, nic, in the
origin of transfer (oriT). MobA becomes cova-
lently attached to the plasmid DNA and the
MobA–DNA complex then moves through themating bridge into the donor cell (Zechner et al.,
2000). MobA and other conjugative relaxases
are not highly similar (Table 3) but they do have
three recognizable motifs in their N-termini. Motif
I includes a conserved tyrosine residue that
remains covalently attached to the DNA at the
50 end of nic, motif II includes a serine that is
implicated in interacting with the 30 end of nic,motif III contains either three histidines, (HHH) or
a histidine, a glutamate and an asparagine (HEN)
(Varsaki et al., 2003). The MobA proteins of the
A. salmonicida plasmids all have motifs I and II
and the HEN sequence at motif III (data not
shown). MobB, C, and D are accessory proteins
that facilitate the action of MobA. As in ColE1,
these genes are organized in an apparent operonwith mobC upstream of mobA, while mobB and
mobD are encoded on the same DNA segment as
mobA, but in different reading frames (Fig. 1). The
MobA, C, and D proteins of plasmid pAsa2 are
very similar to those of ColE1 (Table 3), while
those of pAsa1 and pAsa3 are similar to each
other, but less similar to ColE1. The A. salmonicida
MobB proteins are not very similar to each otheror to that of ColE1.
Putative oriT regions have been found upstream
of the mobC genes in plasmids pAsa1 and pAsa3,
and upstream of orf1 in pAsa2 (Fig. 1). These oriT
regions are similar to those of ColE1-type plas-
mids, which reflects the similarity of the mobA
genes to that of ColE1-type plasmids (Lanka and
Wilkins, 1995; Zechner et al., 2000). Fig. 5 showsan alignment of the putative oriT regions from the
A. salmonicida plasmids with those of ColE1-type
plasmids. We have no evidence that the various
MobA proteins can specifically identify their cog-
nate oriTs, but the sequence diversity of both the
oriTs and the MobA proteins suggests that this is
the case.
While the presence of the mob genes and oriT
regions in these three plasmids suggests they are
mobilizable, they are lacking genes encoding pro-
teins required for transfer. To be mobilized, these
plasmids must rely on transfer proteins encoded
elsewhere. It is worth noting that the two large
plasmids found in A. salmonicida A449 each carry
transfer gene operons (unpublished results).
Fig. 4. Alignment of the replication control region (oriV) of pAsa2 with that of other ColE1-type plasmids from E. coli. Stem
structures are indicated by solid and dashed line arrows, loops are clear boxes. Structures I, II, and III are found in RNAI; structures I,
II and IV are found in RNAII. Promoter elements are indicated by grey boxes. Open arrows indicate the site and direction of
transcription and replication. Accession Nos. are: ColE1, J01566.1; ColA, 144670; and ColD, 144289.
J. Boyd et al. / Plasmid 50 (2003) 131–144 139
Table
3
Percentsimilarity
(lower
left)andidentity
(upper
right)
oftheMobproteins
MobA
MobB
MobC
MobD
pAsa1
pAsa2
pAsa3
pColE1
pAsa1
pAsa2
pAsa3
pColE1
pAsa1
pAsa2
pAsa3
pColE1
pAsa1
pAsa2
pAsa3
pColE1
pAsa1
—21
60
22
—15
54
26
—22
80
26
—18
41
16
pAsa2
34
—23
44
27
—9
22
39
—21
44
31
—24
51
pAsa3
70
35
—21
76
23
—18
88
38
—24
57
35
—24
pColE1
34
57
34
—41
39
36
—40
58
39
—29
60
36
—
Sim
ilarity
wascalculatedusingtheBLOSUM
62matrix.GenBankAccessionNo.ofColE1isJ01566.1.
Fig. 5. Alignment of the origins of transfer (oriTs) of four
A. salmonicida plasmids with that of ColE1 and ColA. The nick
site (nic) is indicated by an arrow. Accession Nos. are: pAsal1,
NP_710167.1; ColE1, J01566.1; and ColA, 144670.
140 J. Boyd et al. / Plasmid 50 (2003) 131–144
3.5. Toxin–antitoxin systems in pAsa1 and pAsa3
Plasmids pAsa1 and pAsa3 both have proteic
toxin–antitoxin genes that presumably act as
plasmid stability mechanisms by post-segrega-tional killing. These systems, also known as ad-
diction modules, consist of two proteins, one a
toxin and the other the specific antidote (Engel-
berg-Kulka and Glaser, 1999). The antidote is
more labile than the toxin and if a cell stops
making the antidote, as in the case of a plasmid-
less daughter cell, the toxin will be able to kill the
cell. These genes are usually transcribed as anoperon with the antitoxin gene upstream and
overlapping the toxin gene. The systems on pAsa1
and pAsa3 also follow this general rule.
Plasmids pAsa1 and pAsa3 carry genes ho-
mologous to the relBE system (Gronlund and
Gerdes, 1999), in which RelB is the antitoxin and
RelE is the toxin. RelE has recently been shown to
cleave mRNAs bound to ribosomes in a codon-specific manner (Pedersen et al., 2003). This toxin–
antitoxin system is widespread among prokaryotes
and is found in Gram-negative and Gram-positive
bacteria and archaea (Gerdes, 2000). Many of
these RelBE systems are found on the chromo-
some where they act as a global regulator of
translation (Christensen et al., 2001).
The homologues most similar to the pAsa1system are those of the E. coli and Salmonella
enterica chromosomes, while those of pAsa3 are
most similar to genes called pasAB in plasmids of
Acidithiobacillus caldus (Gardner et al., 2001;
Smith and Rawlings, 1997) and Pseudomonas flu-
orescens (Peters et al., 2001). While the RelE toxins
J. Boyd et al. / Plasmid 50 (2003) 131–144 141
from pAsa1 and pAsa3 do not show high identity(26%) or similarity (47%) to each other, the pasAB
genes do belong to the relBE family (Gerdes,
2000), therefore an alignment of all these proteins
is shown in Fig. 6.
To our knowledge, the presence of two plasmid-
encoded, toxin–antitoxin systems in the same
bacterial strain has not been detected. However,
there are instances of strains carrying more thanone plasmid with other types of plasmid stability
systems, most notably restriction/modification
(rm) systems. In this situation, two plasmids car-
rying rm systems will both be stably maintained as
long as the target rm sites on the chromosome are
different. If both methylases can protect the same
site then one or the other restriction enzyme can be
lost without cell death (Kusano et al., 1995). In theA. salmonicida case as long as each RelB antitoxin
recognizes only its own toxin, neither plasmid can
be lost without cell death. The low degree of se-
Fig. 6. Alignment of the toxin and antitoxin proteins from plasmids p
are: RelE E. coli, 76201; RelE S. enterica, 16763250; RelB E. coli, 132
10834752; PasB Acidithiobacillus caldus, 14209913; PasA P. fluorescen
quence conservation among the antitoxin proteins(Fig. 6) may be indicative of their specificity for
their cognate toxin.
No other known form of plasmid stability sys-
tem is found on these plasmids. Most notably no
cer or xis sites are obvious. These are sites of site-
specific recombination that are used by the plas-
mid to resolve dimers created during replication.
Dimer and higher multiple forms of all threeplasmids are commonly seen in plasmid prepara-
tions (data not shown).
3.6. Other ORFs of unknown function
There are several ORFs in these plasmids that
share little or no sequence similarity with genes in
the databases. The most notable is orf1, which isfound on all three plasmids. orf1 shares limited
identity with a putative gene of unknown function
from a Ralstonia solanacearum plasmid, pJTPS1
Asa1 and pAsa3 with their closest homologues. Accession Nos.
283; RelB S. enterica, 16763249; PasB Pseudomonas fluorescens,
s, 10834752; and PasA A. caldus, 14209912.
Table 4
Percent similarity (lower left) and identity (upper right) of the
ORF1 proteins
pAsa1 pAsa2 pAsa3 pJTPS1
pAsa1 — 36 77 20
pAsa2 50 — 33 15
pAsa3 86 50 — 21
pJTPS1 29 24 30 —
Similarity was calculated using the BLOSUM 62 matrix.
GenBank Accession No. of pJTPS1 OrfC1 (Ralstonia solana-
cearum) is NP_052314.
142 J. Boyd et al. / Plasmid 50 (2003) 131–144
(Table 4). In addition to the sequence similarity,the orf1 genes are all positioned upstream of the
mobC genes. In pAsa2, orf1 is positioned between
mobC and oriT. This close proximity to the mob
cluster and the fact that the mob and orf1 genes are
the only genes shared among all the three plasmids
suggests orf1 may be involved in mobilization of
these plasmids. pAsa2 has two more ORFs of
unknown function (orf2 and orf3) and pAsa3 hasone (orf4). Each plasmid also has a large region
(500–1000 bp) with no obvious features.
Fig. 7. Plasmids from A. salmonicida subsp. salmonicida strains. (A) P
EcoRI cuts once in pAsal1, pAsa1, pAsa2, and four times in pAsa3
visible). Plasmid names are indicated to the right and MW standards a
amplified with primers specific to each of the four small plasmids usi
3.7. Presence of pAsa1, pAsa2, and pAsa3 in other
strains of A. salmonicida
Previous analyses of the plasmid profiles of
A. salmonicida strains (Belland and Trust, 1989;
Giles et al., 1995; Pedersen et al., 1996; Sorum et
al., 2000) suggested that different strains often
carried different sets of plasmids. To investigate
the plasmid profiles of the strains present in our A.salmonicida strain collection, we designed primers
to specific regions of the plasmids and used them
to amplify total genomic DNA from the strains.
For pAsa1 and pAsa3 the toxin–antitoxin regions
were amplified, and for pAsa2, orf3 was chosen.
We also amplified the aopP gene from plasmid
pAsal1 that was sequenced by Fehr et al. (Acces-
sion No: NC_004338). Additionally, plasmidDNA was isolated from all the strains and analy-
sed on an agarose gel following digestion with
EcoRI. EcoRI cuts all plasmids only once, except
pAsa3, in which case a diagnostic 4.8 kb fragment
is generated. In all cases the results of the PCR and
agarose gel were identical (Fig. 7). All of the
lasmids prepared from A. salmonicida were digested with EcoRI.
creating one large 4800 bp fragment and three small ones (not
re on the left. (B) Presence (+) or absence ()) of PCR products
ng total genomic DNA as the template.
J. Boyd et al. / Plasmid 50 (2003) 131–144 143
strains in our collection carried pAsa1 and pAsa2.All but one carried pAsa3. Many of the strains,
but not A449, also carried another larger plasmid
of approximately 6.5 kb, which is similar to the
size of pAsal1. These strains also gave positive
results in PCR with primers to aopP, suggesting
that the 6.5 kb plasmid in these strains is indeed
pAsal1. As predicted by the different Rep/oriV
insertions in the ColE2 plasmids, pAsa1, pAsa3,and pAsal1, all three can indeed be compatibly
maintained in a single A. salmonicida strain.
The virulence of the strains in our collection is
quite varied, as is their plasmid profile. However,
as others have shown (Bast et al., 1988; Brown
et al., 1997), there does not appear to be any
correlation between carriage of these small plas-
mids and virulence. We now know this is because,at least for the small plasmids, there are no known
virulence factors except for the type III secretion
system effector, AopP, encoded by pAsal1.
4. Summary
The sequences of the three small plasmids fromA. salmonicida subsp. salmonicida A449 demon-
strate that one is a ColE1-type while the other two
are ColE2-type plasmids. The genes encoded by
these plasmids function primarily in replication,
mobilization and plasmid stability. Differences in
the Rep/oriV regions of the ColE2-type plasmids
provide specificity for replication and the ability
for multiple ColE2-type plasmids to be maintainedin a single strain. The presence of two different
plasmid addiction systems in a single bacterial
strain supports the idea that these plasmids exist
primarily to promote their own replication and
spread.
Acknowledgments
We thank the IMB DNA sequencing team for
carrying out the DNA sequencing and Drs. S.
Douglas and A. Patrzykat for comments on the
manuscript. This work was supported by the NRC
Genomics and Health Initiative. This is NRCC
Publication No. 42381.
References
Bast, L., Daly, J., DeGrandis, S.A., Stevenson, R.M.W., 1988.
Evaluation of profiles of Aeromonas salmonicida as epide-
miological markers of furunculosis infections in fish. J. Fish
Dis. 11, 133–145.
Belland, J., Trust, T.J., 1989. Aeromonas salmonicida plasmids:
plasmid-directed synthesis of proteins in vitro and in
Escherichia coli minicells. J. Gen. Microbiol. 135, 513–524.
Bonfield, J.K., Smith, K., Staden, R., 1995. A new DNA
sequence assembly program. Nucleic Acids Res. 23, 4992–
4999.
Brown, R.L., Sanderson, K., Kirov, S.M., 1997. Plasmids and
Aeromonas virulence. FEMS Immunol. Med. Microbiol. 17,
217–223.
Chan, P.T., Ohmori, H., Tomizawa, J., Lebowitz, J., 1985.
Nucleotide sequence and gene organization of ColE1 DNA.
J. Biol. Chem. 260, 8925–8935.
Christensen, S.K., Mikkelsen, M., Pedersen, K., Gerdes, K.,
2001. RelE, a global inhibitor of translation, is activated
during nutritional stress. Proc. Natl. Acad. Sci. USA 98,
14328–14333.
del Solar, G., Giraldo, R., Ruiz-Echevarria, M.J., Espinosa,
M., Diaz-Orejas, R., 1998. Replication and control of
circular bacterial plasmids. Microbiol. Mol. Biol. Rev. 62,
434–464.
Engelberg-Kulka, H., Glaser, G., 1999. Addiction modules and
programmed cell death and antideath in bacterial cultures.
Annu. Rev. Microbiol. 53, 43–70.
Espinosa, M., Cohen, S., Couturier, M., del Solar, G., Diaz-
Orejas, R., Giraldo, R., Janniere, L., Miller, C., Osborn,
M., Thomas, C.M., 2000. Plasmid replication and copy
number control. In: Thomas, C.M. (Ed.), The Horizontal
Gene Pool: Bacterial Plasmids and Gene Spread. Harwood
Academic Publishers, Amsterdam, pp. 1–47.
Gardner, M.N., Deane, S.M., Rawlings, D.E., 2001. Isolation
of a new broad-host-range IncQ-like plasmid, pTC-F14,
from the acidophilic bacterium Acidithiobacillus caldus and
analysis of the plasmid replicon. J. Bacteriol. 183, 3303–
3309.
Gerdes, K., 2000. Toxin–antitoxin modules may regulate
synthesis of macromolecules during nutritional stress.
J. Bacteriol. 182, 561–572.
Giles, J.S., Hariharan, H., Heaney, S.B., 1995. The plasmid
profiles of fish pathogenic isolates ofAeromonas salmonicida,
Vibrio anguillarum, and Vibrio ordalii from the Atlantic and
Pacific coasts of Canada. Can. J. Microbiol. 41, 209–216.
Gronlund, H., Gerdes, K., 1999. Toxin–antitoxin systems
homologous with relBE of Escherichia coli plasmid P307
are ubiquitous in prokaryotes. J. Mol. Biol. 285, 1401–1415.
Hanninen, M.L., Ridell, J., Hirvela-Koski, V., 1995. Pheno-
typic and molecular characteristics of Aeromonas salmoni-
cida subsp. salmonicida isolated in southern and northern
Finland. J. Appl. Bacteriol. 79, 12–21.
Hiraga, S., Sugiyama, T., Itoh, T., 1994. Comparative analysis
of the replicon regions of eleven ColE2-related plasmids.
J. Bacteriol. 176, 7233–7243.
144 J. Boyd et al. / Plasmid 50 (2003) 131–144
Kusano, K., Naito, T., Handa, N., Kobayashi, I., 1995.
Restriction–modification systems as genomic parasites in
competition for specific sequences. Proc. Natl. Acad. Sci.
USA 92, 11095–11099.
Lanka, E., Wilkins, B.M., 1995. DNA processing reactions in
bacterial conjugation. Annu. Rev. Biochem. 64, 141–169.
Mathews, D.H., Sabina, J., Zuker, M., Turner, D.H., 1999.
Expanded sequence dependence of thermodynamic param-
eters improves prediction of RNA secondary structure.
J. Mol. Biol. 288, 911–940.
Pedersen, K., Dalsgaard, I., Larsen, J.L., 1996. Characteriza-
tion of atypical Aeromonas salmonicida isolates by ribotyp-
ing and plasmid profiling. J. Appl. Bacteriol. 80, 37–44.
Pedersen, K., Zavialov, A.V., Pavlov, M.Y., Elf, J., Gerdes, K.,
Ehrenberg, M., 2003. The bacterial toxin RelE displays
codon-specific cleavage of mRNAs in the ribosomal A site.
Cell 112, 131–140.
Peters, M., Jogi, E., Suitso, I., Punnisk, T., Nurk, A., 2001.
Features of the replicon of plasmid pAM10.6 of Pseudo-
monas fluorescens. Plasmid 46, 25–36.
Shinohara, M., Itoh, T., 1996. Specificity determinants in
interaction of the initiator (Rep) proteins with the origins in
the plasmids ColE2-P9 and ColE3-CA38 identified by
chimera analysis. J. Mol. Biol. 257, 290–300.
Smith, A.S., Rawlings, D.E., 1997. The poison–antidote stabil-
ity system of the broad-host-range Thiobacillus ferrooxidans
plasmid pTF-FC2. Mol. Microbiol. 26, 961–970.
Smith, P., 1997. The epizootiology of furunculosis: the present
state of our ignorance. In: Bernoth, E.-M., Ellis, A.E.,
Midtlyng, P.J., Olivier, G., Smith, P. (Eds.), Furunculosis
Multidisciplinary Fish Disease Research. Academic Press,
San Diego, USA, pp. 25–53.
Sorum, H., Holstad, G., Lunder, T., Hastein, T., 2000.
Grouping by plasmid profiles of atypical Aeromonas
salmonicida isolated from fish, with special reference to
salmonid fish. Dis. Aquat. Organ 41, 159–171.
Takechi, S., Yasueda, H., Itoh, T., 1994. Control of ColE2
plasmid replication: regulation of Rep expression by a
plasmid-coded antisenseRNA.Mol. Gen.Genet. 244, 49–56.
Tamm, J., Polisky, B., 1983. Structural analysis of RNA
molecules involved in plasmid copy number control. Nucleic
Acids Res. 11, 6381–6397.
Tomizawa, J., 1990. Control of ColE1 plasmid replication.
Intermediates in the binding of RNA I and RNA II. J. Mol.
Biol. 212, 683–694.
Tomizawa, J., Itoh, T., 1981. Plasmid ColE1 incompatibility
determined by interaction of RNA I with primer transcript.
Proc. Natl. Acad. Sci. USA 78, 6096–6100.
Umelo, E., Trust, T.J., 1998. Physical map of the chromosome
of Aeromonas salmonicida and genomic comparisons be-
tween Aeromonas strains. Microbiology 144, 2141–2149.
Varsaki, A., Lucas, M., Afendra, A.S., Drainas, C., De La
Cruz, F., 2003. Genetic and biochemical characterization of
MbeA, the relaxase involved in plasmid ColE1 conjugative
mobilization. Mol. Microbiol. 48, 481–493.
Zechner, E.L., de la Cruz, F., Eisenbrandt, R., Grahn, A.M.,
Koraimann, G., Lanka, E., Muth, G., Pansegrau, W.,
Thomas, C.M., Wilkins, B.M., Zatyka, M., 2000. Conjuga-
tive-DNA transfer processes. In: Thomas, C.M. (Ed.), The
Horizontal Gene Pool: Bacterial Plasmids and Gene Spread.
Harwood Academic Publishers, Amsterdam, pp. 87–174.
Zuker, M., Mathews, D.H., Turner, D.H., 1999. Algorithms
and thermodynamics for RNA secondary structure predic-
tion: a practical guide. In: Barciszewski, J., Clark, B.F.C.
(Eds.), RNA Biochemistry and Biotechnology. Kluwer
Academic Publishers, Dordrecht, pp. 11–43.
Communicated by I. Kobayashi