“IN VITRO REGENERATION AND GENETIC
TRANSFORMATION OF FINGER MILLET
(Eleucine coracana L.) GENOTYPE GN-4”
A
THESIS
SUBMITTED TO THE
NAVSARI AGRICULTURAL UNIVERSITY
NAVSARI
IN PARTIAL FULFILMENT OF THE REQUIREMENTS
FOR
THE AWARD OF THE DEGREE
OF
MASTERS OF SCIENCE
IN
PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY
BY
DABHI KIRTI ARAJANBHAI B.Sc. (Biotechnology)
DEPARTMENT OF BIOTECHNOLOGY
N.M.COLLEGE OF AGRICULTURE
NAVSARI AGRICULTURAL UNIVERSITY
NAVSARI- 396 450
GUJARAT
November-2015
Registration No. 04-0955-2011
In vitro regeneration and genetic transformation of finger millet
(Eleucine coracana L.) genotype GN-4
Name of Student
Dabhi Kirti A.
Major Advisor
Dr. Sanjay Jha
Finger millet (Eleucine coracana L.) is an important cereal crop
which constitutes about 81% of the minor millets produced in India. An
efficient in vitro plant regeneration and Agrobacterium tumefaciens
mediated genetic transformation protocol has been described for finger
millet (Eleucine coracana L.) using callus as explants. Among different
cytokinins used, kinetin (1.50 mg/l) in combination with BAP (0.50 mg/l)
produced maximum number of shoots (11.00) and shoot length (9.8 cm).
Maximum frequency of rooting and highest number of roots were
produced on half strength MS basal with NAA (1.0 mg/l).
Agrobacterium mediated genetic transformation, of finger millet
genotype GN-4 was developed by using Agrobacterium Rs-AFP2 strain
carrying marker gene hygromycine phosphotransferase II (hpt II) gene
was used. The integration of the gene was confirmed by PCR. When the
effect of the age of the callus and co-cultivation duration were evaluated,
forty five days old co-cultivated callus for five days yielded 1.33%
frequency of transformation. The morphological features of transgenic
plants did not differ from those of non transgenic plants.
ABSTRACT
Gujarat Agricultural Biotechnology Institute, Surat
Navsari Agricultural University
Navsari - 396 450
Dr. Sanjay Jha Phone no : 7600059128
Associate Professor [email protected]
(Biotechnology)
C E R T I F I C A T E
This is to certify that the thesis entitled “In vitro regeneration
and genetic transformation of finger millet (Eleucine coracana L.)
genotype GN-4” submitted by DABHI KIRTI ARAJANBHAI in partial
fulfillment of the requirement for the award of the degree of
MASTER OF SCIENCE in PLANT MOLECULAR BIOLOGY
AND BIOTECHNOLOGY of the Navsari Agricultural University
is a record of bonafide research work carried by her under my
guidance and the thesis has not previously formed the basis for the
award of any degree, diploma or other similar title .
Place: Navsari (Sanjay Jha)
Date:06 November 2015
Major Advisor
DECLARATION
This is to declare that the whole of the research work
reported in the thesis for partial fulfillment of the
requirements for the degree of Master of Science in PLANT
MOLECULAR BIOLOGY AND BIOTECHNOLOGY by the
undersigned is the results of investigation done by her under
direct guidance and supervision of Dr. Sanjay Jha, Associate
Professor, Gujarat Agricultural Biotechnology Institute , Surat,
Navsari Agricultural University, Navsari and that no part of
the work has been submitted for any other so far.
Place : Navsari
Date : (Dabhi K. A.)
Countersigned by
(Sanjay Jha)
Associate Professor
Gujarat Agricultural Biotechnology Institute ,
Surat, Navsari Agricultural University
ACKNOWLEDGEMENT
Writing this thesis has been fascinating and extremely rewarding. I would
like to thank a number of people who have contributed to the final result in many
different ways:
My deepest gratitude goes to Almighty God who has blessed me
abundantly to complete my research work with success. I give him all glory and
honor for all that he had done for me.
I gratefully acknowledge to work under the competent guidance of my
major advisor Dr. Sanjay jha, Associate Professor, G.A.B.I., NAU, Surat for his
advice, supervision, valuable suggestions and crucial contribution, which made
him a backbone of this research and so to this thesis. His involvement with his
originality has triggered and nourished my intellectual maturity that I will
benefit from, for a long time to come.
From the bottom of my heart, with a deep sense of requite, I owe debts of
thanks to members of my advisory committee Dr. Nilima Karmakar, Assistant
Professor, Department of Biochemistry, Dr. R. K. Parikh, Rtd. Professor,
Department of Agril. Statistics and Dr. Taslim Ahmed, Professor and Head,
Department of Plant Molecular Biology and Biotechnology for their guidance and
words of wisdom which guided me to carry out my research in a meaningful
manner.
I deem it honorable pleasure to thank my teachers Dr. R. M. Patel, Mr.
Vipul Parekh, Dr. Diwakar Singh, Dr. Chintan Kapadiya and Mr. Kiran Suthar for
their constant encouragement and for providing the needed facilities to carry out
my research. I take pleasure to acknowledge the sincere help rendered by staffs
of Department of Plant Molecular Biology and Biotechnology, made me realize
that little acts of kindness often add up to noble deeds.
I am also thankful to Director of Research & Dean P. G. Studies Dr. A. N.
Sabalpara, Principal and Dean of N. M. College of Agriculture, Dr. M. K. Arwadiya
and Principal and Dean of ASPEE College of Horticulture and Forestry, Dr. N. L.
Patel for providing me this valuable and golden opportunity to upgrade my
qualifications in the discipline of Plant Molecular Biology and Biotechnology.
I would also like to thank my seniors and juniors for their moral support
during my research work. This journey was not possible without their guidance
and provide friendly environment in lab.
I would like to sincerely thank them not only for their support but also for
welcoming me openheartedly into their communities. My mission would be
incomplete if I fail to acknowledge my beloved friends, Kailu, Chinka, Ami di,
Unnati, Vrunda, Komal, Abhilasha di, Niki di, Manisha, Dipak, suresh, Amit,
Chaitanya , Reena, Pooja, Kajal who helped me in every possible way to make my
efforts worthwhile. I will always cherish your friendship and the times that we
spent together. My special appreciation goes to Sanchit, Bhumi, Rima, Usha and
Samir for their friendship and encouragement.
I would also like to extend huge, warm thanks to my roommates Anku Di
and Pritam Di for their love, care and moral support. I admire your distinguished
helping nature and motivation.
It’s my fortune to gratefully acknowledge the support of some special one.
Words fail me to express my appreciation to my roommate Swati Di for her
support and generous care. She was always beside me during the happy and hard
moments to push me and motivate me. Thank you for your sincere
encouragement and inspiration throughout my research work and lifting me
uphill this phase of life. Thank you doesn’t seem sufficient but it is said with
appreciation and respect to you for your encouragement, understanding and
precious friendship.
Last but not least, This journey would not have been possible without the
huge love, kindness and endless support I enjoyed from my family, my parents
Mr. Arajan Dabhi and Mrs. Varsha Dabhi and my brother Kashyap who are my
pillars of hope and strength. I thank them for bearing with my long absences
away from home. I deeply appreciate their immense input into what I have
become today. Thank you for your encouragement and help when I needed it
most.
Place: Navsari
Date: 06/11/2015 (Dabhi K. A.)
CONTENTS
Sr. No. Chapters Particulars Page
No.
1. INTRODUCTION 1-4
2. REVIEW OF LITERATURE 5-15
3. MATERIALS AND METHODS 16-37
4. RESULTS AND DISCUSSION 38-60
5. SUMMARY AND CONCLUSION 61-63
6. REFERENCES I-VI
7. APPENDICES I-VI
LIST OF TABLES
Table
No.
Title Page
No.
4.1 Effect of surface sterilization agent Mercuric Chloride (HgCl2)
on contamination and establishment of finger millet seeds
40
4.2 Effect of days taken for callus formation 40
4.3 Callus formation from seed of finger millet in presence of
different growth regulators
41
4.4 Effect of different concentration of BAP and Kinetin for
multiple shoot regeneration through callus
44
4.5 Effect of different combination of cytokinin and auxin on shoot
culture and root cuture through callus
45
4.6 Effect of serial subculturing on multiple shoot regeneration
through callus
47
4.7 Effect of auxins and strength of media on induction of in vitro
rooting in finger millet
48
4.8 Effect of different potting mixture on survival of in vitro raised
plantlets of finger millet
50
4.9 Effect of different hygromycin concentrations on the callus of
control and transformed finger millet plants
54
4.10 Effect of age of the explants and co cultivation duration with
Agrobacterium on survival percentage of the isolated callus
57
4.11 Percentage generation of PCR positive plants after
transformation
60
LIST OF FIGURES
Fig.
No.
Title Page
No.
3.1 Schematic procedure for preparation of MS medium 20
3.2 General procedure followed for in vitro regeneration
of finger millet
21
3.3 A schematic diagram depicting the cascade of events
leading to Agrobacterium mediated genetic
transformation into plant.
30
4.1 Comparative real time PCR result expression of gene from
finger millet plant after transformation.
60
LIST OF PLATES
Plate
No.
Title
Page No.
4.1 Germination of finger millet seed on seed germination
media and callus initiation
42
4.2 (A) Multiple shoot initiation from callus 46
4.2 (B) Multiple shoot formation from callus 46
4.2 (C) Multiple root formation from callus 46
4.3 Hardening of finger millet plants 49
4.4 In vitro regeneration protocol for Eluecine coracana L. 51
4.5 Determination hygromycin concentration for selecting
finger millet transgenics
53
4.6 Agrobacterium mediated genetic transformation protocol
developed for finger millet
56
4.7 (A) Genomic DNA of finger millet (Eluecine coracana L.) 58
4.7 (B) Confirmation of presence of transgene hpt II (250bp) in
finger millet
58
4.7 (C) Intact total RNA were run on a 1.5% denaturing gel 58
APPENDICES
Sr. No. Title
I List of the instruments used for the study
II Composition of Murashige and Skoog (1962) medium
III Finger millet seed germination medium
IV (a) YEB (yeast extract broth) Medium
IV (b) YEP (yeast extract peptone) Medium
V Media for induction of Agrobacterium tumefaciens.
VI Media for co-cultivation of Agrobacterium tumefaciens
LIST OF ABBREVIATION
CTAB Cetyl-tri-ethyl ammonium bromide
% Per cent
@ At the rate of
µg Micro gram
µl Micro liter
µM Micro molar
½ MS Half strength Murashige and Skoog medium
0C Degree Celsius
BAP 6-Benzylaminopurine or (6-Benzyl adenine)
Bp Base pair
C.D. Critical difference
C.V. Co efficient of variance
Cm Centi meter
DNA Deoxyribonucleic acid
dNTPs 2’- deoxyribonuclotide - 5’ triphosphates
EDTA Ethylene – diamine tetra acetic acid
TE Tris EDTA
et al. Et allii ( and others)
G Gram
HgCl2 Mercuric Chloride
i. e. That is
Kb Kilo base pair
Kin Kinetin ( 6 – furfuryl amino purine)
M Molar
V Volt
mg Milligram
mg/l Milligram per liter
Min Minutes
ml Milliliter
mM Milli molar
NAA 1- Naphthalene Acetic Acid
nM Nanomolar
Ng Nanogram
O.D. Optical Density
ºC Degree Celsius
PCR Polymerase Chain Reaction
S. Em. Standard error of mean
TBE Tris-Borate EDAT
EtBr Ethidium Bromide
Tris Tris (hydroxymethyl) amino methane
RNA Ribonucleic acid
RT PCR Real Time Polymerase Chain Reaction
hptII Hygromycin phosphotransferase II
UV Ultraviolet
v/v Volume per volume or (Volume by volume)
2,4-D 2,4-Dichlorophenoxyacetic acid
CEH Casein enzyme hydrolysate
PGRs Plant Growth Regulators
INTRODUCTION
Finger millet (Eleucine coracana L.) is an important
cereal which belongs to Poaceae family and subfamily
Chloridoidae (Dida et al., 2008). Finger millet is an
allotetraploid (2n=4x=36) and Eleusine coracana sub species
coracana is an annual tetraploid (n=18) grown extensively
through the semi-arid regions of Africa and India (Werth et
al., 1994). It is grown globally on more than 4 million hectares
and is the primary food for millions of people in tropical dry
land regions. The crop is grown as food grain both in Africa
and south East Asia, mainly India and Nepal (Upadhyay et al.,
2006).
It constitutes about 81% of the minor millets produced
in India. In India, it is mainly grown in the states of Uttar
Pradesh, Bihar, Tamil Nadu, Karnataka and Andhra Pradesh
(Dida et al ., 2008). Gujarat is the fourth largest state
producing finger millet preceded by Karnataka on top, Uttar
Pradesh and Maharashtra.
1
Table 1.1: Composition of finger millets (per 100 g edible portion,
12% moisture content)
Sr. No. Particulars Finger millet
1. Carbohydrate (g) 72.6
2. Protein (g) 7.7
3. Fat (g) 1.5
4. Crude fibre (g) 3.6
5. Minerals (g) 2.7
6. Calcium (mg) 344
7. Phosphorus (mg) 250
8. Iron (mg) 6.3
9. Manganese (mg) 3.5
10. Magnesium (mg) 130
(Verma and Patel, 2013)
Finger millet grains also have a relatively higher content
of protein, carbohydrate but contains less amount of fat. It is
rich in calcium, phosphorus, iron, cysteine, tyrosine,
tryptophan and methionine as compared to other cereals.
Finger millet has superior nutritional qualities compared to
rice and wheat (Latha et al ., 2005). Finger millet is high in
dietary fiber, also has medicinal attributes and is used by
diverse communities for making special foods for diabetics,
gluten-free food for people suffering from celiac disease and
weaning foods for infants (Tylor et al., 2006). Finger millet
contains nutritionally important starch fractions (Sharavathy
et al., 2001), which are slowly digested and absorbed and
hence favorable in the diet pattern for metabolic disorders
such as diabetes, hypertension, and obesity (Asp et al.,1983;
Jenkins et al., 1985).
Despite possessing these important qualities, finger millet
has received little attention for transformation studies till
date. Finger millet is also more vulnerable to fungal blast,
which is a major constraint in finger millet production, this
2
demands genetic improvement of finger millet (Ceasar and
Ignacimuthu., 2008). Finger millet blast disease (Pyricularia
grisea) is known to cause as much as 50% losses in yields
(Latha et al ., 2005). It is the most serious disease, particularly
in eastern Africa and India. It declines finger millet grain
quality and is responsible for yield losses of up to 10% to 80%
in Kenya and Uganda and more than 50% in India (Obilana et
al., 2002).
Finger millet blast caused by Magnaporthe grisea
(Pyricularia grisea) is a great threat to finger millet
production worldwide. Agrobacterium tumefaciens has been
considered a universal vector for introducing foreign genes
into crop plants and this bacterium has facilitated the
development of many transgenic plants. Initially, monocots
were considered to be non-transformable by
Agrobacterium , since in natural conditions these plants are not
infected by Agrobacterium .
The lack of an efficient in vitro regeneration system in
monocots was a major cause for the low number of
Agrobacterium-mediated transformation events. After the
development of efficient regeneration systems and a detailed
study on the molecular events occurring during T-DNA
transfer, many laboratories have transformed monocots. These
monocots include rice, wheat, barley, maize and sorghum
(Shrawat and Lorz, 2006). However, finger millet is yet to be
added to the list of monocots transformed by Agrobacterium .
Preliminary work on finger millet transformation was
performed by (Gupta et al., 2001). In another study, a
transgenic finger millet resistant to fungal blast disease was
3
developed by inserting an antifungal gene from prawn (Latha
et al., 2005) using the biolistic method.
Development of fungal resistant finger millet by
transferring genes such as chitinase is one of the best options
available today to overcome fungal attack and improve the
yield of finger millet. So there is an urgent need for genetic
improvement of finger millet by transferring fungal resistance
genes. (Ceasar and Ignacimuthu., 2011).
The success of using transgenic approach for these insect,
pest resistance, disease resistance largely depends on an
efficient in vitro regeneration system and genetic
transformation protocol, which is rapid, reproducible and
applicable to a broad range of genotypes. Therefore, it is
necessary to develop an efficient regeneration and genetic
transformation protocol by a range of different techniques
which would widen the possibilities for developing transgenic
lines and multiplication of improved varieties.
Objectives:
(1) To standardize the protocol for in vitro regeneration of
finger millet genotype GN-4
(2) To optimize genetic transformation protocol for finger
millet genotype GN-4
4
REVIEW OF LITERATURE
Plant tissue culture has an important role to play in the production
and in the manipulation of plant for improved agronomic performance.
Achievement made by various scientists in the field of plant tissue culture
and genetic transformation in finger millet and different plant species is
reviewed in this chapter. Plant tissue culture research and development of
transgenic are multi-dimensional science that offers exciting prospects to
future improvements in crop productivity.
However, difficulty in tissue culture based regeneration and poor
reproducibility of results in the major bottleneck in genetic
transformation of finger millet. The work related to present investigation
entitled “In vitro regeneration and genetic transformation of finger millet
(Eluecine coracana L.) genotype GN-4” were described in brief as
below:
2.1 History of Plant tissue culture
In vitro technique dates back to 1902, when Haberlandt stated the
totipotency of the plant cells. Efforts to demonstrate totipotency led to the
development of the tissue culture. Major breakthrough in plant tissue
culture was seen after (Skoog and Miller,1957) put forth the concept of
hormonal control of organ formation and showed that differentiation of
roots and shoots was a function of relative concentration of auxin and
cytokinin in the medium. The earlier work of (Morel , 1960) reported on
in vitro propagation of orchid provided the stimulus for propagating the
ornamental species through tissue culture. (Murashige and Skoog, 1962)
standardized the nutrient media for tissue culture of tobacco, was a great
achievement. The medium is now widely use for most of the species.
Murashige, 1974 was instrumental in giving the techniques of in
vitro culture, the status of viable practical means for rapid and mass
5
propagation of horticultural crops. Clonal propagation through tissue
culture can be achieved in short space and time. Rapid propagation is one
of the benefits provided by this technique for economically important
crops, especially those plants which are difficult to propagate
conventionally. Plant cell, tissue and organ culture were used to study
biochemical and other aspects of plant physiology and somatic cell
genetics.
At present, plant tissue culture technique is being successfully
employed for rapid production of uniform and superior quality planting
material. In in vitro propagation, the organs and tissues are cultured
through a sequence of steps in which differential cultural and
environmental conditions are provided. (Murashige, 1974) grouped this
sequence of steps into different stages as under.
Stage-I: Explants establishment including selection of mother plant and
collection of explants
Stage-II: Rapid multiplication of shoots through increased axillary
branching / Somatic organogenesis
Stage-III: In vitro rooting
Stage-IV: Acclimatization and planting out
2.2 In vitro regeneration of finger millet
Availability of an efficient and highly reproducible system of tissue
culture regeneration is a prerequisite for genetic transformation
experiments. The effect of different levels of ammonium nitrate used as
macronutrient in the MS medium was investigated for plant regeneration
from embryogenic callus of Eleusine coracana in the presence and
absence of NAA used as growth regulator. Seeds of Eleusine coracana
were cultured on MS medium supplemented with 2.0 mg/l 2,4-D and 0.5
mg/l Kin to obtain embryogenic callus. The results indicate that addition
of higher concentrations of NH4NO3 can substitute for the growth
6
regulator requirement in the medium for plant regeneration (Poddar et
al.,1997).
Kumar et al., 2001 observed that in cereal crops, somatic
embryogenesis is the most common pathway of plant regeneration. The
induction of apical domes occurred on MS medium supplemented with
different auxins and cytokinins. The primary domes, after four weeks of
subculturing on MS + 2,4-D (0.1, 0.2 mg/l), proliferated rapidly and gave
rise to secondary and tertiary domes along with green, nodular, compact
callus. The domes on MS medium containing GA3 (1 mg/l) or NAA
(1 mg/l) gave rise to high-frequency shoot bud differentiation.
Kothari et al., 2004 studied the growth and morphogenesis of plant
tissues under in vitro conditions are largely influenced by the composition
of the culture media. Primary callus induction without ZnSO4 resulted in
improved shoot formation upon transfer of callus to normal regeneration
medium. CuSO4 increased to 5X the normal concentration in the media
for primary seed callus induction and plant regeneration resulted in a 4-
fold increase in number of regenerated shoots.
Ceasar and Ignacimuthu, 2008 reported an efficient somatic
embryogenesis and plant regeneration system was developed from shoot
apex explants of finger millet, Eleusine coracana. Eight genotypes, CO 7,
CO 9, CO 13, CO 14, GPU 26, GPU 28, GPU 45, and GPU 48 were
assessed in this study. The maximum somatic embryogenic induction, at
98.6%, was obtained from explants cultured on MS medium
supplemented with 18.0 μM 2,4-D and 2.3 μM Kin. The highest number
of shoot induction was observed after transfer of embryonic callus to
regeneration medium supplemented with 4.5 μM TDZ and 4.6 μM Kin.
Significant differences were observed between genotypes for somatic
embryogenesis and plant regeneration. GPU 45 gave the best response,
while CO 7 was the least responsive under the culture conditions tested in
7
this study. Regenerated plants were successfully rooted and grown to
maturity after hardening in soil.
Rao et al., 2009 studied genotypic differences for callus induction,
per cent frequency of plantlet regeneration and mean number of plants
formed per 200 mg callus were observed in finger millet (Eleusine
coracana). BAP was better, but kinetin is effective in finger millet for
plant regeneration. High frequency plant regeneration was noticed up to
165 to 180 days which would pave the way for genetic transformation of
finger millet.
Kothari et al., 2008 observed that basal medium constituents and
their concentration play an important role in growth and morphogenesis
of plant tissues cultured in vitro. The effect of different inorganic
nutrients (CoCl2, MnSO4, ZnSO4, CuSO4 and AgNO3) on callus induction
and plant regeneration in Eleusine coracana was examined. Significant
improvement in plant regeneration was also observed with the increase in
levels of Co and Mn. Optimization of nutrient level in the basal medium
has highly significant role in obtaining maximum regeneration response
from explants and callus culture.
Prasad et al., 2011 produced an effective protocol for the
regeneration of multiple shoots from the shoot apices. Shoot apex from
10-12 days old seedlings were collected and were inoculated onto MS
medium supplemented with various growth regulators. Proliferation of
about 8 shoots was obtained 4 mg/l BAP. The regenerated shoots were
rooted on MS medium + IBA (1mg/l). Rooted shoots were sequential
acclimatized by transferring them to sterile distilled water and tap water
before plating in various pot mixtures. A maximum of 60% survival rate
was noticed on a mixture of soil: sand: manure. (1:1:1).
Anjaneyulu et al., 2011 reported that Shoot tips of finger millet
(Eleusine coracana) were inoculated on to MS medium supplemented
8
with different concentrations and combinations of auxins [(2,4-D, NAA),
cytokinins (KN, BAP) and other growth promoters (Proline, Tryptophan,
CEH]. The higher degree of embryogenic callus formation observed with
2,4-D was at 2.5 mg/l in the presence of 0.5 mg/l of BAP. Among all the
combinations employed the highest degree of callus formation was
observed at 2.5 mg/l of 2,4-D, 0.5 mg/l of BAP, Proline (500 mg/l),
Tryptophan (250 mg/l) and CEH (300 mg/l). A maximum of 97 % of
shoot tip explants were successful in inducing callus at this combination
of growth regulators. Highest mean number of shoot buds (67%) and
good rooting was observed when embryogenic calli was subcultured on
MS medium supplemented with 1 mg/l Kin and 0.5 mg/l NAA. The
regenerated plantlets could be transferred successfully to the field with
85% survival.
Finger millet production is significantly affected by fungal disease
(Nicholas 2003). Integration of fungal resistant genes into finger millet is
needed to enhance the fungal resistance and improve the yield
(Radjacommare et al., 2004).Transgenic modification offers one method
for the introduction of fungal resistance genes but requires first the
development of efficient in vitro plant regeneration systems. The first in
vitro study in finger millet was reported in by (Rangan, 1976). The
induction of somatic embryogenesis in finger millet has been reported in
which immature inflorescences and shoot apical meristems were induced
to form somatic embryos on MS basal medium containing 2,4-D and KN
(Sivadas et al., 1990; Latha et al., 2005) and also from medium
supplemented with picloram and kinetin(George and Eapen, 1990).
2.3 Agrobacterium mediated genetic transformation
Agrobacterium tumefaciens is a gram-negative soil bacterium that
causes crown gall tumours on many dicotyledonous and some
monocotyledonous plants by transferring a part of its DNA called
transferred DNA (T-DNA) from its tumor inducing (Ti) plasmids to the
9
plant genome. The virulence (vir) region of the Ti plasmid codes for the
function of required processing and transfer of T- DNA. The discoveries
that T-DNA is coded for oncogenes which is only transferred to plant cell
genome and non virulent or disarmed strains i.e. containing T-DNA from
which oncogenes are being removed and replaced by any other gene of
interest behave in the same way as virulent strain do, that opened a new
avenues in transformation of higher plants.
Genetic engineering or transformation refers to the delivery of
DNA, encoding a desirable trait to the plant cell. In order to deliver
pieces of DNA to the plant of choice, two methods, namely physical and
biological, are used. The physical method includes particle or
microprojectile bombardment and electroporation while the only
successfully applied biological technique is Agrobacterium-mediated
transformation. Since both physical and biological methods facilitate the
transfer of the traits of importance to the plants of interest, a number of
crop improvement studies benefited from the technique. Traits commonly
employed in the transformation are those which increase resistance
against biotic and abiotic stresses or those which improve the quality of
food.
Ceasar and Ignacimuthu, 2011 studied that Agrobacterium-mediated
transformation system was developed for finger millet using shoot apex
explants. The Agrobacterium strain LBA4404 harboring binary vector
pCAMBIA1301, which contained hygromycin phosphotransferase (hptII)
as selectable marker gene and b-glucuronidase (GUS) as reporter gene,
was used for optimization of transformation conditions. Two finger millet
genotypes, GPU 45 and CO 14, were used in this study. The optimal
conditions for the Agrobacterium mediated transformation of finger
millet were found to be the co-cultivation of explants obtained on the 16th
day after callus induction (DACI), exposure of explants for 30 min to
agrobacterial inoculum and 3 days of co-cultivation on filter paper placed
10
on medium supplemented with 100 mM acetosyringone (AS). Both finger
millet genotypes were transformed by Agrobacterium. A frequency of
19% transient expression with 3.8% stable transformation was achieved
in genotype GPU 45 using optimal conditions.
Sharma et al., 2011 reported that Agrobacterium-mediated
transformation protocol has been developed for Eleusine coracana (var.
PR-202) by varying several factors which influence T-DNA delivery.
Green nodular regenerative calli with meristematic nodules of seed origin
were used as the target tissue for Agrobacterium tumefaciens-mediated
gene transfer. The highest frequency of transformation (44.4%) was
observed when callus was infected, co-cultivated and incubated at 22°C.
Incorporation of higher level of CuSO4 in the regeneration medium had
significantly positive effect on the recovery of transformed plants. PCR
analysis of T0 and T1 generation plants with nptII-specific primers
revealed the amplification of nptII gene. Southern blot analysis of six
regenerated plants confirmed selectable marker gene integration in three
plants. This is a first report on Agrobacterium-mediated genetic
transformation of finger millet and will pave the way for further studies in
this and other millet crops.
Ignacimuthu and Ceasar, 2012 reported that finger millet plants
conferring resistance to leaf blast disease have been developed by
inserting a rice chitinase (chi11) gene through Agrobacterium-mediated
transformation. Transformed plants were selected and regenerated on
hygromycin-supplemented medium. The incorporation of rice chitinase
gene in R0 and R1 progenies was confirmed by PCR and Southern blot
analyses. Expression of chitinase gene in finger millet was confirmed by
Western blot analysis with a barley chitinase antibody. A leaf blast assay
was also performed by challenging the transgenic plants with spores of
Pyricularia grisea. The frequency of transient expression was 16.3% to
11
19.3%. Stable frequency was 3.5% to 3.9. Chitinase activity ranged from
19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced
three resistant and one sensitive for hygromycin, confirming the normal
Mendelian pattern of transgene segregation. Transgenic plants showed
high level of resistance to leaf blast disease compared to control plants.
This is the first study reporting the introduction of rice chitinase gene into
finger millet for leaf blast resistance.
Latha et al., 2005 studied the reproducible protocols for in vitro
plant regeneration and genetic transformation have been established in
finger millet using particle inflow gun-mediated method. Using the
optimized protocol, >4000 plantlets were regenerated from the callus of
each shoot-tip explants within 75 days. Plasmid construct pPur,
containing uid A gene driven by CaMV 35S promoter, was used for
developing the transformation system. A gene coding for an antifungal
protein (PIN) of prawn was chemically synthesized and was cloned into
bacterial and plant expression vectors. Embryogenic calli were co-
bombarded with the construct containing pin gene (pPin 35S) and another
construct containing bar gene (pBar 35S) driven by CaMV 35S promoter.
For stable transformation, the co-bombarded calli were cultured on
phosphinothricin (PPT) - supplemented medium. This study, first of its
kind, reports the production of pin expressing transgenic finger millet
exhibiting high-level resistance to leaf blast disease.
In the era of the plant transformation was initiated when (Fraley et
al., 1983) reported the Agrobacterium mediated transformation of petunia
and tobacco. Protoplast cells were inoculated with the Agrobacterium
tumefaciens. The chimeric genes containing nopaline synthase region
joined to gene for neomycin phosphotransferase II and I. Transformed
cells proliferated on medium containing 50 mg/ml kanamycin. They
discussed that expression of NPTase I and II enzymes in plants depends
on transcription from the nopaline synthase promoter. Southern
12
hybridization was used to confirm the presence of chimeric gene in the
transformed plants.
Horsch et al., 1985 described a protocol of co-cultivating
Agrobacterium with leaf discs instead of protoplasts to overcome
problems of regeneration of the plants through protoplasts. This most
common Agro-infection methodology includes a two-day co-cultivation
of Agrobacterium (containing a selectable marker such as npt-II; which
confers resistance to the antibiotic kanamycin) with the mesophyll cells
of the leaf disc. This was followed by the culture of leaf discs on shoot
induction medium containing kanamycin resulting in production of
transgenic plantlets.
2.4 Co-cultivation with Agrobacterium culture
There are some requirements to optimize several factors like age of
the explants, concentration of infection and co-cultivation time of the
Agrobacterium as these factors affect the efficiency of transformation
(Mannan et al., 2009). A specific time period is required by
Agrobacterium for its attachment and for transfer of its T-DNA to
explant. Less infection time period, of course produces low number of
transformed explants where as more time period for explants in infection
medium may cause hypertonic conditions that bursts the cell or it may be
due to hyper activation of defense mechanism that may be lethal to cell
and hence results low frequency of transformation. Plant cell requires
some time to adopt this foreign DNA making co-cultivation time
important. Less time does not ensure integration and working of
transferred DNA while higher time can also be lethal due to overgrowth
of Agrobacterium that behaves as parasite with explants and decreases
nutrients supply.
Mondal et al., 2001 reported that the differential requirement of co-
cultivation period depend on Agrobacterium strain used for co-cultivation
13
or medium for bacterial culture. An experiment on optimization of
Agrobacterium mediated genetic transformation in Indica rice using two
important parameters: Infection time and Co-cultivation period. They
have used infection time 5, 10 and 15 minutes and co-cultivation period
2, 3 and 4 days using 50 numbers of explants in each treatment. The
transformation experiment showed that infection was most effective when
explants were inoculated for 15 minutes (72.59% GUS positive) and co-
cultivation for four days (70.37% GUS positive) with Agrobacterium
(Nazim-Ud Dowla et al.,2008).
Carvalho et al., 2004 reported that the four factors that we found
most influenced transformation were: the sensitivity of immature
sorghum embryos to Agrobacterium infection, the growth conditions of
the donor plant, type of explant and co-cultivation medium. A major
problem during the development of our protocol was a necrotic response
which developed in explants after co-cultivation. Immature sorghum
embryos proved to be very sensitive to Agrobacterium infection and we
found that the level of embryo death after co-cultivation was the limiting
step in improving transformation efficiency. The addition of coconut
water to the co-cultivation medium, the use of vigorous and actively
growing immature embryos and the removal of excess bacteria
significantly improved the survival rate of sorghum embryos and was
critical for successful transformation. Hygromycin phosphotransferase
(hpt) proved to be a good selectable marker for sorghum. They were also
found that β-glucuronidase (GUS) activity was low in most of the
transgenic plant tissues tested, although it was very high in immature
inflorescences. Although promising, the overall transformation efficiency
of the protocol is still low and further optimization will require particular
attention to be given to the number of Agrobacterium in the inoculum and
the selection of sorghum genotypes and explants less sensitive to
Agrobacterium infection.
14
Indra Arulselvi et al., 2010 studied that Sorghum ranks as the sixth
most planted crop and it is vulnerable to fungal diseases resulting in
decreased grain quality and yield loss. Agrobacterium strains used were
LBA4404 harbouring pcambia-ubi-chi11 (rice chitinase), EHA105
harbouring pcambia-ubi RC7 (rice chitinase) with bar gene and EHA105
harbouring pMKURF2 (rice chitinase gene) having hph gene for
producing fungal resistance in sorghum plants. pCRC7 harbouring
chitinase gene driven by ubiquitin promoter was found to be more
efficient than pCG11 and pMKURF2. Out of the concentrations of
acetosyringone tested, 200µM showed maximum transformation
efficiency. Out of the two selection agents tested, bialaphos was found as
a suitable selection agent. The transgenic nature of the sorghum calli and
plants were shown by transient gus expression, their ability to survive in
the selection medium and by western blot. The transformation frequency
was found to be very low.
Sharma et al., 2009 observed that conditions such as co-cultivation
period, bacterial concentration, concentration of BAP, zeatin and IAA
were optimized. Co-cultivation of explants with a bacterial concentration
of 108 cells/ml for three days on 2 mg/l BAP, followed by regeneration
on a medium containing 1 mg/ml zeatin resulted in a transformation
frequency of 41.4%. Transformation of tomato plants was confirmed by
Southern blot analysis and β-glucuronidase (GUS) assay. The protocol
developed showed very high efficiency of transformation for tomato
varieties Pusa Ruby, Arka Vikas and Sioux.
15
MATERIALS AND METHODS
The present investigation entitled “In vitro regeneration and
genetic transformation of finger millet (Eluecine coracana L.)
genotype GN-4” was carried out at the Department of Plant Molecular
Biology and Biotechnology, ASPEE College of Horticulture and
Forestry, Navsari Agricultural University, Navsari, Gujarat during the
year 2011-2015. The chapter contains the details regarding the
experimental materials used and methodology adopted during the course
of investigation.
3.1 MATERIALS
3.1.1 Source of explants
Seed material of finger millet genotype GN-4 obtained from Hill
Millet Research station, Waghai (Dang). Navsari Agricultural University,
Gujarat.
3.1.2 Chemical and Glassware
All the glassware’s required were obtained from Corning, Borosil,
Schott and Duran. The disposable plastic wares (centrifuge tubes, PCR
tubes, micro tips, etc.) from Tarsons Ltd. India, Axygen, Axiva, Future
Bioscience and Eppendorf. All the chemicals used were of analytical
reagent grade/molecular grade and were obtained from Sisco Research
Lab. (SRL), LOBA Chemicals, Sigma, Hi-Media, E-Merck, Qualigens,
Bangalore Genei, Fermentas and QIAGEN.
3.1.3 Instruments
The basic instruments required for the present study are enlisted in
Appendix-I.
16
3.2 METHODS
3.2.1 Preparation of glasswares and equipments
Glass wares and culture vessels used for preparation of media and
the contaminant purposes were cleaned in chromic acid (Potassium
dichromate in Sulphuric acid). Acid traces were removed by prolonged
and thorough washing in tap water. The glass wares and culture vessels
were then washed with detergent (Teepol, BDH) followed by thorough
washing with excess tap water and finally rinsed with glass double
distilled water and dried in an oven at 700C. Pipettes, all dissecting
equipments, filter papers were autoclaved at 1210 C for 20 min at a
pressure of 15 lbs/inch2 after wrapping in aluminum foil.
3.2.2 Media Preparation
Stock solutions of the media ingredients were prepared in double
distilled water. Appropriate aliquots of these solutions were mixed to
prepare the media. Concentration of the macro and micro nutrients and
organic constituents of the MS (Murashige and Skoog, 1962) basal
medium are listed in Annexure-II. Stock solutions of plant growth
regulators (PGRs) were prepared and stored for maximum period of one
month. For media preparation, calculated amount of aliquots were added
from these stock solutions. Carbohydrate was weighted and added in
required quantity and allowed to dissolve. Unless mentioned, pH of all
the media adjusted to 5.7-5.8 using 1N NaOH or 1N HCL after mixing all
the constituents except the gelling agent. The final volume was made up
with distilled water. Gelling agent (agar agar or phytagel) was then added
and heated on gas stove to allow the agar/ phytagel to melt. Thoroughly
mixed molten medium (approximately 30 ml) was dispersed into sterile
culture bottles or flask. All the culture media were autoclaved for 20 mins
at 1210C and 15 lbs/inch
2. Autoclaved media was poured in sterile
petridishes inside laminar flow cabinet before gelling, as and when
required. Gibberellic acid and antibiotics used in media were filter
17
sterilized through syringe filter (0.22µM) and added aseptically to the
autoclaved medium before it was allowed to solidify.
3.2.3 Aseptic techniques
All inoculations and manipulations involving sterile culture or
media were carried out inside laminar flow cabinet. The interior of the
laminar flow was swabbed with 70 per cent ethanol. The instruments and
other materials and placed inside the laminar airflow cabinet. The cabinet
door was closed and UV lights were switched on for 20 to 30 minutes
prior to working. The hands and arms were washed with soap and water
and then swabbed with 70 per cent ethanol before carrying out plant
manipulations inside the cabinet. The equipments such as forceps,
scalpels, blade handle etc. were sterilized by dipping them in absolute
alcohol followed by flaming and cooling. This was done at the start of
inoculation and also several times during the operation. During
inoculation, first the cap or cotton plug of the culture vessel was removed
and the neck of the vessel was flamed over a spirit lamp kept in the
cabinet. The sterile and trimmed explants were quickly transferred to the
culture vessels containing suitable culture medium using sterilized
forceps.
The neck of the culture vessel was once again flamed and quickly
stoppered by cap or cotton plug. Care was taken to avoid any obstruction
of the laminar flow by placing nothing between the work area and the
source of air flow. Further, crossing over of hands and arm was avoided.
If any plant material fell on to the floor of the cabinet, it was discarded
assuming that it was contaminated. After completion of work the cabinet
was switched off, sprayed with 70 per cent ethanol and front panel
replaced.
18
3.2.4 Culture conditions
All the culture were incubated in a culture room at a temperature of
25 ± 20
C with relative humidity at 55 ± 5 per cent and kept in dark
condition for callus induction and for multiplication were exposed to a
photoperiod of 16 h and 55±5% of relative humidity (RH).
19
Figure 3.1: Schematic procedure for preparation of MS medium
20
3.3 Micro propagation procedure
General micropropagation procedure adopted in the present
investigation was illustrated in figure.
Figure 3.2: General procedure followed for in vitro regeneration of
finger millet
EXPLANT
ESTABLISHMENT ON
GROWTH MEDIUM
MULTIPLE SHOOT
REGENERATION
SURFACE STERILIZATION
AND WASHING
PROLIFERATION OF
SHOOTS
IN VITRO ROOTING
ACCLIMATIZATION
21
3.3.1 In vitro establishment of explants
3.3.1.1 Preparation and inoculation of explants
Seed material of finger millet genotype GN-4 obtained from Hill
Millet Research station, Waghai (Dang). Navsari Agricultural University,
Gujarat. Seeds were surface sterilized in 0.1% (w/v) mercuric chloride for
6 minutes followed by 4-5 times rinses in sterile deionized water. Seven
to eight seeds were placed in petriplates containing basal MS medium
(Murashige and Skoog, 1962) and incubated in the dark condition for
germination.
3.3.1.2 Standardization of surface sterilization method for seeds
In order to standardize the most effective surface sterilization
treatment of seeds, a trial was conducted using different duration for
treatments of 0.1% (w/v) mercuric chloride (HgCl2). The experiment was
repeated for three times. The details of treatments were given below:
Treatments
Sterilizing
agent
Concentration
(%)
Duration for
treatments
S1 HgCl2 0.1 2 minutes
S2 HgCl2 0.1 4 minutes
S3 HgCl2 0.1 6 minutes
S4 HgCl2 0.1 8 minutes
S5 HgCl2 0.1 10 minutes
3.3.1.3 Standardization of age of seeds to isolate callus
After standardization of sterilization method, the age of explants
used for isolating callus was examined. The experiment was repeated for
three times.
22
The details of treatments were given below:
Treatments Age of explants in days
A1 15 days
A2 30 days
A3 45 days
A4 60days
A5 75days
3.3.1.4 Standardization of callus induction
MS basal medium was used for trial which showed better response
for callus induction in the presence of different plant growth regulators
separately. Different plant growth regulators were tried to standardize the
most suitable culture medium for callus induction of finger millet. The
experiment was repeated for three times.
The details of the treatments were given below.
Treatment No. Treatments
F1 MS + 50 mg/l 2,4-D
F2 MS + 100 mg/l 2,4-D
F3 MS + 150 mg/l 2,4-D
F4 MS + 200 mg/l 2,4-D
F5 MS + 100 mg/l Proline
F6 MS + 300 mg/l Proline
F7 MS + 500 mg/l Proline
F8 MS + 700 mg/l Proline
F9 MS + 100 mg/l CEH
F10 MS + 300 mg/l CEH
F11 MS + 500 mg/l CEH
F12 MS + 700 mg/l CEH
24
18
23
3.3.1.5 Standardization of callus formation from finger millet seeds in
combination of different growth regulators
MS basal medium was used for trial which showed better response
for callus formation. Different plant growth regulators and their
combinations were tried to standardize the most suitable culture medium
for finger millet. The combination which showed better response was
used for callus induction. The experiment was repeated for three times.
The details of the treatments were given below.
Treatment
No. Treatments
F1 MS + 100 mg/l 2,4-D + 100 mg/l Proline + 100 mg/l CEH
F2 MS + 100 mg/l 2,4-D + 100 mg/l Proline + 100 mg/l CEH
F3 MS + 100 mg/l 2,4-D + 100 mg/l Proline + 100 mg/l CEH
F4 MS + 100 mg/l 2,4-D + 100 mg/l Proline + 100 mg/l CEH
F5 MS + 100 mg/l 2,4-D + 300 mg/l Proline + 300 mg/l CEH
F6 MS + 100 mg/l 2,4-D + 300 mg/l Proline + 300 mg/l CEH
F7 MS + 100 mg/l 2,4-D + 300 mg/l Proline + 300 mg/l CEH
F8 MS + 100 mg/l 2,4-D + 300 mg/l Proline + 300 mg/l CEH
F9 MS + 100 mg/l 2,4-D + 500 mg/l Proline + 500 mg/l CEH
F10 MS + 100 mg/l 2,4-D + 500 mg/l Proline + 500 mg/l CEH
F11 MS + 100 mg/l 2,4-D + 500 mg/l Proline + 500 mg/l CEH
F12 MS + 100 mg/l 2,4-D + 500 mg/l Proline + 500 mg/l CEH
F13 MS + 100 mg/l 2,4-D + 700 mg/l Proline + 700 mg/l CEH
F14 MS + 100 mg/l 2,4-D + 700 mg/l Proline + 700 mg/l CEH
F15 MS + 100 mg/l 2,4-D + 700 mg/l Proline + 700 mg/l CEH
F16 MS + 100 mg/l 2,4-D + 700 mg/l Proline + 700 mg/l CEH
24
3.3.1.6 Standardization of multiplication medium
MS basal medium was used for trial which showed better response
for establishment of finger millet explants. Different plant growth
regulators were tried to standardize the most suitable culture medium for
multiplication of finger millet. The experiment was repeated for three
times.
The details of the treatments were given below.
Treatment
No. Treatments
T1 MS + 0.50 mg/l BAP
T2 MS + 1.00 mg/l BAP
T3 MS + 1.50 mg/l BAP
T4 MS + 2.00 mg/l BAP
T5 MS + 0.50 mg/l KIN
T6 MS + 1.00 mg/l KIN
T7 MS + 1.50 mg/l KIN
T8 MS + 2.00 mg/l KIN
3.3.1.7 Standardization of subculturing for multiplication of shoots
Basal medium was used which showed better response for
establishment of finger millet explants. Different plant growth regulators
and their combinations were tried to standardize the most suitable culture
medium for finger millet. The combination which showed better response
was used for establishment of subculturing for multiple shoot
regeneration. The experiment was repeated for three times.
25
The details of the treatments were given below.
Treatment
No. Treatments
E1 MS + 0.50 mg/l BAP + 0.50 mg/l KIN + 0.50 mg/l NAA
E2 MS + 0.50 mg/l BAP + 0.50 mg/l KIN + 1.00 mg/l NAA
E3 MS + 0.50 mg/l BAP + 0.50 mg/l KIN + 1.50 mg/l NAA
E4 MS + 0.50 mg/l BAP + 0.50 mg/l KIN + 2.00 mg/l NAA
E5 MS + 0.50 mg/l BAP + 1.00 mg/l KIN + 0.50 mg/l NAA
E6 MS + 0.50 mg/l BAP + 1.00 mg/l KIN + 1.00 mg/l NAA
E7 MS + 0.50 mg/l BAP + 1.00 mg/l KIN + 1.50 mg/l NAA
E8 MS + 0.50 mg/l BAP + 1.00 mg/l KIN + 2.00 mg/l NAA
E9 MS + 0.50 mg/l BAP + 1.50 mg/l KIN + 0.50 mg/l NAA
E10 MS + 0.50 mg/l BAP + 1.50 mg/l KIN + 1.00 mg/l NAA
E11 MS + 0.50 mg/l BAP + 1.50 mg/l KIN + 1.50 mg/l NAA
E12 MS + 0.50 mg/l BAP + 1.50 mg/l KIN + 2.00 mg/l NAA
E13 MS + 0.50 mg/l BAP + 2.00 mg/l KIN + 0.50 mg/l NAA
E14 MS + 0.50 mg/l BAP + 2.00 mg/l KIN + 1.00 mg/l NAA
E15 MS + 0.50 mg/l BAP + 2.00 mg/l KIN + 1.50 mg/l NAA
E16 MS + 0.50 mg/l BAP + 2.00 mg/l KIN + 2.00 mg/l NAA
3.3.1.8 Standardization of in vitro rooting medium
The trial on in vitro rooting was conducted on half and full MS
medium gelled with 0.8 per cent agar. Each medium was supplemented
with different concentrations of NAA and IBA. The experiment was
repeated for three times.
26
The details of the treatments were given below:
Treatment
No. Treatments
R1 ½ MS basal
R2 ½ MS + 0.05 mg/l NAA
R3 ½ MS + 0.10 mg/l NAA
R4 ½ MS + 0.50 mg/l NAA
R5 ½ MS + 1.00 mg/l NAA
R6 MS + 0.05 mg/l IBA
R7 MS + 0.10 mg/l IBA
R8 MS + 0.50 mg/l IBA
R9 MS + 1.00 mg/l IBA
3.3.1.9 Standardization of potting mixture for hardening of in vitro
plantlets
The different potting mixtures (H) used for hardening of in vitro
raised plantlets in the experiment are appended below. Each experiment
was repeated three times.
The details of the treatments done was given below:
Treatment
No. Treatments
H1 Vermicompost
H2 Sand
H3 Coco peat
H4 Vermicompost : sand (1:1 v/v)
H5 Vermicompost : sand : Coco peat (1:1:1 v/v)
27
3.4 Agrobacterium mediated transformation and transgenic plants
regeneration:-
3.4.1 Hygromycin sensitivity test
The test was performed in order to check the sensitivity of cultured
tissues to hygromycin. Different concentration of hygromycin were added
to pre sterilized molten MS media by filter sterilizations through 0.22 µm
pore size membrane filter and the medium poured in petriplates. Isolated
callus were inoculated at different concentrations of hygromycin. Effect
of the antibiotic on callus was observed to determine its optimum
concentration in selection media.
3.4.2 Maintenance of Agrobacterium tumefaciens culture
The laboratory glycerol stocks of the bacterial culture stored at -80
0C was utilized to streak YEB medium plates containing 50mg/l
kanamycin and 10mg/l rifampicin. To achieve proper growth of A.
tumefaciens, inoculated plates were incubated at 280C under dark
conditions for 3-4 days. Then cultures were kept at low temperature
(4±20C).
3.4.3 Preparation of fresh culture of Agrobacterium tumefaciens
1. Single, isolated colonies from YEB medium plates was inoculated
individually in 50ml YEP medium containing 50mg/l kanamycin
and 10mg/l rifampicin in tubes and was grown at 28 0C with 200
rpm in an incubator shaker for 20-24 hours to make primary
culture.
2. The inoculum for secondary culture was taken from this primary
culture and inoculated to 50ml of YEP medium in 250 ml
Erlenmeyer flask harvested at 0.4-0.6 O.D. at 600nm and was
utilized for transformation experiments.
28
3.4.4 Induction of Agrobacterium tumefaciens culture:
1. The secondary culture was centrifuged at 5000 rpm for 10 minutes
at 40C.
2. The pellet resuspended in an induction medium (Annexure V) with
100μM acetosyringone and incubated for 4 hour on an incubator
shaker at 175 rpm and 26 0C temperature.
3. After this incubation period, the bacteria was centrifuged at 5000
rpm for 10 minutes and the pellet was resuspended in MSO
medium ( Annexure VI) containing 100 μM acetosyringone and
grown for 2 hours at 250C and 150 rpm in an incubator - shaker.
3.4.5 Infection and co-cultivation of the explants
30, 45 and 60 days old callus on MS medium were taken as a
source of explants. The latter were shaked with Agrobacterium culture
harboring the Rs AFP2 gene constructs and co-cultivated in dark for 3, 5
and 7 days respectively. In this method callus were infected and
inoculated with culture of the Agrobacterium tumefaciens.
3.5 Confirmation of putative transgenic finger millet plant
3.5.1 Confirmation of putative transformed plant on selection media
In the putative transgenic plants, expression of the transgene hpt II
was analyzed by first establishing the concentration of hygromycin and
cefotaxime in that hygromycin that would kill untransformed plants.
After co-cultivation, explants were washed six times with sterile
distilled water containing 250 mg/l cefotaxime. Cleaned apices were
blotted dry using a sterile paper towel and cultured on the selection
medium consisting of MS with 250mg/l cefotaxime and 40mg/l
hygromycin. Callus which was not inoculated with Agrobacterium
tumefaciens were placed on the selection medium served as a negative
control. Cefotaxime was included in the selection medium to suppress
the Agrobacterium tumefaciens growth.
29
The petridishes were incubated at a temperature of 280C under an
18 hours photoperiod and sub-cultured every 2 weeks. The process was
repeated until negative control, which was not inoculated with
A. tumefaciens,were totally dead. After this period the surviving callus
were transferred to an MS medium without hygromycin to root the plants.
Figure 3.3: A schematic diagram depicting the cascade of events
leading to Agrobacterium mediated genetic
transformation into plant
3.5.2 Confirmation of putative transformed plants through PCR
3.5.2.1 Extraction of DNA
3.5.2.1a Extraction of plant genomic DNA:
Genomic DNA isolated from leaves of plants by the CTAB method
with minor modification (Doyle and Doyle, 1990). The procedure for
DNA isolation used was as under:
1. One gram of leaf tissue was taken from the young plant, frozen in
liquid nitrogen and ground into a fine powder in a prechilled
mortar and pestle.
2. Sample were homogenized properly and the powder transferred
into 1.5ml centrifuge tube and 2 ml of the extraction buffer
30
(0.1 M Tris, pH 8.0; 0.05 M EDTA, pH 8.0; 1.5 M NaCl; 0.01 M
β-mercaptoethanol, CTAB 3%, PVP 1%) was added.
3. Mixture were homogenized properly and incubated at 650 C for 40-
45 mins.
4. Equal volume of Chloroform: Isoamyl alcohol (24:1) was added,
mixed by mild vortexing for 5-10 seconds and centrifuged at
13,000 rpm for 5 minutes at room temperature.
5. Upper phase was collected and double volume of isopropanol was
added, gently invert the tubes and keep at -200C for 2-3 hour.
6. After this DNA was pelleted by centrifugation at 13,000 rpm for 20
minutes at 40C.
7. The pellet was washed with 70 % ethanol, centrifuge at 13,000
rpm for 20 minutes at 40C.
8. Pellet was dried in dry bath at 650C
9. 50µl TE buffer was added in pellet, spin it for proper mixing
3.5.2.1b Isolation of plasmid DNA
Plasmid DNA was isolated by standard alkaline lysis method
(Sambrook et al., 1989). Isolated DNA was given RNAse treatment and
purified with phenol: chloroform method.
3.5.2.2 Estimation of quantity and quality of DNA
The quantification of DNA was carried out as per using Nanodrop
spectrophotometer and O.D was measured at 260 and 280 nm. The
quality of DNA was checked on 0.8 % (w/v) agarose gel prepared in 0.5X
TBE (Tris 45 mM, Boric Acid 45 mM and EDTA 1 mM ) containing 5 µl
of ethidium bromide (EtBr 50g/ml) per 100 ml of buffer. The already
extracted genomic DNA from the stock (5 µl) was mixed with 1 µl of 6X
agarose gel loading dye. The 5µl sample was loaded in each well using
micropippette. Gel was provided a potential difference of 5-6 V/cm for an
hour. Bands were visualized under UV light using a transilluminator.
31
The samples, which resolved into a single discrete high molecular
weight band near the well with no shearing, were considered to be of
good quality. The good quality DNA samples with a ratio of 1.8 – 2.0 at
O.D. 260/280 were retained for PCR amplification. The stocks were
diluted to a final concentration of 50 ng/µl of DNA and used for further
applications.
3.6 Polymerase Chain Reaction (PCR):
Genomic DNA isolated from leaves of plants by the CTAB method
with minor modification (Doyle and Doyle, 1990). PCR amplification of
a 1.0 kb DNA fragment of gene was carried out in Biometra thermal
cycler using the hpt II gene fragment was amplified using the forward
primer 5’ CCCTGATGGCATCCGAAGAGC 3’ and the reverse primer
5’ GAGGCAGCAGTGATGACATCC 3’. The PCR reaction mixture
contain 50 ng genomic DNA in a final volume of 20 µl containing 1x
PCR buffer, 1.2 µl MgCl2, 250 µM dNTPs, 1 µl each of primer and 0.3
units of Taq DNA polymerase. Amplification was carried out by:-
Step-I: Initial denaturation at 94 0C for 4 minutes
Step-II: followed by 30 amplification cycle at 94 0C for 50 seconds
Step-III: Final extension at 72 0C carried for 5 minutes.
The completed reactions were then held at 4 0C until
electrophoresis was done. PCR products were separated by loading 1.5
µL of each sample and 2 µl of loading buffer type II on a 1.2 % agarose
gel prepared with 0.5X TBE buffer. The sample were subject to
electrophoresis at 80-90V for 20-25 minutes in 0.5X TBE buffer. The gel
was stained with ethidium bromide and visualized under UV light.
3.7 Total RNA Isolation
Total RNA was extracted from the leaves by a modified Trizol
method. Fresh leaves (0.1 g) from plant were powdered in liquid nitrogen
using a pestle and mortar.
32
The resulting powder was transferred to a 1.5 ml tight capped
eppendorf tube with 1 ml TRIzol reagent and incubated at room
temperature for 5 minutes. 0.2 ml chloroform was added with vigorous
shaking for 30 seconds and incubated at room temperature for 2-3 min.
Tubes were centrifuged at 12000 X g at 40C for 15 min. Aqueous phase
was transferred in another eppendorf tube and 0.5 ml of isopropanol was
mixed properly. Then eppendorf tubes were kept at room temp for 10 min
and centrifuged. Supernatant was removed and RNA pellet was washed
in 1 ml 75% ethanol at 10000 X g for 5 min at 40C. Pellets were dried
about 1-2 hour then dissolved in 25-30 µl DEPC treated water and kept at
65 0C on dry bath for 10 min. The extracted RNA was loaded on 0.8%
agarose gel.
3.7.1 Quantification and quality check of RNA
The quality of RNA was checked by agarose gel electrophoresis
and quantification was carried out by Nano Spectrophotometer. The RNA
absorbs UV light very efficiently making it possible to detect and
quantify either at concentrations as low as 2.5 ng/µl. The nitrogenous
bases in nucleotides have an absorption maximum at about 260 nm. The
RNA samples with the ratio of 1.7-2.0 at O.D. 260/280 were retained for
RNA fingerprinting. RNA was separated by denaturing agarose gel
electrophoresis. The gels of 0.8% (w/v) agarose was prepared in 1.0 X
formaldehyde agarose gel buffer (Sambrook and Russell, 2001). Agarose
(0.8 gm) was dissolved in 10 ml 10x Formaldehyde Agarose gel buffer
and volume was made up to 100 ml with RNase free water. Agarose was
boiled in microwave oven and cooled to 650C in a water bath. Then 1.8
ml of 37% (12.3 M) formaldehyde and 1 µl of a 10 mg/ml ethidium
bromide form stock solution were added. Gel solution was mixed
thoroughly and poured onto gel support. Prior to running the gel, gel was
equilibrated in 1x Formaldehyde agarose gel running buffer for 30 min.
one volume of 5x loading buffer was added per 4 volumes of RNA
33
sample and Incubated for 3–5 min at 650C, chill on ice, and loaded onto
the equilibrated formaldehyde agarose gel. Gel was run in 1x
Formaldehyde agarose gel running buffer at 5V/cm till the dye reaches
three fourth of gel. RNA bands were visualized on UV Transilluminator
(GeNeiTM). When resolved by electrophoresis the 28S and 18S RNA
should exhibit at near 2:1 ratio on ethidium bromide staining indicating
that no significant degradation of RNA has occurred.
3.7.1.1 1x Formaldehyde Agarose Gel Running Buffer
100 ml 10x Formaldehyde Agarose gel buffer
20 ml 37% (12.3 M) formaldehyde
880 ml RNase-free water
3.7.1.2 5x RNA Loading Buffer
16 µl saturated aqueous bromophenol blue solution
80 µl 500 mM EDTA, pH 8.0
720 µl 37% (12.3 M) formaldehyde
2 ml 100% glycerol
3084 µl formamide
4ml 10 x Formaldehyde Agarose gel buffer
RNase-free water to 10 ml
Stability: Approximately 3 months at 4°C
3.7.2 cDNA synthesis
The cDNA was synthesized by using high capacity cDNA reverse
transcription kit which uses the random primer scheme for initiating
cDNA synthesis. Random primers ensure that the first strand synthesis
occurs efficiently with all species of RNA molecules present, including
mRNA and rRNA. A master mix for cDNA synthesis was prepared by
following method.
34
Preparation of First Strand cDNA Synthesis
Component Volume (µl)
Template RNA 2.0
Oligo (dt)18 primer 01
Water 09
Total volume 11
Reaction mixture mixed gently centrifuged briefly and incubated at
650C for 5 min. Chill on ice, spins down and placed the vial. Add the
following component in the indication order.
5X reaction Buffer 04
Ribolock TM RNase Inhibitor (20u/µl) 01
10 mM dNTP mix 02
Reverse Transcriptase (20u/µl) 02
Total 20
Mix gently and centrifuge. Incubate for 5 min at 25 0C followed by 60
min at 37 0C. Terminate the reaction by heating at 70
0C for 5 min. The
reverse transcription reaction product directly used in PCR application or
stored at -20 ºC for less than one week. For longer storage, -70 0C was
used.
3.7.3 Expression Analysis of Gene by Real-Time (RT) PCR
Real-time PCR is one of the most sensitive and reliably
quantitative methods for gene expression analysis. It has been broadly
applied to microarray verification, pathogen quantification, cancer
quantification, transgenic copy number determination and drug therapy
studies. A PCR has three phases, exponential phase, linear phase and
plateau phase. The exponential phase is the earliest segment in the PCR,
in which product increases exponentially since the reagents are not
35
limited. The linear phase is characterized by a linear increase in product
as PCR reagents become limited. The PCR will eventually reach the
plateau phase during later cycles and the amount of product will not
change because some reagents become depleted.
Real-time PCR exploits the fact that the quantity of PCR products
in exponential phase is in proportion to the quantity of initial template
under ideal conditions. During the exponential phase PCR product will
ideally double during each cycle if efficiency is perfect, i.e. 100%. It is
possible to make the PCR amplification efficiency close to 100% in the
exponential phases if the PCR conditions, primer characteristics, template
purity, and amplicon lengths are optimal. Both genomic DNA and reverse
transcribed cDNA can be used as templates for real-time PCR. The
dynamics of PCR are typically observed through DNA binding dyes like
SYBR green or DNA hybridization probes such as molecular beacons
(Strategene) or Taqman probes (Applied Biosystems). The basis of real-
time PCR is a direct positive association between a dye with the number
of amplicons.
Real-time PCR data are quantified absolutely and relatively.
Absolute quantification employs an internal or external calibration curve
to derive the input template copy number. Absolute quantification is
important in case that the exact transcript copy number needs to be
determined, however, relative quantification is sufficient for most
physiological and pathological studies. Relative quantification relies on
the comparison between expression of a target gene versus a reference
gene and the expression of same gene in target sample versus reference
samples.
3.7.8 Relative quantification of RT PCR analysis
Gene quantification was achieved using the CT (Cycle Threshold)
comparative method and is expressed as ‘‘n-fold up or down regulation of
transcription’’ in relation to a calibrator which is represented by the
36
smallest signal detectable for that specific gene. For relative
quantification by the comparative CT method, values are expressed
relative to a reference sample, called the calibrator. Real time PCR results
were expressed as CT (cycle threshold) values.
Each sample was tested in triplicate for all primers. Melting curve
analysis was performed on all samples to ensure amplification of a single
product with the expected melting temperature and the absence of primer-
dimers. The products of each primer set were tested by agarose gel
electrophoresis to verify that a single product of the expected size was
produced. Relative RNA quantities were determined with the delta-delta
(ΔΔ)Ct, according to the following formula (Dussault and Pouliot, 2006).
3.8 Statistical Analysis
Statistical methods were used for comparison of treatment mean
during optimization parameters for micropropagation. Completely
Randomized Design (CRD) were used for all the experiments. The data
were subjected to analysis of variance (ANOVA) and treatment means
were compared using the critical difference (CD) at a 1% level of
significance (Panse and Sukhatme, 1985).
37
39
RESULTS AND DISCUSSION
During the present investigation entitled "In vitro regeneration
and genetic transformation of finger millet (Eleucine coracana L.)
genotype GN-4" conducted at the Department of Plant Molecular
Biology and Biotechnology Department of Biotechnology, ASPEE
College of Horticulture and Forestry, Navsari Agricultural University,
Navsari during the period 2011-2015, efforts were made towards
standardizing the procedures for in vitro regeneration through callus and
development of Agrobacterium mediated genetic transformation protocol
for finger millet genotype GN-4. The results of the investigation are
presented and discussed in the present chapter.
4.1 Standardization of protocol for in vitro regeneration of finger
millet
While standardizing in vitro regeneration protocol, correct
procedures of surface sterilization, collecting explants from sources;
organics such as plant growth regulators, sucrose, pH, light and growth
regulator balance at various stages are crucial since all these factors are
crop development dependent. Hence, in the present investigation, all
these have been ardently studied to produce a reproducible and efficient
protocol for in vitro finger millet regeneration through seeds used as
explants.
4.1.1 Surface sterilization treatments for finger millet seeds
Even after three decades of research and development in plant
tissue culture, microbial contamination by yeasts, fungi, bacteria, viruses,
mites and thrips is still the major problem that has hampered the
establishment of truly aseptic plants and their successful micro
propagation.
38
Finger millet seeds from the field are generally laden with large
numbers of spores of fungi and bacteria. Surface sterilization with
mercuric chloride (HgCl2) has been reported by several workers as an
effective sterilant to reduce the risk of contamination in the cultures.
To obtain the optimum time for sterilization intended for proper
aseptic culture establishment and germination of the finger millet seeds,
five time intervals for seed sterilization with mercuric chloride was
studied. The surface sterilized seeds were then cultured on basal MS
medium for 10-15 days. The number of visually contaminated seeds and
the number of germinated seeds were recorded after 10-15 days.
Perusal to Table 4.1 showed that treatment S3 (0.1% HgCl2 for 6
min) gave the best surface disinfection since it showed less contamination
(10%) and higher establishment, followed by treatment S2 (15%), S4
(15%) and S5 (20%). However, treatment S1 showed high contamination
rate (45%). Although prolonged treatment with mercuric chloride (HgCl2)
reduced the contamination in culture, it also suppressed the germination
of finger millet seeds (Table 4.1). The use of anti-microbial agents (anti-
microbial as well as anti-fungal) to control contamination was the
preferred method. However, their indiscriminate use may leads to
phytotoxicity problems.
Since the treatment with 0.1% HgCl2 for 6 minutes was found to be
effective for higher establishment of explants with an optimal control on
contamination, all further experimentation for in vitro seed germination
were carried out with the same treatment.
4.1.2 Standardization for establishment of age of explants
4.1.2.1 Effect of age of seeds to isolate callus
To determine optimum age of seeds for callus isolation, seeds of
variety GN-4 were grown in vitro. The results of the establishment of
callus isolated at different ages of seeds (15, 30, 45, 60 and 75). Perusal
to Table 4.2 revealed that variation in seedling age at the time of explants
39
preparation affected establishment of callus. The best result was found
when 45 days old seeds showed 53.53 per cent callus.
Table 4.1: Effect of surface sterilizating agent mercuric chloride
(0.1% HgCl2) on contamination and establishment of
finger millet seeds.
Tr. No. Surface sterilizing agent Establishment
(%)
Contamination
(%)
Death (%)
S1 HgCl2 for 2 minutes 35.0 45.0 20.0
S2 HgCl2 for 4 minutes 60.0 15.0 25.0
S3 HgCl2 for 6 minutes 75.0 10.0 15.0
S4 HgCl2 for 8 minutes 50.0 15.0 35.0
S5 HgCl2 for 10 minutes 45.0 20.0 35.0
* Treatments were repeated three times.
Table 4.2: Effect of days taken for callus formation
Treatment No. Days taken for callus
Formation Establishment (%)
A1 15 days 25.82
(19.0)
A2 30 days 39.61
(40.7)
A3 45 days 53.53
(64.7)
A4 60 days 50.77
(60.0)
A5 75 days 40.20
(41.7)
S.Em. ± 0.48
C.D. at 5% 1.40
C.V. % 2.27
* Treatments were repeated three times.
40
Table 4.3: Callus formation from seed of finger millet in presence of
different growth regulators
Tr. No. Plant growth regulators (mg/l) with MS (%) of callus
formation 2,4-D Proline CEH
F1 50 - - 27.96
(22.0)
F2 100 - - 51.17
(60.7)
F3 150 - - 44.43
(49.0)
F4 200 - - 35.25
(33.3)
F5 - 100 - 30.22
(25.3)
F6 - 300 - 42.13
(45.0)
F7 - 500 - 55.35
(67.7)
F8 - 700 - 48.06
(55.3)
F9 - - 100 28.66
(23.0)
F10 - - 300 58.28
(72.3)
F11 - - 500 47.10
(53.7)
F12 - - 700 41.94
(44.7)
S.Em. ± 0.767
C.D. at 5%
2.23
C.V. % 3.90
* Treatments were repeated three times.
The table 4.3 indicate that plant growth regulators used for the
better callus induction was achieved in media supplemented with 2,4-D,
proline and CEH. MS basal medium with the combination of plant
growth regulators 2,4-D 100 mg/l, Proline 300 mg/l and CEH 500 mg/l
gave the best result for callus induction from seeds.
41
42
Age and the physiological stage at which explants were isolated
had significant effect on the establishment of shoots from the callus
explants. Five weeks old callus used as explants material were cultured
on MS medium to establish an efficient regeneration protocol for finger
millet.
Thus, isolation of callus from five weeks old callus produced
highest establishment percentage. Hence, for further investigations, five
weeks old callus were used for in vitro regeneration of finger millet.
4.1.3 Standardization of multiplication medium
4.1.3.1 Effect of plant growth regulators on shoot multiplication of
finger millet
In order to unearth the suitable and optimal auxin and cytokinin
concentration for in vitro regeneration of finger millet, basal MS media
was fortified with two cytokinins (i.e. BAP and Kin) at various
concentration (0.50, 1.0, 1.50 and 2.0 mg/l).The data on multiple shoot
regeneration through callus response to different levels of cytokinins at
various concentrations on per cent response to multiplication, number of
shoots and length of shoot was presented in (Table 4.5).Perusal of the
table revealed that there was a significant difference in response to type
and concentration of the cytokinins used on multiplication and length of
shoots.
Maximum number of explants responded towards shoot
multiplication (37.35%) in M1 with 0.50 mg/l BAP and (33.25%) in M7
with 1.50 mg/l Kin. The numbers of shoots per explants (9.7) and
maximum shoot length (9.8 cm) were found highest in M1 followed by
M7 was observed (Table 4.5).
43
Table4.4: Effect of different concentrations of BAP and Kinetin for
multiple shoot regeneration through callus.
Tr. No. Cytokinin (mg/l) Multiplication
(%)
No. of
shoots
Length of
shoots (cm) BAP Kin
M1 0.50 - 37.35
(36.8) 9.7 9.8
M2 1.00 - 28.90
(23.4) 7.7 5.8
M3 1.50 - 27.53
(21.4) 7.3 5.5
M4 2.00 - 25.14
(18.1) 6.3 4.9
M5 - 0.50 24.40
(17.1) 5.7 3.9
M6 - 1.00 23.38
(15.7) 4.0 4.6
M7 - 1.50 33.25
(30.1) 11.0 8.9
M8 - 2.00 21.78
(13.8) 6.0 5.9
S.Em.
±
0.34 0.18 0.23
C.D. at
5% 0.99 0.52 0.68
C.V. % 4.00 1.99 2.84
*Data were recorded after 3 weeks of inoculation.
It was evident from the table that cytokinins used for the better
multiplication and good quality of shoots as well as good proliferation
rate was achieved in media supplemented with BAP and Kin.
44
Table 4.5: Effect of different combination of cytokinins and auxins on
shoot culture and root culture through callus
Tr. No.
Cytokinin + Auxins (mg/l)
with MS Culture
rooted
(%)
No. of
shoots
No. of
roots/shoot BAP Kin NAA
E1 0.50 0.50 0.50 20.65
(12.33) 3.3 2.8
E2 0.50 0.50 1.00 24.26
(16.67) 3.8 3.8
E3 0.50 0.50 1.50 23.31
(16.00) 5.6 5.4
E4 0.50 0.50 2.00 22.79
(15.00) 5.0 5.8
E5 0.50 1.00 0.50 24.18
(17.33) 4.4 5.2
E6 0.50 1.00 1.00 27.89
(21.67) 5.8 5.8
E7 0.50 1.00 1.50 25.92
(19.33) 6.0 5.5
E8 0.50 1.00 2.00 27.66
(21.67) 7.0 6.0
E9 0.50 1.50 0.50 32.37
(29.00) 8.3 8.3
E10 0.50 1.50 1.00 39.30
(39.33) 11.0 12.0
E11 0.50 1.50 1.50 34.72
(39.33) 9.6 9.4
E12 0.50 1.50 2.00 30.44
(25.00) 8.0 8.0
E13 0.50 2.00 0.50 26.00
(19.67) 6.4 6.1
E14 0.50 2.00 1.00 22.79
(15.00) 5.4 5.0
E15 0.50 2.00 1.50 18.96
(10.67) 4.6 4.4
E16 0.50 2.00 2.00 15.83
(7.33) 3.1 3.4
S.Em. ± 0.30 0.20 0.17
C.D. at 5%
0.87 0.58 0.48
C.V. % 1.99 2.43 2.05
Table 4.5 showed the effect of combination of cytokinins and
auxins on the shoot and root culture. The result achieved MS
supplemented with BAP 0.50mg/l+ Kin 1.50mg/l+ NAA 1.00mg/l gave
45
46
the best result for number of shoots (11.00) and number of roots/shoot
(12.00).
4.1.3.2 Effect of serial subculturing on multiple shoot regeneration
through callus.
The objective of any micro propagation protocol is to produce
maximum number and good quality of plants making the protocol
economic. To establish the exact number of subcultures to produce
maximum number of superior quality plants, the best growth regulator
combination of previous experiment were used in three cycles of
subculture. Among the different subcultures, Multiplication rate gradually
increased till third subculture afterwards it showed declining trend and
even the length of shoot after third subculture decreased gradually.
Table 4.6: Effect of serial subculturing on multiple shoot
regeneration through callus.
No. of subculture No. of Shoots Length of shoots (cm)
1 4.0
(11.54)
4.2
(11.87)
2 6.7
(14.95)
6.9
(15.23)
3 9.3
(17.78)
9.8
(18.21)
4 7.3
(15.70)
7.5
(15.93)
5 4.5
(12.29)
4.5
(12.29)
S.Em. ± 0.28 0.17
C.D. at 5% 0.81 0.50
C.V. % 3.82 2.33
4.1.4 Effect of auxins and strength of the media on induction of in
vitro rooting finger millet
Rooting parameters were significantly influenced by the
type and concentration of auxins. From the different auxin
concentration used, half strength of MS medium supplemented
47
with 1mg/l NAA recorded significantly minimum days to initiate
the root, maximum rooting per cent and number of root/shoot.
Table 4.7: Effect of auxins and strength of the media on induction of in
vitro rooting in finger millet
Tr. No.
Auxin (mg/l) with ½
MS Rooting
(%)
Days taken for
root initiation
No. of
roots/plant NAA IBA
R1 ½ MS - 34.04
(31.33) 7.7 5.3
R2 0.50 - 43.66
(47.67) 7.3 6.3
R3 1.00 - 47.49
(54.33) 6.0 12.3
R4 1.50 - 45.19
(50.33) 6.3 7.0
R5 2.00 - 49.99
(58.67) 8.7 8.3
R6 - 0.50 29.33
(24.00) 9.0 5.7
R7 - 1.00 26.08
(19.33) 8.3 4.7
R8 - 1.50 27.74
(21.67) 9.7 5.0
R9 2.00 33.83
(31.00) 7.7 4.3
S.Em. ± 0.51 0.26 0.25
C.D. at 5% 1.47 0.77 0.72
C.V. % 2.34 3.76 2.94
48
49
Table 4.8: Effect of different potting mixtures on survival of in vitro
raised plantlets of finger millet
Treatment
No.
Treatments Survival (%) of
plantlets
Days taken for
new sprouting
H1 Vermicompost 39.24
(40.0) 7.8
H2 Sand 22.01
(24.0) 8.3
H3 Coco peat 27.36
(35.4) 7.0
H4 Vermicompost : Sand (1:1 v/v) 35.77
(54.7) 6.0
H5 Vermicompost : Sand : Coco
peat (1:1:1 v/v)
44.51
(74.0) 4.4
S.Em. ± 0.53 0.21
C.D. at 5 % 1.57 0.61
C.V. % 2.51 2.78
After three weeks of incubation on rooting medium, the in vitro
raised plantlets of finger millet with well developed 10-15 roots were
taken out from the culture tubes. The roots were washed thoroughly to
remove adhering agar. The rooted plantlets of finger millet were then
transplanted in plastic cups (200 ml) containing combination of different
potting mixtures. The plantlets were initially covered with transparent
plastic cups. Then they were transplanted in plastic cups having different
potting mixture after drenching it with 1.0 per cent bavistin.
The results obtained on survival per cent in hardening and plant
growth were presented in Table 4.8. The maximum survival (44.51%) of
plantlets with minimum days for new sprouting (4.4 days) was reported in
Vermicompost : Sand : Coco peat (1:1:1 v/v).
50
51
4.2 Standardization of protocol for Agrobacterium mediated genetic
transformation
4.2.1 Determination of hygromycin concentration for selecting
transgenic finger millet plants
The use of proper concentration of antibiotics used in the selection
medium is essential in transformation experiments, in which the
antibiotics serves as the selective agent that allows only transformed cells
or plants to survive. Hygromycin has been extensively used as a selective
antibiotic in transformation experiments, mainly because several plant
transformation vectors include hygromycin phosphotransferase II (hpt II)
as selectable marker gene. Only transformed cells can grow in the
presence of hygromycin.
In this experiment, callus were transferred on to a medium
containing hygromycin at 20, 40, 60, 80 and 100 mg/l after pre-culturing
in MS medium+1.50 mg/l kinetin + 0.50 BAP for 7 days. Five callus
were placed in each petridish and replicated three times for each
concentration. Over a period of three weeks, the number of elongated
shoots were counted and recorded in each week.
The control (0 mg/l) grew very well in MS media. Shoot
elongation was significantly decreased on MS media containing
hygromycin in a dose dependent manner. The minimum lethal
concentration to kill all the callus in three weeks was 20mg/l. The higher
level of hygromycin (60 mg/l, 80mg/l and 100mg/l) killed all the apices
within two weeks (Table 4.9). Therefore, a concentration of 40mg/l
hygromycin was used to select transgenic apices in this experiment.
52
53
Table 4.9: Effect of different hygromycin concentrations on the callus
of control and transformed finger millet plants.
Tr. No.
Concentration of
Antibiotic
Survival (%) of
control plants
Survival (%) of
transformed
plants Hygromycin (mg/l)
H1 0 53.14
(64.0)
51.16
(60.7)
H2 20 28.65
(23.0)
33.03
(29.7)
H3 40 9.97
(3.0)
12.72
(4.9)
H4 60 8.50
(2.2)
9.26
(2.6)
H5 80 5.15
(0.8)
6.08
(1.1)
H6 100 0.43
(0.0)
1.59
(0.2)
S.Em. ± 0.38 0.29
C.D. at
5%
1.1 0.84
C.V. % 4.36 2.96
4.2.3 Effect of concentration of Agrobacterium tumifaciens and
duration of co-cultivation
Efficient transformation parameters were analyzed by using
different A. tumefaciens concentrations (Absorbance at O.D600 is 0.2, 0.4,
0.6, 0.8 and 1.0) and duration of co-cultivation (3, 5 and 7 days). seventy
five callus were placed in each treatment combination with three
replications. The survival per cent of transformed plants after co-
cultivation and frequency of transformation was recorded. Both
Agrobacterium tumefaciens concentrations had a significant effect on
transformation frequency.
The highest survival of transformed plants and frequency of
positive plants were observed at O.D600=0.6. The transfer T-DNA from
Agrobacterium tumefaciens to plant cells is a complicated process and it
54
takes time. The highest observed survival per cent transformed plants
were 48 and frequency of transformed plant was 2.2, which occurred at
O.D600=0.6 and 5 days co-cultivation. Co-cultivation with Agrobacterium
tumefaciens for 3 days was not long enough to maximize the transfer
event. Increasing the Agrobacterium tumefaciens concentration did not
always increase the transformation frequency. This may be due to
Agrobacterium tumefaciens over growth problems. Therefore, O.D600=0.6
and 5 days co-cultivation were selected as the efficient transformation
parameters in the investigation.
4.2.4 Effect of age of seeds to isolate callus and co-cultivation
condition
The data pertaining to survival percentage of germinating seeds to
isolate callus and for co-cultivation duration of culture was presented in
the Table-4.10. The effect of the age of callus on survival percentage was
found to be significant. Maximum survival percentage was found for
forty five days old callus (53.22%) as compared to thirty days (33.44%)
and sixty days (39.89%) age of seedlings.
The effect of co-cultivation duration was found to be significant. Co-
cultivation duration for five days gave maximum survival percentage
(57.00%) of the callus. Increasing co-cultivation duration above five days
drastically reduced the survival percentage.
The survival percentage for five days of the co-cultivation and
forty five days old callus gave higher survival percentage (49.03%). The
reduction in the survival percentage (34.65%) was observed in case of
thirty days old callus and three days of the co-cultivation duration.
55
56
Table 4.10: Effect of the age of the explant (days after germination
of seeds) and co-cultivation duration with Agrobacterium
on survival percentage of the isolated callus.
Tr. No.
Age of
seedling
(Days)
Co-cultivation (Duration in days)
Mean C1 C2 C3
3 5 7
I1 30 32.33
(34.65)
34.33
(35.87)
33.67
(35.46)
33.44
I2 45 50.67
(45.38)
57.00
(49.03)
52.00
(46.15)
53.22
I3 60 38.33
(39.23)
41.33
(40.01)
40.00
(38.25)
39.89
Mean 39.43 41.63 40.28
S. Em ± 0.73
C.D. 5% 1.03
C.V.% 3.14
4.4 Production of Putative Transgenic Plants
Presence of hpt II was confirmed by PCR amplification. The
callus were co-cultivated with Agrobacterium tumefaciens for five days.
After co-cultivation, the callus were transferred to MS medium with 40
mg/l hygromycin and 250 mg/l cefotaxime and established multiple shoot
regeneration. Under hygromycin selection pressure, most of the callus
killed and some of the callus that were initially green killed gradually,
leaving only a few green callus.
Callus were transferred to fresh media after every two weeks. After
six weeks of selection, surviving shoots were transferred to MS media
without hygromycin to induce rooting. Rooting of the transformed shoot
apices occurred when they were transferred from hygromycin selection
medium to hygromycin free medium. Further, hardening of the
transformed plants required optimization in the pots.
57
58
The morphological features of the transgenic plants did not differ
from those of non-transgenic plants. Out of a total of 200 explants,
Agrobacterium tumefaciens treated callus placed on hygromycin
selection, two regenerated plants grew and were transferred to further
culturing while others died.
4.4.1 Molecular characterization of transformed plants
Presence of transgene were confirmed by PCR amplification of
the genes for hpt II. DNA isolated from the leaves of putative transgenic
plants, a non-transgenic control plant, and plasmid isolated from
Agrobacterium strain Rs-AFP2 was used as template DNA (control) for
PCR amplification of the hpt II gene. The presence of a band in samples
from transformed plants confirmed the integration of the hpt II gene and
the presence of a band at 500 bp in samples from transformed plants
confirmed the integration of the gene. Amplification of this fragment 250
band 500 bp was not observed in non transformed control plants.
4.4.1.1 PCR analysis of putative transgenic plants
Age of the isolated callus and co-cultivation duration was found to
influence the frequency of transformation. Forty five days old callus gave
higher frequency of transformation (1.33%) while thirty days and sixty
days old callus gave 0.66% and 0.33 % frequency of transformation
respectively.
Co-cultivation duration for five days on an average gave maximum
frequency of transformation (1.33%) while co-cultivation period for three
days and seven days gave 0.33% and 1% frequency of transformation. No
transformants obtained with thirty days seedling and three days of co-
cultivation duration.
The maximum frequency of transformation was obtained for 45
days old callus and five days of co-cultivation. From above described
treatments, 30 and 60 days age of seedling and co-cultivation for three
days gave low frequency of transformation.
59
Table 4.11: Percentage generation of PCR positive plants after
transformation.
Tr. No.
Age of
seedling
(Days)
Co-cultivation (Duration in days)
Mean C1 C2 C3
3 5 7
I1 30 0 1 0 0.33
I2 45 1 2 1 1.33
I3 60 1 1 1 1.00
Mean 0.66 1.33 0.66
4.7 Real time PCR assays:
Intact total RNA were run on a 1.5% denaturing gel which showed
sharp 28S and 18S rRNA bands. The 28S rRNA band was two times
intense than the 18S rRNA band. The 2:1 ratio (28S:18S) indicated that
the RNA was intact. The relative quantification real time PCR was
performed. Amplification plots and dissociation curves were generated.
Single melt curve generation showed that only specific product was
generated.
The product specificity and its expression was confirmed by agarose gel
electrophoresis based on amplification plot using threshold line value of
individual primer mean CT value of all samples.
Figure-4.1: Comparative real time PCR result expression of gene
from finger millet plant after transformation.
60
5
SUMMARY AND CONCLUSION
The present investigation on “In vitro regeneration and genetic
transformation of finger millet (Eleusina coracana L.) genotype GN-4” is
summarized and concluded in this chapter.
1. An efficient in vitro protocol for finger millet genotype GN-4
has been developed.
Seeds were surface sterilized in laminar air flow chamber using
0.1% (w/v) mercuric chloride for 6 minutes followed by 4-5 times rinsing
in sterile deionized water proved to be the treatment and eight to ten
treated seeds were placed in plastic petriplates containing basal MS
medium gelled 0.8 per cent agar at pH 5.8, containing 30 gm/l sucrose as
carbon source proved best for initiation.
The culture petriplates were inoculated in an air conditioned
culture room at 26 ± 2 0C temperature with a relative humidity of 55 ± 5
per cent in dark condition. After five weeks of incubation, the in vitro
established explants were transferred for multiplication in MS medium
supplemented with 0.5 mg/l BAP and 1.50 mg/l Kin. The multiple shoots
obtained were separately transferred to fresh medium containing MS +
0.5 mg/l BAP + 1.50 mg/l Kin for proliferation in three cycles on the
same proliferation medium. Then, separated individual shoots were
transferred to half strength MS medium containing 1 mg/l NAA for in
vitro rooting. Approximately after three weeks the well rooted plantlets
were ready for acclimatization.
Plantlets from culture tube were removed carefully and adhering
agar from roots ten removed by thorough washing in tap water. The well
61
developed in vitro raised plantlets were transplanted for hardening in
plastic glasses containing vermicompost, sand and cocopeat. The potting
mixture was drenched with half strength liquid MS medium at 2-3 days
interval.
2. A Protocol has been developed for Agrobacterium–mediated
genetic transformation of finger millet
Agrobacterium strain Rs-AFP2 harboring the marker gene hptII
was used for Agrobacterium mediated genetic transformation. Isolated
colonies of bacteria from YEB medium plated were inoculated
individually in 10 ml YEP medium containing 50 mg/l kanamycin and 10
mg/l rifampicin in flask and was grown at 280C with shaking at 200 rpm
in an inocubator shaker for 20-24 hours to establish primary culture. The
inoculum for secondary culture was taken from this primary culture and
inoculated to 50 ml of YEP medium harvested at 0.4 - 0.6 O.D. at 600
nm. The secondary culture was centrifuged at 5000 rpm for 10 minutes at
4°C. The pellet was then re-suspended in an induction medium containing
100mM acetosyringone and incubated for 4-6 hours on an incubator-
shaker at 175 rpm and 260C temperature.
The bacterial culture was centrifuged at 5000 rpm for 10 minutes
and resulting pellet was re-suspended in MSO medium containing 100
mM acetosyringone and grown for 2 hours at 25 0C with shaking at 150
rpm in an incubator-shaker. Then, callus explants from 45 days old
germinated seedling of finger millet (cultured on MS medium) was
infected with Agrobacterium tumefaciens harbouring the Rs-AFP2 gene
construct containing marker gene hptII and co-cultivated in dark for 5
days.
After 5 days co-cultivation, explants were washed six times with
sterile distilled water containing 250mg/l cefotaxime. The cleaned callus
were blotted dry using a sterile tissue paper towel and cultured on the
62
selection medium consisting of MS with 250 mg/l cefotaxime and 40
mg/l hygromycine. The petridishes were incubated at a temperature of 28
0C under an 18 hours photoperiod and thereafter sub-cultured every 2
week. The leaves of surviving shoot apices were removed to isolate DNA
and RNA for confirmation of transformed plants with PCR and rt PCR
for reaction.
Conclusion
In recent years, there has been a focus in the development of
regeneration and genetic transformation protocol for which efficient in
vitro procedure are desirable. The present endeavour was to establish
efficient in vitro regeneration protocol as well as genetic transformation
protocol in finger millet. Thus, transformation protocol has been
developed in GN-4, where upto 1.33% transformation efficiency has been
achieved. Henceforth, to improve transformation efficiency and
hardening of in vitro plants, further investigation is required.
63
REFERENCES
Anjaneyulu, E.; Attitalla, I. H. and Balaji, M. (2011). An Efficient
protocol for callus induction and plant regeneration in finger millet
(Eleusine coracana L.). World Appl. Sci. J., 12 (7) : 919-923.
Asp, N. G.; Johansson, C. G.; Miller, H. and Siljestron, M. (1983). Rapid
enzymatic assay of insoluble and soluble dietary fiber. J. Agric.
Food Chem., 31 : 476-479.
Carvalho, C. H.; Zehr, U. B.; Gunaratna, N.; Anderson, J.; Kononowicz,
H. H.; Hodges, T. K. and Axtell, J. D. (2004). Agrobacterium-
mediated transformation of sorghum: factors that affect
transformation efficiency. Genet. Mol. Biol., 27(2) : 259-269.
Ceasar, A. S. and Ignacimuthu, S. (2008). Efficient somatic
embryogenesis and plant regeneration from shoot apex explants of
different indian genotypes of finger millet (Eleusine coracana L.)
Gaertn. In Vitro Cell. Dev. Biol.-Plant., 44 : 427–435.
Ceasar, S. A. and Ignacimuthu, S. (2011). Agrobacterium-mediated
transformation of finger millet (Eleusine coracana L.) Gaertn.
using shoot apex explants. Plant Cell Rep., 30 : 1759–1770.
Dida, M. M.; Srinivasachary, S.; Ramakrishnan, J. L.; Bennetzen, M. D.
and Devos, K. (2008). Population structure and diversity in finger
millet (Eleusine coracana L.) germplasm. Tropical Plant Biol., 1 :
131-141.
Doyle, J. J. and Doyle, J. L. (1990). Isolation of plant DNA from fresh
tissue. Focus., 12 : 13-15.
Dussault, A. and Pouliot, M. (2006). Rapid and simple comparison of
messenger RNA levels using real-time PCR. Biol. Proced Online.,
8 : 1-10.
I
Fraley, R. T.; Roger, S. G.; Horsch, R. B.; Sanders, P. R.; Hoffman, N. L.
and Woo, S. C. (1983). Expression of bacterial gene in plant cells.
Proc. Natl. Acad. Sci., 80 : 4803-4807.
George L. and Eapen S. (1990). High frequency plant regeneration
through direct shoot development and somatic embryogenesis in
immature inflorescence cultures of finger millet (Eleusine
coracana L.) Gaertn. Euphytica., 48 : 269–274.
Gupta, P.; Raghuvanshi, S. and Tyagi, A. (2001). Assessment of the
efficiency of various gene promoters via biolistics in leaf and
regenerating seed callus of millets, Eleusine coracana and
Echinochloa crusgalli. Plant Biotechnol., 18 : 275–282.
Horsch, R. B.; Fry, J. E.; Roger, S. G. and Fraley, R. T. (1985). A simple
and general method for transferring genes into plants. Science., 227
: 1229-1231.
Ignacimuthu, S. and Ceasar A. S. (2012). Development of transgenic
finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast
disease. J. Biosci., 37(1) : 1-14.
Indra Arulselvi, P.; Michael, P.; Umamaheswari S. and Krishnaveni, S.
(2010). Agrobacterium mediated transformation of sorghum
bicolor for disease resistance. Int. J. Pharm. Bio. Sci., 1(4) : 272-
281.
Jenkins, D. J.; Wolever, T. M. and Kalmusky, J. (1985). Low glycemic
index foods in the management of hyperlipidemia. Am. J. Clin.
Nutr., 42 : 604-617.
Kothari, A. C.; Sharma, M.; Kachhwaha, S. and Kothari, S. L. (2008).
Micronutrient optimization results into highly improved in vitro
plant regeneration in kodo (Paspalum scrobiculatum L.) and finger
(Eleusine coracana L.) Gaertn. millets. Plant Cell Tiss Organ
Cult., 94 : 105–112.
II
Kothari, S. L.; Agarwal, K. and Kumar, S. (2004). Inorganic nutrient
manipulation for highly improved in vitro plant regeneration in
finger millet–(Eleusine coracana L.) Gaertn. In Vitro Cell. Dev.
Biol.–Plant., 40(5) : 515–519.
Kumar, S.; Agarwal, K. and Kothari, S. L. (2001). In vitro induction and
enlargement of apical domes and formation of multiple shoots in
finger millet, (Eleusine coracana L.) Gaertn. and crowfoot grass,
(Eleusine indica L.) Gaertn. Curr. Sci., 81(11) : 1482-1485.
Latha, A. M.; Rao, K. V. and Reddy, V. D. (2005). Production of
transgenic plants resistant to leaf blast disease in finger millet
(Eleusine coracana L.) Gaertn. Plant Sci., 169 : 657-667.
Mannan, A.; Syed, T. N. and Mirza B. (2009). Factors affecting
Agrobacterium tumefaciens mediated transformation of Artemisia
absinthium L. Pak. J. Bot. 41(6) : 3239-3246.
Mondal, T. K.; Bhattacharya, A; Ahuja, P. S. and Chand, P. K. (2001).
Transgenic tea [(Camellia sinensis L.) O.kuntze cv. Kangar Ja]
plant obtained by Agrobacterium mediated transformation of
somatic embryos. Plant cell rep., 20 : 712-720.
Morel, G. (1960). Producing virus free cymbidiums. Amer. Orchid. Soc.
Bull., 29 : 595-497.
Murashige, T. (1974). Plant propagation through tissue culture. Annu.
Rev. Plant Physiol., 22 : 135-165.
Murashige, T. and Skoog F. (1962). A revised medium for rapid growth
and bioassays with tobacco tissue culture. Physiol Plant., 15 : 473-
497.
Nazim-Ud-Dowla1, M. A. N.; Ahmed, N. U. and Hassan, L. (2008).
Optimization of Agrobacterium-mediated genetic transformation in
indica Rice. Thai J. Agric. Sci., 41(3-4) : 127-133.
Nicholas J. T. (2003). On the trail of a cereal killer: Exploring the biology
of Magnaporthe grisea. Annu Rev Microbiol., 57 : 177–202.
III
Obilana, A. B.; Manyasa, E. O.; Kibuka, J. G. and Ajanga, S. (2002).
Finger millet blast samples collection in Kenya: passport data,
analyses of disease incidence and report of activities. ICRISAT.
Panse, V. G. and Sukhatme, P. V. (1985). Statistical analysis for
agricultural workers. ICAR, New Delhi.
Poddar, K.; Vishnoi, R. K. and Kothari, S. L. (1997). Plant regeneration
from embryogenic callus of finger millet (Eleusine coracana L.)
Gaertn. on higher concentrations of NH4NO3 as a replacement of
NAA in the medium. Plant Sci., 129 : 101–106.
Prasad, M. G.; Jaffar, S. K.; Ramu, A. and Kondala Rao, M. (2011).
Efficient regeneration protocol for ragi. IJSID., 1(2) : 283-287.
Radjacommare R.; Ramanathan A.; Kandan A.; Sible G. V. and
Samiyappan, R. (2004). Purification and anti-fungal activity of
chitinase against Pyricularia grisea in finger millet. World. J.
Microb. Biot., 20 : 251–256.
Rangan T. S. (1976). Growth and plant regeneration in tissue culture of
some Indian millets; Papsalum scorbiculatum (L.); (Eleusine
coracana L.) Gaertn. and Pennisetum typhoideum Pers.
Pflawzenphysiol., 78 : 208–216.
Rao, M. A.; Kumar, S. I.; Sekhar, N. P.; Reddy, P. S. and Polavarapu, R.
(2009). High frequency plant regeneration from callus cultures of
two finger millet (Eleusine coracana L.) cultivars. Curr. Trends.
Biotechnol. Pharm., 3(1) : 85-89.
Sambrook, J. and D, Russell. (2001). "Molecular Cloning: A Laboratory
Manual", 3rd edition. Cold Spring Harbor Laboratory Press. Cold
Spring Harbor, NY. 7.32.
Sambrook, J.; Fritch, E. F. and Maniatis, T. (1989). Molecular cloning a
laboratory manual, 2nd edn. cold spring harbor laboratory press,
cold spring harbor, NewYork.
VI
Sarker, S. R.; Hossain, M. and Shirin, F. (2009). Precise incubation
period for the Agrobacterium‐mediate transformation efficiency in
potato (Solanum tuberosum) cvs. Cardinal and Atlas. Plant Tiss
Cult. Biotech., 19(2) : 227‐235.
Sharavathy, M.; Urooj, A. and Puttaraj, S. (2001). Nutritionally important
starch fractions in cereal based indian food preparations. Food
Chem., 70 : 107-111.
Sharma, M. K.; Solanke, A. U.; Jani, D.; Singh, Y. and Sharma, A. K.
(2009). A simple and efficient Agrobacterium-mediated procedure
for transformation of tomato. J. Biosci., 34 : 423–433.
Sharma, M.; Kothari, A. C.; Chugh, S. J. and Kothari, S. L. (2011).
Factors influencing Agrobacterium tumefaciens-mediated genetic
transformation of (Eleusine coracana L.) Gaertn. Plant Cell Tiss
Organ Cult., 105 : 93–104.
Shrawat, A. K. and Lorz, H. (2006). Agrobacterium-mediated
transformation of cereals: a promising approach crossing barriers.
Plant Biotechnol J., 4 : 575–603.
Sivadas P.; Kothari S. L. and Chandra, N. (1990). High frequency
embryoid and plantlet formation from tissue culture of the finger
millet-(Eleusine coracana L.). Gaertn. Plant Cell Rep., 9 : 93–96.
Skoog, F. and Miller, C. O. (1957). Chemical regulation of growth and
organ formation in plant tissues cultivated in vitro. Sym Soc. Exp
Biol., 11 : 118-131.
Tylor, J. R.; Schober, T. J. and Bean, S. R. (2006). Novel food and non-
food uses for sorghum and millets. J. Cereal Sci., 44 : 252-271.
Upadhyaya, H. D.; Gowda, C. L.; Pundir, R. P.; Reddy, V. G. and Singh,
S. (2006). Development of core subset of finger millet germplasm
using geographical origin and data on 14 quantitative traits. Genet.
Resour. Crop Evol., 53 : 679-685.
V
Verma, V. and Patel, S. (2013). Production enhancement, nutritional
security and value added products of millets of bastar region of
Chhattisgarh. Int. J. Res. Chem. Environ., 2(3) : 102-106.
Werth, C. R.; Hilu, K. W. and Langner, C. A. (1994). Isozymes of
Eleucine (Gramineae) and the origin of finger millet. Am. J. Bot.,
81 : 1186-1190.
VI
APPENDIX-I
List of the instruments used for the study
Sr. No.
Name of the Instrument
Company’s name
1. Weighing balance Vibra , Japan
2. Laminar air flow Genetix, India
3. pH meter Analab, India
4. Spectrophotometer Shimadzu, Japan
5. Water bath LabTech, Korea
6. Electrophoresis unit Banglore Genei ,India
7. Power pack Wealtec corp., Taiwan
8. Micro-pipettes Eppendorf, Germany
9. Centrifuge Sigma, Germany
10. Rotatory shaking incubator Kuhner, Germany
11. Microwave oven LG Convection, India
12. UV Transilluminator Banglore Genei ,India
13. Gel documentation Biorad, USA
14. Deionised Water system Merck-Millipore,
Germany
15. Thermo Cyclers (PCR) Eppendorf, Germany
16. Dry bath Labnet, USA
17. Vertical autoclave Equitron, Mumbai
18. Laminar air flow Genetix, India
19. -80 oC Deep freeze LabTech, Korea
I
APPENDIX-II
Composition of Murashige and Skoog (1962) medium
Constituents Final concentration in medium in mg/l
(A) Macronutrients
NH4NO3 1650
KNO3 1900
MgSO4.7H2O 370
KH2PO4 170
(B) Micronutrients
H3BO3 6.20
KI 0.83
Na2MoO4.2H2O 0.25
COCl2.6H2O 0.025
MnSO4.4H2O 22.30
ZnSO4.7H2O 8.60
CuSO4.5H2O 0.025
(C) Iron Sources
FeSO4.7H2O 27.85
Na2EDTA 37.85
(D) CaCl2.2H2O 440
(E) Vitamins
Thiamine.HCl 0.1
Pyridoxine.HCl 0.5
Nicotinic acid 0.5
(F) Carbon Sources
Sucrose 30,000
Myo-inositol 100
Clerigel 2,250
II
III
II
APPENDIX-III
Finger millet seed germination medium
Sr.
No.
Components Concentration
1. MS (Macronutrients, Micronutrients,
Iron source) As per Appendix-II
2. B5 vitamins As per Appendix-II
3. Myo inositol 100 mg/l
4. Sucrose 30 g/l
5. MgCl2 0.750 g/l
6. Casien hydrosylate 0.3 g/l
7. L-Proline 0.5 g/l
8. 2,4-D (1 mg%) 25.5 ml
9. pH 5.80
IV III
APPENDIX-IV (a) & (b)
(a) YEB (yeast extract broth) Medium
Sr.
No.
Components Concentration g/l
1. Beef extract 10.0
2. Yeast extract 2.0
3. Peptone 10.0
4. MgSO4.7H2O 0.1
5. Sucrose 10.0
6. Agar 15.0
7. pH 7.2
(b) YEP (yeast extract peptone) Medium
Sr. No. Components Concentration g/l
1. Yeast extract 10
2. Peptone 10
3. NaCl 5
4. pH 7.2
V IV
APPENDIX-V
Media for induction of Agrobacterium tumefaciens.
Sr. No. Chemicals Concentration g/l
1. NH4Cl 1.0
2. MgSO4.7H2O 0.3
3. KCl 0.15
4. CaCl2 0.01
5. FeSO4.7H2O 0.0025
6. KH2PO4 0.272
7. MES* 0.390
8. Glucose 5.0
9. pH 7.2
MES* (2N morpholino ethane sulfonic acid)
APPENDIX-VI
Media for co-cultivation of Agrobacterium tumefaciens
Sr. No. Composition Concentration
10. MS (Macronutrients, Micronutrients,
Iron source)
As per Appendix-II
11. Vitamins As per Appendix-II
12. MES 193 mg/l
13. Glucose 2 %
14. pH 5.65
VI
V
C E R T I F I C A T E
This is to certi fy that I have no objection to
supply one copy of any part of this thesis at a t ime to any
scientist through reprographic process for rendering
reference services in a l ibrary or documentat ion centre.
Place : Navsari
Date : 06/11/2015 (Dabhi K. A.)