INSERM U397, Endocrinologie et Communication Cellulaire, Institut Federatif de RechercheLouis Bugnard, CHU Rangueil, 31403 Toulouse cedex 04, France
Received 3 April 1998/Returned for modification 2 June 1998/Accepted 4 August 1998
The mRNA of vascular endothelial growth factor (VEGF), the major angiogenic growth factor, contains anunusually long (1,038 nucleotides) and structured 5* untranslated region (UTR). According to the classicaltranslation initiation model of ribosome scanning, such a 5* UTR is expected to be a strong translation inhib-itor. In vitro and bicistronic strategies were used to show that the VEGF mRNA translation was cap indepen-dent and occurred by an internal ribosome entry process. For the first time, we demonstrate that two inde-pendent internal ribosome entry sites (IRESs) are present in this 5* UTR. IRES A is located within the 300nucleotides upstream from the AUG start codon. RNA secondary structure prediction and site-directed mu-tagenesis allowed the identification of a 49-nucleotide structural domain (D4) essential to IRES A activity. UVcross-linking experiments revealed that IRES A activity was correlated with binding of a 100-kDa protein to theD4 domain. IRES B is located in the first half of the 5* UTR. An element between nucleotides 379 and 483 isrequired for its activity. Immunoprecipitation experiments demonstrated that a main IRES B-bound proteinwas the polypyrimidine tract binding protein (PTB), a well-known regulator of picornavirus IRESs. However,we showed that binding of the PTB on IRES B does not seem to be correlated with its activity. Evidence isprovided of an original cumulative effect of two IRESs, probably controlled by different factors, to promote anefficient initiation of translation at the same AUG codon.
The vascular endothelial growth factor (VEGF) is a potentendothelial cell mitogen that plays a crucial role in the regu-lation of both physiologic and pathologic angiogenesis (10, 44).VEGF is involved not only in embryogenic development anddifferentiation of the vascular system, in wound healing, and inreproductive function but also in pathologic angiogenic pro-cesses such as proliferative retinopathies, tumor growth, arthri-tis, and psoriasis (10).
Numerous studies have been devoted to understanding theexpression regulation of this factor, especially at the transcrip-tional level. A wide range of cytokines or oncogenic proteins,including interleukins 1b (31) and 6 (8), insulin-like growthfactor 1 (IGF-1) (14), tumor growth factor b (TGF-b) (5),c-Src (36), v-Raf (15), and Ras (46), and oxygen tension havebeen shown to regulate VEGF gene transcription (48). VEGFmay also be posttranscriptionally regulated. The VEGF pre-mRNA undergoes alternative splicing which generates fourpolypeptide isoforms of 121, 165, 189, and 206 amino acids(11), the functions of which have not yet been fully defined.VEGF mRNA stability is also influenced by hypoxic conditionsor by IGF-1 expression (49, 57). Finally, posttranslational mod-ifications of VEGF isoforms, including plasmin and urokinaseproteolysis or glycosylation, have been described (11, 43).
Surprisingly, very little is known about the possible transla-tional control of VEGF messenger except for a stimulatoryeffect on VEGF translation in CHO cells overexpressing thecap binding protein eukaryotic initiation factor 4E (eIF4E)
(25). However, the VEGF mRNA presents unusual featuresalso found in other RNAs of viral origin or transcribed fromcellular proliferation regulator genes, such as the fibroblastgrowth factor 2 (FGF-2) gene, the platelet-derived growthfactor (PDGF) gene, or the c-myc proto-oncogene. The 59untranslated region (UTR) of the mRNA is unusually long, asthe transcription starting point is located 1,038 nucleotides (nt)upstream from the AUG initiation codon and heavily struc-tured due to a high percentage of G and C residues. The 59UTR region also contains three noncanonical upstream CUGcodons in frame with the initiator AUG codon. All of theseelements make the use of a conventional ribosome scanningmodel for translation initiation very difficult (26).
A cap-independent mechanism involving an internal ribo-some entry site (IRES) has been identified in picornavirusmessengers, which are uncapped and present a long 59 UTR(20, 41). The presence of an IRES has also been reported formany viral (cardiovirus, rhinovirus, and aphthovirus) (21) andsome cellular human (Bip, FGF-2, IGF-II, eIF4G, PDGF, andc-Myc) (2, 13, 33, 37, 50, 51, 53) messengers and in Drosophilaantennapedia and ultrabithorax mRNAs (39, 59). The IRESsdiscovered so far differ in their primary sequences but showsimilarities in their secondary structures which appear to becrucial to IRES function (21, 28). In several picornaviruses, theinternal entry process has been shown to require cellular fac-tors including the polypyrimidine tract binding protein (PTB)(1), which is also involved in the nuclear splicing regulatorypathway (40, 56).
We show here that the mRNA of the major angiogenicfactor is translated by an internal ribosome entry process. Fur-thermore, we demonstrate that the VEGF 59 mRNA leadercontains two independent IRESs which are able to promoteefficient translation at the AUG start codon. The patterns of
* Corresponding author. Mailing address: INSERM U397, Endocri-nologie et Communication Cellulaire, Institut Federatif de RechercheLouis Bugnard, CHU Rangueil, Ave. Jean Poulhes, 31403 Toulousecedex 04, France. Phone: 33 (5) 61 32 21 44. Fax: 33 (5) 61 32 21 41.E-mail: [email protected].
cellular proteins binding to the two IRESs are clearly different.These data suggest that different factors could control theactivities of these IRESs.
MATERIALS AND METHODS
Plasmid constructions. The VEGF cDNAs and the DNA fragment corre-sponding to 59 UTR of the messenger were kindly provided by J. Abraham (52)and cloned into a pKS-derived plasmid. PCR was performed with sense oligo-nucleotide 59AAATCTAGAATTCGCGGAGGCTTGGGGCA39 and antisenseoligonucleotide 59GGTATCGATTGGATGGCAGTAG39 to construct a trans-lational fusion between VEGF and chloramphenicol acetyltransferase (CAT).The amplified fragment extending from positions 1 to 1205 (corresponding to the59 UTR and the 167 nt downstream from the AUG codon) was cloned in apreviously described pSCT-derived vector (45) upstream from the CAT codingsequence, under the control of cytomegalovirus (CMV) and T7 promoters. Thischimeric construct, called pVC, was expected to encode one VEGF-CAT proteinof 32 kDa.
A hairpin (DG 5 240 kcal/mol) (described in reference 53) was introducedinto the pVC construct between the promoters and the 59 end of VEGF cDNA,leading to the pHVC construct. Bicistronic vectors were constructed from thepreviously described pSCTCAT plasmid, which contains the CAT gene down-stream from the CMV promoter (45). The IVS2b intron was removed from thisplasmid, and a synthetic intron, obtained from plasmid pRLCMV (Promega),was added just downstream from the CMV promoter. A second CAT gene wasthen introduced downstream from the intron. This intermediate vector wascalled pCC. All or part of the 59 UTR leader of VEGF plus 167 nt of the codingsequence was then cloned in the intercistronic region between the two CATgenes. The bicistronic vector containing the entire 59 UTR (nt 1 to 1205),designated pCVC, was expected to encode two CAT proteins of 24 and 32 kDa.The above-described hairpin (DG 5 240 kcal/mol) was introduced into pCVCbetween the CMV promoter and the first cistron. This construct was designatedpHCVC. Different deletions of the VEGF 59 UTR were performed. Removal ofthe first 475 nt in the 59 UTR (up to the BamHI site) resulted in plasmid pCVC1,removal of the first 654 nt (up to the XmnI site) resulted in pCVC2, removal ofthe first 745 nt (to Nhe site) yielded pCVC3, removal of the first 846 nt (to theBanII site) resulted in pCVC4, and removal of the first 917 nt (up to the Smasite) gave pCVC5. We then constructed another bicistronic plasmid to determinethe 39 border of the IRES. This plasmid contained the entire VEGF 59 UTR, inwhich the AUG codon of VEGF was directly fused to a chimeric CAT gene(fCAT) resulting from translational fusion of part of the nucleolin gene with theCAT gene (pSVNC82) (9). This chimeric fCAT gene was used to discriminatebetween the products of the two CAT cistrons encoded by this bicistronic vectorduring Western immunoblotting. This 59 UTR-fCAT fusion was obtained byPCR amplification using oligonucleotides T7 (matching sequence upstream fromthe 59 UTR), and 59 AAACCTAGGGCCCAAGTTCATGGTTTCGGAG 39(matching nt 1029 to 1046) on plasmid pVC. This PCR fragment was digested atthe ApaI site (underlined sequence) and fused to fCAT in the pCC vectordeleted from the second CAT cistron. This CAT-VEGF 59 UTR (nt 1 to 1046)-fCAT-containing plasmid was called pCVC0. Several deletions were then madefrom this plasmid in the VEGF 59 UTR. The plasmid was called pCVC30 whenthe first 745 nt were deleted, pCVC60 when nt 654 (XmnI site) to 917 (Sma site)were removed, pCVC70 when nt 554 (NaeI site) to 1013 (NaeI site) were deleted,pCVC90 when nt 1 to 91 (AgeI site) as well as nt 554 to 1013 were removed, andpCVC80 when nt 332 (SacI site) to 1013 (NaeI site) were deleted.
We also constructed a set of bicistronic vectors containing two different re-porter cistrons, i.e., the renilla and firefly genes coding for luciferase enzyme,designated LUCr and LUCf, respectively. LUCr was cloned from plasmidpRLCMV (Promega), whereas the LUCf gene was obtained from plasmidpGL3LUCf (Promega). For technical convenience, the XbaI and NarI sitespresent in the 59 end of the LUCf cDNA were mutated by a single base pairchange using complementary oligonucleotides (59 CTAGTGGATAGAATGGTGCCGGGCCTTTCTTTATGTTTTTGGCGTCTTCCATACCA 39 and 59 AGCTTGGTATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCACCATTCTATCCA 39). The backbone of this new bicistronic vector was the same asthat of pCVC. The full 59 UTR (nt 1 to 1046) was cloned between the two LUCgenes; this construct was called pRVL1. We also cloned nt 745 to 1046 in theintercistronic region and called the construct pRVL2.
A deletion was performed in pRVL2 in which nt 848 (BanII site) to 918 (Smasite) were replaced with complementary oligonucleotides 59 CATGGACAGGCCCTGGC 39 and 59 CCGGGCCAGGGCCTGTCCATGAGCC 39. This con-struct was called pRVL2DD4. Another deletion plasmid (pRVL3) constructedfrom pRVL2 consisted of a deletion of nt 917 (Sma site) to 1013 (NaeI site).pRVL4 contained a 59 UTR fragment limited by nt 801 to 1046 in the intercis-tronic space. This fragment was obtained by PCR from plasmid pCVCO, us-ing oligonucleotide 59 TTTGGATCCGAAGGAAGAGGAGAGGGGGC 39(matching residues 798 to 817) and a reverse one located in the CAT gene (59GCAACTGACTGAAATGCC 39). This amplified fragment was then restrictedat the ApaI (see description of pCVCO above) and BamHI (underlined) sites toobtain only the corresponding VEGF sequence. pRVL6 was obtained aftercloning of the 59 UTR fragment (nt 91 to 554 and 1013 to 1039) contained in
plasmid pCVC90 between the two LUC genes. pRVL7, pRVL8, pRVL9, andpRVL10 were constructed from pRVL6 after deletion of nucleotides 483 (PvuIsite) to 1013 (NaeI site), 379 (BssHII site) to 1013, 332 (SacI site) to 1013, and189 (DraI site) to 1013, respectively. pRVL11 contained nt 134 to 483 and 1013to 1039. This fragment was obtained from plasmid pRVL6 by PCR using oligo-nucleotide 59 AAAGAATTCAGATCTTTGATATTCATTGATCCGGG 39(matching residues 134 to 155) and a reverse one located in the LUCf gene. Thisamplified fragment was then restricted by the EcoRI (underlined) and the PvuIsites and recloned in the intercistronic space. pRVL12 was constructed in thesame way, using oligonucleotide 59 AAAGAATTCAGATCTTGAATCGGGCCGACGGCT 39 (matching residues 241 to 260), and thus contained nt 241 to483 and 1013 to 1039 between the two LUC genes. pRVL13 consisted of adeletion of nucleotides 379 (BssHII site) to 1013 (NaeI site) from pRVL12.
Monocistronic vectors derived from plasmid pSCTCAT in which VEGF 59UTR fragments had been introduced upstream from the CAT gene were con-structed for cross-linking experiments. pVC30 contained nt 745 to 1046 upstreamfrom the CAT gene. We also cloned the mutated 59 UTR fragment contained inpRVL2DD4 (nt 745 to 858 and 907 to 1046) upstream from the CAT gene. Thisplasmid was called pVC30DD4. pVC1 was a pVC-derived plasmid in which nt 1to 475 were deleted. Probes C and D (see Fig. 8A) are derived from plasmidspSKV3 and pKSV4, pKS-derived vectors in which were inserted the VEGF 59UTR regions contained in plasmids pRVL11 (nt 134 to 483 and 1013 to 1046)and pRVL12 (nt 241 to 483 to 1013 to 1046), respectively.
Two new plasmids, pVC80 and pVC90, were constructed for in vitro transla-tion by inserting the fragments of the VEGF 59 UTR contained in plasmidspCVC80 and pCVC90 (nt 1 to 332 and 1013 to 1046 and nt 91 to 554 and 1013to 1046) into the pSCTCAT vector upstream from the CAT gene. We alsoconstructed vector pVC5, a derivative from pVC in which nt 1 to 917 weredeleted.
Probes transcribed from two pKS-derived vectors, called pKSV1 and pKSV2,were used for the RNase protection assays. We inserted nt 1 to 745 (bordered byEcoRI and NheI sites) into plasmid pKS digested at the XbaI and EcoRI sites inpKSV1. In pKSV2, we inserted nt 1 to 1046 (bordered by the XbaI and ApaIsites) into plasmid pKS digested by XbaI and ApaI.
In vitro translation. Plasmids pVC, pVC90, pVC80, pVC30, and pVC30DD4were linearized downstream from the 39 end of the CAT coding sequence at theBglII site. pSCT11A (53) was linearized downstream from the 39 end of theFGF-2 coding sequence at the HindIII site. Capped or uncapped RNAs weregenerated in vitro, using the T7 mMessage mMachine kit (Ambion) according tothe manufacturer’s instructions, with or without adding m7GpppG (0.5 mM) tothe transcription reaction. RNA transcripts were quantified by absorbance at 260nm and ethidium bromide staining on an agarose gel, which also allowed veri-fication of their integrity. In vitro translation in rabbit reticulocyte lysate (RRL;Promega) was performed as previously described (45), in the presence of [35S]methionine (Amersham). Translation products were analyzed by polyacrylamidegel electrophoresis (PAGE) in a sodium dodecyl sulfate (SDS)–12.5% polyacryl-amide gel (45); the dried gels were scanned with a PhosphorImager apparatus(Molecular Dynamics), and quantification of the bands was performed withImagequant software.
DNA transfection and Western immunoblotting. COS-7 monkey cells weretransfected with Fugene-6 transfection reagent (Boehringer) according to man-ufacturer’s instructions or by the DEAE-dextran method as described previously(45). Forty-eight hours after transfection, either (i) the cells were scraped inphosphate-buffered saline (PBS) and the pellets were resuspended in 1% SDSsolution and sonicated or (ii) the cells were lysed in 1 ml of Tri-Reagent (Eu-romedex). Following the latter method and after total RNA extraction (seebelow), the proteins were precipitated with 1 volume of isopropanol. The proteinpellet was then washed five times in 2 ml of a 0.3 M guanidine hydrochloride–95% ethanol buffer and once in 2 ml of ethanol. The protein pellet was thenheated to 65°C for 20 min and resuspended in 1% SDS solution. Total proteinswere quantified by the bicinchoninic acid assay (Pierce) (absorbance at 562 nm),and 10 mg of proteins from each cell lysate was used for Western immunoblot-ting. In summary, lysates were heated for 2 min at 95°C in SDS- and dithiothre-itol (DTT)-containing sample buffer, separated in a 12.5% polyacrylamide gel,and transferred onto a nitrocellulose membrane. CAT proteins were immuno-detected with rabbit polyclonal anti-CAT antibodies prepared in the laboratory(1/10,000 dilution). Antibodies were detected with an enhanced chemilumines-cence kit (Amersham).
Cellular RNA purification. Total cellular RNAs were prepared by the Tri-Reagent method (Euromedex), derived from the guanidinium thiocyanate pro-cedure (7). A total of 5 3 106 transfected cells were scraped, centrifuged, andlysed in 1 ml of Tri-Reagent. RNA was extracted after addition of 0.2 ml ofchloroform and precipitated with isopropanol. After an ethanol wash and pre-cipitation, the RNA was quantified by measuring the absorbance at 260 nm andchecked for integrity by electrophoresis on an agarose gel and ethidium bromidestaining.
RNase mapping. A complementary-strand RNA probe was generated in vitroby T7 or T3 RNA polymerase (Promega) according to manufacturer’s instruc-tions, using a linearized DNA template and in the presence of 50 mCi of[a-32P]UTP. Probe A was transcribed by using T3 polymerase from plasmidpKSV2 linearized at the XbaI site. Probe C was transcribed by using T3 poly-merase from plasmid pKSV2 linearized at the BamHI site. Probe B was tran-
scribed by using T7 polymerase from plasmid pKSV1 linearized at the EcoRIsite. 32P-labeled RNA was purified by using the RNaid kit (Bio 101). The RNaseprotection experiments were performed with an RPAII kit (Ambion) accordingto the manufacturer’s instructions. A 10-mg aliquot of total cellular RNA and alarge excess (2 3 106 cpm) of probe were precipitated with ethanol; 10 mg ofyeast RNA can be added to the total RNA before precipitation to increase thesize of the RNA pellet. All experiments described were tested with and withoutaddition of RNA. As a control experiment, total RNA samples were incubated15 min at 37°C in the presence of 10 U of RNase-free DNase 1 prior to theprecipitation in order to avoid DNA contamination. The pellet was resuspendedin 20 ml of hybridization buffer, heated at 90°C for 4 min, and incubated at 42°Cfor 14 h. Then 200 ml of RNase digestion buffer containing 20 U of RNase T1 and1 mg of RNase A were added, and the reaction mixture was incubated for 30 minat 37°C; 300 ml of inhibitor RNase buffer and 10 mg of carrier yeast RNA werethen added, and the reaction mixture was precipitated at 220°C for 20 min. Thepellet was resuspended in 8 ml of gel loading buffer, denatured, and fractionatedon a 5% acrylamide–8 M urea gel at 200 V for 1.5 h. The gel was then fixed,dried, and autoradiographed. Control experiments showed that all probes de-scribed, used alone or only with yeast RNA, were totally digested after RNasemix treatment.
UV cross-linking assay and immunoprecipitation. Cytoplasmic extracts fromCOS-7 cells were prepared as previously described (53). Confluent cells werescraped in PBS and centrifuged. The cell pellet was resuspended in lysis buffer(10 mM NaCl, 10 mM Tris-HCl [pH 7.4], 0.5 mM phenylmethylsulfonyl fluoride,0.5 mM DTT), and frozen-thawed three times. The extract was centrifuged at12,000 3 g for 10 min, and the supernatant (S10) was brought to 5% (vol/vol)glycerol and frozen in aliquots at 280°C.
Probes A (nt 1 to 1121) and B (nt 1 to 475) (see Fig. 6A) were transcribed byusing T7 polymerase from plasmid pVC linearized at the NcoI site and BamHIsites, respectively. Probe C (nt 475 to 1121; Fig. 6A) was transcribed by using T7polymerase from plasmid pVC1 linearized with NcoI. Probes D (nt 745 to 1046)and E (nt 745 to 858 and 907 to 1046) (Fig. 6A) were transcribed by using T7polymerase from plasmids pVC30 and pVC30DD4 linearized with Bsp120.1.Probes A (nt 91 to 554 and 1013 to 1046) and B (nt 91 to 189) (Fig. 8A) weretranscribed from plasmid pVC90 linearized with Bsp120.1 and DraI, respectively.Probes C (nt 134 to 483) and D (nt 241 to 483) (Fig. 8A) were transcribed fromplasmids pKSV3 and pKSV4 linearized with NaeI.
32P-labeled RNA probes (1 3 106 to 1.5 3 106 cpm) were incubated with 6 mgof S10 extract, preincubated or not with 2.5 mg of calf liver tRNA (BoehringerMannheim) for 15 min at 30°C, in buffer containing 5 mM HEPES (pH 7.5), 25mM KCl, 2 mM MgCl2, 3.8% glycerol, 0.2 mM DTT, and 1.5 mM ATP in a finalvolume of 10 ml at 30°C for 15 min (34). Samples were transferred to ice andirradiated with a UV Stratalinker (Stratagene) by being fixed 10 cm from thebulbs and routinely irradiated with 400,000 mJ/cm2 at 254 nm; 2.5 mg of calf livertRNA was then added to calibrate the RNase digestion when no prior incubationof the S10 extract with tRNA had been performed. The samples were thentreated with a mix of RNase ONE (5 U; Promega) and 2.5 mg of RNase A at 37°Cfor 30 min and, when indicated, with proteinase K (Sigma) at 37°C for 20 min ata final concentration of 1 mg/ml. PAGE sample buffer was added, and thesamples were heated for 2 min at 95°C and loaded on an SDS–10 or 12.5%polyacrylamide gel. The gel was fixed in 30% methanol–10% acetic acid for 30min, dried, and autoradiographed.
The cross-linked proteins were immunoprecipitated with Pansorbin as follows.Ten microliters of the cross-linked 32P-labeled sample (see below) was diluted to150 ml in PBS–Nonidet P-40 (NP-40) buffer (13 PBS, 50 mM NaF, 2 mM EDTA,2 mM EGTA, 0.05% NP-40) and precleared by incubation with 50 ml of Pan-sorbin for 10 min at room temperature (RT). The supernatant was incubated for30 min at RT with 5 ml of anti-PTB antibody (kindly provided by J. G. Patton)(40) and then for 30 min at RT with 50 ml of Pansorbin. After five washes inHEPES–NP-40 buffer (150 mM NaCl, 15 mM HEPES [pH 7.4], 1 mM EDTA[pH 7.4], 0.5% NP-40), the samples were analyzed by PAGE (10 or 12.5% gel)as described above.
Dual luciferase assay. LUCf and LUCr activities were measured by using theDual-Luciferase reporter assay system (Promega). Transfected COS-7 cell plates(60 by 15 mm) or 24-well dishes were rinsed twice with PBS, scraped, andhomogenized in 400 ml of lysis reagent provided with the kit 24 to 48 h aftertransfection. The lysate was cleared by a 2-min centrifugation at 4°C. Chemilu-minescent signals were measured in a luminometer (Berthold) equipped withautomatic injectors. A 20-ml volume of extract was incubated with 100 ml ofLuciferase Assay Reagent II (Promega) for 2 s, and LUCf activity was measuredfor a period of 15 s; 100 ml of Stop and Glo buffer (Promega), stopping the fireflyenzymatic reaction and containing the substrate for LUCr enzyme, was theninjected. Luminescence corresponding to LUCr activity was measured for 15 sstarting 3 s after injection.
RESULTS
Identification of an IRES in the 5* UTR of the VEGF mRNA.Two alternative strategies involving hairpin-containing mono-cistronic vectors or bicistronic vectors were used to study wheth-er VEGF expression was translationally regulated by an inter-
nal ribosome entry process. The first approach had beensuccessful for identification of Moloney murine leukemia virusIRES (55), and the second had been used to identify IRESs inseveral viral and cellular mRNAs (22, 33, 41).
DNA plasmids were designed to contain the 1,038 nt of theVEGF 59 UTR and the first 167 nt of its coding sequence fusedin frame with the CAT coding sequence (Fig. 1A). The pre-dicted size of the chimeric VEGF-CAT protein encoded bythis vector was 32 kDa. In the monocistronic plasmid (Fig. 1A,construct A [pVC]), this 59 UTR-VEGF-CAT sequence wascontrolled by the CMV and T7 promoters. In a second con-struct, a stable (DG 5 240 kcal/mol) hairpin was added down-stream from the promoters to impair the cap-dependent ribo-some scanning (construct B [pHVC]). This latter construct wasexpected to encode a 32-kDa VEGF-CAT protein only if therewas an IRES in the VEGF mRNA leader.
Two bicistronic constructs were also derived from the pVCconstruct by subcloning the CAT coding sequence upstreamfrom the 59 UTR-VEGF-CAT sequence (Fig. 1A, construct C[pCVC]) and adding a 59 hairpin structure upstream from theCAT first cistron (construct D [pHCVC]). A 24-kDa CATprotein and a 32-kDa VEGF-CAT protein were expected to betranslated from the first and second cistrons, respectively, if theVEGF mRNA 59 UTR contained an IRES.
The four constructs were separately transfected into COS-7cells, and the translation products were analyzed by Westernimmunoblotting using an anti-CAT antibody (Fig. 1B). Theamount of mRNA encoded by the transfected constructs wasanalyzed in each extract by RNase protection assay, and thesignals were quantified with a PhosphorImager (data not shown).The amounts of transfected COS-7 cell protein extracts in-volved in the Western blotting experiment were adjusted to thequantity of mono- and bicistronic mRNAs present in each
FIG. 1. Identification of an IRES in the VEGF mRNA 59 UTR. (A) Sche-matic representation of the chimeric constructs used for transfection experi-ments. pVC (construct A) corresponds to the VEGF-CAT fusion in which nt 1to 1205 of the VEGF cDNA were fused to the CAT coding sequence (seeMaterials and Methods). This fusion gives rise to a chimeric VEGF-CAT proteinof 32 kDa. pHVC (construct B) is derived from pVC and carries an additional 59hairpin (DG 5 240 kcal/mol) downstream from the CMV promoter. pCVC(construct C) is a bicistronic vector containing the CAT gene as a first cistronupstream from the VEGF-CAT fusion in the pVC construct. pHCVC (constructD), derived from pCVC, contains a 59 hairpin (DG 5 240 kcal/mol) upstreamfrom the first CAT cistron. (B) The constructs depicted in panel A were tran-siently transfected in COS-7 cells, and their expression was analyzed by Westernimmunoblotting using an anti-CAT antibody. The amount of transfected cellprotein extract loaded on each lane was adjusted to the quantity of the mono-and bicistronic mRNAs present in each extract. The control (Ct) lane corre-sponds to untransfected COS-7 cells. The positions of CAT and VEGF-CATproteins are indicated by arrows.
extract. A 32-kDa VEGF-CAT protein was detected as a majorband with all four constructs, while a minor band band, prob-ably corresponding to a proteolysis product of the 32-kDaprotein, was observed at 28 kDa (Fig. 1B, lanes A to D). Theprotein was expressed from the hairpin-containing monocis-tronic vector pHVC (lane B) as well as from the bicistronicvector (lanes C and D), even though the level of expression waslower than that obtained from the monocistronic vector pVC.
This phenomenon had been observed previously with FGF-2and Moloney murine leukemia virus mRNAs (53, 55) and canbe explained by a contribution of cap-dependent initiation inaddition to the internal ribosome entry process in these vec-tors. Interestingly, the second cistron (VEGF-CAT) was moreefficiently expressed than the first cistron (CAT) from thebicistronic pCVC vector (lane C). Furthermore the presence ofa 59 hairpin in the bicistronic construct strongly decreased
FIG. 2. Mapping of the IRES by progressive deletions in the VEGF mRNA 59 UTR. (A) Schematic representation of the different deletions of the 59 leaderperformed in the bicistronic vectors pCVC and pHCVC. Only the pHCVC series is represented here. (B) Western immunoblotting was performed as described for Fig.1B after transfection of COS-7 cells with the constructs detailed in panel A. The presence or absence of a hairpin in the vector, as well as the name of the vector, isindicated above each lane. The same quantity of COS-7 cell protein extract was loaded in all lanes. Positions of the CAT and VEGF-CAT proteins are indicated witharrows. (C) Representation of two bicistronic vectors containing another VEGF-CAT fusion in which nt 1 to 1046 (including the AUG codon) of the VEGF 59 leaderare fused to the chimeric fCAT gene resulting from the translational fusion of part of the nucleolin gene with the CAT gene (9). These two plasmids were transfectedin COS-7 cells, and the extracts were analyzed as described for Fig. 1B. The positions of the CAT and fCAT proteins are indicated with arrows.
CAT translation without affecting that of the chimeric VEGF-CAT protein, thereby confirming that expression of the secondcistron was not due to a reinitiation event (lane D). Theseresults revealed the presence of a very efficient IRES in theVEGF mRNA leader sequence.
Localization of IRES A in the VEGF mRNA 5* UTR. Anumber of additional bicistronic constructs containing short-ened intercistronic UTRs, with or without a 59 hairpin (Fig.2A), were designed to more precisely localize the IRES struc-ture in the VEGF mRNA 59 UTR. Identical amounts of eachDNA construct were used to transfect COS-7 cells, and thelevel of protein synthesis was determined as described above.The same quantity of COS-7 cell protein extracts was loaded inall lanes.
As expected, the first cistron CAT was expressed in cellstransfected with the different constructs lacking the 59 hairpin(Fig. 2B, lanes A, C, E, G, I, and K), whereas its expression wasstrongly diminished in cells transfected with plasmids contain-ing the 59 hairpin (lanes B, D, F, H, J, and L). Expression of theVEGF-CAT second cistron was detected for deletions of thefirst 475, 654, and 745 nt of the VEGF 59 UTR (lanes C to H,respectively) and was not affected by the presence of a 59hairpin. In contrast, no expression of VEGF-CAT was ob-served with a shorter intercistronic sequence starting at posi-tion 846 or 917 of the leader 59 end.
These results indicate that the 101-nt-long fragment delim-ited by positions 745 and 846 (between positions 2293 and2192 upstream from the AUG codon) is required for theformation of a functional IRES. Hereafter this fragment willbe referred to as the IRES A 59 region. Although the 293 ntupstream from the AUG codon seem sufficient for IRESfunction, Fig. 2B shows that the translation efficiency of theVEGF-CAT mRNA decreased with shortening of the 59 UTR(compare lanes A to H). This finding suggests that sequenceslocated at different positions in the 59 UTR are required foroptimal IRES efficiency.
Two additional constructs were made to determine the in-volvement of the VEGF coding sequence located downstreamfrom the AUG codon in the internal entry process. They con-sisted of fusion of the full VEGF 59 UTR or its 39 293 bp up toand including the AUG codon with the chimeric fCAT geneand composed of 560 neutral nucleotides of the nucleolin cod-ing sequence in frame with the CAT gene. This chimeric fCATreporter gene was used to discriminate the products of the twoCAT cistrons in Western immunoblotting. The results showedan efficient expression of the fCAT protein from both con-structs (Fig. 2C), revealing that the first 167 coding nucleotidesof the VEGF coding region, present in the plasmids usedpreviously (Fig. 2A), were not required for efficient internalentry of the ribosomes on the messenger.
Altogether, these data clearly localize an IRES within the293 nt upstream from the AUG start codon of VEGF mRNA.This IRES will hereafter be called IRES A.
Verification of the bicistronic mRNA integrity in transfectedCOS-7 cells. Bicistronic RNA integrity was assessed by RNaseprotection assays (see Materials and Methods) to rule out thepossibility that the observed VEGF-CAT protein could be ex-pressed from unexpected monocistronic mRNA generated by acleavage or a cryptic promoter located in the VEGF 59 UTR.The protection experiments were performed with total RNAfrom COS-7 cells transfected with bicistronic or monocistronicconstructs containing either the complete leader sequence, adeletion of the first 475 nt, or a deletion of the last 293 nt (Fig.3A). Three probes, A, B, and C, with expected sizes of 1054,748, and 572 nt were used for hybridization with transfectedCOS-7 total RNA before RNase digestion; they were expected
to produce protected fragments of 1,017, 696, and 535 nt,respectively, after RNase digestion. The data presented in Fig.3B show that the protected fragments are unique and of theexpected sizes, thus demonstrating that the intercistronic re-gion is full size in the bicistronic mRNA.
Characterization of the structural features of IRES A. Fig-ure 4 shows the secondary structures, predicted by the Zukerprocedure (6), of the entire or 293-bp fragment of the 59 UTR(nt 745 to 1038) demonstrated to be sufficient for IRES func-tion (Fig. 2B). Extended base pairing is apparent all along thisUTR fragment, bringing the AUG codon in the vicinity of theIRES A 59 region (nt 745 to 846). A stem-loop structure, calledD5, bearing an unpaired GNRA (where N is C, G, A, or U andR is G or A; in this case GUGA) sequence is located in the firsthalf of the leader between nt 416 and 434. This motif wasshown to be common to picornavirus IRES and implicated inaphthovirus IRES function (32). Involvement of this predictedstructure in the VEGF IRES activity is discussed later.
Interestingly, two predicted structured domains (D3 and D4,
FIG. 3. Verification of the integrity of the bicistronic mRNA by RNaseprotection assay. (A) Schematic representation of monocistronic vector pVC(construct 1) and bicistronic vectors pCVC and pCVC1 (constructs 2 and 3) usedto generate RNA templates. The regions A9, B9, and C9, protected by the threeantisense RNA probes A, B, and C, are indicated. The RNA probes A, B, and Care slightly longer than the protected fragments because of the presence ofadditional nucleotides in the polylinker regions of the plasmids used as templatesfor the probes (see Materials and Methods). (B) Vectors shown in panel A weretransfected in COS-7 cells. Total mRNAs were purified and analyzed by RNaseA and T1 protection (see Materials and Methods), using the RNA probes A(1054 nt), B (748 nt), and C (572 nt), complementary to nt 1 to 1046, 1 to 745,and 475 to 1046, respectively. The first lane corresponds to a mix of the threeprobes alone, without RNase treatment. The RNA templates and probes usedare indicated at the bottom. The fragments protected by the probes A, B, and Care notated as A9 (1,017 nt), B9 (690 nt), and C9 (535 nt), respectively.
from nt 917 to 1013 and 858 to 907, respectively) are presentdownstream from the IRES A 59 region (Fig. 4B). Further-more, a DNA sequence comparison of the human (29), bovine(52), rat (30), and mouse (47) 39 ends of the VEGF mRNA 59UTR revealed several regions highly conserved in these spe-cies, particularly the region corresponding to the D4 domain
(Fig. 4C). This led us to study the potential role of theseevolutionary conserved domains in IRES function.
cis elements involved in IRES A activity. The predictedstructural data shown in Fig. 4 were used to design new dele-tions for further characterization of the VEGF IRES A. A newbicistronic vector was produced in which the LUCr gene was
FIG. 4. IRES A secondary predicted structures and sequence conservation in mammals. (A) Secondary structure of the complete VEGF mRNA 59 UTR predictedby the ESSA folding program (6). The 59 and 39 ends of the sequence corresponding to nt 1 and 1047, respectively, are indicated. Nucleotide positions and the IRESA predicted domains D1 to D4 are also indicated. D5 corresponds to a stem-loop structure bearing an unpaired loop-located GNRA sequence. (B) Secondary predictedstructure of the IRES A. Nucleotide positions and the four domains D1 to D4 are indicated. The 59 and 39 ends of the region analyzed correspond to nt 745 to 1052,respectively. (C) Alignment of the cDNA sequence of the region corresponding to human IRES A with bovine, rat, and mouse VEGF cDNA sequences. The conservedregions are boxed. The D4 domain is indicated. Relative positions of the nucleotides aligned from the transcription start point of rat, human, and mouse cDNAs areindicated. The complete 59 UTR of bovine VEGF mRNA is not known.
subcloned as the first cistron and the (LUCf) gene was sub-cloned as the second cistron (Fig. 5) to improve sensitivity andquantification of the assay. The VEGF complete or deleted 59UTR (constructs pRVL1, pRVL2, and pRVL5), as well as newdeleted fragments corresponding to removal of predicted do-mains D4 and D3 and the first 56 nt of IRES A (constructspRVL2DD4, pRVL3, and pRVL4, respectively), were intro-duced into the intercistronic region. Either a hairpin (DG 5240 kcal/mol) or the encephalomyocarditis virus (EMCV)IRES (35) was introduced between the LUCr and LUCf genesas controls (construct pRHL or pREL, respectively). Theseplasmids were transfected in COS-7 cells as described above.The ratio between the activities of the two luciferase enzymesobserved in the cell extracts was calculated and compared withthe data obtained with the negative control construct pRHL(Fig. 5).
Clearly the full-size VEGF 59 UTR induced LUCf expres-sion comparable to that induced by the EMCV IRES (pRVL1and pREL), whereas the 745-nt-deleted 59 UTR containing theIRES A 59 region (pRVL2) resulted in a reduced relativeactivity. These results were in agreement with those obtainedin assays using the bicistronic CAT/VEGF-CAT mRNA (Fig.2B), thereby ruling out any interference of the reporter systemwith the IRES activity.
Interestingly, removal of the D4 domain strongly affectedtranslation of the LUCf gene (pRVL2DD4), while deletion ofthe D3 domain (pRVL3) resulted in only a 50% decrease inIRES activity compared to that obtained with the pRVL2construct. In comparison to pRVL2 construct efficiency, dele-tion of the 59 56 nt of IRES A resulted in a 60% decrease ofLUCf expression (pRVL4), indicating a very low IRES activity,albeit higher than that obtained with the D4 deletion. Thisresult confirmed the observation made in Fig. 2. These resultsindicated that the IRES A 59 end (nt 745 to 801) and the D4domain (nt 858 to 907) are necessary for the IRES function.Both elements probably form the core of the VEGF IRES,whereas the D3 domain (nt 917 to 1013) seems also to play arole in IRES activity.
Identification of cellular factors bound to VEGF 5* UTR andto IRES A. UV cross-linking experiments were performed withCOS-7 cell extracts and different 32P-labeled RNA probes cor-responding to either the complete 59 UTR or deleted frag-ments of the 59 UTR (Fig. 6A) to identify cellular factorsinteracting with the VEGF 59 UTR and particularly with IRES
A. As shown in Fig. 6B, the protein pattern differed accordingto the RNA probe used. The complete leader was able to bindat least nine proteins (Fig. 6B, lane A). Most of these proteinswere able to bind to probe B, corresponding to the upstreampart of the leader (lane B). In contrast, probes C, D, and Ebound only a small number of proteins. Three major proteinsmigrating at 120, 100, and 85 kDa were detected with probes Cand D, corresponding to the downstream part of the leaderand both containing the IRES (lanes C and D, bands a, b, andc). Finally probe E, in which the D4 domain was deleted, wasable to bind the p85 and the p120 proteins but not p100 (laneE). These results showed a correlation between the cross-link-ing of p100 to RNA and IRES activity and suggested a poten-tial role of the 100-kDa protein in IRES function.
With regard to the proteins cross-linked to the upstreampart of the VEGF 59 UTR, one of the major bound proteinshad an apparent molecular mass of 60 kDa (Fig. 6B, lanes Aand B, band P), close to that of PTB, a well-known proteininvolved in the activities of several picornavirus IRESs. Thisprompted us to immunoprecipitate the proteins cross-linked tothe first half of the leader (probe B) with an anti-PTB antibody(Fig. 6C). An EMCV IRES probe was used as a positive con-trol. As shown in Fig. 6C, PTB could be clearly detected fol-lowing immunoprecipitation of both VEGF and the EMCVRNA cross-linked proteins with the anti-PTB antibody.
The VEGF mRNA 5* UTR contains two distinct IRESs. It isclear from data presented in Fig. 2B and 5 that the complete 59UTR behaved as a more efficient IRES than the IRES Afragment containing nt 745 to 1046. Furthermore, deletion ofthe D4 domain in the full-length 59 UTR led to a 30% reducedinternal entry activity compared to that observed with thecorresponding complete leader (data not shown), whereas thesame deletion in the IRES A context almost abolished IRESactivity. We also showed above that the binding of PTB oc-curred in the 59 part of the VEGF mRNA 59 UTR. These dataled us to investigate the presence of a second IRES in the 59part of the UTR.
To test this hypothesis, four new bicistronic plasmids con-taining different portions of the upstream half of the VEGF 59UTR were designed (Fig. 7A, left) and used to transfect COS-7cells, and the cell extracts were analyzed by Western immuno-blotting with an anti-CAT antibody. It was apparent from theseexperiments that three VEGF mRNA leader fragments corre-sponding to nt 1 to 654, 1 to 554, and 91 to 554, respectively,
FIG. 5. Characterization of IRES A cis-acting elements. Schematic drawing of the bicistronic vectors containing the LUCr gene as the first cistron, all or part ofthe VEGF mRNA leader sequence in the intercistronic region, and the LUCf gene as the second cistron. Construct pREL contains the EMCV IRES in theintercistronic region (positive control); construct pRHL contains a hairpin (DG 5 240 kcal/mol) in the intercistronic region (negative control). These plasmids weretransfected in COS-7 cells, and luciferase activities were measured as described in Materials and Methods. On the right, the histogram and corresponding valuesrepresent the ratio between the LUCf/LUCr activities obtained with each construct and that obtained with pRHL. Each value represents the average of at least fourindependent transfection experiments.
were able to promote translation of the second cistron fCAT(Fig. 7A, right, lanes B, C, and E). fCAT expression was, how-ever, less efficient with these three constructs (lacking theIRES A) than with the complete leader (lane A). In contrast,
the fragment extending from positions 1 to 332 exhibited verylow IRES activity (Fig. 7A, lane D).
Taken together, these results suggest that a second IRES ispresent between positions 91 and 554 of the VEGF 59 UTR.To obtain a more precise and more quantitative characteriza-tion of this IRES, we subcloned a series of segments of the 59half of the VEGF UTR into the LUCr-LUCf vector depictedin Fig. 5. COS-7 cell transfection and luciferase activity mea-surements were performed as described above. With regard tothe IRES 39 border deletions, it was clearly apparent that nt 91to 483 (pRVL7) retained most of the activity of the referencefragment characterized by the results in Fig. 7A (Fig. 7B,pRVL6, nt 91 to 554) and can be defined as IRES B. Incontrast, the fragments containing nt 91 to 379, 91 to 332, and91 to 189 (pRVL8, -9 and -10) had no significant IRES activity.These results suggest that a 104-bp fragment located betweennt 379 and 483 is strictly necessary for IRES B activity since itsdeletion abolished the internal entry process. Deletions per-formed in the 59 border (pRVL11, -12, and -13) showed thatthe two fragments containing nt 134 to 483 or 241 to 483retained about 50% of IRES B activity (Fig. 7B, pRVL11 and-12). It was thus apparent that the sequence limited by nt 91and 134 played a role in IRES B function. These data enabledus to conclude that IRES B was located in a 392-nt-long frag-ment between nt 91 and 483 and that a 104-nt segment at the39 end of this fragment was strictly necessary for IRES activity.It should be noted that this 104-nt segment contains the D5predicted stem-loop structure bearing a GNRA sequence inthe loop (Fig. 4A). We can thus hypothesize a possible role ofthe GNRA motif in a cellular IRES function.
PTB binding to IRES B is independent of IRES efficiency.As we had shown that PTB was the main protein bound to theupstream half of the VEGF RNA leader sequence (Fig. 6), wewere prompted to see whether PTB interacted with IRES B.As for Fig. 6, this was investigated by UV cross-linking andimmunoprecipitation experiments using several fragments ofthe 59 part of the leader with or without IRES activity asprobes; the EMCV IRES was used as a control (Fig. 8). It wasclearly apparent from these experiments that the RNA seg-ments containing nt 91 to 189 and nt 134 to 483 were able tobind PTB with the same efficiency as the segment extendingfrom nt 91 to 554 (Fig. 8, probes and lanes A, B, and C). Incontrast, the fragment extending from nt 241 to nt 483 was nolonger able to bind this protein (Fig. 8, probe and lane D). PTBbinding to probe C was confirmed by immunoprecipitationwith anti-PTB antibody (Fig. 8B, lane C).
These results permitted the localization of a PTB bindingsite between nt 134 and 189, a region which had no influenceon IRES activity (Fig. 7B, pRVL11 and -12). Furthermore,PTB bound to fragments B and C but not to fragment D (Fig.8), while internal entry activity was maintained in fragments Cand D but was not detected in fragment B (Fig. 7B). Thisevidenced an absence of correlation between PTB binding andIRES B activity in our experimental conditions.
Activities of the two IRESs in RRL. The ability of bothIRESs to promote cap-independent translation in vitro wasanalyzed by using monocistronic RNA containing differentfragments of the VEGF 59 UTR fused to the CAT gene. A cap-dependent control which corresponded to the leader deletedFGF-2 mRNA (53) was included. Equal amounts of uncappedand capped monocistronic mRNAs were transcribed in vitrofor each construct and assayed for translation in RRL (Fig.9B). Cap independence was evaluated by calculating the ratioof CAT expression obtained from uncapped versus cappedmRNA (NC/C ratio) (Fig. 9B and C).
Interestingly, the 1,038-nt-long leader showed an NC/C ratio
FIG. 6. UV cross-linking of COS-7 cell proteins on the VEGF mRNA 59UTR. (A) Drawing of the different 32P-labeled RNA probes, obtained from T7in vitro transcription and corresponding to the complete or parts of the VEGF59 UTR mRNA. Relative positions of the 59 and 39 ends of each probe are indi-cated. (B) UV cross-linking experiments performed with probes A to E. S10COS-7 cell extracts were incubated with 106 cpm of the different probes followedby UV irradiation and treatment with RNases A and ONE (see Materials andMethods). The control (Ct) lane corresponds to proteinase K treatment ofsample loaded in the first lane. Size markers are indicated. (C) 32P-labeled probescorresponding to VEGF probe A (complete 59 UTR) and to EMCV IRES werecross-linked with proteins extracted from S10 COS-7 cells, and the complex wasimmunoprecipitated with an anti-PTB antibody. The samples were analyzedbefore (CL) and after (I) immunoprecipitation. The use of a VEGF or EMCVprobe is indicated above the lanes. PTB migration is indicated with an arrow.
of 1.25, indicating mostly cap independence compared to thecap-dependent control (Fig. 9B and C; compare constructs Aand G). Cap independence in the various deleted constructswas conferred by the fragment from nt 91 to 554, with an NC/Cratio of 0.9 (Fig. 8, construct B), whereas translation becamecap dependent when the leader contained nt 1 to 332 (Fig. 8,construct C). Furthermore, the segment containing nt 745 to1038 was also able to confer cap independence to translation,with an NC/C ratio of 1, whereas deletion of the D4 domain ledto cap-dependent translation of the CAT gene (Fig. 8, con-structs D and E). As expected, translation was cap dependentwhen the leader was restricted to nt 917 to 1038 (construct F).
These results show that two distinct mRNA segments areable to promote cap-independent translation in vitro. Thesesegments correspond to IRESs A and B characterized in trans-fected COS-7 cells.
These different approaches enabled us to conclude that theVEGF mRNA leader contains two distinct IRESs which canpromote cap-independent translation from AUG 1039 in bothRRL and COS-7 transfected cells.
DISCUSSION
In this study, we demonstrate that the synthesis of VEGF,the major angiogenic factor, occurs through an internal ribo-
some entry site process. This observation, together with theprevious discovery of an IRES in the mRNA of another im-portant angiogenic factor, FGF-2 (53), suggests an involve-ment of IRES-dependent translation in the control of angio-genesis. It is also clearly apparent from our results that twoIRESs are present in the 59 UTR of the VEGF mRNA andthat they bind some different factors. This novel and interest-ing feature of VEGF mRNA suggests that VEGF expression iscontrolled at the translational level, probably in a specific way,by each of the two IRESs.
IRES A is located in a 293-nt-long fragment just upstreamfrom the AUG codon (nt 745 to 1038 from the mRNA 59 end[Fig. 2]). Analysis of the cis elements involved in the activity ofthis IRES revealed a need for at least two elements: the 59 partof the IRES-containing fragment (IRES A 59 region, betweennt 745 and 846) and the D4 domain (nt 858 to 907 [Fig. 5]).The D4 loop, containing nucleotides AGACA, differs fromthe sequences of the loop consensus motifs ACCC (21) andGNRA or CAAA (18, 32) conserved in picornavirus IRESs.The data from Fig. 5 also show a detectable but more marginalinfluence of the D3 domain (nt 917 to 1013) in IRES function.According to its AUG proximal location, this IRES seems toallow ribosome binding and translation initiation without scan-ning. This is reminiscent of the so-called type II IRESs describedin the literature and including the cardiovirus IRESs (21).
FIG. 7. Mapping of IRES B. (A) Schematic drawing of the bicistronic constructs containing the complete or truncated VEGF 59 UTR between the first CAT cistronand the second chimeric fCAT cistron (depicted in Fig. 2C). The 59 and 39 boundaries of the deletions are indicated. Western immunoblotting was performed (right)as described for Fig. 1B after transfection of COS-7 cells with plasmids A to E. The CAT and fCAT proteins are shown by arrows. The control (Ct) lane correspondsto untransfected cells. (B) Representation of bicistronic vectors containing a stable hairpin structure upstream from the LUCr gene (first cistron), fragments of theVEGF mRNA leader sequence in the intercistronic region, and the LUCf gene as the second cistron. The 59 and 39 boundaries of the deletions are indicated. Theseplasmids were transfected into COS-7 cells, and luciferase activities measured as described in Materials and Methods. On the right, the histogram and correspondingvalues represent the LUCf/LUCr activity ratio obtained with each construct and that obtained with pRHL. Each value represents the average of at least fourindependent transfection experiments.
IRES B is located in a 392-nt segment between nt 91 and 483from the mRNA 59 end and exhibits optimal activity in thepresence of nt 91 to 134 (Fig. 7). A 104-bp sequence limited bynt 379 and 483 is strictly necessary for IRES B activity. Thissequence contains a predicted stem-loop structure bearing aGNRA motif, defined as an element shared by all picornavirusIRES (21, 32). The observation of such a predicted structurealso suggests the presence of an IRES in this region. Althoughinvolvement of the motif would need to be confirmed, it seemsthat VEGF mRNA could be an example of cellular IRES theactivity of which would require this unpaired GNRA sequence.Strikingly the 39 border of this IRES was located more than500 nt from the AUG codon (position 1039). This is reminis-cent of the picornavirus type I IRESs, in which the 39 border islocated quite far upstream from the start codon (1). However,in IRES B, the spacer region, which does contain a secondIRES, is longer than that of the picornavirus type I IRES,which is usually about 150 nt in length. Insertion of AUG
codons in the poliovirus type I IRES, upstream from the au-thentic start codon, has demonstrated that ribosome scanningoccurs from the IRES 39 border to reach the AUG codon (17).It cannot be excluded that this could be the case for VEGFIRES B, although the length of the spacer region and itspredicted stable structure (Fig. 4) would argue against such ahypothesis. Alternatively, two other hypotheses can be pro-posed. One possibility is that the spacer region allows a jumpbetween the IRES B and the AUG. Such a mechanism hasbeen described for adenovirus (60) and cauliflower mosaicvirus (12). In the case of adenovirus, the 59 part of the mRNAleader allows cap-independent translation to occur, while the39 part is required for the jump. This hypothesis cannot beruled out here. Another possibility is that the 59 part of theleader, although it contains an independent IRES, can alsobehave as an enhancer of IRES A. In this case, the two IRESswould together form a single super-IRES structure. Furtherinvestigations are necessary before we can choose betweenthese hypotheses.
However, the existence of two independent IRESs is sup-ported by their very different UV cross-linked protein patterns(Fig. 6). Interestingly, very few proteins are UV cross-linked toIRES A (Fig. 6). One, p100, seems to bind to the D4 domain,suggesting a potential role of this protein in IRES function.
Among the proteins which are bound to the 59 half of theVEGF mRNA leader (Fig. 6), most, including the PTB, arebound on the 59 part of IRES B (Fig. 8A). These experimentsdid not permit detection of protein whose binding was corre-lated to IRES B activity. This one-dimensional analysis wasnot, however, sufficient for conclusions to be drawn in anabsence of IRES-specific protein, as different proteins mayhave the same electrophoretic mobility. Several proteins werebound to a polypyrimidine-rich sequence located between nt189 and 241 (Fig. 8A; compare lanes B, C, and D). PTB is themajor protein bound to the 59 part of the RNA leader, and itsbinding site was mapped to between nt 134 and 189, whichsuggests that it recognizes the short UUUC sequence presentaround position 172 of the leader, which corresponds to thePTB consensus binding site described for viral IRESs (19, 42).According to the predicted structural data, this consensus siteis located in a paired sequence. However, whereas PTB playsa crucial role in the function of EMCV and foot-and-mouthdisease IRESs (4, 23, 38), its binding to IRES B does not seemto be correlated to IRES activity. These data are consistentwith several reports showing that PTB is not the universalinternal entry factor and that its binding to RNA does notnecessarily imply its requirement for IRES function (3, 24).
The occurrence of two IRESs in the VEGF mRNA, proba-bly controlled by different factors, provides interesting possi-bilities for the regulation of VEGF expression at the transla-tional level. As VEGF plays a central role in angiogenesis, itsexpression has to be finely regulated. Two independent IRESdomains, sensitive to different environmental conditions orcellular contexts, could permit an additional degree of flexibil-ity in the expression of this growth factor. It should also bementioned that the VEGF 59 leader presents potential initia-tion codons located between the two IRESs, in the same openreading frame as the AUG 1039 initiation codon. It could thusbe hypothesized that the upstream IRES controls the expres-sion of longer VEGF isoforms, as has been observed for FGF-2 mRNA (53). However, the existence of such alternativeVEGF isoforms remains to be demonstrated. It would also beinteresting to know whether translation of the various splicingvariants of VEGF mRNA is regulated differently by the twoIRESs. Indeed, although we have shown that the secondIRES does not extend downstream from the AUG codon, we
FIG. 8. UV cross-linking of COS-7 cell proteins on IRES B. (A) Top, draw-ing of the different 32P-labeled RNA probes, obtained from T7 in vitro tran-scription and corresponding to the complete or parts of the IRES B sequence.Relative positions of the 59 and 39 ends of each probe are indicated. Bottom, UVcross-linking experiments performed with probes A to D and a probe corre-sponding to the EMCV IRES (first lane). S10 COS-7 cell extracts were incubatedwith 1.5 3 106 cpm of the different probes followed by UV irradiation andtreatment with RNases A and ONE (see Materials and Methods). Size markersare indicated. (B) Immunoprecipitation with an anti-PTB antibody of COS-7 cellprotein extract cross-linked to EMCV and VEGF probes C and D (lane 1, 2, and4). Lane 3 corresponds to a control immunoprecipitation of cell extract and probe Cwithout previous cross-linking. UV cross-linking or absence of cross-linking be-fore immunoprecipitation is indicated by a plus or a minus sign, respectively,below each lane.
cannot rule out that long-range interactions of IRES A or Bwith the downstream coding sequence of the messenger couldaffect or stabilize the IRES structure and influence its ribo-some binding efficiency.
The discovery of IRESs in the mRNAs of two major angio-genic growth factors, VEGF and FGF-2, as well as in themRNA of PDGF, a factor involved in vascular physiology,raises the question as to the possible involvement of this trans-lation initiation mechanism in the control of angiogenesis. Wehave already shown that FGF-2 expression is translationallyactivated in response to stress or vascular lesion (8a, 54). Thus,the advantage of IRES-dependent regulation might be to allowan immediate response of the cell to exogenous stimuli. Thecontrol of such a process could have important repercussionsin cardiovascular disease therapy.
The FGF-2 IRES seems to be constitutively activated invarious transformed cell types (54), whereas c-myc is overex-pressed in an IRES-dependent manner in Bloom’s syndromecells (58). The observation of an IRES-dependent translationalactivation of growth factor or proto-oncogene expression in
tumors, added to previous descriptions of eIF4E-dependenttranslation enhancement (25, 27), favors the hypothesis thattranslational deregulation of gene expression may play a keyrole in cell transformation. Furthermore, it has been reportedthat overexpression of VEGF induces cell transformation incooperation with FGF-2 (16). Thus, the existence of IRESs inboth FGF-2 and VEGF mRNAs suggests that the processesleading to cell transformation and/or tumor neovascularizationcould involve an IRES-dependent activation of the expressionof these angiogenic factors.
ACKNOWLEDGMENTS
We thank B. Michot for predicted secondary structures, F. Bayardand J. Plouet for helpful discussions, and D. Warwick for Englishproofreading. We thank J. Abraham for the gift of the VEGF cDNAand promoter region and J. G. Patton for sending the anti-PTB anti-body.
This work was supported by grants from the Association pour laRecherche contre le Cancer, the Ligue Nationale contre le Cancer, theConseil Regional de Midi-Pyrenees, the European Community Bio-
FIG. 9. Activities of IRES A and IRES B in vitro. (A) Schematic drawing of the monocistronic vectors used as T7 polymerase templates. The in vitro transcriptionswere performed in the presence or absence of a cap structure. In constructs A and F, the translation product is the chimeric VEGF-CAT protein depicted in Fig. 1A.In constructs B to E, the translation product is the CAT protein. In construct G, the translation product is the FGF-2 protein. (B) Identical quantities of the differentcapped or noncapped mRNAs were translated in RRL. The presence or absence of a cap structure in the mRNA is indicated by a plus or minus sign, respectively, beloweach lane, together with the construct used. (C) The lanes in panel B were quantified with PhosphorImager. The histogram indicates the ratio of the translationefficiency observed in uncapped RNA versus capped mRNA. The line corresponds to cap-independent translation initiation (ratio of 1). The experiment reported hereis representative of five independent experiments.
technology program (subprogram Cell Factory, Actions de RecherchesConcertees, contract 94/99-181). I. Huez received fellowships from theMinistere de l’Education Nationale et de la Recherche Scientifique.L. Creancier received a fellowship from the European CommunityBiotechnology program.
REFERENCES
1. Belsham, G. J., and N. Sonenberg. 1996. RNA-protein interactions in reg-ulation of picornavirus RNA translation. Microbiol. Rev. 60:499–511.
2. Bernstein, J., O. Sella, S. Y. Le, and O. Elroy-Stein. 1997. PDGF2/c-sismRNA leader contains a differentiation-linked internal ribosomal entry site(D-IRES). J. Biol. Chem. 272:9356–9362.
3. Borman, A., M. T. Howell, J. G. Patton, and R. J. Jackson. 1993. Theinvolvement of a spliceosome component in internal initiation of humanrhinovirus RNA translation. J. Gen. Virol. 74:1775–1788.
4. Borovjagin, A., T. Pestova, and I. Shatsky. 1994. Pyrimidine tract bindingprotein strongly stimulates in vitro encephalomyocarditis virus RNA trans-lation at the level of preinitiation complex formation. FEBS Lett. 351:299–302.
5. Brogi, E., T. Wu, A. Namiki, and J. M. Isner. 1994. Indirect angiogeniccytokines upregulate VEGF and bFGF gene expression in vascular smoothmuscle cells, whereas hypoxia upregulates VEGF expression only. Circula-tion 90:649–652.
6. Chetouani, F., P. Monestie, P. Thebault, C. Gaspin, and B. Michot. 1997.ESSA: an integrated and interactive computer tool for analysing RNA sec-ondary structure. Nucleic Acids Res. 25:3514–3522.
7. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolationby acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Bio-chem. 162:156–159.
8. Cohen, T., D. Nahari, L. W. Cerem, G. Neufeld, and B. Z. Levi. 1996.Interleukin 6 induces the expression of vascular endothelial growth factor.J. Biol. Chem. 271:736–741.
8a.Concina, P., et al. Unpublished results.9. Creancier, L., H. Prats, C. Zanibellato, F. Amalric, and B. Bugler. 1993.
Determination of the functional domains involved in nucleolar targeting ofnucleolin. Mol. Biol. Cell. 4:1239–1250.
10. Ferrara, N., and T. Davis-Smyth. 1997. The biology of vascular endothelialgrowth factor. Endocrine Rev. 18:4–25.
11. Ferrara, N., and B. Keyt. 1997. Vascular endothelial growth factor: basicbiology and clinical implications. EXS 79:209–232.
12. Futterer, J., Z. Kiss-Laszlo, and T. Hohn. 1993. Nonlinear ribosome migra-tion on cauliflower mosaic virus 35S RNA. Cell 73:789–802.
13. Gan, W., and R. E. Rhoads. 1996. Internal initiation of translation directedby the 59-untranslated region of the mRNA for eIF4G, a factor involved inthe picornavirus-induced switch from cap-dependent to internal initiation.J. Biol. Chem. 271:623–626.
14. Goad, D. L., J. Rubin, H. Wang, A. H. Tashjian, Jr., and C. Patterson. 1996.Enhanced expression of vascular endothelial growth factor in human SaOS-2osteoblast-like cells and murine osteoblasts induced by insulin-like growthfactor I. Endocrinology 137:2262–2268.
15. Grugel, S., G. Finkenzeller, K. Weindel, B. Barleon, and D. Marme. 1995.Both v-Ha-Ras and v-Raf stimulate expression of the vascular endothelialgrowth factor in NIH 3T3 cells. J. Biol. Chem. 270:25915–25919.
16. Guerrin, M., E. Scotet, F. Malecaze, E. Houssaint, and J. Plouet. 1997.Overexpression of vascular endothelial growth factor induces cell transfor-mation in cooperation with fibroblast growth factor 2. Oncogene 14:463–471.
17. Hellen, C. U., T. V. Pestova, and E. Wimmer. 1994. Effect of mutationsdownstream of the internal ribosome entry site on initiation of poliovirusprotein synthesis. J. Virol. 68:6312–6322.
18. Hoffman, M. A., and A. C. Palmenberg. 1995. Mutational analysis of the J-Kstem-loop region of the encephalomyocarditis virus IRES. J. Virol. 69:4399–4406.
19. Iizuka, N., H. Yonekawa, and A. Nomoto. 1991. Nucleotide sequences im-portant for translation initiation of enterovirus RNA. J. Virol. 65:4867–4873.
20. Jackson, R. J. 1988. RNA translation. Picornaviruses break the rules. Nature334:292–293.
21. Jackson, R. J., and A. Kaminski. 1995. Internal initiation of translation ineukaryotes: the picornavirus paradigm and beyond. RNA 1:985–1000.
22. Jang, S. K., H. G. Krausslich, M. J. Nicklin, G. M. Duke, A. C. Palmenberg,and E. Wimmer. 1988. A segment of the 59 nontranslated region of encepha-lomycarditis virus RNA directs internal entry of ribosomes during in vitrotranslation. J. Virol. 62:2636–2643.
23. Kaminski, A., S. L. Hunt, J. G. Patton, and R. J. Jackson. 1995. Directevidence that polypyrimidine tract binding protein (PTB) is essential forinternal initiation of translation of encephalomyocarditis virus RNA. RNA 1:924–938.
24. Kaminski, A., and R. J. Jackson. 1998. The polypyrimidine tract bindingprotein (PTB) requirement for internal initiation of translation of cardiovi-rus RNAs is conditional rather than absolute. RNA 4:626–638.
25. Kevil, C. G., A. De Benedetti, D. K. Payne, L. L. Coe, F. S. Laroux, and J. S.Alexander. 1996. Translational regulation of vascular permeability factor by
26. Kozak, M. 1989. The scanning model for translation: an update. J. Cell Biol.108:229–241.
27. Lazaris-Karatzas, A., K. S. Montine, and N. Sonenberg. 1990. Malignanttransformation by a eukaryotic initiation factor subunit that binds to mRNA59 cap. Nature 345:544–547.
28. Le, S. Y., and J. V. Maizel, Jr. 1997. A common RNA structural motifinvolved in the internal initiation of translation of cellular mRNAs. NucleicAcids Res. 25:362–369.
29. Leung, D. W., G. Cachianes, W. J. Kuang, D. V. Goeddel, and N. Ferrara.1989. Vascular endothelial growth factor is a secreted angiogenic mitogen.Science 246:1306–1309.
30. Levy, A. P., N. S. Levy, S. Wegner, and M. A. Goldberg. 1995. Transcriptionalregulation of the rat vascular endothelial growth factor gene by hypoxia.J. Biol. Chem. 270:13333–13340.
31. Li, J., M. A. Perrella, J. C. Tsai, S. F. Yet, C. M. Hsieh, M. Yoshizumi, C.Patterson, W. O. Endege, F. Zhou, and M. E. Lee. 1995. Induction of vascularendothelial growth factor gene expression by interleukin-1 beta in rat aorticsmooth muscle cells. J. Biol. Chem. 270:308–312.
32. Lopez de Quinto, S., and E. Martinez-Salas. 1997. Conserved structuralmotifs located in distal loops of aphthovirus internal ribosome entry sitedomain 3 are required for internal initiation of translation. J. Virol. 71:4171–4175.
33. Macejak, D. J., and P. Sarnow. 1991. Internal initiation of translation me-diated by the 59 leader of a cellular mRNA. Nature 353:90–94.
34. Meerovitch, K., J. Pelletier, and N. Sonenberg. 1989. A cellular protein thatbinds to the 59-noncoding region of poliovirus RNA: implications for inter-nal translation initiation. Genes Dev. 3:1026–1034.
35. Molla, A., S. K. Jang, A. V. Paul, Q. Reuer, and E. Wimmer. 1992. Cardio-viral internal ribosomal entry site is functional in a genetically engineereddicistronic poliovirus. Nature 356:255–257.
36. Mukhopadhyay, D., L. Tsiokas, X. M. Zhou, D. Foster, J. S. Brugge, andV. P. Sukhatme. 1995. Hypoxic induction of human vascular endothelialgrowth factor expression through c-Src activation. Nature 375:577–581.
37. Nanbru, C., I. Lafon, S. Audigier, M. C. Gensac, S. Vagner, G. Huez, andA. C. Prats. 1997. Alternative translation of the proto-oncogene c-myc by aninternal ribosome entry site. J. Biol. Chem. 272:32061–32066.
38. Niepmann, M., A. Petersen, K. Meyer, and E. Beck. 1997. Functional in-volvement of polypyrimidine tract-binding protein in translation initiationcomplexes with the internal ribosome entry site of foot-and-mouth diseasevirus. J. Virol. 71:8330–8339.
39. Oh, S.-K., M. P. Scott, and P. Sarnow. 1992. Homeotic gene AntennapediamRNA contains 59-noncoding sequences that confer translational initiationby internal ribosome binding. Genes Dev. 6:1643–1653.
40. Patton, J. G., S. A. Mayer, P. Tempst, and B. Nadal-Ginard. 1991. Charac-terization and molecular cloning of polypyrimidine tract-binding protein: acomponent of a complex necessary for pre-mRNA splicing. Genes Dev. 5:1237–1251.
41. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation ofeukaryotic mRNA directed by a sequence derived from poliovirus RNA.Nature 334:320–325.
42. Pestova, T. V., C. U. Hellen, and E. Wimmer. 1991. Translation of poliovirusRNA: role of an essential cis-acting oligopyrimidine element within the 59nontranslated region and involvement of a cellular 57-kilodalton protein.J. Virol. 65:6194–6204.
43. Plouet, J., F. Moro, S. Bertagnolli, N. Coldeboeuf, H. Mazarguil, S. Clamens,and F. Bayard. 1997. Extracellular cleavage of the vascular endothelialgrowth factor 189-amino acid form by urokinase is required for its mitogeniceffect. J. Biol. Chem. 272:13390–13396.
44. Plouet, J., J. Schilling, and D. Gospodarowicz. 1989. Isolation and charac-terization of a newly identified endothelial cell mitogen produced by AtT-20cells. EMBO J. 8:3801–3806.
45. Prats, A. C., S. Vagner, H. Prats, and F. Amalric. 1992. cis-acting elementsinvolved in the alternative translation initiation process of human basicfibroblast growth factor mRNA. Mol. Cell. Biol. 12:4796–4805.
46. Rak, J., J. Filmus, G. Finkenzeller, S. Grugel, D. Marme, and R. S. Kerbel.1995. Oncogenes as inducers of tumor angiogenesis. Cancer Metastasis Rev.14:263–277.
47. Shima, D. T., M. Kuroki, U. Deutsch, Y. S. Ng, A. P. Adamis, and P. A.D’Amore. 1996. The mouse gene for vascular endothelial growth factor.Genomic structure, definition of the transcriptional unit, and characteriza-tion of transcriptional and post-transcriptional regulatory sequences. J. Biol.Chem. 271:3877–3883.
48. Shweiki, D., A. Itin, D. Soffer, and E. Keshet. 1992. Vascular endothelialgrowth factor induced by hypoxia may mediate hypoxia-initiated angiogen-esis. Nature 359:843–845.
49. Stein, I., M. Neeman, D. Shweiki, A. Itin, and E. Keshet. 1995. Stabilizationof vascular endothelial growth factor mRNA by hypoxia and hypoglycemiaand coregulation with other ischemia-induced genes. Mol. Cell. Biol. 15:5363–5368.
50. Stoneley, M., F. E. Paulin, J. P. Le Quesne, S. A. Chappell, and A. E. Willis.
1998. C-Myc 59 untranslated region contains an internal ribosome entrysegment. Oncogene 16:423–428.
51. Teerink, H., H. O. Voorma, and A. A. Thomas. 1995. The human insulin-likegrowth factor II leader 1 contains an internal ribosomal entry site. Biochim.Biophys. Acta 1264:403–408.
52. Tischer, E., R. Mitchell, T. Hartman, M. Silva, D. Gospodarowicz, J. C.Fiddes, and J. A. Abraham. 1991. The human gene for vascular endothelialgrowth factor. Multiple protein forms are encoded through alternative exonsplicing. J. Biol. Chem. 266:11947–11954.
53. Vagner, S., M. C. Gensac, A. Maret, F. Bayard, F. Amalric, H. Prats, andA. C. Prats. 1995. Alternative translation of human fibroblast growth factor2 mRNA occurs by internal entry of ribosomes. Mol. Cell. Biol. 15:35–44.
54. Vagner, S., C. Touriol, B. Galy, S. Audigier, M. C. Gensac, F. Amalric, F.Bayard, H. Prats, and A. C. Prats. 1996. Translation of CUG- but notAUG-initiated forms of human fibroblast growth factor 2 is activated intransformed and stressed cells. J. Cell Biol. 135:1391–1402.
55. Vagner, S., A. Waysbort, M. Marenda, M. C. Gensac, F. Amalric, and A. C.
Prats. 1995. Alternative translation initiation of the Moloney murine leuke-mia virus mRNA controlled by internal ribosome entry involving the p57/PTB splicing factor. J. Biol. Chem. 270:20376–20383.
56. Valcarcel, J., and F. Gebauer. 1997. Post-transcriptional regulation: thedawn of PTB. Curr. Biol. 7:R705–R708.
57. Warren, R. S., H. Yuan, M. R. Matli, N. Ferrara, and D. B. Donner. 1996.Induction of vascular endothelial growth factor by insulin-like growth factor1 in colorectal carcinoma. J. Biol. Chem. 271:29483–29488.
58. West, M. J., N. F. Sullivan, and A. E. Willis. 1995. Translational upregulationof the c-myc oncogene in Bloom’s syndrome cell lines. Oncogene 11:2515–2524.
59. Ye, X., P. Fong, N. Iizuka, D. Choate, and D. R. Cavener. 1997. Ultrabithoraxand antennapedia 59 untranslated regions promote developmentally regu-lated internal translation initiation. Mol. Cell. Biol. 17:1714–1721.
60. Yueh, A., and R. J. Schneider. 1996. Selective translation initiation by ribo-some jumping in adenovirus-infected and heat-shocked cells. Genes Dev. 10:1557–1567.
![Page 1 Proteomicsthesammonslab.org/pdfs/papers/2020-link-proteomics.pdfeukaryotic initiation factors (eIFs) into an 80S ribosome at the mRNA’s AUG initiation [codon (Fig. 2A) 17].](https://static.documents.pub/doc/80x56/5f69b93fc73edb6e5568dde3/page-1-proteomicsthesammonslaborgpdfspapers2020-link-proteomicspdf-eukaryotic.jpg)
![Ribosome Stoichiometry: From Form to Function · Ribosome abundance: A major model, also termed the ribosome concentration hypothesis [3], that explains how ribosomes could exert](https://static.documents.pub/doc/80x56/60de31e56d30fc4fb30719b8/ribosome-stoichiometry-from-form-to-function-ribosome-abundance-a-major-model.jpg)
