+ All Categories
Home > Documents > Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic...

Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic...

Date post: 02-Jan-2016
Category:
Upload: cori-spencer
View: 227 times
Download: 0 times
Share this document with a friend
Popular Tags:
13
Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms? Gene libraries/Genetic testing Genetically-modified crops and livestock Protein-producing bacteria Gene therapy
Transcript
Page 1: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

Transgenic Organisms•What is DNA?

•What do genes do?

•What are restriction enzymes?

•How are transgenic organisms made?

•What can be done with transgenic organisms?

•Gene libraries/Genetic testing

•Genetically-modified crops and livestock

•Protein-producing bacteria

•Gene therapy

Page 2: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What is DNA?

•The cell’s nucleus contains chromosomes (46 chromosomes in human cells).

•Each chromosome is a molecule of DNA.

•Each molecule of DNA is like a cookbook of protein recipes.

•The recipes are written using a four-nucleotide (four letter) alphabet.

•DNA is double-stranded. Each recipe is on one strand (the other strand is like a back-up).

Page 3: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What is do genes do?

2 Alpha Chains (141 amino acids each)2 Beta Chains (146 amino acids each)

Normal Hemoglobin

2 Alpha Chains (141 amino acids each)2 Beta Chains (145 normal amino acids, 1 changed amino acid)

Valine instead of Glutamate

Sickle-Cell Hemoglobin

•If a chromosome is a cookbook, each gene is one protein recipe within that cookbook.

•Small changes in a recipe can lead to big changes in the protein that is produced.

•A change of one nucleotide out of around 900 nucleotides changes the hemoglobin protein from normal to the sickle-cell form! (That’s like one typo in a 3-page paper).

Page 4: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What are Restriction Enzymes?

5’ AACTGAATTCCGGATCCGACTAGAATTCATCT 3’

3’ TTGACTTAAGGCCTAGGCTGATCTTAAGTAGA 5’

• DNA is double-stranded. The nucleotides in the two strands are complementary: A pairs with T and G pairs with C.

• Enzymes, made by bacteria, that recognize specific DNA nucleotide sequences, and make single-stranded cuts in the DNA.

EcoRI

Recognizes GAATTC

BamHIRecogniz

es GGATCC

Page 5: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

Restriction Enzymes: EcoRI as an example• There are dozens of restriction enzymes now available. Each has a unique recognition sequence and cut site.

• There are two EcoRI recognition sites in the DNA sequence that is shown.

• The EcoRI recognition sequence is a palindrome (the sequence is5’ GAATTC 3’ on both strands).

EcoRI

Recognizes GAATTC

BamHIRecogniz

es GGATCC

5’ AACTGAATTCCGGATCCGACTAGAATTCATCT 3’

3’ TTGACTTAAGGCCTAGGCTGATCTTAAGTAGA 5’

Page 6: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

Restriction Enzyme: EcoRI Active Site• The EcoRI active site binds to DNA where ever 5’ GAATTC 3’ occurs. This works with any DNA.

EcoRI

Recognizes GAATTC

BamHIRecogniz

es GGATCC

5’ AACTGAATTCCGGATCCGACTAGAATTCATCT 3’

3’ TTGACTTAAGGCCTAGGCTGATCTTAAGTAGA 5’

EcoRI EcoRI

EcoRIEcoRI

Page 7: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

Restriction Enzymes: EcoRI Endonuclease Activity

• EcoRI cuts the sugar-phosphate backbone between the G and A in the regognition sequence GAATC.

• The cuts in the two strands are off-set from one another. This leaves short single-stranded ends. The ends are called sticky ends because they will stick to each other (they have complementary sequence).

EcoRI

Recognizes GAATTC

BamHIRecogniz

es GGATCC

AATTCA

TCT

GT

AGA

AACTG

TTGACT

TAA

AATTCCGGATCCGACTAG GGCCTAGGCTGATCTTAA

Page 8: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

How are transgenic organisms made?• Plasmids are collected from bacteria. Plasmids are small bits of DNA that can be taken up and given off by bacteria. They can be used as vectors for getting foreign DNA into bacteria.

• Plasmid DNA is collected and cut with a restriction enzyme.

• DNA of interest (like human DNA) is collected and cut with the same restriction enzyme. This results in human DNA and plasmid DNA having complementary sticky ends.

• Human DNA and plasmid DNA is mixed together and their sticky ends will bind with one another to form recombinant plasmids.

• Recombinant plasmids are then mixed with, and taken up by, bacterial cells. This creates recombinant (or transgenic or genetically-modified) organisms.

• The same process can be used to make other types of transgenic organisms as long as we have an appropriate vector.

Page 9: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

Single-Gene versus Multifactorial Traits

If all traits were determined by single genes, this is how the world would look. Thankfully, that’s not how life is.

We can only modify single genes. Thus, we only have ability to alter a very limited array of genetic traits.

Most complex traits are influenced by many genes and many environmental factors. We call these multifactorial traits. These account for the amazing variation we see among organisms in the world.

Page 10: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What can be done with transgenic organisms: Gene Libraries/Genetic

Tests• Each of the genes of an organism can be inserted into a different transgenic bacterium. These can be maintained in their own cultures.

• The entire collection of these transgenic bacterial strains is called a gene library.

• Suppose you want to be tested to see if you carry BRCA1 (one of the major genes involved in familial breast cancer).

• Your DNA can be collected. We can then take the BRCA1 gene from the human gene library and see if it sticks to your DNA.• The BRCA1 gene will stick if your DNA has complementary sequence to the BRCA1 gene. If that is the case, you must carry the BRCA1 gene.

• In theory, we can do this with any other gene in our gene library (in practice, not all of those genetic tests has yet been developed).

Page 11: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What can be done with transgenic organisms: Genetically-Modified

Crops and LivestockWhat type of crops and livestock have been genetically

modified?Plants: Corn and Soy (Bt-Producing, Roundup

Resistant)Tomato (Slow ripening)Strawberries (Frost-resistant)Bananas (Hepatitis B antigen)

Animals: Cows (Bovine Growth Hormone)Sheep (Fibrinogen production)Chicken (Avian Flu Resistance)

Controversies (http://www.ornl.gov/sci/techresources/Human_Genome/

elsi/gmfood.shtml) * Safety * Access and Intellectual Property * Ethics * Labeling * Society

Page 12: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What can be done with transgenic organisms: Protein-Producing

BacteriaGenetically-modified bacteria are now grown in mass cultures to produce human proteins. This is possible because bacteria read the genetic code in identical ways to humans (and other organisms).

Human proteins produced by bacteria:Insulin Human Growth HormoneBlood Clotting FactorsErythropoietinInterferon

Page 13: Transgenic Organisms What is DNA? What do genes do? What are restriction enzymes? How are transgenic organisms made? What can be done with transgenic organisms?

What can be done with transgenic organisms: Gene Therapy

Person with a single gene mutation that

causes a health disorder

Good copy of human gene from a donor

Harmless virus genetically modified to contain good copy of human

gene.

Sick person’s cells

intentionally infected with genetically

modified virus.

Viral DNA (including good human gene)

integrates into sick person’s chromosome.

Sick person’s cells begin to

produce functional protein.

Sick person is CURED!


Recommended