Tumor Cell–Derived IL1b Promotes Desmoplasia andImmune Suppression in Pancreatic CancerShipra Das, Beny Shapiro, Emily A. Vucic, Sandra Vogt, and Dafna Bar-Sagi
ABSTRACT◥
Pancreatic ductal adenocarcinoma (PDA) is an aggressivemalignancy typified by a highly stromal and weakly immuno-genic tumor microenvironment that promotes tumor evolutionand contributes to therapeutic resistance. Here, we demonstratethat PDA tumor cell–derived proinflammatory cytokine IL1b isessential for the establishment of the protumorigenic PDAmicroenvironment. Tumor cell–derived IL1b promoted theactivation and secretory phenotype of quiescent pancreaticstellate cells and established an immunosuppressive milieumediated by M2 macrophages, myeloid-derived suppressor cells,CD1dhiCD5þ regulatory B cells, and Th17 cells. Loss of tumorcell–derived IL1 signaling in tumor stroma enabled intratumoralinfiltration and activation of CD8þ cytotoxic T cells, attenuatedgrowth of pancreatic neoplasia, and conferred survival advan-tage to PDA-bearing mice. Accordingly, antibody-mediated
neutralization of IL1b significantly enhanced the antitumoractivity of a-PD-1 and was accompanied by increased tumorinfiltration of CD8þ T cells. Tumor cell expression of IL1bin vivo was driven by microbial-dependent activation of toll-likereceptor 4 (TLR4) signaling and subsequent engagement of theNLRP3 inflammasome. Collectively, these findings identify ahitherto unappreciated role for tumor cell–derived IL1b inorchestrating an immune-modulatory program that supportspancreatic tumorigenesis.
Significance: These findings identify a new modality forimmune evasion in PDA that depends on IL1b production bytumor cells through TLR4-NLRP3 inflammasome activation.Targeting this axis might provide an effective PDA therapeuticstrategy.
IntroductionPancreatic ductal adenocarcinoma (PDA) is a highly lethal malig-
nancy with a mortality rate approaching the rate of incidence (1). Inaddition to lack of efficient early diagnosis methods, disease survival iscompromised by resistance to conventional chemotherapy and immu-notherapeutic strategies that are proving effective in the treatment ofother cancers (2, 3). It is becoming increasingly recognized that thisrecalcitrance is largely attributable to an elaborate network of tumor–stromal interactions that are orchestrated by paracrine factors releasedby the tumor epithelium, activated fibroblasts, and immune cells (4, 5).Identification and functional characterization of such factors, and theprocesses they control, is therefore an essential prerequisite for rationaldevelopment of strategies that can circumvent therapeutic barriers andimprove immune responsiveness of PDA tumors.
The cytokine IL1b is an inflammatory mediator that is frequentlyupregulated in a variety of cancers and its production is associatedwithpoor prognosis (6, 7). Upregulation of either IL1B expression orposttranslational processing in head and neck squamous carcinoma,breast cancer, lung cancer, and melanoma results in increased tumorinfiltration of immunosuppressive macrophages and myeloid-derived
suppressor cells (MDSC), thereby promoting immune evasion andtumor development (8–10). Other protumorigenic effects of IL1b havebeen attributed to the induction of neoangiogenesis (11) and theregulation of expression in stromal cells of soluble mediators thatenhance tumor cell survival and metastasis (7). These effects aremediated by IL1b-dependent signaling cascades that under conditionsof IL1b overabundance result in the sustained activation of NFkB andMAPK pathways (6).
Several lines of evidence suggest a role for IL1b in pancreaticcancer development and progression. Increased pancreatic levels ofIL1b are observed in association with pancreatitis, a well-established PDA risk factor (12). High intratumoral and serumIL1b levels in patients with pancreatic cancer correlate with pooroverall survival and increased chemoresistance (13–15). In mousemodels of PDA, adipocyte-secreted IL1b is found to promoteobesity-induced pancreatic carcinogenesis and drug resistancethrough recruitment of tumor-associated neutrophils (16). In addi-tion, regulatory pathways that control IL1b production in PDA-associated myeloid cells have been reported to support tumorprogression by promoting immune tolerance (17, 18). Overall,several lines of evidence suggest a heterotypic distribution of IL1bexpression in PDA with implications in disease pathogenesis. Thus,in this study, we sought to elucidate the mechanisms underlying theregulation and function of IL1b in PDA, with an eye on assessing itspotential as a therapeutic target.
Here, we identify the tumor cell compartment as a prominentsource of IL1b production in human and mouse PDA throughactivation of the TLR4–NLRP3 inflammasome signaling pathway.Targeted depletion of IL1b in established mouse models demonstratesacute dependency of pancreatic cancer evolution on tumor cell–derived IL1b through protumorigenic modulation of the stroma andimmune microenvironment. Overall, our study identifies IL1b as anattractive target that may improve PDA response to therapeuticstrategies, including immunotherapy.
Department of Biochemistry and Molecular Pharmacology, New York UniversityGrossman School of Medicine, New York, New York.
Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).
Corresponding Author: Dafna Bar-Sagi, New York University Grossman Schoolof Medicine, 530 First Avenue, Executive Offices— HCC 15th Floor, New York, NY10016. Phone: 212-263-2095; Fax: 646-501-6721; E-mail:[email protected]
All mouse protocols were reviewed and approved by the Institu-tional Animal Care and Use Committee of the New York University(NYU) Grossman School of Medicine (New York, NY). The LSL-KrasG12D/þ, LSL-Trp53R172H/þ, and p48Cre/þ mice strains have beendescribed previously (19, 20). Eight- to 10-week-old wild-type (WT)C57BL/6 (stock 027) mice were purchased from The Charles RiverLaboratories. Eight- to 10-week-old IL1r1�/� (stock # 003245) micewere purchased from The Jackson Laboratories. All mice were on aC57BL/6 genetic background. Female mice were used for orthotopicinjections ofKRasG12D-PDECandKPC cells (21, 22). Briefly,micewereanesthetized using a ketamine (100 mg/kg)/Xylazine (10 mg/kg)cocktail administered via intraperitoneal injection. After making asmall incision on the left abdominal wall, either 106 KRasG12D-PDECor 5� 104KPC cells in ice-cold PBSmixed at 1:1 dilutionwithMatrigel(#354234, Corning) in a volume of 50 mL were injected into the tail ofthe pancreas using a 28-gauge needle. For pancreatic stellate cell (PSC)coimplantation experiments, 106 KRasG12D-PDEC cells and 105 PSCswere mixed in 50 mL of ice-cold PBS: Matrigel (1:1) and injected intothe tail of the pancreas using a 28-gauge needle. The incisionwas closedusing 5-0 Vicryl RAPIDE sutures (Ethicon) for the body-wall and 4-0PROLENE sutures (Ethicon) for the skin. All animals were givenbuprenorphine (0.1 mg/kg) for pain relief directly after surgery andonce a day for three days postsurgery. Mice were euthanized by carbondioxide–induced narcosis 2 weeks postimplantation of KRasG12D-PDEC. For KPC cells, mice were euthanized 2 weeks and 4 weekspostimplantation for flow cytometry analysis and tumor volumeassessment, respectively. KPC tumors were measured using digitalcaliper (VWR) at the endpoint and tumor volumewas calculated usingthe formula pLW2/6.
Anti-PD-1, anti-IL1b treatment, and CD8þ depletionMice were orthotopically injected into the pancreas with 5 � 104
KPC cells. On day 7 postinjection, mice were intraperitoneally admin-istered either 10 mg/kg anti-PD-1 (Novartis), 10 mg/kg anti-IL1b(Novartis), or IgG control (Novartis) antibody diluted in 200 mL ofsterile PBS. Thereafter, anti-PD-1 antibody was administered on days9, 11, and 16 and anti-IL1b was administered every 2 days. For CD8þ
T-cell depletion, 200mg of anti-CD8 (BioXCell, clone 53-6.7) or an IgGisotype control antibody (BioXCell, clone 2A3) diluted in 200 mL ofsterile PBS were administered intraperitoneally daily starting 3 daysprior to tumor cell injection and every 5 days after tumor cell injection.Efficiency of CD8þ T-cell depletion was assessed by flow cytometry.
Murine bacterial depletionMouse gut microbiota depletion was performed as described
previously (23). Briefly, 6-week-old WT mice were administered0.2 mL of 0.1 mg/mL amphotericin-B (Sigma) by oral gavage every12 hours for 3 days. Subsequently, water flasks were supplementedwith 1g/L ampicillin (Fisher Bioreagents) and antibiotic cocktailcontaining 0.2 mL of 5 mg/mL vancomycin (Cayman ChemicalCompany), 10 mg/mL neomycin (Sigma), and 10 mg/mL metroni-dazole (Sigma) was administered by oral gavage once a day for 2 weekspresurgery and then for the duration of the experiment. Fresh anti-biotic cocktail was mixed every day and ampicillin and water wasrenewed every seventh day. To assay for microbial depletion, fecalpellets were collected from mice at day 0 and day 14 of antibiotictreatment. DNA was isolated from fecal pellets with QIAamp DNAStool Mini Kit (Qiagen) as per manufacturer's instructions. Bacterial
16S DNA gene quantification was assessed by quantitative PCR asdescribed previously (24).
Cell linesIsolation, culture, and adenoviral infection of PDEC were carried
out as described previously (21). The KPC cell line (line 4662) was akind gift from Dr. R.H. Vonderheide. The immortalized PSC cell linewas a kind gift from Dr. A.C. Kimmelman. Isolation and culture ofprimary PSCs was carried out as described previously (25). Celllines were not authenticated and were tested for Mycoplasma con-tamination every 4 months. Scramble control and shRNAs againstIl1b, Nlrp3, and Tlr4 were cloned into the lentiviral pLKO.1 hygrovector obtained from Addgene (#24150). shRNA sequences used wereas follows—scramble: GCGACATCCTCATCTCGTTAGTA; IL1b-sh1: GTGGTCAGGACATAATTGACTTC, IL1b-sh2: GCAGCACA-TCAACAAGAGCTTCA; NLRP3-sh1: AGCCTGAGCTGACTATA-GTCTTC, NLRP3-sh2: CTTGAAGATGTGGACCTCAAGAA;TLR4-sh1: GCCAATCCTAAGAATGCTATA. Lentiviral particleswere generated by transfecting HEK-293T cells with the pLKO.1vector, the packaging construct (psPAX2), and the envelope plasmid(pMD2G). Supernatants containing viral particles were collected overa period of 48 hours and stored at 4�C. Following final collection,supernatants were filtered through a 0.45-mm syringe filter andconcentrated using 100 MWCO Amicon Ultra centrifugal filters(Millipore). A multiplicity of infection of 15 was used for lentiviralinfection of KRasG12D-PDEC or KPC cells in the presence of 10 mg/mLpolybrene (Chemicon) and infected cells were selected using150 mg/mL hygromycin (Sigma).
Human data generation130 human PDA tumor (n ¼ 75) and adjacent normal (Adj Norm;
n ¼ 55) mRNA expression profiles generated on the same array(Affymetrix GeneChip Human Genome U133 Plus 2.0) were down-loaded from GEO (https://www.ncbi.nlm.nih.gov/geo/; GSE15471,GSE16515). Adj Norm samples clustering with PDA tumors, PDAtumor profiles clustering with subsets of Adj Norm samples, andduplicates were discarded (as described previously; ref. 26), for aremainder of n ¼ 74 tissues (n ¼ 50 PDA tumor and n ¼ 24 AdjNorm). Raw data were processed and normalized in one batch using aGC-content background correction robustmulti-array average (RMA)algorithm (GC-RMA), performed in R: A language and environmentfor statistical computing. Unpaired Student t tests were generated inGraphPad Prism (GraphPad Software; www.graphpad.com).
Human pancreas specimensFor the purposes of analyzing IL1B, NLRP3, and TLR4 expression
patterns, we examined 8–10 patient PDA lesions and correspondingadjacent normal tissue samples. Samples consisted of 5-mm sectionsthat were cut from formalin-fixed, paraffin embedded blocks providedby the Center for Biospecimen Research and Development at NYULangone Health. This study was conducted in accordance with theDeclaration of Helsinki; all samples were anonymized prior to beingtransferred to the investigator's laboratory and therefore met exempthuman subject research criteria.
Histology and IHCMouse pancreata were fixed in 10% buffered formalin (Thermo
Fisher Scientific) overnight and embedded in paraffin as describedearlier (21). Trichrome staining was performed at NYU GrossmanSchool of Medicine Histopathology Core Facility. For IHC, depar-affinized sections (6 mm) were rehydrated, quenched in 2%
IL1b Promotes Immune Suppression in Pancreatic Cancer
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1089
hydrogen peroxide/methanol for 15 minutes, and antigen retrievalwas performed in 10 mmol/L sodium citrate/0.05% Tween-20 (pH6.0) for 15 minutes in a microwave oven. Blocking was done in 10%serum/1% BSA/0.5% Tween-20 for 1 hour at room temperature,followed by incubation with the primary antibodies diluted in 2%BSA overnight at 4�C. Primary antibodies are detailed in Supple-mentary Data. After incubating with secondary biotinylatedantibodies and ABC solution (both from Vector Laboratories),sections were developed with DAB peroxidase substrate kit (VectorLaboratories) according to the manufacturer's instructions. Aftercounterstaining with Harris hematoxylin (Sigma), slides were sub-jected to an alcohol dehydration series and mounted with Permount(Thermo Fisher Scientific). Slides were examined on a NikonEclipse 80i microscope and images were analyzed to measurestained area using ImageJ software.
ImmunofluorescenceFormalin-fixed, paraffin-embedded sections were deparaffinized
and rehydrated, permeabilized with TBS/0.1% Tween-20, and washedin PBS. Citrate buffer antigen retrieval (10 mmol/L sodium citrate/0.05% Tween-20, pH 6.0) was performed in a microwave for 15minutes. Blocking was performed in 10% serum/1% BSA/0.5%Tween-20/PBS for 1 hour at room temperature. Primary antibodieswere diluted in 2% BSA/0.5% Tween-20/PBS and incubated on sec-tions overnight at 4�C. Primary antibodies are detailed in Supple-mentary Data. Secondary antibodies (Alexa Fluor–labeled; 1:1,000,Invitrogen)were diluted in 2%BSA/PBS, and incubated on sections for1 hour at room temperature. Sections were washed with PBS andstained with DAPI. Slides were examined and imaged on a NikonEclipse Ti2 microscope.
Flow cytometrySingle-cell suspensions were prepared from pancreas as described
previously (27). For isolation of tumor-infiltrating lymphocytes,tumor tissue was minced into 1 to 2 mm pieces and digested withcollagenase IV (1.25 mg/mL, Worthington) and 0.1% trypsin inhib-itor from soybean (Sigma), in complete RPMI for 25 minutes at37�C. For isolation and FACS analysis of epithelial and fibroblastcompartments, minced tumor tissue was digested with Pronase(0.2 mg/mL, Roche), Collagenase P (0.5 mg/mL, Roche), and DNaseI (0.5 mg/mL, Roche). Cells were suspended in 1%FBS/PBS,passed through a 70-mm strainer and treated with RBC lysis buffer(eBiosciences). Single-cell suspensions were blocked with anti-CD16/CD32 antibody (Fc Block, BD Biosciences) for 5 minuteson ice and labeled with mAbs against mouse antigens as detailed inSupplementary Data. All samples were acquired on LSR II (BDBiosciences) at NYU Flow Cytometry Core Facility and analyzed byFlowJo version 10.2 (TreeStar, Inc.). Cell sorting using a BD FACSARIA II sorter was performed to isolate Ep-CAMþ cells, CD140aþ
fibroblasts and CD45þ cells, and >95% purity of sorted cells wasachieved.
Quantitative RT-PCRFor RNA isolation from tumors, pancreata processed to
single-cell suspension were stained for flow cytometry.CD45�CD34�CD140aþEp-CAM�
fibroblasts were FACS sortedusing a 100-mm nozzle into the lysing reagent RLT and total RNAwas extracted as per the manufacturer's instructions (RNeasy MiniKit, Qiagen). To check knockdown in KRasG12D-PDEC and KPCcells, 105 cells were lysed in 350 mL RLT reagent and total RNA wasextracted as per the manufacturer's instructions (RNeasy Mini Kit,
Qiagen). Total RNA (1 mg) was reverse-transcribed using theQuantitect Reverse Transcription Kit (Qiagen). Subsequently, spe-cific transcripts were amplified by SYBR Green PCR Master Mix(USB) using a Stratagene Mx 3005P thermocycler. Where foldexpression is specified, comparative Ct method was used to quantifygene expression. Expression was normalized to GAPDH. Primersused for qPCR are detailed in Supplementary Data.
Supernatant collection and cytokine analysisFor cytokine analysis of mouse pancreata, the tissues were har-
vested, minced with a sterile razor blade, and incubated in 500 mL ofcomplete media for 24 hours before supernatant collection. MouseIL1b protein levels were determined byMouse IL1bQuantikine ELISAKit (R&D Systems) as per manufacturer's instructions.
Statistical analysisAt least 7 to 15 mice were used in each group, and the experiments
were repeated a minimum of two times to validate reproducibility.Group means were compared with Student t tests. Significance invariations between two groupswas determined by an unpaired Studentt test (two-tailed). Statistical analyses were performed using GraphPadPrism software (version 7.0d), and data are presented as mean � SD.P < 0.05 was considered statistically significant.
To assess IL1b production in PDA, we first examined microarraydata from 50 PDA patient tumors and 24 adjacent normal tissuesamples. Our analysis revealed significant upregulation of IL1b expres-sion in PDA tumors relative to normal adjacent pancreatic tissue(Fig. 1A). We next assessed the distribution pattern of IL1b by IHCstaining of tumor sections from patient PDA samples. Consistent withprevious reports documenting the expression of IL1b by innateimmune cells and fibroblasts (15, 16, 18), robust IL1b staining wasdetected in the tumor stroma (Supplementary Fig. S1A). However,unexpectedly, we also observed significant IL1b staining in theductal epithelium (Fig. 1B). Similarly, robust expression of IL1bin the CK8þ epithelial tumor cell compartment was revealed byimmunofluorescence staining of pancreata from the slowly pro-gressive KrasG12D; p48Cre (KC) mouse model of pancreatic neopla-sia (19) and the KrasG12D;p53R172H;p48Cre (KPC) invasive PDAmouse model (Fig. 1C and D; Supplementary Fig. S1B; ref. 20).The relative levels of IL1b production by stromal (CD140aþ
fibroblasts and CD45þ immune cells) and tumor cells (EpCAMþ
epithelium) from KC mice was further analyzed by flow cytometry(Fig. 1E; Supplementary Fig. S1C). In agreement with the IHC data,the epithelial compartment displayed the highest levels of IL1bproduction (Fig. 1E).
Next we sought to investigate the functional significance of tumorcell–derived IL1b. Utilizing a RNAi strategy, two independent shorthairpin (sh) sequences targeting IL1B were introduced intopancreatic ductal epithelial cells derived from either KrasG12D mice(KRasG12D-PDEC) or KrasG12D;Trp53R172H;p48Cre mice (KPC;refs. 21, 22). Knockdown efficiency was ascertained by qPCR andimmunofluorescence staining (Supplementary Fig. S1D–S1F). Ortho-topic injection of IL1b-shKRasG12D-PDEC into pancreata of syngeneicmice led to grafts that displayed a significant reduction of CK8þ
pancreatic intraepithelial neoplasia (PanIN)-like lesions, relative toscramble control (Fig. 1F; Supplementary Fig. S1G). A role for tumorcell–derived IL1b was also evident in the context of more advanced
Das et al.
Cancer Res; 80(5) March 1, 2020 CANCER RESEARCH1090
Tumor cell–derived IL1b is required for pancreatic oncogenesis.A,mRNA transcript levels of IL1b in PDA comparedwith normal adjacent tissue frompublicly availablehuman transcriptomic data (74 patient samples, n ¼ 50 PDA and n ¼ 24 adjacent normal). Each data point indicates an individual tissue sample. Error bars, SD;P-values determinedby theStudent t test (two-tailed, unpaired).B,Representative IHCdetectionof IL1bexpression in sections fromhumanPDAandadjacent normaltissues (n¼ 10 patient samples). C, Representative immunofluorescence detection of IL1b expression on a section from a 4-month-old KCmouse pancreas (N¼ 12;CK8, red; IL1b, green; DAPI, blue).D,Representative immunofluorescence detection of IL1b expression on a section froma2-month-oldKPCmousepancreas (N¼8 at2–4 months; CK8, red; IL1b, green; DAPI, blue). E, Quantification of flow cytometric analysis of distribution of IL1b expression in epithelial (EpCAMþ), fibroblast(CD140aþ), and immune (CD45þ) cells sorted from pancreata of 1- to 2month-old KCmice (N¼ 7). Error bars, SD. F,Graph indicates quantification of percentage ofCK8þ signal per lesion from IHC staining with CK8 antibody on sections of orthotopic pancreatic grafts 2 weeks after implantation of KRasG12D-PDEC expressingscrambled shRNA (scr-sh) control or IL1b shRNAs (IL1b-sh1 and IL1b-sh2) in wild-type (WT)mice (N¼ 8–9). Error bars, SD; P values determined by the Student t test(two-tailed, unpaired). Data representative of three independent experiments. G, Representative tumors 4 weeks after orthotopic implantation of KPC cellsexpressing scrambled shRNA (scr-sh) or IL1b shRNA (IL1b-sh) in pancreata of WT mice. H, Graph represents quantification of G, indicating tumor volume (N ¼ 15).Error bars, SD; P values determined by the Student t test (two-tailed, unpaired). Data representative of three independent experiments. I, Kaplan–Meier curve forsurvival analysis of mice bearing pancreatic tumors derived from orthotopically implanted scr-sh or IL1b-sh KPC cells (N¼ 8). P values determined by the Student ttest (two-tailed, unpaired). Data representative of two independent experiments. ***, P < 0.001; ****, P < 0.0001.
IL1b Promotes Immune Suppression in Pancreatic Cancer
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1091
Tumor cell–derived IL1b promotes immune suppression in the pancreatic tumor microenvironment. A–C, Representative flow cytometry plots (top) andquantification (bottom) from orthotopic pancreatic grafts of scr-sh or IL1b-sh KRasG12D-PDEC in WT mice 2 weeks postimplantation analyzing CD11bþF4/80þ
tumor-associated macrophages (A), CD11bþGr1þ MDSCs (B), and CD11bþLy6Gþ tumor-associated neutrophil populations (C). For A–C, graphs indicate immunesubpopulations as a percentage of CD45þ cells (N¼ 5–8). Error bars, SD.P values determined by the Student t test (two-tailed, unpaired). Data representative of twoindependent experiments. D–F, Representative flow cytometry plots (top) and quantification (bottom) from orthotopic pancreatic grafts of scr-sh or IL1b-shKRasG12D-PDEC inWTmice 2weeks postimplantation analyzing CD5þ regulatory B (Breg) cells measured as a percentage of total CD19þCD1dhi B cells (N¼ 6;D) andRORgtþ TH17 cells measured as a percentage of total CD4þ Th cells (N¼ 8–9; E). F, CD206þ M2-polarized macrophages measured as a percentage of total stromalmacrophages (N¼ 5–6). Data representative of two (D and E) or three (F) independent experiments. For D–F, error bars, SD; P values determined by the Student ttest (two-tailed, unpaired).G, IHCdetection ofCD8þTc cells on sections of scr-sh and IL1b-shKRasG12D-PDECgrafts inWTmice, 2weeks postorthotopic implantation.Representative images are shown. Graph depicts quantification of IHC, indicating the average percentage of CD8þ cells per field of view (FOV) of the implant (4–610� FOV per animal, N¼ 5). Error bars, SD; P values determined by the Student t test (two-tailed, unpaired). Data representative of two independent experiments.Representative flow cytometry plots and quantification (right) from orthotopic pancreatic grafts of scr-sh or IL1b-sh KRasG12D-PDEC in WT mice 2 weekspostimplantation analyzing activated cytotoxic CD8þ T cells (Tc) asmeasured by IFNg (H) and granzymeB (GzmB; I) expression. Quantification of IFNgþ andGzmBþ
cells is represented as a percentage of total CD8þ Tc cells (N ¼ 5–7). Error bars, SD. P-values determined by the Student t test (two-tailed, unpaired). Datarepresentative of two independent experiments. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.
Das et al.
Cancer Res; 80(5) March 1, 2020 CANCER RESEARCH1092
lesions, with IL1b-depleted KPC cells forming significantly smallertumors upon orthotopic implantation (Fig. 1G and H). Furthermore,IL1b knockdown increased the survival of mice bearing orthotopicKPC tumors (Fig. 1I). Overall, these results establish a prooncogenicrole for tumor cell–derived IL1b in pancreatic cancer.
Tumor cell–derived IL1b induces a tolerogenic immune state inthe PanIN microenvironment
Given the well-established role of IL1b as an inflammatory medi-ator, we tested whether tumor cell–derived IL1b promotes pancreaticoncogenesis through its interactions with the tumor microenviron-ment (TME) by implanting KRasG12D-PDEC or KPC cells into thepancreas of Il1b receptor (Il1r1) null mice (28). Absence of IL1bsignaling in the pancreatic stroma phenocopied the depletion of
tumor cell–derived IL1b, with reduced growth of orthotopicKRasG12D-PDEC grafts and KPC tumors in IL1r1-null mice relativeto wild-type control (Supplementary Fig. S1H–S1K). In addition, theoverall survival of KPC cell–implanted animals was extended inIL1r1-null mice, relative to wild-type control (SupplementaryFig. S1L). Notably, surface expression of IL1R1 is nearly undetectablein KrasG12D-PDEC cells (Supplementary Fig. S1M). These observa-tions suggest a paracrine role for tumor cell–derived IL1b and there-fore prompted us to investigate the fibro-inflammatory effects oftumor cell–derived IL1b on the TME.
Flow cytometric analysis of pancreatic grafts formed by IL1b-shKRasG12D-PDEC revealed a pronounced alteration of the TMEimmune landscape, relative to the scramble control. Specifically,depletion of tumor cell–derived IL1b significantly decreased stromal
scr-
shIL
1β-s
h1IL
1β-s
h2
αSMAA Vimentin
scr-sh IL1β-sh
B KPC-scr-sh KPC-IL1β-sh
C
mR
NA
Fold
cha
nge
CK
8αS
MA
DA
PI
scr-
shIL
1β-s
hIL
1β-s
h+C
AF
CK8 αSMA DAPID E
F4/8
0+ CD
11b+
(%C
D45
+ cel
ls)
CD
206+
(% F
4/80
+ CD
11b+ )
F
CD
8; 2
0X
scr-sh
0
10
20
30
0
2040
6080
100
G
H
0100200300400
CD
8+ Tc C
ells
/FO
V 500
scr-sh
0.0
0.5
1.0
1.5
IL1β-sh IL1β-sh+CAF****
****
**
**NS
****
*
0
10
20
30
IFN
γ+
(%C
D8+ )
***
F4/8
0
CD11b
scr-sh IL1β-sh IL1β-sh+CAF18.50 4.53 14.80
scr-sh
CD206
85.90 51.50 83.80FSC
-H
5.8223.303.96
scr-sh
IFNγ
FSC
-H
IL1β-sh
IL1β-sh
IL1β-sh+CAF
IL1β-sh+CAF
* * * * ** *****
Ccl2 Ccl5 Ccl8 Ccl12 Il6 Il1α Cxcl12
IL1β-sh IL1β-sh +CAF
IL1β-sh IL1β-sh +CAF
IL1β-sh IL1β-sh +CAF
IL1β-sh IL1β-sh +CAF
scr-sh
scr-sh
scr-sh
Figure 3.
Tumor cell–derived IL1b regulates PSC activationand inflammatory functions. A, IHC detection ofaSMAand vimentin expressionon sections of scr-sh and IL1b-sh KRasG12D-PDEC grafts in WT mice,2 weeks postorthotopic implantation (N ¼ 7).Representative images are shown. B, Immuno-fluorescence detection of aSMA expression onsections of scr-sh and IL1b-sh KPC tumors in WTmice, 4 weeks postorthotopic implantation (N ¼10; CK8, red; aSMA, green; DAPI, blue). Repre-sentative images are shown.C, Levels of cytokinemRNA in CD140aþ CAFs sorted from scr-sh orIL1b-shKRasG12D-PDECgrafts inWTmice, 2weekspostorthotopic implantation (N¼ 9), analyzed byquantitative PCR. Results show mean � SD ofthree biological replicates, each with three tech-nical replicates. P values determined by Student ttest (two-tailed, unpaired). D, Immunofluores-cence detection of aSMA expression on sectionsof orthotopic pancreatic grafts of scr-sh, IL1b-shKRasG12D-PDEC, and IL1b-sh KRasG12D-PDECcoimplanted with CAFs in WT mice, 2 weekspostimplantation (N ¼ 7; CK8, red; aSMA, green;DAPI, blue). Representative images are shown.E–G, Representative flow cytometry plots (left)and quantification (right) from orthotopic pan-creatic grafts 2weeks after implantationof scr-sh,IL1b-sh KRasG12D-PDEC, and IL1b-sh KRasG12D-PDEC coimplanted with CAFs of CD11bþF4/80þ
macrophages measured as a percentage of totalCD45þ cells (N ¼ 7; E), CD206þ M2–polarizedmacrophages measured as a percentage of totalstromal macrophages (N ¼ 7; F), and activatedcytotoxic CD8þT cellsmeasuredby IFNgþ cells asa percentage of total CD8þ Tc cells (N¼ 7;G). ForE–G, error bars, SD; P values determined by theStudent t test (two-tailed, unpaired). Data rep-resentative of two independent experiments.H, IHC detection of CD8þ T cells on sections ofpancreatic grafts of scr-sh, IL1b-sh KRasG12D-PDEC, and IL1b-sh KRasG12D-PDEC coimplantedCAFs, 2 weeks postorthotopic implantation (N ¼7). Representative images are shown. Graphdepicts quantification of IHC, indicating the aver-age percentage of CD8þ cells per field of view(FOV) of the implant (4–6 10� FOV per animal, N¼ 7). Error bars, SD; P values determined by theStudent t test (two-tailed, unpaired). Data rep-resentative of two independent experiments. *, P< 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001;NS, not significant.
IL1b Promotes Immune Suppression in Pancreatic Cancer
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1093
accumulation of CD11bþF4/80þ tumor-associated macrophages(TAM; Fig. 2A), CD11bþGr1þ myeloid-derived suppressor cells(MDSC; Fig. 2B), CD11bþLy6Gþ tumor-associated neutrophils(TAN; Fig. 2C), CD1dhiCD5þ regulatory B cells (Breg; Fig. 2D), andCD4þRORgtþ Th17 cells (Fig. 2E). In addition, knockdown of tumorcell–derived IL1b also decreased the CD206þ M2-polarized state ofstromal TAMs (Fig. 2F). No significant changes were observed instromal recruitment of CD4þFoxP3þ regulatory T cells, CD4þ Thcells, and CD19þ B cells, upon IL1b knockdown (SupplementaryFig. S2A–S2C).
The immune cell profile resulting from the suppression of IL1bproduction is consistent with a role for tumor cell–derived IL1b inconstraining antitumor immunity in PDA. For instance, TANs havebeen reported to downregulate T-cell infiltration in the PDA stro-ma (29). In addition, M2 TAMs, MDSCs, and CD1dhiCD5þ Breg areimmunosuppressive cell populations that have been shown to inhibit
the tumor lytic activity of CD8þ Tc cells (21, 27, 30). Indeed, loss ofstromal immunosuppressive subpopulations in IL1b-depletedKRasG12D-PDEC grafts was accompanied by a significant increase intumor infiltration (Fig. 2G) and activation of CD8þ Tc cells, asmeasured by IFNg and granzyme B expression (Fig. 2H and I). Similarimmune changes were also observed in tumors formed by orthotopictransplantation of IL1b-sh KPC cells (Supplementary Fig. S2D–S2L),indicating a role for IL1b in shaping the immunemicroenvironment inadvanced disease as well.
Together, these observations implicate tumor cell–derived IL1b inpromoting the establishment of an immunosuppressive microenvi-ronment. Notably, we observed a reduction in IL1b-expressing CD45þ
immune cells present in IL1b-sh KRasG12D-PDEC pancreatic graftsrelative to the scramble control (Supplementary Fig. S2M), suggestinga feedforward mechanism wherein the tumor-derived IL1b coulddictate the abundance of stromal-derived IL1b.
-3 0
KRasG12D-PDECImplantation
5 10
Analysis
A
0
10
20
30
40
% C
K8+ A
rea/
lesi
on
B
-α-CD8 or Isotype
-7
KPCImplantation
0 2 4 6 8 10 12
Analysis
-α-PD-1 -α-IL1βC
D
α-PD-1 α-PD-1
α-PD-1
α-PD-1
Veh α-IL1β0
100
200
300
400
+ α-IL1β
α-IL1β+ α-IL1β
α-IL1β+ α-IL1β
Tum
or w
eigh
t (m
g)
500
scr-sh IL1β-sh IL1β-sh+ α-CD8
FSC
-H
CD8
Vehicle α-PD-1
FSC
-H
CD8
5.59 7.11
9.01 15
α-IL1β α-PD-1 + α-IL1β
α-PD-1Veh
CD
8+ Tc
(%C
D45
+ Cel
ls)
0
5
10
15
20E
α-PD-1Veh0
50
100
150
#CD
8+ TC/T
umor
wei
ght
14
**** **** ***
**
***
******
**
**
Figure 4.
IL1b neutralization sensitizes PDAtumors to PD-1 checkpoint blockade.A, Schematic of anti-CD8 antibodytreatment regimen. Anti-CD8 or con-trol IgG antibody (red arrow) wasadministered every day for three daysprior to orthotopic implantation ofKrasG12D-PDECs and then every fivedays hence. B, Graph depicts quantifi-cation of IHC analysis of CK8 stainingon sections of orthotopic pancreaticgrafts 2 weeks postimplantation ofscr-sh or IL1b-sh KRasG12D-PDEC andindicates percentage of CK8þ signalper lesion (N ¼ 8). Error bars, SD;P values determined by the Studentt test (two-tailed, unpaired). Data rep-resentative of two independent experi-ments. C, Schematic of anti-IL1b andanti-PD-1 antibody treatment regimen.Treatment was initiated 1 week postorthotopic implantation of KPC cells.Green and red arrows indicate anti-PD-1 and anti-IL1b antibody administration,respectively. D, Graph representsquantification of analysis in C, indicat-ing tumor weight (N ¼ 8). Error bars,SD; P values determined by the Stu-dent t test (two-tailed, unpaired). Datarepresentative of two independentexperiments. E, Representative flowcytometry plots (left) of KPC tumorstreated with vehicle control, anti-PD-1antibody alone, anti-IL1b antibodyalone, or both anti-PD-1 and anti-IL1bantibody, indicating tumor-infiltratingCD8þ T cells. Graphs depict quantita-tion of FACS analysis, represented aseither percentage of CD45þ immunecells (top right; N ¼ 8) or absolutenumber of CD8þ T cells relative totumor weight (bottom right; N ¼ 7).Error bars, SD; P values determinedby the Student t test (two-tailed,unpaired). Data representative oftwo independent experiments. *, P <0.05; **, P < 0.01; ***, P < 0.001;****, P < 0.0001.
Das et al.
Cancer Res; 80(5) March 1, 2020 CANCER RESEARCH1094
Pro-IL1b processing in pancreatic tumor cells is regulated by the NLRP3 inflammasome.A andB, IHC detection on sections of 2- to 4-month-old KCmouse pancreataof NLRP3 expression (N ¼ 8; A) and cleaved caspase-1 expression (N ¼ 8; B). Insets show respective isotype controls. Representative images are shown.C, Immunofluorescence detection of NLRP3 and phospho-ASC (Y144) colocalization in a 2-month-old KPCmouse pancreas (N¼ 8; NLRP3, red; p-Asc, green; DAPI,blue). Representative image is shown.D, Immunofluorescence detection of NLRP3 and phospho-Asc (Y144) colocalization on a section of human PDA tissue (N¼ 8;NLRP3, red; p-Asc, green; DAPI, blue). Representative image is shown. The 36% � 3.42% ductal epithelium costained positively for NLRP3 and phospho-Asc, asmeasured using ImageJ [3-5 field of view (FOV)/sample, N¼ 8]. E, IHC detection of NLRP3 and cleaved caspase-1 expression on sections of orthotopic pancreaticgrafts 2 weeks postimplantation of KRasG12D-PDEC expressing scramble shRNA (scr-sh) control or NLRP3 shRNA (NLRP3-sh) in WT mice (N ¼ 6). Representativeimages are shown. F, ELISA analysis for assessing IL1b protein production in scr-sh or NLRP3-sh KRasG12D-PDEC in orthotopic pancreatic grafts 2 weekspostimplantation in WT mice (N ¼ 4). P values determined by the Student t test (two-tailed, unpaired). Data representative of two independent experiments.G, Graph depicts quantification of immunofluorescence detection of IL1b on orthotopic pancreatic graft sections, 2 weeks postimplantation of scr-sh or NLRP3-shKRasG12D-PDEC in WT mice. Represented as percentage of IL1b-positive epithelium per FOV of the implant (4–6 FOV per animal, N ¼ 8). Error bars, SD; P valuesdetermined by the Student t test (two-tailed, unpaired). Data representative of two independent experiments. H,Graph depicts quantification of IHC analysis of CK8staining on sections of orthotopic pancreatic grafts 2 weeks postimplantation of scr-sh or NLRP3-sh KRasG12D-PDEC and indicates percentage of CK8þ signal perlesion (N ¼ 8). Error bars, SD; P values determined by the Student t test (two-tailed, unpaired). Data representative of two independent experiments.I, Representative tumors 4 weeks after orthotopic implantation of KPC cells expressing scrambled shRNA (scr-sh) or NLRP3 shRNA (NLRP3-sh) in pancreataof WT mice. J, Graph represents quantification indicating tumor volume (N¼ 7; I). Error bars, SD; P values determined by the Student t test (two-tailed, unpaired).Data representative of two independent experiments.K,Kaplan–Meier curve for survival analysis ofmice bearing orthotopically implantedpancreatic tumors derivedfrom scr-sh or NLRP3-sh KPC cells (N ¼ 7). P values determined by the Student t test (two-tailed, unpaired). Data representative of two independentexperiments. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.
IL1b Promotes Immune Suppression in Pancreatic Cancer
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1095
The pancreatic microbiome drives IL1b expression in tumor cells through TLR4 signaling. A,mRNA transcript level of TLR4 in PDA compared with normal adjacenttissue from publicly available human transcriptomic data (74 patient samples, n¼ 50 PDA and n¼ 24 adjacent normal). Each data point indicates an individual tissuesample. Error bars, SD;P values determined by the Student t test (two-tailed, unpaired).B, IHCdetection of TLR4 expression on a section fromhumanPDA tissue (n¼8 patient samples). Representative image is shown. The 67%� 8.94% ductal epithelium costained positively for TLR4, as measured using ImageJ [3–5 field of view(FOV)/sample, N ¼ 8]. C, IHC detection of TLR4 expression on a section from a 4-month-old KC mouse pancreas (N ¼ 8). Representative image is shown. D,Immunofluorescence detection of IL1b expression on sections of orthotopic pancreatic grafts 2 weeks postimplantation of KRasG12D-PDEC expressing scrambleshRNA (scr-sh) control or TLR4 shRNA (TLR4-sh) in WT mice (N ¼ 7; CK8, red; IL1b, green; DAPI, blue). Representative images are shown. (Continued on thefollowing page.)
Das et al.
Cancer Res; 80(5) March 1, 2020 CANCER RESEARCH1096
Tumor cell–derived IL1b promotes immunosuppression, in part,by regulating activation and secretory phenotype of pancreaticstellate cells
In addition to the immune changes described above, we alsoobserved a significant decrease in stromal fibrosis, as detected bycollagen deposition, in IL1b-sh KRasG12D-PDEC pancreatic grafts(Supplementary Fig. S3A). Because the most prominent source ofcollagen deposition in the extracellular matrix are cancer-associatedfibroblasts (CAF) that are generated by the activation of PSCs, weassessed the state of PSC activation in IL1b-sh pancreatic grafts byassaying for the activation marker aSMA (31). While prominentaSMA staining was observed in the microenvironment of scramblecontrol KRasG12D-PDEC grafts and KPC tumors, the IL1b-shKRasG12D-PDEC grafts and IL1b-sh KPC tumors were largely devoidof aSMA staining (Fig. 3A and B). In contrast, no change in theabundance of vimentin-positive fibroblasts was detected in theIL1b-sh KRasG12D-PDEC grafts (Fig. 3A), indicating that tumorcell–derived IL1b is required for PSC activation and not viability.The potential relevance of this activation mechanism to our observa-tions is supported by the findings that these cells display surfaceexpression of IL1b receptor as determined by FACS analysis (Sup-plementary Fig. S3B).
To distinguish between direct and indirect effect of tumor-derivedIL1b on PSC activation, we isolated primary PSCs from wild-type orIl1r1-null mice and coimplanted each with KRasG12D-PDECs in Il1r1-null mice. Under these conditions, all components of the host stromaare Il1r1 null and therefore by definition unresponsive to tumor cell–derived IL1b. We found that coimplanted wild-type PSCs successfullyunderwent activation, as detected by aSMA staining (SupplementaryFig. S3C). These results implicate tumor cell–derived IL1b as theprimary driver of PSC activation. Consistent with this interpreta-tion, the Il1r1-null PSCs derived from pancreata of Il1r1-null micefailed to undergo activation when coimplanted with tumor cells(Supplementary Fig. S3C). The functional significance of the tumor-derived IL1b/PSCs axis for pancreatic tumor growth is indicated bythe observation that the growth defect of KRasG12D-PDEC pancre-atic grafts in Il1r1-null mice could be rescued by coimplanted wild-type PSCs but not Il1R1-null PSCs (Supplementary Fig. S3D).
The protumorigenic effects of CAFs is well documented and ismediated by multiple paracrine mechanisms (31, 32). In addition tosecreting extracellular matrix proteins and growth factors, the tran-sition of PSCs from a quiescent to an activated state has been shown tobe accompanied by the induction of an inflammatory program withupregulation of cytokines and chemokines such as IL6, CCL2, CCL5,and CCL8 (32). To investigate the effect of tumor cell–derived IL1bdepletion on the inflammatory secretome of CAFs, we sorted CAFsfrom scramble control and IL1b-sh KRasG12D-PDEC pancreatic graftsusing the fibroblast marker CD140 (Supplementary Fig. S3E) and
analyzed them for expression of previously characterized cyto-kines (33). Loss of tumor cell–derived IL1b significantly downregu-lated the expression of several inflammatory cytokines, relative toscramble control (Fig. 3C). Moreover, flow cytometric analysis ofCD140aþ CAFs derived from IL1b-sh KRasG12D-PDEC grafts showeda significant decrease in Ly6C expression, a surface glycoprotein thatmarks cytokine-producing CAFs (Supplementary Fig. S3F; ref. 34).Our results thus indicate that tumor cell–derived IL1b promotes theactivation and shapes the secretory phenotype of CAFs.
Many of the cytokines produced by CAFs in response to IL1b areknown modulators of immune cell function (35). We thereforepostulated that tumor cell–derived IL1b-mediated PSC activationmay, in turn, contribute to the establishment of an immune-suppressive TME. To test this hypothesis, we coimplanted immortal-ized CAFs isolated from KPC tumors (36) with IL1b-sh KRasG12D-PDEC in wild-type mice pancreata. Successful coimplantation wasverified by restoration of stromal aSMA staining (Fig. 3D), increasein Ly6Cþ CD140aþ cell population (Supplementary Fig. S3F) andincreased collagen deposition (Supplementary Fig. S3G). Significantly,CAF coimplantation with IL1b-sh KRasG12D-PDEC specifically res-cued the decrease in macrophage recruitment and M2 TAM polari-zation induced by loss of tumor cell–derived IL1b (Fig. 3E and F;Supplementary Fig. S3H–S3K) as well as restored the inactive state ofCD8þ Tc cells and the decrease in CD8þ Tc cell infiltration (Fig. 3Gand H). This phenotype is consistent with the observed IL1b-depen-dent production by CAFs of CCL2 and CCL5 (Fig. 3C), whichpromote macrophage infiltration and M2 polarization (37, 38), andCXCL12 (Fig. 3C), which is known to impede tumor infiltration ofCD8þ Tc cells (39). To determine the functional significance of CD8þ
T-cell exclusion in the protumorigenic role of tumor cell–derived IL1b,we depleted CD8þ T cells in mice prior to orthotopic implantation ofscramble or IL1b-sh KRasG12D-PDECs (Supplementary Fig. S4A).CD8þ T-cell depletion completely rescued tumor growth defect ofIL1b-sh KRasG12D-PDEC pancreatic grafts (Fig. 4A and B; Supple-mentary Fig. S4B), indicating that the oncogenic role of tumor cell–derived IL1b ismediated through immune suppression of CD8þT-cellinfiltration and activity.
IL1b neutralization sensitizes pancreatic tumors to anti-PD-1checkpoint therapy
The poor response of pancreatic tumors to immune checkpointblockade has been primarily attributed to its immunosuppressivemicroenvironment and poor CD8þ T-cell infiltration (3). Becausedepletion of tumor-derived IL1b significantly increases CD8þ T-cellinfiltration and activity, we reasoned that IL1b neutralization maysensitize PDA tumors to PD-1 checkpoint blockade. To this end,orthotopic KPC tumor–bearing mice were treated with neutralizingantibodies against IL1b and PD-1 (Fig. 4C). Indeed, addition of
(Continued.) E,Graph depicts quantification of data inD, represented as a percentage of IL1b-positive epitheliumper FOVof the implant (4–6FOVper animal,N¼ 7).Error bars, SD;P values determinedby the Student t test (two-tailed, unpaired). Data representative of two independent experiments. F,Graphdepicts quantificationof IHC analysis of CK8 staining on sections of orthotopic pancreatic grafts 2weeks postimplantation of scr-sh or TLR4-shKRasG12D-PDEC and indicates percentage ofCK8þ signal per lesion (N¼ 7). Error bars, SD; P values determined by the Student t test (two-tailed, unpaired). Data representative of two independent experiments.G, Representative tumors 4 weeks after orthotopic implantation of KPC cells expressing scr-sh or TLR4-sh in pancreata of WT mice. H, Graph representsquantification of G, indicating tumor volume (N ¼ 8). Error bars, SD; P values determined by the Student t test (two-tailed, unpaired). Data representative of twoindependent experiments. I,Kaplan–Meier curve for survival analysis ofmice bearing pancreatic tumors derived fromorthotopically implanted scr-sh or TLR4-shKPCcells (N¼ 7). P values determined by the Student t test (two-tailed, unpaired). Data representative of two independent experiments. J, Immunofluorescence analysisof IL1b expression on sections of orthotopic pancreatic grafts 2 weeks postimplantation of KRasG12D-PDEC in WT mice treated with vehicle control or antibioticcocktail (N¼ 7; CK8 red, IL1b green, DAPI blue). Representative images are shown. K, Graph depicts quantification of data in J, represented as a percentage of IL1b-positive epitheliumper FOVof the implant (4–6FOVper animal,N¼ 7). Error bars, SD;P values determined by the Student t test (two-tailed, unpaired). ***,P <0.001;****, P < 0.0001).
IL1b Promotes Immune Suppression in Pancreatic Cancer
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1097
a-IL1b treatment significantly enhanced the antitumor activity ofa-PD-1 (Fig. 4D; Supplementary Fig. S4C). As predicted, combinedtreatment of a-IL1b and a-PD-1 resulted in increased tumor infil-tration of CD8þ T cells, relative to vehicle control or a-PD-1 alone(Fig. 4E).
IL1b production in pancreatic tumor cells is mediated by theNLRP3 inflammasome
Having established its importance in pancreatic tumorigenesis, wenext wanted to dissect the molecular pathway regulating IL1b pro-duction in tumor cells. In innate immune cells, IL1b mRNA istranslated to produce an inactive precursor pro-IL1b form, which isfurther processed to yield themature secreted form of the cytokine by amultimeric protein complex called the inflammasome (6). The mostwell-characterized inflammasomes are comprised of a Nod-like recep-tor protein family pyrin-domain containing (NLRP) protein thatserves as an activation sensor, which associates with apoptosis-associated speck-like proteins containing a CARD complex (ASC)protein (40). In complex with NLRP, ASC recruits procaspase-1 thatautocatalyzes its cleavage to active caspase-1. Active caspase-1, in turn,cleaves pro-IL1b to produce the functional IL1bprotein.Of the variousNLRP proteins that can form inflammasomes, the NLRP3 inflamma-some appears most relevant to our study because its activation wasfound to be necessary for induction of pancreatitis (41), a major riskfactor for PDA development. In addition, NLRP3 inflammasomeactivity is associated with malignancies such as colon cancer andmelanoma (42). We therefore analyzed the activation status of theNLRP3 inflammasome axis in the pancreatic tumor epithelium. Arobust presence of NLRP3 was detected in the tumor epithelialcompartment of KC mice pancreata (Fig. 5A). NLRP3 expression inthese tumor cells strongly correlated with the expression of cleavedcaspase-1 (Fig. 5B), a product of active inflammasomes. Moreover,NLRP3 was found to colocalize with phospho-ASC (Y223) in speck-like aggregates (43) in tumor cells of both KC and KPC mousepancreata (Fig. 5C; Supplementary Fig. S5A) as well as in humanPDA samples (Fig. 5D), further validating the presence of activeNLRP3 inflammasomes in these cells.
To determine whether the NLRP3 inflammasome is the primarysource of pro-IL1b–processing in tumor cells, we knocked downNLRP3 expression in KRasG12D-PDEC and KPC cells using twoindependent short hairpins (Supplementary Fig. S5B and S5C).Depletion of NLRP3 in the transformed ductal epithelia signifi-cantly reduced cleaved caspase-1 expression and IL1b production inIL1b-sh KRasG12D-PDEC pancreatic grafts, relative to scramblecontrol (Fig. 5E–G; Supplementary Fig. S5D). This was accompa-nied by a decrease in growth of IL1b-sh KRasG12D-PDEC pancreaticgrafts (Fig. 5H; Supplementary Fig. S5E) as well as decreased tumorgrowth and increased overall survival of orthotopic IL1b-sh KPCtumor-bearing mice (Fig. 5I–K). Together, these results implicatethe NLRP3 inflammasome in the production of tumor cell–derivedIL1b and define a tumor-supportive role for NLRP3 in pancreaticcancer.
Tumor-derived IL1b expression is regulated by TLR4 and thepancreatic microbiome
NLRP3 inflammasome assembly and the posttranslational pro-cessing of IL1b that ensues is predominantly regulated by Toll-likereceptors (TLR) through induction of IL1B and NLRP3 expressionin response to pathogens or cellular damage (44). Members of theTLR family are expressed in various cancers and have been shown topromote tumor growth (45). In pancreatic cancer, while most TLRs
have been shown to be expressed largely in stromal cells, elevatedTLR4 expression has been reported in the tumor cell compartmentof patient PDA samples and shown to be correlated with reducedsurvival (46, 47). Consistent with these findings, analysis of a panelof patient PDA samples revealed significant upregulation of tumor-associated TLR4 expression, relative to adjacent normal tissue(Fig. 6A), and IHC analysis demonstrated robust TLR4 expressionin tumor cells in human PDA as well as KC and KPC mousepancreata (Fig. 6B and C; Supplementary Fig. S6A). To determinewhether IL1b production in tumor cells is TLR4-driven, weemployed RNAi to stably knockdown TLR4 expression inKRASG12D-PDEC (Supplementary Fig. S6B). Transformed ductalepithelium of TLR4-sh KRasG12D-PDEC pancreatic grafts had sig-nificantly reduced IL1b production, relative to scramble control(Fig. 6D and E). Moreover, TLR4 knockdown in KRasG12D-PDECand KPC cells decreased growth of orthotopic KRasG12D-PDECpancreatic grafts (Fig. 6F; Supplementary Fig. S6C) and KPCtumors, respectively (Fig. 6G and H; Supplementary Fig. S6D) andincreased overall survival of TLR4-sh KPC orthotopic tumor bear-ing mice, relative to scramble control (Fig. 6I). We conclude TLR4thus serves as a critical regulator of tumor cell–derived IL1bproduction and pancreatic tumorigenesis.
Having identified TLR4 as the receptor that controls IL1bproduction in pancreatic tumor cells, we next searched for possiblecues in the pancreatic microenvironment that can induce TLR4signaling. Recent reports on the existence of a complex pancreaticmicrobiome (23) prompted us to hypothesize that microbial-derived ligands that are known to activate TLR4 signaling (17)could be responsible for inducing IL1b production in pancreatictumor cells. To test this hypothesis, we treated wild-type mice withan antibiotic cocktail for 3 weeks to ablate their microbiome prior toimplantation of KRasG12D-PDEC (Supplementary Fig. S6E).KRasG12D-PDEC grafts formed in antibiotic-treated mice indeeddisplayed a significant reduction in tumor cell IL1b expressionwithout affecting TLR4 level, relative to vehicle-treated control mice(Fig. 6J and K; Supplementary Fig. S6F). Overall, our resultsindicate a role for the pancreatic microbiome in initiating asignaling cascade, likely through TLR4, to activate IL1b productionin pancreatic tumor cells.
DiscussionIn this study, we demonstrate a role for tumor cell–derived IL1b in
promoting pancreatic oncogenesis by paracrine induction of hetero-typic stromal interactions. Specifically, we show that tumor-derivedIL1b is critical for shaping the tolerogenic immune landscape of PDAby promoting stromal accumulation of immunosuppressive cell popu-lations. These include M2-polarized macrophages, tumor-associatedneutrophils, IL17-producing Th17 cells, MDSCs, and CD1dhiCD5þ
regulatory B cells. In addition, we report that tumor-derived IL1bregulates PDA-associated desmoplasia by promoting activation ofquiescent PSCs.
IL1b is a member of the IL1 family of proinflammatorycytokines, which also includes the cofounding member, IL1a (7).Both IL1a and IL1b are critical immune regulators that signalthrough a common cell surface receptor (IL1R1-IL1RAcP) toactivate two main pathways: IKK–IkB–NF-kB and/or MKK–MAPK/JNK/ERK (6). Despite considerable functional homology,the two cytokines differ appreciably in several aspects. While IL1ais predominantly a cytosolic or membrane-bound protein consti-tutively expressed in epithelial, endothelial, and immune cells, IL1b
Das et al.
Cancer Res; 80(5) March 1, 2020 CANCER RESEARCH1098
is a secretory protein chiefly produced by immune cells only inresponse to inflammatory cues (7). In PDA, previous studies havepredominantly categorized IL1 signaling into tumor cell productionof IL1a (48) and stromal production of IL1b (15, 16, 18). In fact,IL1b protein is reportedly undetectable in PDA cell lines andorganoids in vitro (33, 49). Consistent with these reports, we toodid not detect IL1b production by KRasG12D-PDEC and KPC cellscultured ex vivo. We did, however, observe a robust in vivo pro-duction of the IL1b protein in the tumor cell compartment ofhuman and murine PDA. This suggests the existence within thepancreatic tumor microenvironment of regulatory cues that caninduce the activation of the toll-like receptor signaling pathway intumor cells to drive IL1b expression and posttranslational proces-sing. This conclusion is supported by our finding that the TLR4/NLRP3 inflammasome signaling axis is active in pancreatic tumorcells and is required for the production of IL1b by these cells.
The TLR4 receptor is a specific sensor of exogenous microbialligands such as lipopolysaccharides (LPS) as well as endogenousligands termed damage-associated molecular patterns (DAMP),derived from host tissue or cells (46). Significantly, the pancreaticmicroenvironment has been shown to be rich in such endogenousTLR4 ligands including HMGB-1 and S100A9 that can activateTLR4 signaling in tumor cells (17). Furthermore, the recentlydescribed PDA-associated microbiome has been shown to be richin microbial ligands capable of activating the toll-like receptorpathway (23). Our finding that bacterial dysbiosis leads to inhibi-tion of tumor cell–derived IL1b production indicates that thepancreatic microbiome plays a significant role in inducing IL1bproduction in transformed cells, likely through the TLR pathway.Moreover, it raises the possibility that the prooncogenic role of themicrobiome in pancreatic cancer (23) could be, in part, mediated bythe activation of TLR4-mediated IL1b production in the tumor cellcompartment.
We have established that the posttranslational mechanisms thatdrive IL1b processing and maturation in the tumor cells requirethe NLRP3 inflammasome. The precise nature of the TLR4-induced signals that promote the assembly and activation of theNLRP3 inflammasome in pancreatic tumor cells remain to bedetermined. In monocytes, TLR4 ligation can induce ATP release,which, in turn, triggers NLRP3 inflammasome assembly via theATP-gated ionotropic receptor P2X7 (P2RX7) (40). Interestingly,P2RX7 is highly expressed in pancreatic cancer cells (50), suggest-ing that a cooption by the tumor cells of this immune cell–specificsignaling axis might be responsible for the NLRP3 inflammasomeactivation.
As indicated by our loss-of-function and rescue experiments, thesecretion by pancreatic tumor cells of IL1b instigates sweepingchanges in the fibroinflammatory pancreatic milieu, in part, bymodulating PSC function. PSCs have been implicated in the reg-ulation of a plethora of protumorigenic processes including tumorcell growth and metabolic adaptation and metastasis (31, 32).Recently, €Ohlund and colleagues have described the presence oftwo distinct intratumoral CAFs subpopulations in PDA: myofibro-blastic cancer-associated fibroblasts (myCAF) with elevated aSMAexpression and inflammatory cancer-associated fibroblasts CAF(iCAF) expressing an array of cytokines and chemokines (51). Ourdata indicate a role for IL1b in regulating the secretory phenotype ofinflammatory CAFs. Specifically, we demonstrate the dependence ofstromal CAFs on tumor-derived IL1b for the production of cyto-kines and chemokines with documented roles in subverting anti-
tumor immunity. These include the chemokines CCL2 and CCL5that regulate chemotaxis of monocytes, and, in the context ofpancreatic cancer, have been found to regulate macrophage infil-tration and M2 polarization (37, 38), as well as the chemokineCXCL12, which is known to inhibit intratumoral accumulation ofCD8þ T cells (39). In accordance with this IL1b-dependent secre-tory profile, we found that upregulation of M2-TAMs and restric-tion of CD8þ Tc cell tumor infiltration is dependent on stromalPSCs. Overall, our study delineates epistatic interactions betweentumor cell–derived IL1b and PSCs that are critical for the estab-lishment of immune tolerance in pancreatic cancer.
The low immunogenicity of pancreatic cancer due to poor tumorinfiltration of CD8þ Tc cells is considered a major factor responsiblefor the failure of checkpoint immunotherapy in PDA (3). Asdemonstrated by our studies, neutralizing IL1b promotes intratu-moral CD8þ Tc-cell infiltration and function and sensitizes PDA tocheckpoint immunotherapy. Hence, therapeutic strategies thattarget IL1b may increase the efficacy of immune checkpoint inhi-bitors in pancreatic cancer. It is noteworthy that in a recent analysisof pancreatic cystic neoplasms (PCN) in patients, intracystic bac-terial load as well as increased IL1b protein levels were detected incystic precursors to pancreatic cancer called intraductal papillarymucinous neoplasms (IPMN), relative to non-IPMN PCNs (52).This study in combination with our current findings suggest thatIL1b production might be an early event in pancreatic tumorigen-esis, the targeting of which could be used to impede diseaseprogression.
Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.
Authors’ ContributionsConception and design: S. Das, D. Bar-SagiDevelopment of methodology: S. Das, D. Bar-SagiAcquisition of data (provided animals, acquired and managed patients, providedfacilities, etc.): S. Das, B. Shapiro, S. VogtAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S. Das, B. Shapiro, E.A. VucicWriting, review, and/or revision of the manuscript: S. Das, E.A. Vucic, S. Vogt,D. Bar-SagiAdministrative, technical, or material support (i.e., reporting or organizing data,constructing databases): S. DasStudy supervision: D. Bar-Sagi
AcknowledgmentsThe authors thank L.J. Taylor for help with article preparation, Mark Choi for
technical assistance, and members of the Bar-Sagi lab for valuable discussions andcomments. The KPC cell line (line 4662) was a kind gift from Dr. R.H. Vonderheide.The immortalized CAF cell line isolated fromKPC tumors was a kind gift fromDr. A.C. Kimmelman. We thank Novartis for providing the mouse anti-PD1 and anti-IL1bantibodies and isotype controls for this study. The TROMA-I antibody againstcytokeratin-8 developed by Brulet P and colleagues, Institut Pasteur, was obtainedfrom the Developmental Studies Hybridoma Bank, created by the NICHD of the NIHand maintained at The University of Iowa, Department of Biology. The authors alsothank NYU Langone's Cytometry and Cell Sorting Laboratory and the ExperimentalPathology Research Laboratory, which are supported, in part, by grant P30CA016087from the NIH/National Cancer Institute, for providing cell sorting/flow cytometrytechnologies and histochemistry support, respectively, as well as the Center forBiospecimen Research and Development for providing patient pancreatic tumortissue sections. This work was supported by NIH/NCI grant CA210263 (D. Bar-Sagi)and by a StandUpToCancer-Lustgarten FoundationPancreatic Cancer ConvergenceDream Team Name Translational Research Grant (SU2C-AACR-DT14-14). StandUp to Cancer is a division of the Entertainment Industry Foundation administered bythe American Association for Cancer Research, the Scientific Partner of SU2C. B.
IL1b Promotes Immune Suppression in Pancreatic Cancer
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1099
Shapiro was supported by NIH grant T32GM115313. E.A. Vucic was supported by aCanadian Institutes of Health Research Fellowship (146792).
The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.
Received July 6, 2019; revised November 22, 2019; accepted December 31, 2019;published first January 8, 2020.
References1. Simoes PK, Olson SH, Saldia A, Kurtz RC. Epidemiology of pancreatic adeno-
carcinoma. Chin Clin Oncol 2017;6:24.2. Von Hoff DD, Ervin T, Arena FP, Chiorean EG, Infante J, Moore M, et al.
Increased survival in pancreatic cancer with nab-paclitaxel plus gemcitabine.N Engl J Med 2013;369:1691–703.
3. Johnson BA III, Yarchoan M, Lee V, Laheru DA, Jaffee EM. Strategies forincreasing pancreatic tumor immunogenicity. Clin Cancer Res 2017;23:1656–69.
4. Cullis J, Das S, Bar-Sagi D. Kras and tumor immunity: friend or foe?Cold Spring Harb Perspect Med 2018;8. DOI: 10.1101/cshperspect.a031849.
5. Padoan A, Plebani M, Basso D. Inflammation and pancreatic cancer: focus onmetabolism, cytokines, and immunity. Int J Mol Sci 2019;20.
6. Bent R, Moll L, Grabbe S, Bros M. Interleukin-1 Beta-A friend or foe inmalignancies? Int J Mol Sci 2018;19. DOI: 10.3390/ijms19082155.
7. Apte RN, Dotan S, Elkabets M, White MR, Reich E, Carmi Y, et al. Theinvolvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis andtumor-host interactions. Cancer Metast Rev 2006;25:387–408.
8. Chen L, Huang CF, Li YC, Deng WW, Mao L, Wu L, et al. Blockage ofthe NLRP3 inflammasome by MCC950 improves anti-tumor immuneresponses in head and neck squamous cell carcinoma. Cell Mol Life Sci2018;75:2045–58.
10. Jiang H, Gebhardt C, Umansky L, Beckhove P, Schulze TJ, Utikal J, et al.Elevated chronic inflammatory factors and myeloid-derived suppressor cellsindicate poor prognosis in advanced melanoma patients. Int J Cancer 2015;136:2352–60.
11. Saijo Y, Tanaka M, Miki M, Usui K, Suzuki T, Maemondo M, et al. Proin-flammatory cytokine IL-1 beta promotes tumor growth of Lewis lung carcinomaby induction of angiogenic factors: in vivo analysis of tumor-stromal interaction.J Immunol 2002;169:469–75.
12. Mayer J, Rau B, Gansauge F, Beger HG. Inflammatory mediators in humanacute pancreatitis: clinical and pathophysiological implications. Gut 2000;47:546–52.
13. Maker AV, Katabi N, Qin LX, Klimstra DS, SchattnerM, BrennanMF, et al. Cystfluid interleukin-1beta (IL1beta) levels predict the risk of carcinoma in intra-ductal papillary mucinous neoplasms of the pancreas. Clin Cancer Res 2011;17:1502–8.
14. Mitsunaga S, IkedaM, Shimizu S, Ohno I, Furuse J, InagakiM, et al. Serum levelsof IL-6 and IL-1beta can predict the efficacy of gemcitabine in patients withadvanced pancreatic cancer. Br J Cancer 2013;108:2063–9.
15. ZhangD, Li L, JiangH, Li Q,Wang-GillamA, Yu J, et al. Tumor-Stroma IL1beta-IRAK4 feedforward circuitry drives tumor fibrosis, chemoresistance, and poorprognosis in pancreatic cancer. Cancer Res 2018;78:1700–12.
16. Incio J, Liu H, Suboj P, Chin SM, Chen IX, Pinter M, et al. Obesity-inducedinflammation and desmoplasia promote pancreatic cancer progression andresistance to chemotherapy. Cancer Discov 2016;6:852–69.
17. Ochi A, Nguyen AH, Bedrosian AS, Mushlin HM, Zarbakhsh S, Barilla R, et al.MyD88 inhibition amplifies dendritic cell capacity to promote pancreaticcarcinogenesis via Th2 cells. J Exp Med 2012;209:1671–87.
18. Daley D, Mani VR, Mohan N, Akkad N, Pandian G, Savadkar S, et al. NLRP3signaling drives macrophage-induced adaptive immune suppression in pancre-atic carcinoma. J Exp Med 2017;214:1711–24.
19. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, et al.Preinvasive and invasive ductal pancreatic cancer and its early detection in themouse. Cancer cell 2003;4:437–50.
20. Hingorani SR,Wang L,Multani AS, Combs C, Deramaudt TB, Hruban RH, et al.Trp53R172H andKrasG12D cooperate to promote chromosomal instability andwidelymetastatic pancreatic ductal adenocarcinoma inmice. Cancer Cell 2005;7:469–83.
21. Pylayeva-Gupta Y, Lee KE, Hajdu CH, Miller G, Bar-Sagi D. Oncogenic Kras-induced GM-CSF production promotes the development of pancreatic neopla-sia. Cancer Cell 2012;21:836–47.
22. Tseng WW, Winer D, Kenkel JA, Choi O, Shain AH, Pollack JR, et al.Development of an orthotopic model of invasive pancreatic cancer in animmunocompetent murine host. Clin Cancer Res 2010;16:3684–95.
23. Pushalkar S, Hundeyin M, Daley D, Zambirinis CP, Kurz E, Mishra A, et al. Thepancreatic cancer microbiome promotes oncogenesis by induction of innate andadaptive immune suppression. Cancer Discov 2018;8:403–16.
24. Reikvam DH, Erofeev A, Sandvik A, Grcic V, Jahnsen FL, Gaustad P, et al.Depletion of murine intestinal microbiota: effects on gut mucosa and epithelialgene expression. PloS one 2011;6:e17996.
25. Apte M.Isolation of quiescent pancreatic stellate cells from rat and humanpancreas. Pancreapedia: Exocrine Pancreas Knowledge Base; 2011. Available at:https://www.pancreapedia.org/tools/methods/isolation-of-quiescent-pancreatic-stellate-cells-from-rat-and-human-pancreas.
26. Gadaleta E, Cutts RJ, Kelly GP, Crnogorac-Jurcevic T, Kocher HM,Lemoine NR, et al. A global insight into a cancer transcriptional spaceusing pancreatic data: importance, findings and flaws. Nucleic Acids Res2011;39:7900–7.
27. Pylayeva-Gupta Y, Das S, Handler JS, Hajdu CH, Coffre M, Koralov SB, et al.IL35-Producing B cells promote the development of pancreatic neoplasia.Cancer Discov 2016;6:247–55.
28. GlaccumMB, Stocking KL, Charrier K, Smith JL,Willis CR, Maliszewski C, et al.Phenotypic and functional characterization of mice that lack the type I receptorfor IL-1. J Immunol 1997;159:3364–71.
29. Chao T, Furth EE, Vonderheide RH. CXCR2-dependent accumu-lation of tumor-associated neutrophils regulates t-cell immunity inpancreatic ductal adenocarcinoma. Cancer Immunol Res 2016;4:968–82.
30. Arnold JN,Magiera L, KramanM, Fearon DT. Tumoral immune suppression bymacrophages expressing fibroblast activation protein-alpha and heme oxyge-nase-1. Cancer Immunol Res 2014;2:121–6.
31. Mekapogu AR, Pothula SP, Pirola RC, Wilson JS, Apte MV. Multifunctionalrole of pancreatic stellate cells in pancreatic cancer. J Ann Pancreatic Cancer2019;2:10.
32. Fu Y, Liu S, Zeng S, Shen H. The critical roles of activated stellate cells-mediatedparacrine signaling, metabolism and onco-immunology in pancreatic ductaladenocarcinoma. Mol Cancer 2018;17:62.
33. Sherman MH, Yu RT, Engle DD, Ding N, Atkins AR, Tiriac H, et al. Vitamin Dreceptor-mediated stromal reprogramming suppresses pancreatitis andenhances pancreatic cancer therapy. Cell 2014;159:80–93.
34. Biffi G, Oni TE, Spielman B, Hao Y, Elyada E, Park Y, et al. IL1-InducedJAK/STAT signaling is antagonized by TGFbeta to shape CAF hetero-geneity in pancreatic ductal adenocarcinoma. Cancer Discov 2019;9:282–301.
35. Nagarsheth N, Wicha MS, Zou W. Chemokines in the cancer microenvi-ronment and their relevance in cancer immunotherapy. Nat Rev Immunol2017;17:559–72.
36. Sousa CM, Biancur DE, Wang X, Halbrook CJ, Sherman MH, Zhang L, et al.Pancreatic stellate cells support tumour metabolism through autophagic alaninesecretion. Nature 2016;536:479–83.
37. Sanford DE, Belt BA, Panni RZ, Mayer A, Deshpande AD, Carpenter D, et al.Inflammatory monocyte mobilization decreases patient survival in pancre-atic cancer: a role for targeting the CCL2/CCR2 axis. Clin Cancer Res 2013;19:3404–15.
39. Feig C, Jones JO, Kraman M, Wells RJ, Deonarine A, Chan DS, et al. TargetingCXCL12 from FAP-expressing carcinoma-associated fibroblasts synergizes withanti-PD-L1 immunotherapy in pancreatic cancer. ProcNatl Acad SciU SA2013;110:20212–7.
Das et al.
Cancer Res; 80(5) March 1, 2020 CANCER RESEARCH1100
40. He Y, Hara H, Nunez G. Mechanism and regulation of NLRP3 inflammasomeactivation. Trends Biochem Sci 2016;41:1012–21.
41. Zhang GX, Wang MX, Nie W, Liu DW, Zhang Y, Liu HB. P2X7R BlockadePrevents NLRP3 inflammasome activation and pancreatic fibrosis in a mousemodel of chronic pancreatitis. Pancreas 2017;46:1327–35.
42. ZhiyuW,WangN,WangQ, Peng C, Zhang J, Liu P, et al. The inflammasome: anemerging therapeutic oncotarget for cancer prevention. Oncotarget 2016;7:50766–80.
43. Hara H, Tsuchiya K, Kawamura I, Fang R, Hernandez-Cuellar E, Shen Y, et al.Phosphorylation of the adaptor ASC acts as a molecular switch that controls theformation of speck-like aggregates and inflammasome activity. Nat Immunol2013;14:1247–55.
44. NeteaMG, van de Veerdonk FL, Kullberg BJ, Van der Meer JW, Joosten LA. Therole of NLRs and TLRs in the activation of the inflammasome. Expert Opin BiolTher 2008;8:1867–72.
45. Dajon M, Iribarren K, Cremer I. Toll-like receptor stimulation in cancer:a pro- and anti-tumor double-edged sword. Immunobiology 2017;222:89–100.
46. Vaz J, Andersson R. Intervention on toll-like receptors in pancreatic cancer.World J Gastroenterol 2014;20:5808–17.
47. Zhang JJ, Wu HS, Wang L, Tian Y, Zhang JH, Wu HL. Expression andsignificance of TLR4 and HIF-1alpha in pancreatic ductal adenocarcinoma.World J Gastroenterol 2010;16:2881–8.
48. Ling J, Kang Y, Zhao R, Xia Q, Lee DF, Chang Z, et al. KrasG12D-induced IKK2/beta/NF-kappaB activation by IL-1alpha and p62 feedforward loops is requiredfor development of pancreatic ductal adenocarcinoma. Cancer Cell 2012;21:105–20.
49. Tjomsland V, Spangeus A, Valila J, Sandstrom P, Borch K, Druid H, et al.Interleukin 1alpha sustains the expression of inflammatory factors in humanpancreatic cancer microenvironment by targeting cancer-associated fibroblasts.Neoplasia 2011;13:664–75.
50. Giannuzzo A, Pedersen SF, Novak I. The P2X7 receptor regulates cell survival,migration and invasion of pancreatic ductal adenocarcinoma cells. Mol Cancer2015;14:203.
51. Ohlund D, Handly-Santana A, Biffi G, Elyada E, Almeida AS, Ponz-Sarvise M,et al. Distinct populations of inflammatory fibroblasts and myofibroblasts inpancreatic cancer. J Exp Med 2017;214:579–96.
52. Gaiser RA,Halimi A, AlkharaanH, Lu L,DavanianH,Healy K, et al. Enrichmentof oral microbiota in early cystic precursors to invasive pancreatic cancer. Gut2019;68:2186–94.
AACRJournals.org Cancer Res; 80(5) March 1, 2020 1101
IL1b Promotes Immune Suppression in Pancreatic Cancer
