+ All Categories
Home > Documents > UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina...

UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina...

Date post: 13-May-2015
Category:
Upload: irma-verstraeten
View: 219 times
Download: 3 times
Share this document with a friend
Popular Tags:
17
UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital
Transcript
Page 1: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

UMC Utrecht consists of

the University Hospital Utrechtthe Medical Faculty Utrecht

the Wilhelmina Children’s Hospital

Page 2: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

Afdeling Medische Genetica

09-11-2013

Voortgang in de DNA diagnostiek

T.G.W. Letteboer, Klinisch GeneticusAfdeling Medische Genetica, UMC U

9 november 2013

Page 3: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

DNA diagnostiek

HHT1, HHT2, HHT-JP, en toen….

Nieuwe technieken voor bekende families zonder mutatie

Conclusie

Page 4: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

23 chromosomen van iedere ouder

Page 5: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

celkern

cel

chromosoom

dubbele helix

DNA-basen

DNA, chromosomen en genen

Page 6: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

HHT1 HHT2

HHT3

HHT4

JP-HHT

Page 7: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

HHT1 en HHT2 verschillende genen

HHT2

- chromosoom 12- gen: ACVRL1 (ALK1)

vaker HAVM

HHT1

- chromosoom 9- gen: ENG

vaker PAVM, CAVM

Page 8: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

HHT-JP en HHT? Weer andere genen

HHT-JP

- chromosoom 18- gen: SMAD4

HHT?

- chromosoom 5 of 7 of ?- gen: onbekend

Page 9: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

En de families zonder mutatie??

• 10-15% van de families hebben geen mutatie in ENG, ACVRL1 (ALK1) of SMAD4

• Mogelijke verklaringen zijn:• andere genen veroorzaken HHT • onze technieken pikken niet alle mutaties

op (in ENG, ACVRL1 en SMAD4)

Page 10: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

GTTGCTTGTTTATCACCTGT

Vooruitgang in technieken

G A T C

19902.500 per 3 dagen

200025.000per ochtend

201050.000.000per uur

1ste 3de2de

Page 11: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

bron: Science, 17 maart 2006

Op weg naar het individuele genoom

2009: $10.0002007: $1.000.0002000: $300.000.000 (?)

Page 12: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

Recent een nieuw gen ontdekt: BMP9

Page 13: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

BMP9 mutatie veroorzaakt HHT beeld

• Ontdekt in 3 personen met HHT• Teleangiectasien en bloedneuzen

(AVMs niet goed onderzocht, wrs 1 HAVMs)

• Maar: Ontdekt in 3 van de 197 onderzochte

personen

Page 14: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

Onbekende families worden onderzocht op BMP9

• Mogelijk dat andere landen (Nederland) BMP9 vaker voor komt dan in Canada

• Zo veel mogelijk familie’s zonder mutatie onderzoeken op mutaties in BMP9

Page 15: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

Mutaties in niet-coderend gebied

5'cap aggt

poly A-signaal

AATAAAsplice site

Promoter

5’ UTR Intron Intron 3’ UTR

Page 16: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

Zijn onze technieken niet toereikend??

• Mogelijk niet….

• In samenwerking met Hubrecht laboratorium bij aantal families kijken of er met andere techniek mutaties worden gevonden in de bekende genen

Page 17: UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

We zijn hard bezig de families in kaart te brengen, zonder gen afwijking voor de HHT


Recommended