DOI: 10.1161/CIRCRESAHA.115.307362 1 Unique Features of Cortical Bone Stem Cells Associated with Repair of the Injured Heart Sadia Mohsin, Constantine D Troupes, Timothy Starosta, Thomas E Sharp, Elorm J Agra, Shavonn Smith, Jason M Duran, Neil Zalavadia, Yan Zhou, Hajime Kubo, Remus M Berretta, Steven R Houser Running title: Bone-Derived Stem Cells Augment Cardiac Repair Subject Terms: Cell Therapy Heart Failure Angiogenesis Growth Factors/Cytokines Myocardial Regeneration Address correspondence to: Dr. Steven R. Houser Cardiovascular Research Center Temple University 3500 N Broad Street Philadelphia, PA 19140 Tel: 215-707-4045 Fax: 215-707-5737 [email protected]In September 2015, the average time from submission to first decision for all original research papers submitted to Circulation Research was 12.75 days. by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from by guest on April 17, 2018 http://circres.ahajournals.org/ Downloaded from
Transcript
DOI: 10.1161/CIRCRESAHA.115.307362 1
Unique Features of Cortical Bone Stem Cells Associated with Repair of the Injured Heart
Sadia Mohsin, Constantine D Troupes, Timothy Starosta, Thomas E Sharp, Elorm J Agra, Shavonn Smith, Jason M Duran, Neil Zalavadia, Yan Zhou, Hajime Kubo, Remus M Berretta, Steven R Houser
Subject Terms: Cell Therapy Heart Failure Angiogenesis Growth Factors/Cytokines Myocardial Regeneration Address correspondence to: Dr. Steven R. Houser Cardiovascular Research Center Temple University 3500 N Broad Street Philadelphia, PA 19140 Tel: 215-707-4045 Fax: 215-707-5737 [email protected] In September 2015, the average time from submission to first decision for all original research papers submitted to Circulation Research was 12.75 days.
ABSTRACT Rationale: Adoptive transfer of multiple stem cell types has only had modest effects on the structure and function of failing human hearts. Despite increasing use of stem cell therapies, consensus on the optimal stem cell type is not adequately defined. The modest cardiac repair and functional improvement in patients with cardiac disease warrants identification of a novel stem cell population that possesses properties that induce a more substantial improvement in heart failure patients. Objective: To characterize and compare surface marker expression, proliferation, survival, migration and differentiation capacity of Cortical Bone Stem Cells (CBSCs) relative to mesenchymal stem cells (MSCs) and cardiac derived stem cells (CDCs), that have already been tested in early stage clinical trials. Methods and Results: CBSCs, MSCs and CDCs were isolated from Gottingen miniswine or transgenic C57/BL6 mice expressing enhanced green fluorescent protein and were expanded in-vitro. CBSCs possess a unique surface marker profile including high expression of CD61 and Integrin Beta-4 versus CDCs and MSCs. Additionally CBSCs were morphologically distinct and showed enhanced proliferation capacity versus CDCs and MSCs. CBSCs had significantly better survival after exposure to an apoptotic stimuli as compared to MSCs. ATP and histamine induced a transient increase of intracellular Ca2+ concentration in CBSCs versus CDCs and MSCs which either respond to ATP or histamine only further documenting the differences between the three cell types. Conclusion: CBSCs are unique from CDCs and MSCs and possess enhanced proliferative, survival and lineage commitment capacity that could account for the enhanced protective effects after cardiac injury. Keywords: Cortical bone stem cells, cardiac repair, survival, immune modulation, cardiac lineage commitment, myocardial regeneration, cardiac progenitor cells, mesenchymal stem cells, adult stem cells, growth factors and cytokines. Nonstandard Abbreviations and Acronyms: sCBSCs Cortical Bone Derived Stem Cells isolated from mini swine mCBSCs Cortical bone stem cells isolated from mice CDCs Cardiac Derived Stem Cells MSCs Mesenchymal stem cells AVM Adult ventricular myocytes FRAP Fluorescence Recovery After Photo-bleaching SPP1 Secreted phospho protein 1 HGF Hepatocyte growth factor bFGF Fibroblast growth factor IGF-1 Insulin growth factor 1 PDFG Platelet derived growth factor TGF Transforming growth factor beta VEGF Vascular endothelial growth factor SDF Stromal derived growth factor Cn43 Connexin 43 IL-1a Interleukin 1 alpha CCND2 Cyclin D2 GNL3 Guanine Nucleotide Binding Protein-Like 3 RPA3 Replication protein A3
Cardiovascular disease (CVD) causes myocyte death and the reduction in the number of functional cardiac myocytes ultimately results in poor cardiac pump function and heart failure. Since adult cardiac myocytes have extremely limited proliferative capacity, replacing lost myocytes and their supporting vasculature will require the use of cells with the capacity to differentiate into the lost cell types. A number of molecular and cellular approaches have been tested to replace lost cardiomyocytes and restore myocardial function after injury. Research from several laboratories, including ours, suggests that stem cells hold immense potential for cardiac repair and regeneration 1, 2 3 4. Clinical utilization of adult stem cells is a reality today and many stem cell types, including bone marrow derived mesenchymal stem cells (MSCs) 5, bone marrow cells 7 8, cardiac derived cardiac progenitor 6 and cardio-sphere derived cells 9 have been tested. The beneficial effects of tested cell therapies on cardiac structure and function have been modest and most studies to date have not been adequately powered to document efficacy. The emerging consensus from these studies suggests that the donated stem cell population falls short of fully restoring normal cardiac functional capacity due to a combination of issues such as poor survival, lack of proliferation, engraftment, and differentiation. In addition, it appears that much of the benefit derived from cell therapy has come from the release of “paracrine” factors acting on the host myocardium rather than from differentiation of infused/injected stem cells into new cardiac tissue.
The success of cell therapy critically depends on how well the adoptively transferred stem cells survive within the harsh milieu of the diseased heart. Stem cells must be resistant to the apoptotic, necrotic, and hypoxic environment prevalent within the damaged heart 10. Most or all of the donated stem cells die after injection and those that do survive fail to engraft in the damaged organ 11. Current beneficial effects of cellular therapy appear to be mediated by the remaining of 1% of the donated population a week after transplantation. Improving the retention of donated stem cells should enhance their reparative effects. Another stem cell feature that could augment their reparative properties would be enhanced proliferation, which would increase the number of engrafted cells. Furthermore, a hypothesis of the current research is that enhanced myocardial repair is contingent upon communication between injected stem cells and the cells within the heart 12 13 14. This communication could come from secretion of cardioprotective factors (paracrine signaling) or from direct contact between stem cells and cardiomyocytes. Paracrine signaling between the donated stem cell population and host myocardium is important to promote cell-based myocardial repair 15 16. Stem cells with enhanced paracrine signaling should enhance cardiac repair. In addition, improved electric coupling between injected stem cells and cardiac myocytes, via gap junctions, could enhance or induce the commitment of stem cells to the cardiac lineage and thereby improve their ability to repair the damaged heart.
Recently we have shown, in a mouse myocardial infarction (MI) model, that cortical bone derived stem cells (CBSCs) improve cardiac function after myocardial infarction. However, CBSCs have not been fully characterized and their reparative potential relative to other stem cell types currently being tested in human trials is unknown. In this study, two stem cell types are used as standards to evaluate the potential of CBSCs. CDCs are used as a gold standard since they are resident cardiac stem cells and are primed to commit towards cell types that constitute the heart. Additionally, MSCs are used for comparison, as they are isolated from bone marrow, lying in close proximity to hard bone that is the source for CBSCs. We aim to investigate if CBSCs share any properties with MSCs. The current research will determine if CBSCs have enhanced proliferation, survival, and differentiation versus the two other stem cells types (cardiac derived stem cells (CDCs) and bone marrow mesenchymal stem cells (MSCs). Our results show proof of concept that these cells have properties that support the idea that they have greater potential to repair the damaged heart than other cells that are currently being tested clinically.
METHODS Cortical Bone Stem Cell (CBSCs) isolation. Cortical bone stem cells were isolated from biopsies obtained from hard bone of miniswine (Gottingen, female 4-6 months age), or tibias and femurs of eGFP + C57BL/6 mice. Bone marrow was flushed out before taking the bone biopsies (3mm). The bone biopsy was digested in collagenase for an hour and passed through 100m and 40m. The remaining cells were plated in CBSCs growth media until homogenous population of stem cells was obtained as described previously 1. Cardiac Derived Stem Cell (CDCs) isolation. Heart biopsy was obtained from Gottingen miniswine or eGFP + C57BL/6 mice for isolation of cardiac derived stem cells. Heart tissue was digested in collagenase and c-kit sorted as described earlier 1. CDCs were cultured in CBSCs media. Mesenchymal Stem Cells (MSCs) isolation. Mesenchymal stem cells were isolated from swine and obtained from University of Miami. The cells were cultured in DMEM (Invitrogen, containing 20% Fetal Bovine Serum (Gibco Life Technologies, NY), 1% Penicillin/Streptomycin/L-glutamine (Gibco Life Technologies, NY) as described earlier 17. Proliferation and survival assays. CyQuant assay involves plating cells in quadruplicate (2000 cells/ well) in a 96-well plate and incubation CyQuant reagent (Life Technologies, CA) as previously described 2. pCBSCs, CDCs and MSCs were plated in a 6-well dish (30,000 cells/well) and incubated in their respective medium without serum overnight and then treated with 10, 20, 30, 40 and 50 μmol/L H2O2 overnight. Cell death was confirmed by visualizing the cells under a light microscope before collection. Cells were harvested and stained with Annexin-V (Life Technologies, CA) and PI (Life Technologies, CA) according to manufacturer’s protocol. Data were acquired with the BD Caliber and analyzed by Flow Jo software (BD Biosciences). All experiments were done using cells from passage numbers around 12-18. Morphometric analysis. pCBSCs, CDCs and MSCs were plated in a permenox chamber slides, and bright field images were obtained using Nikkon TS100 microscope. Cell morphology was measured by tracing the outline of the cells using ImageJ software. 200 cells were used to quantify cell morphology per stem cell type. Real-Time Reverse Transcriptase-Polymerase Chain Reaction. Total RNA was isolated from multiple stem cell type using Quick-RNA MiniPrep (Zymo Research, CA) according to manufacturer’s protocol. cDNA was prepared using iScript cDNA Synthesis Kit (Bio Rad, CA). Real-time polymerase chain reaction (PCR) was performed on samples in triplicate using iQ SYBER Green (Qiagen, CA). Primer sequences are listed in onlne Table II. Lineage commitment and immuno staining. For differentiation pCBSCs, CDCs and MCS were treated with dexamethasone 10-8 mol/L for 7 days as previously described 2. Cells were fixed with 4% PFA and immuno-staining was performed as described earlier stained for paracrine factors including bFGF (ABCAM, Cambridge MA), Hepatocyte growth factor HGF (ABCAM, Cambridge MA), Insulin like growth factor IGF-1 (ABCAM, Cambridge MA), Vascular endothelial growth factor VEGF (ABCAM, Cambridge MA), Platelet derived growth factor PDGF (ABCAM, Cambridge MA) before and after differentiation. Chemotaxis in response to growth factors. pCBSCs, CDCs and MSCs were exposed to different concentrations (50, 100 and 200ng/ml) of bFGF, HGF, VEGF, IGF-1, SDF-1, PDGF, SDF-1 and TGF- (Peprotech; Rocky Hill, NJ) for 24 hours in a
Boyden chamber (Biocell Labs, CA). The migration was estimated by light microscopy. The migrated cell were stained and dissociated following manufacturer’s guidelines. The measurements were obtained at OD 560 using plate reader (Tecan, CA) Adult ventricular myocytes (AVM) co-culture and FRAP assay. AVM were isolated from feline hearts as described earlier 18. AVM’s were co-culture with pCBSCs, CDCs and MSCs stained with vybrant Dil labeling solution (Life technologies, CA) following manufacture’s protocol. Fluorescence recovery after photobleaching (FRAP) assay was developed to quantify diffusion of a fluorescent dyes between two cells forming connections to study cell-cell coupling and as described previously 19. Cytoplasmic Ca2+ level measurement in stem cells. Cytoplasmic Ca2+ was measured as described earlier 18. RNA sequencing. The sequencing libraries were constructed from 500 ng of total RNA using the Illumina’s TruSeq RNA Samplepre kit V2 (Illumina) following the manufacturer instruction. The fragment size of RNAseq libraries was verified using the Agilent 2100 Bioanalyzer (Agilent) and the concentrations were determined using Qubit instrument (LifeTech). The libraries were loaded onto the Illumina HiSeq 2500 at 6-10 pM on the rapid mode for 2x100 bp paired end read sequencing. The fastq files were generated on the Illumina’s BaseSpace service or locally using the Casava software package for further analysis. Statistical analysis. All data were expressed as a mean ± SEM. Comparison between multiple groups were done by 1- or 2-way ANOVA. P value <0.05 was considered as statistically significant. Statistical analysis was performed using GraphPad prism version 5.0 software. RESULTS Characterization of Cortical bone stem cells.
Cortical bone stem cells were isolated from Gottingen miniswine (sCBSCs) to confirm the feasibility of CBSCs isolation, purification and expansion from a large animal model. Immuno-phenotypic characterization of sCBSCs documented the presence of a distinct cell surface receptor signature compared to CDCs and MSCs. RNA sequencing data revealed sCBSCs have a unique marker profile with high expression of CD55, Integrin 4 (ITGB4), Integrin -3 (CD61), CD82, NT5E (CD73) and Endoglin (ENG), compared to CDCs and MSCs (Online figure I). sCBSCs express lower levels of CD59 compared to CDCs and MSCs. Expression of CD96 was extremely low in sCBSCs and CDCs, compared to MSCs. Similarly, CD248 was expressed on sCBSCs and CDCs. All three cells types expressed CD276, CD109, and were negative for PTPRC (CD45) and CD11b (Online figure I). Expression of some of these markers was also confirmed using Real time RT-PCR analysis (Online table I). Single cell cloning was performed by FACS sorting in a 96-well dish. Each well was carefully assessed under a microscope to confirm the presence of a single cell per well. CBSCs could generate colonies within 5-7 days (Online figure II). These data established that despite the close proximity of origin for MSCs and CBSCs, CBSCs exhibit an extremely distinct cell surface profile and are highly clonogeneic.
sCBSCs isolated exhibited a unique morphometry compared to CDCs and MSCs. CBSCs were thin spindle shaped cells and share some similar morphology with CDCs. MSCs were broad flat cells with distinct differences in morphology when compared with CBSCs (Fig1A-C), as seen under bright field microscopy. There were significant differences in the overall area of CBSCs versus CDCs and MSCs. In addition, CBSCs showed significantly reduced roundness compared to CDCs and MSCs (Fig 1D-E).
sCBSCs showed significantly increased proliferation at day 3 compared to CDCs (p<0.001) and MSCs (p<0.001) (Figure 1F). Concurrently, the enhanced accumulation of sCBSCs in S-phase (20.50%) together with a significant reduction of the G1-phase (64.6%) compared to CDCs (G1-phase 79.7%, S-phase 11.6%) and MSCs (G1-phase 83.7%, S- phase 7.95%) (Figure 1G) documents differences in the proliferative potential of CBSCs versus CDCs and MSCs. Genes involved in proliferation and cell cycle clustered in a heat map indicates increased expression of Cyclin D2 (CCND2), Guanine Nucleotide Binding Protein-Like 3 (GNL3). Similarly, Replication Protein A3 (RPA3), which plays an essential role both in DNA replication and in the cellular response to DNA damage, was up regulated in CBSCs. CDK2A, involved in G1-S transition in a cell cycle, was also increased in CBSCs compared to CDCs and MSCs (Figure 1H). Taken together, these data suggest that CBSCs possess higher proliferative capacity than CDCs and MSCs. Improved survival, immuno-modulatory and migration capacity.
sCBSCs and CDCs exhibit greater survival as compared to MSCs after apoptotic challenge with H2O2. MSCs showed a 27.9 fold increase in cell death compared to CBSCs and CDCs (p<0.01) at 50M of H2O2 treatment for 4 hours (Fig 2A-D). Co-culture experiments with Adult Ventricular Myocytes (AVM) showed that sCBSCs and CDCs improved myocyte survival with a 1.16 fold increased survival of CBSCs versus MSCs (p<0.01) and a 1.25 fold increase in CDCs vs MSCs (p<0.001; Fig 2E). These data suggest that sCBSCs have a greater ability that the comparator cells to withstand apoptotic stimuli and like CDCs they enhance myocyte survival under hostile conditions.
There are new data suggesting that the cardioprotective effects of stem cells could result from modulation of the immune response. sCBSCs expressed extremely low levels of IL-1A that is mainly responsible for the production of inflammation and Secreted Phosphoprotein-1 (SPP1) that is expressed on immune cells including macrophages, neutrophils, dendritic cells, and T and B cells, with varying kinetics (p<0.001 CBSCs vs MSCs). CD86, a protein present on antigen presenting cells that provides signals to activate T cells, was expressed at low levels in s?CBSCs when compared with CDCs and MSCs. IL-33 which is thought to drive expression of T helper cells was also expressed at lower levels in CBSCs (p<0.01 CBSCs vs MSCs and CDCs). IL-18 (interferon gamma inducing factor) expression is also lower in CBSCs as compared to CDCs and MSCs. IL-18 after stimulation activates natural killer (NK) cells and certain T cells which release interferon-γ (IFN-γ) or type II interferon that plays an important role in activating the macrophages. CBSCs had increased expression of TGF-1 as compared to CDCS and MSCs. (p<0.05 CBSCs vs CDCs) (Fig 2F). There was no significant difference in expression of immune markers detected in undifferentiated or differentiated states in s?CBSCs. These preliminary data suggest that CBSCs will influence the immune response after cardiac injury.
Migration of stem cells towards sites of injury is important to augment cardiac repair after injury. Several growth, paracrine, and autocrine factors are released by stem cells if/when they arrive at the site of injury20. sCBSCs, CDCs and MSCs all showed chemotaxis for most of the paracrine factors including b-FGF, HGF, VEGF, IGF-1, SDF-1, PDGF and TGF-. CBSCs showed increased migration towards TGF- compared to CDCs and MSCs (CBSCs vs CDCs and MSCs; p<0.001) (Fig 2G). To test the migration and engraftment capacity of donor stem cell population in response to injury in an in-vivo setting, CBSCs and
CDCs isolated from eGFP C57/BL6 isolated from eGFP C57/BL6 mice were injected in mice after MI. Mice, which received mCBSCs, showed robust mobilization from border zone to injury site versus CDCs that were present as a cluster in a border zone area at 2 weeks. mCBSCs showed engraftment in the infarct area with some cells showing organization after 2 weeks. (Fig 2H) Paracrine factor expression and enhanced lineage commitment.
Stem cells injected into injured hearts could improve cardiac function by the secretion of paracrine factors that stimulate cardiomyocyte survival and/or angiogenesis, by recruitment of endogenous stem cells that enhance cardiac repair into the damaged region, or by differentiation into new cardiac tissue (blood vessels and myocytes). We assessed paracrine factors known to play a role in cardiac repair process including b-FGF, HGF, IGF-1, VEGF and PDGF, in sCBSCs, CDCs and MSCs via immuno-labeling before and after treatment with differentiation media. The expression levels of these paracrine factors changed in response to differentiation stimuli. sCBSCs expressed high levels of HGF, VEGF and PGDF after differentiation with dexamethasone treatment (Fig 3E). Markers of cardiac lineage commitment, including GATA-4 and MEF2C (transcription factors that play an important role in cardiac development), von Willebrand factor (vWF; involved in vasculogenesis), and cardiac troponin T (myogenesis) were increased in s?CBSCs relative to MSCs and CDCs after dexamethasone (Dex) treatment. These results were confirmed by quantitative real-time polymerase chain reaction analysis (Fig 3A-D). Morphological remodeling (flattening of cells) was observed after dexamethasone treatment in CBSCs as prior observed in CDCs 2. Functional gap junctions with the neighboring myocytes.
Improved cardiac function induced by autologous cell therapy is thought to involve integration of transplanted stem cells with the host myocardium. Direct interaction of the transplanted stem cells with the host myocardium could be involved in cardioprotection. The potential of sCBSCs, CDCs, and MSCs to form cell-cell connections with the host myocardium was assessed by co-culture with adult ventricular myocytes. DIL-labeled sCBSCs were co-cultured with isolated adult ventricular myocytes (AVMs) for a week. In co-culture, myocytes formed Connexin-43 (Cn43) positive connections with CBSCs within 2-3 days (Online figure III). Functional gap junctions between the three stem cell types and AVMs were significantly increased during the first week in co-culture. We confirmed the presence of direct cellular communication between AVMs and CBSCs, CDCs and MSCs using a fluorescence recovery after a photo-bleaching assay. FITC- calcein fluorescence signal of the photo-bleached AVM recovered during the 15 min recovery period, while the calcein signal of the neighboring stem cells declined indicating a functional gap junction with neighboring AFVMs (Fig 4). Additionally, electrical coupling of CBSCs to AVMs was demonstrating by recording membrane potential fluctuations in CBSCs that occurred during contractions of neighboring AVMs (n=3). These likely occurred by conduction of local currents from AVMs into CBSCs via gap junctions (Online figure IV). Differential responses to histamine and ATP stimulus between CBSCs, CDCs and MSCs measured by cytosolic calcium levels.
Changes in cytosolic Ca2+ were measured in sCBSCs, CDCs and MSCs after exposure to histamine and nucleotide (ATP). The number of cells responding to Histamine was greater (78.25%) in CBSCs than in MSCs (31.6%) (p>0.01). CDCs did not response to histamine (Fig 5A-D). CBSCs, CDCs, and MSCs also had different responses to 200 μM ATP. ATP caused a transient rise in Ca2+ followed by a steady state elevation. The relative Ca2+ peak was greatest for CBSCs followed by CDCs and then MSCs respectively (Fig 5E-G). 100% of CBSCs and CDCs showed response to ATP compared to 58% for MSCs (p<0.05 CBSCs and CDCs vs MSCs; Fig 5H).
Cellular therapy for patients with heart failure has progressed from pre-clinical studies to early clinical trials during the past decade 9 6 21. However, results from cellular therapy trials using multiple stem cell types have shown little or no positive effect on cardiac structure and function 10. Improved cardiac function is contingent on many factors including the successful delivery of the therapeutic agent to the injury site. The goals of cell therapy for injured hearts include regeneration of new tissue in place of damaged myocardium 22, salvaging myocytes that are at risk of death 23 and/or immunomodulation of the inflammatory response after cardiac insult to improve post MI remodeling 24. Important factors for enhanced regeneration/repair that we explored in this study include the potency/potential of the transplanted cells 25, their capacity to survive 26, migrate and proliferate 27, engraft and make connections to the existing neighboring myocytes in the ischemic cardiac milieu. We simultaneously investigated stem cell derived paracrine, autocrine and growth factors that play an important role in salvaging the existing myocytes and restrict infarct expansion to improve cardiac function.
In the present study a novel population of stem cell from the bone stroma has been characterized and compared to more extensively studied stem cell types that are currently being used for clinical trial including cardiac derived stem cells and bone marrow derived MSCs. Stem cell derived from cortical bone (CBSCs) express a distinctive cell surface marker profile, clearly separating them from MSCs derived from bone marrow and CDCs that was used as a standard in the study (Online figure I). CBSCs also exhibit different morphology when compared with MSCs and share some similarities with CDCs (Fig 1). A unique marker profile and differences in appearance confirm the novelty of CBSCs.
Poor survival and marginal retention of adoptively transferred cells into the pathologically challenged heart is widely reported, massive loss of donated stem cells and failure to engraft in the damaged organ occurs within the first few days after delivery and therefore pose a challenge in the field 11. The optimal stem cell should be able to endure apoptotic, necrotic and hypoxic conditions prevalent in host environment for desirable results. CBSCs and CDCs showed enhanced survival after an apoptotic challenge compared to MSCs. Also, CBSCs and CDCs increased the survival of adult ventricular myocytes in a co-culture experiment, suggesting that their know beneficial effects are not only related to their enhanced survival capacity but also to an ability to salvage myocytes at the site of injury that have survived the acute insult (Fig 2). In addition to low survival the poor mobility and engraftment of donated stem cell could also impede their therapeutic potential. CBSCs showed enhanced capacity to migrate from the injection site to the infarct border zone in vivo and engraft in the infarct zone within 2 weeks (Fig 2H). This enhanced engraftment may be due to their improved secretion of paracrine factors and/or the response to the factors produced at the site of injury. To achieve more meaningful results from cellular therapy, donated stem cells that can proliferate should be more effective since the proliferation of surviving stem cells should compensate for the cells that die after injection and enhance their reparative effects after cardiac injury. Proliferation capacity is significantly enhanced in CBSCs versus MSCs and CDCs with increased numbers of cells in S phase. Concurrently, CBSCs had greater gene expression of CCND2, GNL3, RPA3, CDK2A, which are known regulators for cell cycle progression.
Stem cells could modulate the immune response in the injured heart to improve cardiac repair after injury. Tissue injury results in release of pro inflammatory cytokines that triggers a cascade of events, involving attraction of T lymphocytes to the site of injury that then secrete pro inflammatory factors which increase influx of other immune cell types including T, B and antigen-presenting cells (APCs) to the site of injury 28. However, prolonged intense inflammation can result in further damage eventually leading to organ failure. Immune modulatory properties of stem cells may promote resolution of inflammation and facilitate tissue repair. Previously, MSCs have been well reported to have a beneficial role in immune modulation and are known to be immuno-privileged 29. Therefore we aimed to determine if CBSCs possess markers that suggest that they are be involved in altering the immune response to injury. CBSCs expressed extremely
low levels of IL1, SPP1 and IL-18 compared to MSCs and CDCs. These factors are known to play a pro inflammatory role and trigger T, B cells and APCs responses. IL1 is mainly produced by activated macrophages and neutrophils and is known to play central role in mediating an immune response 30. Diminished expression of these factors suggests CBSCs could play a positive role in modulating the immune response, which might lead to improve wound healing cardiac repair after infarction. Concurrently, CBSCs also express increased TGF levels. TGF can inhibit T lymphocyte proliferation 31 and it has been demonstrated that anti-TGF antibodies can restore T lymphocyte proliferation 32. These preliminary findings suggest that CBSCs might have a potential role in regulating immune suppression after CBSCs delivery.
Stem cell mediated myocardial repair could involve communication between the injected stem cells and the cells within the heart 12 33 14. Communication between the stem cells and myocytes can be achieved by secretion of cardioprotective or angiogenic factors (paracrine signaling) 34 or from direct stem cell, cardiac myocyte, contact 35. CBSCs can form direct gap junctional connections with adult ventricular myocytes that could enhance their reparative properties. Stem cells with enhanced paracrine signaling should be able to augment cardiac repair mitigating direct protection 36 on the existing myocyte and/or stimulating the endogenous pool of stem cells to replicate and contribute in repair processes 37. After lineage commitment all three stem cell types expressed paracrine factors known to be responsible for improvements in cardiac function after stem cell transplantation (Fig 3). In our previous published findings we have shown that, after 24 hours and 2 weeks of CBSCs transplantation, levels of paracrine factors including bFGF and VEGF are up-regulated 1 and could account for enhanced neovascularization previously observed in CBSCs injected animals after ischemic insult. Similarly, these paracrine factors are also known to have protective effects on heart. This protective effect can be on myocytes and vessels that can limit the expansion of infarct area after cardiac injury leading to improvement in cardiac function. Simultaneously, CBSCs also have the ability to differentiate into new myocytes and vessels to improve cardiac function after myocardial infarction in a murine model1. Improved electric coupling between injected stem cells and cardiac myocytes via gap junctions could enhance the commitment of stem cells to the cardiac lineage and enhance their ability to repair the damaged heart. CBSCs, CDCs and MSCs all couple to adult ventricular myocytes making function gap junctions for direct cellular communication as shown by a FRAP assay (Fig 4). To initiate the reparative process, stem cells must respond to various stimuli and our results show that CBSCs can respond to inflammatory cytokines as previously reported in other stem cell types including cardiac progenitor cells 38 and embryonic stem cells 39.Our results reveal that each cell type responds differently to the inflammatory cytokines ATP and histamine. Both of these cytokines activate plasma membrane receptors, which elicit downstream IP3R (spell out?) mediated calcium signaling. ATP and histamine play important roles in inflammatory signaling and contribute to cardiac repair after MI 40 41. Our results indicate that unlike CDCs and MSCs, CBSCs respond to both ATP and histamine making them prime candidates to initiate cardiac repair processes after MI.
In summary, our study delineated unique characteristics of stem cells isolated from cortical bone. CBSCs express distinctive cell surface marker profiles, which clearly distinguish them from MSCs and CDCs. A meticulous comparison of CBSCs with CDCs revealed that despite of CBSCs non-cardiac origin, they are equivalent to or better than CDCs in terms of proliferative, survival and cardiac lineage commitment capacity. Preliminary findings also highlighted the prospective role of CBSCs in modifying the immune response, however detailed in-vivo studies are needed to fully understand their immune modulating properties. Furthermore, CBSCs secrete a host of paracrine factors and possess the ability to migrate to the site of injury and engraft which should reduce damage and enhance repair after ischemic insult. Our findings suggest that CBSCs may be superior to MSCs or CDCs in terms of their ability to repair the heart that has been injured by ischemic disease.
SOURCES OF FUNDING SRH is funded by NIH and American Heart Association, SM is funded by American Heart Association (Scientific Development Grant). DISCLOSURES None. REFERENCES 1. Duran JM, Makarewich CA, Sharp TE, Starosta T, Zhu F, Hoffman NE, Chiba Y, Madesh M,
Berretta RM, Kubo H, Houser SR. Bone-derived stem cells repair the heart after myocardial infarction through transdifferentiation and paracrine signaling mechanisms. Circulation research. 2013;113:539-552
2. Mohsin S, Khan M, Toko H, Bailey B, Cottage CT, Wallach K, Nag D, Lee A, Siddiqi S, Lan F, Fischer KM, Gude N, Quijada P, Avitabile D, Truffa S, Collins B, Dembitsky W, Wu JC, Sussman MA. Human cardiac progenitor cells engineered with pim-i kinase enhance myocardial repair. Journal of the American College of Cardiology. 2012;60:1278-1287
3. Urbanek K, Torella D, Sheikh F, De Angelis A, Nurzynska D, Silvestri F, Beltrami CA, Bussani R, Beltrami AP, Quaini F, Bolli R, Leri A, Kajstura J, Anversa P. Myocardial regeneration by activation of multipotent cardiac stem cells in ischemic heart failure. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:8692-8697
4. Oskouei BN, Lamirault G, Joseph C, Treuer AV, Landa S, Da Silva J, Hatzistergos K, Dauer M, Balkan W, McNiece I, Hare JM. Increased potency of cardiac stem cells compared with bone marrow mesenchymal stem cells in cardiac repair. Stem cells translational medicine. 2012;1:116-124
5. Karantalis V, DiFede DL, Gerstenblith G, Pham S, Symes J, Zambrano JP, Fishman J, Pattany P, McNiece I, Conte J, Schulman S, Wu K, Shah A, Breton E, Davis-Sproul J, Schwarz R, Feigenbaum G, Mushtaq M, Suncion VY, Lardo AC, Borrello I, Mendizabal A, Karas TZ, Byrnes J, Lowery M, Heldman AW, Hare JM. Autologous mesenchymal stem cells produce concordant improvements in regional function, tissue perfusion, and fibrotic burden when administered to patients undergoing coronary artery bypass grafting: The prospective randomized study of mesenchymal stem cell therapy in patients undergoing cardiac surgery (prometheus) trial. Circulation research. 2014;114:1302-1310
6. Bolli R, Chugh AR, D'Amario D, Loughran JH, Stoddard MF, Ikram S, Beache GM, Wagner SG, Leri A, Hosoda T, Sanada F, Elmore JB, Goichberg P, Cappetta D, Solankhi NK, Fahsah I, Rokosh DG, Slaughter MS, Kajstura J, Anversa P. Cardiac stem cells in patients with ischaemic cardiomyopathy (scipio): Initial results of a randomised phase 1 trial. Lancet. 2011;378:1847-1857
7. Patila T, Lehtinen M, Vento A, Schildt J, Sinisalo J, Laine M, Hammainen P, Nihtinen A, Alitalo R, Nikkinen P, Ahonen A, Holmstrom M, Lauerma K, Poyhia R, Kupari M, Kankuri E, Harjula A. Autologous bone marrow mononuclear cell transplantation in ischemic heart failure: A prospective, controlled, randomized, double-blind study of cell transplantation combined with coronary bypass. J Heart Lung Transplant. 2014;33:567-574
8. Delewi R, van der Laan AM, Robbers LF, Hirsch A, Nijveldt R, van der Vleuten PA, Tijssen JG, Tio RA, Waltenberger J, Ten Berg JM, Doevendans PA, Gehlmann HR, van Rossum AC, Piek JJ, Zijlstra F, investigators H. Long term outcome after mononuclear bone marrow or peripheral blood cells infusion after myocardial infarction. Heart. 2015;101:363-368
9. Makkar RR, Smith RR, Cheng K, Malliaras K, Thomson LE, Berman D, Czer LS, Marban L, Mendizabal A, Johnston PV, Russell SD, Schuleri KH, Lardo AC, Gerstenblith G, Marban E.
11. Hong KU, Guo Y, Li QH, Cao P, Al-Maqtari T, Vajravelu BN, Du J, Book MJ, Zhu X, Nong Y, Bhatnagar A, Bolli R. C-kit+ cardiac stem cells alleviate post-myocardial infarction left ventricular dysfunction despite poor engraftment and negligible retention in the recipient heart. PloS one. 2014;9:e96725
12. Xie Y, Ibrahim A, Cheng K, Wu Z, Liang W, Malliaras K, Sun B, Liu W, Shen D, Cheol Cho H, Li T, Lu L, Lu G, Marban E. Importance of cell-cell contact in the therapeutic benefits of cardiosphere-derived cells. Stem cells. 2014;32:2397-2406
13. Yang D, Wang W, Li L, Peng Y, Chen P, Huang H, Guo Y, Xia X, Wang Y, Wang H, Wang WE, Zeng C. The relative contribution of paracine effect versus direct differentiation on adipose-derived stem cell transplantation mediated cardiac repair. PloS one. 2013;8:e59020
14. Hahn JY, Cho HJ, Kang HJ, Kim TS, Kim MH, Chung JH, Bae JW, Oh BH, Park YB, Kim HS. Pre-treatment of mesenchymal stem cells with a combination of growth factors enhances gap junction formation, cytoprotective effect on cardiomyocytes, and therapeutic efficacy for myocardial infarction. Journal of the American College of Cardiology. 2008;51:933-943
15. Mirotsou M, Jayawardena TM, Schmeckpeper J, Gnecchi M, Dzau VJ. Paracrine mechanisms of stem cell reparative and regenerative actions in the heart. Journal of molecular and cellular cardiology. 2011;50:280-289
16. Tang JM, Wang JN, Zhang L, Zheng F, Yang JY, Kong X, Guo LY, Chen L, Huang YZ, Wan Y, Chen SY. Vegf/sdf-1 promotes cardiac stem cell mobilization and myocardial repair in the infarcted heart. Cardiovascular research. 2011;91:402-411
17. Williams AR, Hatzistergos KE, Addicott B, McCall F, Carvalho D, Suncion V, Morales AR, Da Silva J, Sussman MA, Heldman AW, Hare JM. Enhanced effect of combining human cardiac stem cells and bone marrow mesenchymal stem cells to reduce infarct size and to restore cardiac function after myocardial infarction. Circulation. 2013;127:213-223
18. Makarewich CA, Zhang H, Davis J, Correll RN, Trappanese DM, Hoffman NE, Troupes CD, Berretta RM, Kubo H, Madesh M, Chen X, Gao E, Molkentin JD, Houser SR. Transient receptor potential channels contribute to pathological structural and functional remodeling after myocardial infarction. Circulation research. 2014;115:567-580
19. Kubo H, Berretta RM, Jaleel N, Angert D, Houser SR. C-kit+ bone marrow stem cells differentiate into functional cardiac myocytes. Clinical and translational science. 2009;2:26-32
20. Liu SQ, Tefft BJ, Zhang D, Roberts D, Schuster DJ, Wu A. Cardioprotective mechanisms activated in response to myocardial ischemia. Molecular & cellular biomechanics : MCB. 2011;8:319-338
21. Mushtaq M, DiFede DL, Golpanian S, Khan A, Gomes SA, Mendizabal A, Heldman AW, Hare JM. Rationale and design of the percutaneous stem cell injection delivery effects on neomyogenesis in dilated cardiomyopathy (the poseidon-dcm study): A phase i/ii, randomized pilot study of the comparative safety and efficacy of transendocardial injection of autologous mesenchymal stem cell vs. Allogeneic mesenchymal stem cells in patients with non-ischemic dilated cardiomyopathy. Journal of cardiovascular translational research. 2014;7:769-780
22. Messina E, De Angelis L, Frati G, Morrone S, Chimenti S, Fiordaliso F, Salio M, Battaglia M, Latronico MV, Coletta M, Vivarelli E, Frati L, Cossu G, Giacomello A. Isolation and expansion of adult cardiac stem cells from human and murine heart. Circulation research. 2004;95:911-921
23. Quijada P, Toko H, Fischer KM, Bailey B, Reilly P, Hunt KD, Gude NA, Avitabile D, Sussman MA. Preservation of myocardial structure is enhanced by pim-1 engineering of bone marrow cells. Circulation research. 2012;111:77-86
24. Karantalis V, Hare JM. Use of mesenchymal stem cells for therapy of cardiac disease. Circulation research. 2015;116:1413-1430
25. Quijada P, Sussman MA. Making it stick: Chasing the optimal stem cells for cardiac regeneration.
mesenchymal stem cells augment cardiac function and cell survival in the infarct heart. Journal of cardiovascular pharmacology. 2015;65:241-251
27. Dixit P, Katare R. Challenges in identifying the best source of stem cells for cardiac regeneration therapy. Stem cell research & therapy. 2015;6:26
28. Ho MS, Mei SH, Stewart DJ. The immunomodulatory and therapeutic effects of mesenchymal stromal cells for acute lung injury and sepsis. Journal of cellular physiology. 2015
29. Ben Nasr M, Vergani A, Avruch J, Liu L, Kefaloyianni E, D'Addio F, Tezza S, Corradi D, Bassi R, Valderrama-Vasquez A, Usuelli V, Kim J, Azzi J, El Essawy B, Markmann J, Abdi R, Fiorina P. Co-transplantation of autologous mscs delays islet allograft rejection and generates a local immunoprivileged site. Acta diabetologica. 2015
30. Santarlasci V, Cosmi L, Maggi L, Liotta F, Annunziato F. Il-1 and t helper immune responses. Frontiers in immunology. 2013;4:182
31. Delisle JS, Giroux M, Boucher G, Landry JR, Hardy MP, Lemieux S, Jones RG, Wilhelm BT, Perreault C. The tgf-beta-smad3 pathway inhibits cd28-dependent cell growth and proliferation of cd4 t cells. Genes and immunity. 2013;14:115-126
32. Zhang N, Bevan MJ. Tgf-beta signaling to t cells inhibits autoimmunity during lymphopenia-driven proliferation. Nature immunology. 2012;13:667-673
33. Wang DG, Zhang FX, Chen ML, Zhu HJ, Yang B, Cao KJ. Cx43 in mesenchymal stem cells promotes angiogenesis of the infarcted heart independent of gap junctions. Molecular medicine reports. 2014;9:1095-1102
34. Wang WE, Yang D, Li L, Wang W, Peng Y, Chen C, Chen P, Xia X, Wang H, Jiang J, Liao Q, Li Y, Xie G, Huang H, Guo Y, Ye L, Duan DD, Chen X, Houser SR, Zeng C. Prolyl hydroxylase domain protein 2 silencing enhances the survival and paracrine function of transplanted adipose-derived stem cells in infarcted myocardium. Circulation research. 2013;113:288-300
35. Hawat G, Helie P, Baroudi G. Single intravenous low-dose injections of connexin 43 mimetic peptides protect ischemic heart in vivo against myocardial infarction. Journal of molecular and cellular cardiology. 2012;53:559-566
36. Li J, Qi D, Cheng H, Hu X, Miller EJ, Wu X, Russell KS, Mikush N, Zhang J, Xiao L, Sherwin RS, Young LH. Urocortin 2 autocrine/paracrine and pharmacologic effects to activate amp-activated protein kinase in the heart. Proceedings of the National Academy of Sciences of the United States of America. 2013;110:16133-16138
37. Khan M, Nickoloff E, Abramova T, Johnson J, Verma SK, Krishnamurthy P, Mackie AR, Vaughan E, Garikipati VN, Benedict CL, Ramirez V, Lambers E, Ito A, Gao E, Misener S, Qin G, Luongo TS, Elrod JW, Houser SR, Koch WJ, Kishore R. Embryonic stem cell-derived exosomes promote endogenous repair mechanisms and enhance cardiac function following myocardial infarction. Circulation research. 2015
38. Ferreira-Martins J, Ogorek B, Cappetta D, Matsuda A, Signore S, D'Amario D, Kostyla J, Steadman E, Ide-Iwata N, Sanada F, Iaffaldano G, Ottolenghi S, Hosoda T, Leri A, Kajstura J, Anversa P, Rota M. Cardiomyogenesis in the developing heart is regulated by c-kit-positive cardiac stem cells. Circulation research. 2012;110:701-715
39. Yanagida E, Shoji S, Hirayama Y, Yoshikawa F, Otsu K, Uematsu H, Hiraoka M, Furuichi T, Kawano S. Functional expression of ca2+ signaling pathways in mouse embryonic stem cells. Cell Calcium. 2004;36:135-146
40. Eltzschig HK, Sitkovsky MV, Robson SC. Purinergic signaling during inflammation. The New England journal of medicine. 2013;368:1260
41. Levick SP, Melendez GC, Plante E, McLarty JL, Brower GL, Janicki JS. Cardiac mast cells: The centrepiece in adverse myocardial remodelling. Cardiovascular research. 2011;89:12-19
FIGURE LEGENDS Figure 1: Morphology and enhanced proliferation: A-C; Morphometric differences between CBSCs, CDCs and MSCs from mini swine: Bright field images showed distinct morphometric differences between three cell types. D-E; differences in roundness and Area measured by image J. *p <0.05, ***p<0.001 compared to CBSCs. F; Enhanced proliferation rate is observed in mini swine CBSCs compared to CDCs (## p<0.01) and MSCs (*** p<0.001) by CyQuant assay (n=3). G; Increased cell cycle progression in mini swine CBSCs versus CDCs and MSCs; Increased S Phase is observed in CBSCs compared to CDCs and MSCs when stained with PI using FACS based cell cycle analysis (n=3). H; Comparative analysis of genes involved in cell cycle regulation by RNA seq analysis. Figure 2: Increased survival, migration and immunmodulation: A-D; mini swine CBSCs and CDCs showed reduction in Annexin-V+ and PI+ cells compared to MSCs in response to H2O2 challenge as evidenced by FACS based assay (n=3); ** p<0.01 CBSCs vs MSCs, NS CBSCs vs CDCs), E; Increased myocyte survival in a co-culture of mini swine CBSCs and CDCs with Adult ventricular myocytes at 48 and 76 hours measured by viability dye (*** p<0.001 CBSCs and CDCs co-culture with AVM vs myocyte alone, NS MSCs co-culture vs myocyte alone), F; comparative analysis of genes involved in immuno modulation measured by RNA seq analysis (CBSCs vs MSCs; ## p<0.01, ### p<0.001) , (CBSCs vs CDCs; *p<0.05, ** p<0.01), G; migration assay showed enhanced migration of CBSCs towards TGF 50ng (CBSCs vs MSCs; ### p<0.001), (CBSCs vs CDCs; *** p<0.001), H; CBSCs and CDCs isolated from eGFP C57/BL6 mice were transplanted in mice and sacrificed 2 week after transplantation, Red; α- sarcomeric actin, Green; GFP positive CBSCs, Blue; DAPI, scale bar represents 100m. Figure 3: Increased lineage cardiac commitment: A-D; GATA-4, MEF2C, von willibrand Factor (vWF), and cardiac Troponin T (cTnT-T), expression is increased compared to undifferentiated stem cells, with sCBSCs having the highest fold change expression of cardiac lineage commitment markers; NS is non significant, *p <0.05, **p<0.01, ***p<0.001 compared to CBSCs. E; Immuno-labeling of paracrine factor in CBSCs, CDCs and MSCs from mini swine before and after differentiation: Expression of bFGF, HGF, VEGF, PDGF and IGF-1 is represented in green with nuclear staining in blue. Figure 4: CBSCs form functional gap junctions in co-culture with Adult Ventricular Myocytes: Fluorescence Recovery After Photobleaching (FRAP) assay after 5 days of co-culture, A1, B1 and C1 shows bright field images demonstrating connections between mini swine CBSCs, CDCs and MSCs with AVM respectively (red arrows), Cells were loaded with FITC- calcein for 15 min. A2, B2 and C2 shows even distribution of dye before bleaching; A3, B3 and C3, Calcein fluorescence within coupled to AVM was photobleached (red arrows). A4, B4, C4; The calcein fluorescence signal of the photobleached AFVM recovered during 10 min recovery period while the calcein signal of the CBSCs, CDC and MSCs declined indicating that CBSCs form functional gap junction with neighboring AVMs (yellow arrows). D-F; fluorescence recovery at 5, 10 and 15 minutes after photo bleaching. Representative images at 40X; 50m. Figure 5: Differential response to ATP and histamine stimuli measured by cystolic calcium levels: swine CBSCs, CDCs and MSCs were loaded with Fluo-4-AM, perfused with Tyrode’s Solution and recoded for 3 minutes, after which cells were exposed to 1 M ATP or 5 histamine M. A-C; CBSCs, CDCs and MSCs exposed to histamine, D; Percentage of cells respond to histamine, Increased number of CBSCs responded to histamine versus MSCs **p<0.01 whereas CDCs did not respond to histamine. E-G; CBSCs, CDCs and MSCs exposed to ATP, H; all CBSCs and CDCs respond to ATP as compared to MSCS where significantly small numbers respond to ATP stimuli, *p<0.05 CBSCs vs MSCs.
Cell therapy after myocardial infarction leads to modest reductions in infarct size and some minor improvements in cardiac pump functions.
Adoptively transferred stem cells suffer from limited survival, engraftment and differentiation capacity and these problems reduce their ability to induce cardiac repair, justifying the need for identification of a novel stem cell type that has the capacity to overcome these limitations.
Cortical bone derived stem cells (CBSCs) have recently been shown to have a great ability to
improve cardiac structure and function after myocardial infarction.
What New Information Does This Article Contribute?
Cortical bone derived stem cells have enhanced proliferation, survival, engraftment capacity.
Cortical bone stem cells can form functional gap junctions with adult derived feline myocytes CBSCs improve cardiac function after myocardial infarction and these functional gains are attributed to de-novo myocyte formation and neovascularization in combination with paracrine factor secretion from the donated CBSCs. In the present study, an exhaustive characterization of CBSCs was done in comparison to two stem cell types being used in clinical trials, including Cardiac Derived stem Cells (CDCs) and Mesenchymal Stem Cells (MSCs). CBSCs possess a unique cell surface marker profile and had enhanced proliferation, survival and engraftment capacity versus CDCs and MSCs. In addition, CBSCs formed functional gap junctions with adult cardiac myocytes and enhanced myocyte survival. Collectively, our results show proof of concept that CBSCs have properties that explain their greater ability to repair the damaged heart than two other cell types that are currently being tested clinically.
HouserSmith, Jason M Duran, Neil Zalavadia, Yan Zhou, Hajime Kubo, Remus M Berretta and Steven R
Sadia Mohsin, Constantine D Troupes, Timothy Starosta, Thomas E Sharp, Elorm J Agra, Shavonn CUnique Features of Cortical Bone Stem Cells Associated with Repair of the Injured Heart
is online at: Circulation Research Information about subscribing to Subscriptions:
http://www.lww.com/reprints Information about reprints can be found online at: Reprints:
document. Permissions and Rights Question and Answer available in the
Request Permissions in the middle column of the Web page under Services. Further information about this process isOffice. Once the online version of the published article for which permission is being requested is located, click
can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialCirculation Research Requests for permissions to reproduce figures, tables, or portions of articles originally published inPermissions:
Supplemental Material: Cortical Bone Stem Cell (CBSCs) isolation: From mice: Cortical bone stem cells were isolated as previously described 1. Briefly, Femurs and tibias were isolated from transgenic 12-week-old male C57BL/6-Tg (CAG-EGFP)1Osb/J mice (The Jackson Laboratory; Bar Harbor, ME), which constitutively express enhanced green fluorescent protein (EGFP). Bone marrow was flushed out of the bone cavity and washed thoroughly with phosphate-buffered saline (PBS). Cortical bone was crushed using a sterilized mortar and pestle, and bone fragments were further digested using collagenase II for n hour at 37C. Bone chunks were removed using 100 um and 40um filters. Bone derived cells were plated in CBSCs media containing DMEM/F12 Media (Lonza/Biowhittaker; Basel, Switzerland) + 10% fetal bovine serum (Gibco Life Technologies; Grand Island, NY), 1% Penicillin/Streptomycin/L-glutamine (Gibco Life Technologies; Grand Island, NY), 0.2% insulin-transferrin-selenium (Lonza; Basel, Switzerland), 0.02% basic-fibroblast growth factor (Peprotech; Rock Hill, NJ), 0.02% epidermal growth factor (Sigma; St. Louis, MO), and 0.01% leukemia inhibitory factor (Millipore; Billerica, MA). Cells were passaged till homogenous population of stem cells was obtained. From Gottingen mini swine: Cortical bone stem cells were isolated from biopsies obtained from hard bone of miniswine. Bone marrow was flushed out before taking the bone biopsies (3mm). The bone biopsy was digested in collagenase for an hour and passed through 100um and 40um. The remaining cells were plated in CBSCs media until homogenous population of stem cells was obtained. Cardiac Derived Stem Cell (CDCs) isolation: Heart biopsy was obtained from Gottingen miniswine for isolation of cardiac derived stem cells. Heart tissue was digested in collagenase and c-kit sorted as described earlier 1. CDCs were cultured in CBSCs media. Mesenchymal Stem Cells (MSCs) isolation: Mesenchymal stem cells were kindly provided by Dr. Joshua Hare (University of Miami). The cells were cultured in DMEM (Invitrogen, containing 20% Fetal Bovine Serum (FBS, (Gibco Life Technologies; Grand Island, NY), 1% Penicillin/Streptomycin/L-glutamine (Gibco Life Technologies; Grand Island, NY) as described earlier 2. Adult Ventricular myocytes (AVM) Co-culture and FRAP assay: AVM were isolated from feline hearts as described earlier 3. Briefly, Felines were euthanized by IP injection of pentabarbitol (100 mg/kg) and hearts were rapidly excised, cannulated, and mounted on a constant-flow Langendorff apparatus to obtain myocytes. AVM’s were co-culture with CBSCs, CDCs and MSCs stained with vybrant Dil labeling solution (Life technologies, CA) following manufacture’s protocol. Fluorescence recovery after photobleaching (FRAP) assay was developed to quantify diffusion of a fluorescent dyes between two cells forming connections to study cell-cell coupling and as described previously 4. Cells in co-culture were loaded with the fluorescent dye FITC-casein and then the myocyte forming connections to neighboring stem cells were photobleached. The rate of fluorescence recovery into the bleached cell was be used as an indicator of the degree of coupling between the cells and AFVMs. These experiments were performed at day 7 after co-culture.
Cytoplasmic Ca2+ level measurement in stem cells: Cytoplasmic Ca2+ was measured as described earlier 3. Briefly, CBSCs, CDCS and MSCs were loaded with Fluo-4-AM and perfused with Tyrode’s solution and recorded for 3 minutes. The solution was then switched to contain either 1µM ATP (Sigma) or 5µM histamine (Sigma) and the fluorescence signal was acquired. Changes in fluorescence signal were not seen at baseline with prolonged recordings. Data was graphically visualized and analyzed using Nikon AR analysis software. 1. Duran JM, Makarewich CA, Sharp TE, Starosta T, Zhu F, Hoffman NE, Chiba Y,
Madesh M, Berretta RM, Kubo H, Houser SR. Bone-‐derived stem cells repair the heart after myocardial infarction through transdifferentiation and paracrine signaling mechanisms. Circulation research. 2013;113:539-‐552
2. Hatzistergos KE, Quevedo H, Oskouei BN, Hu Q, Feigenbaum GS, Margitich IS, Mazhari R, Boyle AJ, Zambrano JP, Rodriguez JE, Dulce R, Pattany PM, Valdes D, Revilla C, Heldman AW, McNiece I, Hare JM. Bone marrow mesenchymal stem cells stimulate cardiac stem cell proliferation and differentiation. Circulation research. 2010;107:913-‐922
3. Makarewich CA, Zhang H, Davis J, Correll RN, Trappanese DM, Hoffman NE, Troupes CD, Berretta RM, Kubo H, Madesh M, Chen X, Gao E, Molkentin JD, Houser SR. Transient receptor potential channels contribute to pathological structural and functional remodeling after myocardial infarction. Circulation research. 2014;115:567-‐580
4. Kubo H, Berretta RM, Jaleel N, Angert D, Houser SR. C-‐kit+ bone marrow stem cells differentiate into functional cardiac myocytes. Clinical and translational science. 2009;2:26-‐32
Online Figure I: Differen/al cell surface marker expression: CBSCs, CDCs, and MSCs isolated from mini swine express differen8al cell surface markers measured by RNA seq analysis.
Day 1 Day 2 Day 4
Day 5 Day 6 Day 7
Online Figure II: CBSCs are clonal: CBSCs from mini swine are clonally expanded. Single cell was sorted in a 96 well, Day 1 single cell, Day 7 mul8ple colonies of CBSCs generated from single cell demonstra8ng the clonal capacity of CBSCs.
Online Figure III: mCBSCs form gap junc8ons with Adult ventricular myocytes; CBSCs are in green, Connexin-‐43 white, α-‐sarcomeric ac8n red, DAPI Blue.
Patch PipeTe
CBSC
AVM
Online Figure IV: A; AVMs were co-‐cultured with CBSCs and membrane poten8als of CBSCs aTached to AVMs were recorded. Membrane poten8al fluctua8ons B; were recorded in CBSCs that occurred during spontaneous AVM contrac8on C;. (n=3). These likely occurred by conduc8on of local currents from AFVMs into CBSCs via gap junc8ons.
A
C B
Online Table I: Cell surface marker profiling: Cell surface marker profiling: Gene expression of different cell surface markers using Real time PCR showed difference in expression between the three cell types CBSCs , CDCs and MSCs from mini swines. CT values of cell surface receptor expression within 25-35 cycles was labeled as medium and lower CT values than 25 were labeled as high expression. CBSCs CDCs MSCs Functional Relevance
CD105 (High) CD105 (High) CD105 (High) Endoglin, part of TGFβ family, involved in angiogenesis
CD271 (High) LNGFR (low-affinity nerve growth factor receptor), involved in development, survival and differentiation of cells.
CD90 (High) CD90 (High) CD90 (High) Thy-1, expressed on variety of stem cells
CD133(med) CD133(med) CD133(med) Prominin-1, expressed on many stem cells including hematopoietic stem cells, endothelial progenitor cells
CD29 (High) CD29 (High) CD29 (High) Integrin Beta 1, in cell adhesion, recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells.
CD44 (med) CD44 (med) CD44 (med) Cell Adhesion and migration, also expressed on stem cells
CD45 (negative) CD45 (negative)
CD45 (negative)
Protein tyrosine phosphatase, receptor type, C, Present on hematopoietic cells,
CD11-b (negative)
CD11-b (negative)
CD11-b (negative)
Macrophage-1 antigen, expressed on many immune cells
Online Table II: Primer Sequences for Real time Rt-PCR CD105 R GAAACCTGGCTCGTGGTGTA CD105 F CAGCAGGTCTTGCAGAAGGA CD106 R CGTGGATCTGGTCCCGTTAG CD106 F GCGAGTCCTCCCTGTCTTTC CD73 R ACGTGAATTCCATTGTTCCGC CD73 F GACACCCGGATGAGATGTCC CD271R GGCAAAGCTGACTTGGCTTC CD271 F AATGAGGGGCCTCAGGTTTG CD90 R GTTCGAGAGCGGTAGGAGTG CD90 F GAATACCACCAACCTGCCCA CD133 R TCTGTCGCTGGTGCATTTCT CD133F TCCTAATGCCTCTGGTGGGG CD29 R TTCAGAACCTGCCCATAGCG CD29 F TCTCAGCACTGAATGCCAAGT CD44 R GCTTCACCCTTTGGTGTCTC CD44 F TTCCACTGAGGTTGGGGTGTA CD45 R TTCTGGTGTCTGCCTGCTTC CD45 F GTGAGAGTGGACGATAAAGGGA CD11b R TTGCTGGCAACCTAGACAGG CD11b F GCCTGTTGCCTCTGTGAGAA
