Proc. Natl. Acad. Sci. USAVol. 89, pp. 668-672, January 1992Biochemistry

Two adjacent AP-1-like binding sites form the electrophile-responsive element of the murine glutathione S-transferaseYa subunit gene

(enhancer/gene regulation/phorbol esters/c-jun-c-fos genes/synergism)

RONIT SHARON FRILING, SVETLANA BERGELSON, AND VIOLET DANIEL*Department of Biochemistry, The Weizmann Institute of Science, Rehovot 76100, Israel

Communicated by Paul Talalay, October 22, 1991 (received for review June 3, 1991)

ABSTRACT An electrophile-responsive element (EpRE)in the 5' flanking region of the mouse glutathione S-transferaseYa subunit gene was recently found to be responsible for theinduction of gene expression by xenobiotics that contain oracquire by metabolism an electrophilic center. We now findthat this EpRE is composed of two adjacent 9-base-pair motifsrelated in sequence to the AP-1 binding site, a transcriptionalenhancer originally identified as the phorbol 12-myristate13-acetate (PMA) response element and known to be regulatedby the binding of protein products of c-jun and c-fos genes.Synthetic oligonucleotides representing each of the AP-1-likebinding sites of the EpRE and the AP-1 site consensus sequencewere prepared and assayed for their enhancer activity andinducibility by tert-butylhydroquinone, ,B-naphthoflavone, andPMA. Single AP-1-like sequences showed a lower enhanceractivity than an AP-1 consensus sequence and no inducibility.Two adjacent AP-1-like sites were found to act synergisticallyand to confer inducibility beyond that observed for a singleAP-1 consensus sequence. Examination of the PMA-responsiveregion of a number of genes shows the presence of adjacentAP-1-like sites and indicates that the structure of the EpREfound in the Ya gene may occur more generally and may beimportant in regulating the magnitude of the electrophilicresponse. The present study demonstrates the binding andtransactivation of the EpRE by Jun and Fos and indicates thatthe AP-1 site is part of the EpRE. The induction by PMA ortert-butylhydroquinone appears to be independent of proteinkinase C activity since it is not affected by inhibitors of thisenzyme.

Induction of the electrophile-metabolizing enzymes glu-tathione transferases, glucuronosyltransferases, and NAD-(P)H:quinone reductase is considered a major mechanism ofprotection against mutagens, carcinogens, and other toxiccompounds (1-3). Compounds that induce these enzymesinclude the diphenols, isothiocyanates, thiocarbamates, un-saturated dicarboxylic acids, etc., which contain or acquireby metabolism electrophilic centers (2). Many of these in-ducers are Michael reaction acceptors characterized by ole-finic or acetylenic bonds rendered electrophilic by conjuga-tion with electron-withdrawing substituents and share com-mon structural features with glutathione transferasesubstrates (4). As a consequence the potency of inducers wasfound to parallel their efficiency as substrates for glutathionetransferases (5).

In a recent study of a mouse glutathione S-transferase(GST) Ya subunit gene, we have demonstrated (6) that asingle cis-regulatory element in the 5' flanking region, be-tween nucleotides (nt) -754 and -714 from the start oftranscription, is responsible for Ya gene induction by com-

pounds that are electrophilic (e.g., trans-4-phenyl-3-buten-2-one, dimethyl fumarate) or by compounds that are easilyoxidized into electrophilic (tert-butylhydroquinone) and pla-nar aromatic (e.g., 3-methylcholanthrene, P-naphthoflavone,2,3,7,8-tetrachlorodibenzo-p-dioxin) compounds. We havealso shown (6) that, consistent with a model proposed byProchaska and Talalay (3), the planar aromatic compoundshave to be metabolized by the cytochrome Pl-450 system intoelectrophilic compounds to function as Ya gene inducers.The inducible expression of GST Ya gene is, therefore,controlled by an electrophile-responsive element (EpRE)that is activated exclusively by inducers containing an elec-trophilic center. A regulatory antioxidant responsive ele-ment, similar in structure to the EpRE, was described in a ratGST Ya gene (7) and shown to confer inducibility by ,-naph-thoflavone and phenolic antioxidants (8). The molecularmechanisms by which the electrophilic signal is transduced tothe transcriptional machinery are, however, not known. Thefinding that treatment of cultured cells with tert-butylhydro-quinone leads to an increase in EpRE binding activity ofnuclear extracts has suggested that the EpRE sequence isrecognized by a nuclear trans-acting factor whose activity orabundance is modulated by the electrophilic agent (6).

In recent years evidence has accumulated suggesting thattranscriptional regulatory proteins such as Jun and Fos, theprotein products of c-jun and c-fos protooncogenes, play arole in coupling extracellular signals to gene expression in thenucleus by interacting with AP-1 binding sites in target genes.The inducible transcription enhancer AP-1 binding site, ob-served in the promoter region of several phorbol ester(phorbol 12-myristate 13-acetate; PMA)-inducible genes (9-11), was shown to be the DNA binding site for Jun-Fosheterodimeric complexes (for review, see ref. 12). The rapidand transient induction of expression of Jun- and Fos-relatedproteins by a great variety of extracellular stimulatory agentsthat promote cell proliferation, differentiation, and neuronalexcitation enables these proteins to modulate their AP-1DNA binding activities and to mediate specific alterations ingene transcription in response to environmental stimuli (12,13). The mechanisms by which members ofjun and fos genefamilies are induced by multiple cell surface stimuli are,however, unclear. A hypothetical pathway proposed for thealteration of gene expression by PMA involves a cascade ofevents triggered by the activation of protein kinase C, which,by specific phosphorylation, may then modify the AP-1 DNAbinding activities of Jun and Fos proteins (9, 10). In fact,protein kinase C is considered the receptor protein and themajor cellular protein target for the action of tumor-promoting phorbol esters (14).

Abbreviations: EpRE, electrophile-responsive element; GST, glu-tathione S-transferase; PMA, phorbol 12-myristate 13-acetate; nt,nucleotide(s); CAT, chloramphenicol acetyltransferase.*To whom reprint requests should be addressed.

668

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 89 (1992) 669

In this study we show that the EpRE of GST Ya subunitgene contains two adjacent 9-base-pair (bp) motifs related insequence to the AP-1 binding site. Although each of theseAP-1-like binding sites, separately, has low enhancer activityand no inducibility, the presence of two adjacent AP-1-likebinding sites confers electrophile inducibility. In fact weobserve that the combination of two adjacent AP-1 bindingsites, one or both of which deviate in sequence from the AP-1consensus, by mediating low levels of basal expression, hasthe advantage of conferring a higher sensitivity to electro-philic inducers and maximal response. We present evidencethat PMA acts as an electrophilic inducer and conclude thatthe AP-1 enhancer mediates the specific cellular response tothe electrophilic stimuli. The present finding that inductionby tert-butylhydroquinone and induction by PMA are equallyunaffected by the presence of protein kinase C inhibitors maysuggest that not all phorbol ester-induced activities are me-diated by this enzyme.

MATERIALS AND METHODS

Plasmid Constructions. The synthetic oligonucleotides con-taining the sequences of the 41-bp EpRE region between nt-754 and -714 of GST Ya gene (see Fig. 1A), the 11 bpbetween nt -729 and -719, gatcGTACAAAGCA, themutant gatcGAGiACAAAGCA, and the AP-1 consensus gat-cATGACTCAGCA (where lowercase letters represent clon-ing linkers) were prepared by 0. Goldberg (Weizmann Insti-tute). The 25-bp sequence between nt -753 and -729 of theEpRE (see Fig. 1A) was a gift from P. Talalay (Johns HopkinsUniversity, Baltimore). These oligonucleotides were ligatedas a single copy or multiple copies into the -187 site of theGST Ya gene minimal promoter driving the expression of thechloramphenicol acetyltransferase (CAT) coding sequenceas described (15). The DNAs of all constructs have beensequenced. cDNA clone of c-Jun was obtained from D.Nathans (Johns Hopkins University) and c-Fos was from C.Kahana (Weizmann Institute).

Transfections. Plasmid DNA constructs were transfectedfor transient expression into HepG2 or F9 embryonal carci-noma cells as described (15), except that F9 cells were platedat 2.5 x 105 cells per 10-cm dish 24 h before transfection. Inthese experiments, cells in Dulbecco's modified Eagle'smedium (DMEM) containing 10% (vol/vol) fetal calf serumwere incubated for 6 h with calcium phosphate-precipitatedplasmid DNAs (10 ,g of test plasmid and 10 ,g of RSVgalinternal control plasmid per 10-cm dish), rinsed, glycerol-shocked for 1 min, and supplemented with fresh mediumcontaining 10%o fetal calf serum. After a recovery of 4-12 hat 37°C, the cells were exposed to the xenobiotic inducers andwere harvested 16 h later. In experiments where inductionwas carried out in the absence of serum, after the glycerolshock the cells were supplemented with DMEM containing0.5% fetal calf serum, inducers were added after 24 h, andcells were harvested 16 h later. CAT activities were measuredas described (15) and were calculated after normalizing eachassay relative to 8-galactosidase activity, the internal con-trol. All CAT activity data are derived from three to sixtransfection experiments, which did not deviate from eachother by >10%.

In Vitro Transcription and Translation. pGEM-1 plasmidscontaining subcloned cDNAs of c-Jun and c-Fos were lin-earized by BamHI or Sac I and were transcribed by T7 or SP6RNA polymerase, respectively, as described (16). The RNAswere translated with a rabbit reticulocyte lysate as describedby the supplier (Promega).

RESULTS

Activation of GST Ya Gene Promoter by EpRE Sequences.A 41-bp DNA fragment located between nt -754 and -714 inthe 5' flanking region of mouse GST Ya subunit gene wasfound to be exclusively responsible for the induction of Yagene expression by electrophilic compounds (6). This elec-trophile-responsive DNA fragment contains a 9-bp directrepeat sequence, TGACA(A/T)(A/T)GC, spaced by 6 bp(Fig. 1A). To determine which of these nucleotide sequencesare required for electrophile inducibility, a 25-bp oligonucle-otide (nt -753 to -729) that includes the first direct repeatand an 11-bp oligonucleotide (nt -729 to -719) that includesthe second direct repeat (Fig. 1A) were synthesized. Thesynthetic oligonucleotides were ligated upstream of the -187site of the Ya gene promoter fused to the CAT codingsequence to produce plasmids 753-729Ya-cat and 729-719Ya-

A-754 -714

5 gatccAGCTGCAAj GACATTGCTAATGG<GA AAACCACTTTATCGAACC TT§T AACGTTAC -CTGTTTCGJTAAActag 5'

25hp1lbp

60

40

20-

:>

u

C.)CD

a)Er 300

200 -

100

0-

Bc

b c a

a b c a b c 4_ __ I

-187 Ya cat 753-729 Ya cat 729-719 Ya cat 754-714 Ya cat

C

a_a b c

729-71 9 Ya cat (729-719) , Ya cat (729-719) 5 Ya cat

FIG. 1. (A) Sequence of the EpRE located between nt -754 and-714 of the 5' flanking region of mouse GST Ya gene. The directrepeats are boxed, and the 25- and 11-bp oligonucleotides synthe-sized to study their effect on Ya gene promoter activation areindicated. (B) Relative CAT activities expressed in HepG2 cells fromconstructs -187Ya-cat (lacking electrophile responsive sequences)and 753-729Ya-cat, 729-719Ya-cat, and 754-714Ya-cat (containingthe 25-bp, 11-bp, and 41-bp synthetic oligonucleotides, respectively).After transfection, the cells were untreated (bars a) or were exposedfor 24 h to 30 ,uM tert-butylhydroquinone (bars b) or to 50 ,uM,8-naphthoflavone (bars c). (C) Relative CAT activities expressed inHepG2 cells from constructs 729-719Ya-cat, (729-719)2Ya-cat, and(729-719)5Ya-cat containing one, two, or five copies of the 11-bp (nt729 to 719) sequence. The cells were untreated (bars a) or wereexposed for 24 h to 30 ,uM tert-butylhydroquinone (bars b) or to 50AM ,-naphthoflavone (bars c).

Biochemistry: Friling et al.

Proc. Natl. Acad. Sci. USA 89 (1992)

cat. The recombinant plasmids were transfected for expres-sion into HepG2 cells. The inducibility of Ya-cat gene expres-sion was tested by treatment of the transfected HepG2 cellsfor 16 h with tert-butylhydroquinone or p-naphthoflavoneand assays ofCAT activity in the cell extracts. Fig. 1B showsthat, compared with the control construct -187Ya-cat lack-ing electrophile-responsive sequences, the 753-729Ya-catand 729-719Ya-cat constructs express, respectively, 2- and5-fold increases in basal activity. The expression of CATactivity is, however, not inducible in these constructs thoughthe 729-719Ya-cat may present a trace of inducibility (Fig.1B). Since the 729-719Ya-cat construct contains only the 9-bpTGACAAAGC direct repeat flanked by an additional basepair at both extremities, we assumed that this sequencerepresents the core DNA motif of an EpRE. Fig. 1B showsthat a duplication of this DNA motif in the 754-714Ya-catconstruct (Fig. 1A) increases the'basal activity and conferselectrophile inducibility.To assess the activity of multiple EpREs on the basal and

electrophile-induced CAT expression, we have compared theCAT activity expressed from 729-719Ya-cat, (729-719)2Ya-cat, and (729-719)5Ya-cat constructs containing one, two, andfive EpRE GTGACAAAGCA sequences, respectively. Fig.1C shows the synergistic effect of the multiple EpREs. In theabsence of inducer, there is an increase in the level of CATexpression that correlates with the number of EpREs. About20- and 50-fold increases in basal activity were observed,respectively, for the constructs containing two and fiveEpREs as compared to a single EpRE. However, the induc-tion ratio conferred by five EpREs is lower than that of twoEpREs.PMA Acts as an Electrophilic Inducer. Fig. 2 shows that the

two TGACA(A/T)(A/T)GC sequences that constitute theelectrophile-inducible enhancer EpRE of GST Ya gene areactually a variant of the consensus AP-1-binding site TGAC-TCA originally identified as a PMA response element (9-11).To examine the PMA responsiveness of the EpRE se-quences, we have transfected plasmid constructs containinga single EpRE motif, 729-713Ya-cat, or two EpRE motifs,754-714Ya-cat, of GST Ya gene into HepG2 cells and mea-sured the induction of CAT expression after PMA treatment.Fig. 3 shows that, similar to the induction by tert-butylhydroquinone, PMA induction of CAT expression re-quires the presence of the two EpRE motifs but, unliketert-butylhydroquinone, the PMA induction seems to requireserum factors.The AP-1 Binding Site Is an Electrophile-Inducible En-

hancer. Fig. 4 shows that a single-base conversion T -- A atposition 1 of the EpRE motif completely abolished theenhancer activity of the EpRE and reduced the level ofCATexpression to that of the - 187Ya-cat minimal promoter (barsA, B, and C). Thus, independent ofthe number of copies (oneor four), the AGACAAAGC sequence does not increase thebasal activity of the Ya gene promoter and is not responsiveto tert-butylhydroquinone or PMA. To determine the activityof the consensus AP-1 binding site in response to electro-philic reagents, oligonucleotides containing a single consen-sus AP-1 site (A2GACICA.GA) or an EpRE motif inconjunction with a consensus AP-1 sequence (GTQA

AP-1 consensus: TGAG-T-CAC A

EpRE sequences ...in GST Ya gene: TGACATT

TGACMA

FIG. 2. Comparison of the two DNA motifs of the EpRE ofGSTYa subunit gene with the consensus AP-1 binding site. Dots indicatedepartures from consensus.

i." . . _. _ . _ _ ... ... .....

>1L.

>

.5

EII

_ Cog.zay-.

F-i< I

IM 1

seru Em

FIG. 3. EpRE of GST Ya subunit gene can act as a PMA-inducible element. Constructs 729-719Ya-cat, containing a singleEpRE motif, and 754-714Ya-cat, containing two EpRE motifs (seeFig. 1A), were transfected into HepG2 cells. After transfection thecells were untreated (bars a) or were exposed for 16 h to 30 uMtert-butylhydroquinone (bars b) or 100 nM PMA (bars c) in thepresence of 10%o (bars +) or 0.5% (bars -) serum.

CAAAGCAGATCATGACTCAGCA) were synthesized, in-serted in front of - 187Ya-cat, and assayed for enhancing Yagene promoter activity after transfection into HepG2 cells.Fig. 4, bars D and E, shows that a single consensus AP-1binding site, TGACTCAGC, gave an 8-fold enhanced unin-duced level of CAT expression as compared with a 4-foldlevel observed for a single EpRE motif, TGACAAAGC. Inaddition to the increased stimulation of the basal activity, asingle consensus AP-1-binding sequence shows inducibilityby tert-butylhydroquinone. The effect of PMA induction,which is very limited on a single consensus AP-1 sequence(Fig. 4, bars E), becomes evident on the construct containingthe AP-1 sequence 6 bp from an EpRE motif (Fig. 4, bars F).Thus, although a single sequence, TGACTCAGC or TGA-CAAAGC, shows almost no responsiveness to PMA, the twosequences linked together upstream of the -187 Ya genepromoter confer inducibility by both tert-butylhydroquinoneand PMA.

:~~~~~ ~ab ab abc

A B C C F

FIG. 4. Relative CAT activities of constructs containing thefollowing sequences: Bars A show constructs with - 187Ya-cat. Thefollowing oligonucleotides were inserted upstream of the -187Ya-cat: B and C, one and four copies of the T-- A mutant ofEpRE motifGAGACAAAGCA, respectively; D, a single EpRE motif (GTGAfCAAAGCA); E, a single AP-1 consensus sequence (ATGAC-LCAGCA); F, a single copy of an EpRE motif in conjunction with aconsensus AP-1 sequence (GTGACAAAGCAGATCATGACTLCAGCA). (Underlined bases represent compared sequences.) Aftertransfection the HepG2 cells were untreated (bars a) or were exposedfor 16 h to 30 ,uM tert-butylhydroquinone (bars b) or to 100 nM PMA(bars c).

670 Biochemistry: Frifing et al.

Proc. Natl. Acad. Sci. USA 89 (1992) 671

Binding and Transactivation of the EpRE by Fos and JunProteins. To determine the binding to the EpRE sequences,unlabeled Fos and Jun proteins were synthesized in vitro andused in gel shift assays. Fig. 5A shows that, similar to an AP-1site (lane 3), Jun and Fos interacted cooperatively with theEpRE (lane 7). Competition with excess unlabeled EpREoligonucleotide abolished binding at both sites (lanes 4 and 8).Little or no binding was observed with either c-Jun or c-Fosalone (lanes 1, 2, 5, and 6). To examine the transactivation ofEpRE by Jun and Fos, we transfected the 754-714Ya-catplasmid into undifferentiated F9 embryonal carcinoma cells,which lack endogenous AP-1 activity (18, 19). Fig. SB showsthat, similar to the minimal promoter construct 187Ya-cat,the EpRE-containing construct had no basal activity in thesecells (lanes 1 and 2) and only a 3-fold increase in expressionwas induced by tert-butylhydroquinone (lane 3). Cotransfec-tion with both c-Jun and c-Fos expression vectors, however,dramatically increased the expression of 754-714Ya-cat by-100-fold (lane 8). When transfected separately exogenousc-Jun had no effect on basal or inducible activity of the EpRE(lanes 4 and 5), whereas exogenous c-Fos increased bothactivities by 6- and 12-fold, respectively (lanes 6 and 7).

Activity of the Electrophile-Inducible GST Ya Gene En-hancer in the Presence of Protein Kinase C Inhibitors. Thecurrent hypothesis concerning the mechanism by which PMAinduces expression ofgenes carrying AP-1 binding sequences

a23 5 6 X'8

I w

:>Ce

0)

a)cr

60

30 -

ri75 I~-VNM

r- CM0N m

o I

0 0IN Jc I

LO0 Y l

0 -I- --

inducer: None HO PMA

FIG. 6. Activation of the EpRE of GST Ya gene by electrophilicinducers in the presence of protein kinase C inhibitors. Transienttransfections were carried out in HepG2 cells with 754-714Ya-catconstruct followed by a 90-min exposure to 100 ,LM H7 or 100 nMK252a (protein kinase C inhibitors) where indicated. The cells werethen exposed for 16 h to 30 ,uM tert-butylhydroquinone (bars HQ) or100 nM PMA.

proposes that activation of protein kinase C is a primarytarget for phorbol esters (14). The activated protein kinase Cis then assumed to modulate, probably by specific phosphor-ylation, the activity or abundance of cellular proteins thatregulate transcription through AP-1 sequence elements (9,10). To assess the involvement of protein kinase C in theinduction of CAT activity from the 754-714Ya-cat constructby electrophilic compounds, inhibitors of protein kinase Cactivity such as H7 [1-(5-isoquinolinesulfonyl)-2-methylpip-erazine dihydrochloride] (20) and K252a (21) were used. Fig.6 shows that, after transfection of the 754-714Ya-cat geneconstruct into HepG2 cells, addition of the protein kinase Cinhibitors 90 min before addition of the inducers did notreduce the level of the basal or tert-butylhydroquinone- orPMA-inducible CAT activity.

3

c-Jun

c- Fos

HQ

2 3 4 5 6 7 8

+ + - -+i-- 1 + +1-1+1-1+1-1 + -

,*% Acetylation 04 08 2.8 09 2.6 47 9.2 813

FIG. 5. Binding and transactivation of EpRE by Jun and Fosproteins. (A) Gel shift assay for binding of in vitro-synthesized Junand Fos proteins. Reticulocyte lysates containing equal amounts ofc-Jun (lanes 1 and 5), c-Fos (lanes 2 and 6), c-Jun plus c-Fos (lanes3 and 7), or c-Jun plus c-Fos plus a 100x molar excess of unlabeledEpRE oligonucleotide (lanes 4 and 8) were mixed with 2 x 104 cpmof an [a-32P]dATP-labeled AP-1-site-containing a 28-bp oligonucle-otide (lanes 1-4) or a 41-bp EpRE oligonucleotide (lanes 5-8) inreaction mixtures as described (17). After incubation at 23°C for 15min, the reaction products were analyzed on a native 5% polyacryl-amide gel in 0.5 x TBE (1x TBE is 89 mM Tris/89 mM boric acid/2.5mM EDTA). (B) Transactivation of EpRE by Jun and Fos proteins.Five micrograms of plasmid -187Ya-cat (lane 1) or EpRE-containing754-714Ya-cat (lanes 2-8) and 5 ,ug of RSVgal (internal control fortransfection efficiency) were cotransfected into F9 cells with variouscombinations of 5 ,tg of expression plasmids RSV-c-Jun and RSV-c-Fos as indicated. Twenty-four hours after transfection, the cellswere exposed for 16 h to 30 ,uM tert-butylhydroquinone (HQ) whereindicated (+). All CAT activities were standardized with ,-galacto-sidase activity and calculated from three separate transfection ex-

periments.

DISCUSSIONThis study shows that electrophile-inducible expression ofthe GST Ya subunit gene is mediated by two adjacentAP-1-like binding sites that constitute what has been definedas an EpRE (6). The AP-1 binding sites, originally identifiedas PMA response elements (9, 10), are present in many genes,some of which are not induced by PMA (22, 23) and exhibita rather loose AP-1 consensus sequence. Presently, it is notknown whether this sequence variability affects the recog-nition or the binding affinity of particular Jun-Fos proteincomplexes for the AP-1 site.The study of the EpRE of the GST Ya gene suggests that

the deviation from a consensus AP-1 sequence may play arole in the modulation of gene expression. Thus, the twoAP-1-like binding sites of the EpRE, when assayed sepa-rately, confer a lower basal activity to the Ya gene promoterthan the consensus AP-1 sequence and show no inducibility(Figs. lB and 4, bars D and E). The lower basal activities ofthese AP-1-like sites, which correlate with their divergencefrom the consensus sequence (see Fig. 2), may suggest alower affinity of AP-1 binding factors for the imperfectAP-1-like sites. Two imperfect AP-1 sites at close distance,however, act synergistically to form an EpRE inducible bytert-butylhydroquinone, f3-naphthoflavone, and PMA (Figs.1B and 3). It should be observed that inducibility is maximalonly when the basal enhancer activity is low. Thus fiveimperfect AP-1 sites, which augment the basal activity by-50-fold, have only residual inducibility (Fig. 1C). Similarly,in experiments in which the transfection of EpRE constructsinto HepG2 cells is very efficient, we find a high basal activityand poor inducibility. These data suggest that multiple copies

Biochemistry: Friling et al.

Proc. Natl. Acad. Sci. USA 89 (1992)

of AP-1 binding sites reduce the sensitivity to the smallincreases in abundance or activity of the binding factorscaused by the electrophilic induction (6, 10).The inducibility of a single consensus AP-1 site is low

compared to that of the EpRE (Figs. 3 and 4). The increasedinducibility of EpRE is evidently related to the synergisticeffect of the two adjacent AP-1-like sites. Our results suggestthat electrophile-inducible elements with such a structure areimportant in regulating the magnitude of the electrophilicresponse and may occur more generally. Arrangements oftwo adjacent AP-1 sites, one or both of which deviate insequence from AP-1 consensus, can be observed in the PMA-and antioxidant-responsive regions of a number of genes (8,11, 24-26). Two adjacent AP-1-like sites located >2 kilobasesupstream of the transcription start site of a rat placental GSTgene were found to be responsive toPMA induction, whereasa single-copy consensus sequence AP-1 site located in theproximal promoter region had no inducibility (26).The present findings indicate that members of the Jun and

Fos protein families bind to the EpRE and are essential forthe basal and inducible activities of this element. Thus a100-fold increase of the EpRE basal expression is observedin F9 cells only in the presence of both exogenous c-Jun andc-Fos (Fig. 5B, lane 8). In a titration experiment, a steadyincrease in EpRE activity proportional to the amounts ofexogenous c-Jun and c-Fos was observed (data not shown).The low-level (3-fold) increase in 754-714Ya-cat expressionby tert-butylhydroquinone (Fig. 5B) orPMA (data not shown)may reflect the reported induction of endogenous c-Fos andJun-B in F9 by PMA (27). The electrophile-induced levels ofendogenous Jun and Fos seem, however, to be insufficient toactivate the EpRE to its full capacity. The ability of exoge-nous c-Fos alone to cause a 6-fold EpRE-mediated enhance-ment in F9 cells implies its heterodimerization with anendogenous Jun-related protein that by itself is not sufficientto activate the EpRE. The level of this Jun-related protein isfurther increased -2-fold by tert-butylhydroquinone (Fig.5B, lanes 6 and 7). The facts that in F9 cells the jun-D geneis constitutively expressed, the c-jun gene is not expressed orinduced, and jun-B is induced by PMA (27) make jun-B acandidate for EpRE activation. In addition, Jun-B is anefficient activator of constructs containing multimeric AP-1binding sites (27). Our data indicate that activation of EpREcannot be achieved by c-Jun homodimers alone but requiresthe Jun-Fos heterodimer complex.The tumor-promoting phorbol esters such as PMA, due to

their diacylglycerol structure, are thought to exert many oftheir biological effects by the direct activation of proteinkinase C (14). To account for induction ofgene expression byPMA, it was first assumed that the PMA-activated proteinkinase C modulates the activity of AP-1 binding factors byspecific phosphorylation (9, 10). We presently demonstrate,however, that PMA acts as an electrophilic inducer at theEpRE of the GST Ya gene and, since its activity is notaffected by protein kinase C inhibitors (Fig. 6), PMA acts bya pathway independent of protein kinase C. It should benoted that PMA- or serum-induced phosphorylation of c-Fosprotein was also found to be independent of protein kinase Cactivation (28).

The data presented here show that the AP-1 site is part ofan EpRE activated by chemicals that contain an electrophiliccenter. The mechanism by which the electrophilic signal istransmitted to induce members ofjun and fos gene familiesand modulate the AP-1 DNA binding activities remains to beelucidated.

We thank Y. Tichauer for expert DNA sequencing and H. Alonifor technical help. This work was supported in part by researchgrants from the Israel Cancer Research Fund and the Basic ResearchFoundation of the Israel Academy of Sciences and Humanities.

1. Prochaska, H. J., De Long, M. J. & Talalay, P. (1985) Proc.Natl. Acad. Sci. USA 82, 8232-8236.

2. Talalay, P., De Long, M. J. & Prochaska, H. J. (1987) inCancer Biology and Therapeutics, eds. Cory, J. G. & Szenti-vanyi, A. (Plenum, New York), pp. 197-216.

3. Prochaska, H. J. & Talalay, P. (1988) Cancer Res. 48, 4776-4782.

4. Talalay, P., De Long, M. J. & Prochaska, H. J. (1988) Proc.Natl. Acad. Sci. USA 85, 8261-8265.

5. Spencer, S. R., Xue, L., Klenz, E. M. & Talalay, P. (1990)Biochem. J. 273, 711-716.

6. Friling, R. S., Bensimon, A., Tichauer, Y. & Daniel, V. (1990)Proc. Nati. Acad. Sci. USA 87, 6258-6262.

7. Rushmore, T. H., King, R. G., Paulson, E. K. & Pickett, C. B.(1990) Proc. Natl. Acad. Sci. USA 87, 3826-3830.

8. Rushmore, T. H. & Pickett, C. B. (1990) J. Biol. Chem. 265,14648-14653.

9. Lee, W., Haslinger, A., Karin, M. & Tjian, R. (1987) Nature(London) 325, 368-372.

10. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J.,Rahmsdorf, H. J., Jonat, C., Herrlich, P. & Karin, M. (1987)Cell 49, 729-739.

11. Angel, P., Bauman, I., Stein, B., Delius, H., Rahmsdorf, H. J.& Herrlich, P. (1987) Mol. Cell. Biol. 7, 2256-2266.

12. Curran, T. & Franza, R. B., Jr. (1988) Cell 55, 395-397.13. Cohen, D. R. & Curran, T. (1989) Crit. Rev. Oncogen. 1,

65-88.14. Nishizuka, Y. (1984) Nature (London) 308, 693-698.15. Daniel, V., Sharon, R. & Bensimon, A. (1989)DNA 8, 399-408.16. Daniel, V., Maksymowych, A. B., Alnemri, E. S. & Litwack,

G. (1991) J. Biol. Chem. 266, 1320-1325.17. Nakabeppu, Y., Ryder, K. & Nathans, D. (1988) Cell 55,

907-915.18. Kryszke, M. H., Piette, J. & Yaniv, M. (1987) Nature (London)

328, 254-256.19. Chiu, R., Boyle, W. J., Meek, J., Smeal, T., Hunter, T. &

Karin, M. (1988) Cell 54, 541-552.20. Kawamoto, S. & Hidaka, H. (1984) Biochem. Biophys. Res.

Commun. 125, 258-266.21. Kase, H., Iwahashi, K., Nakanishi, S., Matsuda, Y., Yamada,

K., Takahashi, M., Murakata, C., Sato, A. & Kaneko, M.(1987) Biochem. Biophys. Res. Commun. 142, 436-440.

22. Franza, B. R., Jr., Rauscher, F. J., III, Josephs, S. F. &Curran, T. (1988) Science 239, 1150-1153.

23. Morrow, C. S., Goldsmith, M. E. & Cowan, K. H. (1990) Gene88, 215-225.

24. Matrisian, L. M., Leroy, P., Ruhlmann, C., Gesnel, M.-C. &Breathnach, R. (1986) Mol. Cell. Biol. 6, 1679-1686.

25. Diamond, M. I., Miner, J. N., Yoshinaga, S. K. & Yamamoto,K. R. (1990) Science 249, 1266-1271.

26. Sakai, M., Okuda, A. & Muramatsu, M. (1988) Proc. Natl.Acad. Sci. USA 85, 9456-9460.

27. Chiu, R., Angel, P. & Karin, M. (1989) Cell 59, 979-986.28. Barber, J. R. & Verma, I. M. (1986) Mol. Cell. Biol. 7, 2201-

2210.

672 Biochemistry: Friling et al.