University of Groningen

Pex13p degradation in yeastChen, Xin

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2019

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Chen, X. (2019). Pex13p degradation in yeast. University of Groningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 29-12-2020

Pex13p degradation in yeast

PhD thesis

Xin Chen（陈新）

The studies presented in this thesis were performed in the research group Cell

Biochemistry of the Groningen Biomolecular Sciences and Biotechnology

Institute (GBB) of the University of Groningen, The Netherlands.

ISBN digital version: 978-94-034-1616-8

ISBN printed version: 978-94-034-1617-5

Cover design and layout: Chen Xin, Richard Mohler, Ilse Modder

Inner layout: Chen Xin, Ilse Modder, www.ilsemodder.nl

Printing: Gildeprint Enschede

© 2019 Chen Xin, Groningen, The Netherlands

All rights reserved.

Pex13p degradation in yeast

Phd thesis

to obtain the degree of PhD at the

University of Groningen

on the authority of the

Rector Magnificus prof. E. Sterken

and in accordance with

the decision by the College of Deans.

This thesis will be defended in public on

Friday 24 May 2019 at 11.00 hours

by

Xin Chen

born on 29 August 1987

in Neimongol, China

Supervisor

Prof. P.J.M. van Haastert

Co-supervisor

Dr. C.P. Williams

Assessment Committee

Prof. A.J.M. Driessen

Prof. S.J. Marrink

Prof. M. Schrader

Table of contents

Chapter 1 Introduction: From peroxisome formation to peroxisomal

membrane protein degradation

7

Aim and Outline 35

Chapter 2

Insights into the role of the peroxisomal ubiquitination

machinery in Pex13p degradation in the yeast Hansenula

polymorpha

39

Chapter 3

Further insights into Pex13p degradation in the yeast

Hansenula polymorpha

69

Chapter 4

Investigating Pex13p degradation in the yeast Saccharomyces

cerevisiae

105

Chapter 5

Insights into fungal peroxisome function gained from

organellar proteomics based approaches

143

References 160

Chapter 6 Summary and Discussion 189

Samenvatting 195

Acknowledgments 201

1

Chapter 1

Introduction: From peroxisome formation to peroxisomal membrane protein

degradation

Xin Chen and Chris Williams

ONE Introduction

8

1. Introduction

Eukaryotic cells separate a number of processes into distinct compartments. Such

compartments, known as organelles, allow for the creation of different environments

within a cell, which helps to increase the efficiency of these cellular processes and also

to allow them to be regulated separately from other parts of the cell. One such organelle

is the peroxisome (Gabaldon, 2010). Peroxisomes were first identified by electron

microscopy as small and single membrane-bound vesicles present in kidney tissue cells

(Rhodin, 1954). Later, biochemical approaches demonstrated that peroxisomes produce

hydrogen peroxide and contain enzymes that function in the production and degradation

of hydrogen peroxide, which led to them receiving the name “peroxisome” (De Duve &

Baudhuin, 1966; Rhodin, 1954). Since this time, the number of functions prescribed to

peroxisomes has increased dramatically and it is likely that additional functions remain

to be discovered.

Peroxisome function depends upon the organism and cell type under inspection.

Other than the decomposition of reactive oxygen species such as hydrogen peroxide,

peroxisomes in many organisms play a prominent role in fatty acid β-oxidation

(Bonekamp et al, 2009). In yeasts and plants, fatty acid β-oxidation takes place

exclusively in peroxisomes (Kindl, 1993; Kunau et al, 1988) while in mammals and

certain filamentous fungi, the β-oxidation of fatty acids is divided between the

mitochondria and peroxisomes (Kunau et al, 1988). In addition, peroxisomes in certain

organisms are involved in the catabolism of D-amino acids, polyamines and

biosynthesis of plasmalogens and certain antibiotics but many more peroxisomal

functions exist (Islinger et al, 2010). Such functional diversity has led to certain

peroxisome-like organelles being given different names, such as glyoxysomes

(containing enzymes of the glyoxylate cycle) in filamentous fungi such as Neurospora

crassa (Keller et al, 1991) and glycosomes (involved in glucose metabolism) in

members of the trypanosome family of parasites (Opperdoes, 1987).

The proteins that are responsible for peroxisome maintenance have been given the

name Peroxin (Gould & Valle, 2000). To date, 36 Peroxins (Pex for short) have been

identified and these proteins are encoded by PEX genes. Many Pex proteins are well

conserved throughout evolution (such as Pex5p and Pex3p) whereas a number can only

be found in certain organisms (such as Pex33p in N. crassa).

Loss of peroxisome function can have a detrimental effect on cell vitality. For

example, Hansenula polymorpha yeast cells that lack functional peroxisomes cannot

grow on media containing methanol, because methanol degradation occurs exclusively

inside peroxisomes (Baerends et al, 1996). Likewise, Arabidopsis thaliana seedlings

Introduction ONE

9

that display a peroxisome defect are inhibited in growth and suffer from developmental

delays (Woodward et al, 2014). In humans, peroxisomal defects are associated with a

range of different diseases known collectively as Zellweger spectrum disorders (ZSDs).

ZSDs include Zellweger syndrome, neonatal adreno-leukodystrophy and infantile

Refsum disease, listed from the most to the least severe (Waterham et al, 2016). ZSDs

show a wide range of symptoms which stem from an impairment in one or more

peroxisomal functions (Waterham & Ebberink, 2012). At the biochemical level, patients

suffering from ZSDs often display reduced levels of plasmalogens. These

ether-phospholipids, which are particularly essential for brain and lung function, are

synthesized in peroxisomes. In addition, ZSD patients also display elevated levels of

very long chain fatty acids (VLCFA) and branched chain fatty acids (BCFA) because

these fatty acids are degraded in peroxisomes. The accumulation of these fatty acids

compromises the function of multiple organs and can result in symptoms such as

enlarged liver, eye abnormalities, seizures; severe peroxisomal disorders can result in

premature death (Raymond et al, 2009; Steinberg et al, 2006).

The above-mentioned examples demonstrate how important peroxisome function is

for cell health. Hence, it is vital that peroxisome function is tightly regulated. Here we

present an overview of processes that regulate peroxisome function. We first describe

how peroxisomes form, outlining the possible mechanisms of peroxisome biogenesis,

followed by how peroxisomes are degraded by pexophagy. Next, we describe how

peroxisomal protein import is achieved, presenting the different mechanisms by which

peroxisomal membrane and matrix proteins target to peroxisomes. Furthermore, we

outline how the ubiquitin proteasome system, the major protein degradation pathway in

eukaryotic cells, regulates protein homeostasis. Finally, we introduce the topic of

peroxisomal proteomics and present our perspectives on several major questions that

remain to be answered in the peroxisome research field.

2. Peroxisome biogenesis

In general terms, organelles can be seen as either semi-autonomous (e.g. mitochondria,

chloroplasts (Boardman et al, 1971)) or as part of the endomembrane system (such as

the vacuole, endoplasmic reticulum (ER) and Golgi (Harris, 1986)). Organelles from the

endomembrane system import most of their proteins via the ER, often through vesicular

transport. Semi-autonomous organelles, on the other hand, either produce their own

proteins or import them directly from the cytosol. The processes governing peroxisome

formation, known as peroxisome biogenesis, seem to resemble biogenesis processes of

both semi-autonomous organelles (in that peroxisomes can multiply by fission, similar

ONE Introduction

10

to the mitochondria) and the endomembrane system (in that lipids and a set of

peroxisomal membrane proteins can traffic to peroxisomes via the ER). This has led to

two models for peroxisomal biogenesis being proposed; the de novo model and growth

and division model.

The de novo model (Fig. 1) suggests that peroxisomes form from vesicles derived

from the ER (reviewed in (Agrawal & Subramani, 2016)). Certain peroxisomal

membrane proteins (PMPs) target to the ER in yeast cells lacking Pex3p, a protein

involved in PMP import (Agrawal et al, 2011; Titorenko & Rachubinski, 1998; van der

Zand et al, 2010). pex3 cells were reported to lack peroxisome like structures

(Shimozawa et al, 2000). Upon reintroduction, Pex3p targets to the ER and initiates the

formation of peroxisomes at the ER. Other PMPs synthesized in the cytosol then target

to the ER membrane, where they are sorted into peroxisomal ER subdomains (pER)

which then bud off the ER in a Pex3p and Pex19p dependent manner. It was reported

that different vesicles bud from the ER, containing different PMPs required for either the

docking or the receptor recycling steps of peroxisomal matrix protein import (see

section on Protein import into peroxisomes). These heterotypic vesicles fuse in a

Pex1p/Pex6p dependent manner to form functional peroxisomes, which can then import

the matrix proteins (MATs) required for peroxisome function (Fakieh et al, 2013; van

der Zand et al, 2010; van der Zand et al, 2012). However, studies by other groups have

questioned whether such heterotypic vesicles exist (Knoops et al, 2015; Motley et al,

2015). Furthermore, recent studies in H. polymorpha pex3 cells propose an alternative

de novo model (Fig. 1). Knoops et al. demonstrated, contrary to previous reports

(Baerends et al, 1997), that pex3 cells possess tiny pre-peroxisomal vesicles (PPVs) that

contain a subset of PMPs. Upon reintroduction, Pex3p targets to these PPVs and

facilitates the import of other PMPs directly to PPVs, resulting in the formation of

functional peroxisomes (Knoops et al, 2014). Such PPVs were also recently identified in

S. cerevisiae pex3 cells (Wroblewska et al, 2017). Finally, work from Sugiura et al.

suggested that peroxisomes can derive from the mitochondria in mammalian cells

lacking Pex3p (Sugiura et al, 2017). Hence, the mechanisms of de novo peroxisome

formation are still under investigation.

Most observations on the de novo formation of peroxisomes are derived from cells

lacking Pex3p and to date, it has not been reported that Pex3p targets to the ER in wild

type (WT) cells. This has led to the suggestion that de novo formation of peroxisomes is

not the main mechanism by which new peroxisomes are made in WT cells and instead,

new peroxisomes derive from the growth and division model (Motley & Hettema, 2007).

In this model (Fig. 1), PMPs and MATs are synthesized in the cytosol and are

Introduction ONE

11

post-translationally targeted directly to pre-existing peroxisomes (for details on the

import processes, see the section Protein import into peroxisomes). At a certain point,

peroxisomes then divide in a process called fission (see below) to produce new

peroxisomes, that will subsequently import PMPs and MATs to become mature and fully

functional.

Fig 1. Schematic models of de novo peroxisome biogenesis in yeast.

(Upper) The left part represents ER-dependent peroxisome formation in cells lacking

Pex3p. In this model, PMPs first target to the ER and are subsequently sorted into two

heterotypic vesicles, the fusion of which in a Pex1p / Pex6p dependent manner generates

nascent peroxisomes. Through the import of MATs, nascent peroxisomes eventually grow

into mature ones. The right part represents an alternate model in which pre-peroxisomal

vesicles (PPVs) exist in cells lacking Pex3p. Upon reintroduction, Pex3p targets to PPVs

directly and facilitates the import of other PMPs in a Pex19p-dependent manner. When the

complete set of PMPs are present, the import of MATs allows the nascent peroxisome to

mature into a fully functional organelle.

(Lower) A schematic representation of the growth and division model in yeast. After

sufficient import of MATs has occurred, the mature peroxisome is ready to divide. To

initiate fission, an amphipathic α-helix of Pex11p inserts into the peroxisomal membrane

to elongate part of the membrane. High curvature membrane regions attract Fis1p, which

ONE Introduction

12

subsequently recruits Dynamin-related proteins (DRPs) like Dnm1 to the fission site. The

elongated region then undergoes constriction, though which factors are involved remains

unclear. At last, the DRPs finish the scission in a GTP-dependent manner. The daughter

peroxisome then grows in size by importing MATs and PMPs until stimulated to divide,

completing the cycle (see section on Peroxisome fission for more details on the process or

division).

Having said this, the PMP Pex16p appears to travel via the ER prior to targeting to

peroxisomes in WT mammalian cells (Kim et al, 2006), which would contradict the

hypothesis that the growth and division model is the main way in which new

peroxisomes are made in WT cells. In addition, studies in the parasite Trypanosoma

brucei proposed a model where extracellular glucose levels determined whether the

growth and division or the de novo mechanism facilitates glycosome biogenesis (Bauer

& Morris, 2017). Glycosomes (a type of peroxisome involved in glucose metabolism in

this organism) appear to favour the growth and division model in high extracellular

glucose concentrations whereas they favoured de novo biogenesis under low glucose

concentrations.

It seems therefore safe to assume that one model on the biogenesis of peroxisomes

does not fit all the observations and it is indeed highly likely that multiple pathways

exist to maintain the number of peroxisomes in the cell. Probably these mechanisms are

utilized depending upon circumstance and one may be preferred over the other under

certain conditions or in certain cell types.

3. Peroxisome fission

In the growth and division model, a mature and functional peroxisome can be

asymmetrically divided to form two peroxisomes in a process known as peroxisomal

division or fission. Fission can occur as response to external stimuli, such as is the case

when H. polymorpha yeast cells grown on glucose (a condition that does not require

peroxisome function) are shifted to methanol containing media. Because peroxisomes

are required to metabolise methanol, these cells rapidly increase the peroxisome

population, in order to deal with this challenge. Fission is also important to keep the

number of peroxisomes per cell steady, replacing old and worn out peroxisomes that are

degraded via pexophagy (see section Pexophagy).

Current models suggest that peroxisomal fission is a three-step process; peroxisome

remodelling/elongation, membrane constriction and scission. The first step is mediated

by the PMP Pex11p. Pex11p was the first factor identified that controls peroxisomal

Introduction ONE

13

fission. The deletion of PEX11 results in fewer and larger peroxisomes in cells while its

overexpression led to increased number of small peroxisomes (Erdmann & Blobel, 1995;

Marshall et al, 1995). S. cerevisiae contains a single copy of PEX11 (Erdmann & Blobel,

1995) while three PEX11 genes have been identified in mammalian cells (PEX11α, β,

and γ) (Schrader et al, 1998; Tanaka et al, 2003) and five PEX11 copies are present in

Arabidopsis thaliana (Orth et al, 2007). It is believed that these different versions of

Pex11p fulfil different roles in peroxisome fission or are required at different stages

(Huber et al, 2012). Recent work has shed light on the molecular function of Pex11p in

peroxisome fission, demonstrating that Pex11p initiates the membrane

remodelling/elongation step by inserting an amphipathic α-helix into the peroxisome

membrane, to initiate curvature (Koch et al, 2010; Opalinski et al, 2010). Furthermore,

many Pex11p proteins are known to form dimers or even higher order oligomeric

complexes and it is thought that these interactions are important in the elongation step

(Su et al, 2018). Several Pex11-like proteins have also been described, including Pex25p

in S. cerevisiae and H. polymorpha, Pex27p in S. cerevisiae and GIM5A and GIM5B in

trypanosomes (Williams & van der Klei, 2014). The role of these Pex11-like proteins in

peroxisomal fission remains largely unknown.

The second step in the fission process, the constriction step, is not well understood

and we know little about which proteins are involved and the mechanisms that govern

constriction. Some data may indicate that Pex11p may be involved in this step during

peroxisomal fission in mammalian cells (Schrader et al, 2016), but further work is

required before the first mechanistic insights become clear.

Scission, the final step in fission, requires dynamin-related proteins (DRPs). DRPs

are large GTPases that utilize GTP hydrolysis to severe the “daughter” peroxisome from

the “mother”. Drp1 in humans and Dnm1p in H. polymorpha are the DRPs required for

peroxisome fission in these organisms (Koch et al, 2003; Nagotu et al, 2008b). On the

other hand, two DRPs control fission in S. cerevisiae; Dnm1p (under peroxisome

inducing condition) and Vps1p (under peroxisome repressing condition) (Hoepfner et al,

2001; Koch et al, 2003; Kuravi et al, 2006). Interestingly, Pex11p also plays an

important role in the final step of the fission process, by activating the GTPase Dnm1p

(Williams et al, 2015), which demonstrates the interconnected nature of the fission

process and the players involved.

In addition to Pex11p and the DRPs, several other factors are involved in

peroxisomal fission, including Fis1p (Kobayashi et al, 2007; Motley et al, 2008), Mdv1

in yeast (Motley et al, 2008; Nagotu et al, 2008a) and MFF in humans (Itoyama et al,

2013; Koch & Brocard, 2012). The contribution these factors have to the peroxisomal

ONE Introduction

14

fission process are not well understood (Schrader et al, 2016; Schrader & Fahimi, 2008)

but they could be involved in recruiting DRPs to sites of membrane elongation or in

facilitating release of DRPs from the membrane after scission (Schrader et al, 2016;

Schrader & Fahimi, 2008). However, both Fis1p and MFF interact with Pex11p

(Itoyama et al, 2013; Koch & Brocard, 2012), which could suggest an earlier role in the

fission process.

4. Pexophagy – wholesale degradation of peroxisomes

New peroxisomes can be made either de novo or through peroxisomal fission.

Peroxisomal homeostasis however, is not only determined by the production of new

peroxisomes but also by the removal of older or damaged ones. Peroxisome removal

occurs via autophagy. Autophagy is an evolutionary conserved process that degrades

macro-molecules and organelles and is often initiated to recycle cellular components

that are not required or to remove damaged ones. The autophagic pathway that targets

peroxisomes for degradation is known as pexophagy (Eberhart & Kovacs, 2018).

There are two kinds of pexophagy: macro-pexophagy and micro-pexophagy (Farré

& Subramani, 2004; Tuttle & Dunn, 1995). During macro-pexophagy, a phagophore

assembly site (PAS) forms in the cell and from this PAS a double membrane originates

to engulf a cargo peroxisome into a double-membrane vesicle known as the

autophagosome. The autophagosome then fuses with the vacuole (or lysosome in

mammalian cells), to release the cargo into the vacuolar/lysosomal lumen, where the

peroxisomal membrane and proteins are degraded by the hydrolases that reside in the

vacuole/lysosome (Eberhart & Kovacs, 2018). Micro-pexophagy, on the other hand,

involves an invagination of the vacuole/lysosome membrane to engulf a group of

peroxisomes directly. Before complete engulfment of the peroxisomes occurs, the

micro-pexophagy-specific membrane apparatus (MIPA) forms, which

mediates fusion between the tips of the invaginating vacuole/lysosome

(Sakai et al, 2006). Once engulfed, peroxisomes are degraded in the vacuole/lysosome

in the same manner as in macro-autophagy. Both macro- and micro-autophagy are

orchestrated by autophagy-related (Atg) proteins.

In yeast, pexophagy can be triggered by a shift in nutrient conditions. When H.

polymorpha cells growing on methanol (peroxisome inducing) are treated with glucose

or ethanol (peroxisome repressing), the macro-pexophagy pathway degrades all but one

of the peroxisomes present in the cell (van Zutphen et al, 2008a). This is likely to occur

because peroxisomes are energetically expensive and are not required for growth on

glucose. Confusingly, the same happens in methanol-grown P. pastoris cells treated with

Introduction ONE

15

glucose yet pexophagy under these conditions in this organism occurs via the

micro-autophagy pathway (Farré & Subramani, 2004). Damaged H. polymorpha

peroxisomes are also subjected to degradation via macro-autophagy (Kiel et al, 2003). In

S. cerevisiae macro-pexophagy can be triggered when cells are subjected to nitrogen

starvation (Hutchins et al, 1999; Motley et al, 2012), causing cells to degrade

peroxisomes in order to obtain the nitrogen required to survive. In addition, in S.

cerevisiae the loss of the peroxisomal AAA-ATPase components Pex1p, Pex6p or the

PMP Pex15p leads to the accumulation of ubiquitinated Pex5p at the peroxisomal

membrane (see section Mechanism of peroxisomal matrix protein import) and

subsequently the macro-pexophagic degradation of peroxisomes (Nuttall et al, 2014).

Comparably, macro-pexophagy in mammals can also be triggered through loss of the

peroxisomal AAA-ATPase components or the accumulation of ubiquitinated Pex5p on

the peroxisomal membrane (Law, 2017) but also by several stress conditions including

hypoxic stress (insufficient oxygen availability), oxidative stress, serum/ amino acid

depletion and nutrient deprivation (Eberhart & Kovacs, 2018).

Of the two types of pexophagy, the better understood is macro-pexophagy. There

are four main steps in macro-pexophagy: the recognition of a peroxisome for

degradation, the formation of the PAS/autophagosome, fusion with the

vacuole/lysosome and the degradation of the peroxisome by vascular/lysosomal

hydrolases. In S. cerevisiae, the cytosolic C-terminal domain of Pex3p is first recognized

by the autophagy receptor Atg36p (Motley et al, 2012) (Fig. 2). The kinase Hrr25p then

phosphorylates Atg36p, which increases its interaction with Atg11p and Atg8p (Motley

et al, 2012). Atg11p is an essential protein in selective pexophagy in yeasts and serves as

a scaffold protein in the assembly of the PAS by binding to autophagy receptors, Atg17p

and Atg1p (Farré & Subramani, 2016). Atg17p in turn recruits other Atg proteins to the

PAS (Liu & Klionsky, 2016) while Atg1p is a Serine/ threonine protein kinase required

for the formation of the autophagosome (Stromhaug & Klionsky, 2001). The binding of

Atg36p to Atg8p is involved in autophagosome formation (Farré et al, 2013) and brings

the PAS to the peroxisomal membrane. Atg8p is an ubiquitin-like protein that is

conjugated to phosphatidylinositol lipids in the membrane of the phagophore (Klionsky

& Schulman, 2014; Noda & Inagaki, 2015). Recruitment of the

Atg8-phosphatidylinositol conjugate to the PAS requires Vps34p (Grunau et al, 2010).

Once fully assembled the phagophore then elongates, due to the action of the Atg8p

-Atg1p complex, to surround the peroxisome and forms the autophagosome. The fusion

of the autophagosome with the vacuole requires the action of several SNARE (Soluble

NSF Attachment Protein Receptor) proteins such as Sso1p/Sso2p and Sec9p (Nicholson

ONE Introduction

16

et al, 1998).

Fig. 2 Model of the formation of the phagophore in yeast.

(Left) In S. cerevisiae pexophagy, the Atg36p receptor first recognizes Pex3p. Next, the

kinase Hrr25p phosphorylates Atg36p, allowing it to recruit Atg8p and the scaffold protein

Atg11p. Atg11p further binds to the Atg17p scaffold complex and the Atg1p kinase

complex. (Right) To initiate pexophagy in H. polymorpha, Pex3p is ubiquitinated and

degraded via the UPS, which is likely to allow Pex14p to be recognized by an unidentified

autophagy receptor, to initiate pexophagy. Pdd1p is involved in the initial sequestration of

the peroxisome while Atg25p and Atg11p are required in the PAS. Atg1p and Atg8p are

further required to bring the phagophore closer to the peroxisome. Pdd2p is involved in the

later fusion with vacuole.

In H. polymorpha, glucose-induced macro-pexophagy is initiated by the

ubiquitination and degraded of Pex3p via the ubiquitin-proteasome system (UPS, see

section Ubiquitin-proteasome system) (Bellu et al, 2002; Williams & van der Klei,

2013a) (Fig. 2). Hazra et al. showed that Pex3p is involved in the association of

importomer complex (see section Mechanism of peroxisomal matrix protein import)

(Hazra et al, 2002). Hence, Pex3p removal is hypothesized to lead to the dissociation of

this complex (Leão & Kiel, 2003; Monastyrska & Klionsky, 2006) and the exposure of

the N-terminal region of the PMP Pex14p, a step that is required for pexophagy to

proceed (Bellu et al, 2001; van Zutphen et al, 2008b). Exposure of this region of Pex14p

recruits an as yet unknown autophagic receptor to the peroxisome. In addition, Pdd1p,

which is a homologue of S. cerevisiae Vps34p, is assumed to be involved in the initial

sequestration of peroxisome (Kiel et al, 1999). Similar to in S. cerevisiae, Atg11p acts as

scaffold protein while Atg1p and Atg8p are involved in the phagophore elongation step

Introduction ONE

17

(Monastyrska et al, 2005; Noda & Fujioka, 2015; Suzuki & Noda, 2018). In addition,

Atg25p is co-localized with Atg11p and it is likely involved in the formation of the

pre-autophagosomal structure.

In mammalian cells, macro-pexophagy can be initiated by the presence of

ubiquitinated proteins on the surface of the peroxisome (Law, 2017; Sargent et al, 2016).

Mammalian macro-pexophagy requires the ubiquitin-binding autophagy receptors

NBR1 and SQSTM1 (also termed p62) to connect the phagophore to the peroxisome

requiring degradation (Mancias & Kimmelman, 2016). Both these receptors contain an

LC3-interacting domain, allowing them to associate with the phagophore as well as

ubiquitin-association domains that bind to ubiquitinated proteins on the surface of the

peroxisome (Kirkin et al, 2009). LC3 is a family of Atg8p like proteins in mammalian

cells that, similar to Atg8p, are conjugated to phospholipids in the membrane of the

phagophore and are required for the formation of the autophagosome.

Defects that result in the accumulation of ubiquitinated Pex5p on the peroxisomal

membrane trigger NBR1-dependent macro-pexophagy (Deosaran et al, 2013; Subramani,

2015) (Fig. 3). However, starvation-induced macro-pexophagy can also be induced by

the presence of an ubiquitinated protein on the peroxisomal membrane. Recently,

Sargent et al. demonstrated that both Pex5p as well as the fatty acid transporter PMP70

(and possibly other PMPs) can be ubiquitinated by Pex2p in cells under amino acid

starvation conditions (Sargent et al, 2016). Amino acid starvation activates repressors of

tuberous sclerosis complex 1 (TSC1), TSC2 and Ras homolog enriched in brain (RHEB).

TSC1, TSC2 and RHEB are regulators of the mechanistic target of rapamycin complex 1

(mTORC1). The inhibition of mTORC1 results in an increased ubiquitination of Pex5p

and PMP70 by Pex2p, which is turn facilitates the recruitment of NBR1and the

formation of the phagophore.

ONE Introduction

18

Fig. 3 Model of the formation of the phagophore in mammalian cells.

(Left) Pexophagy caused by defects in the AAA-ATPases Pex1p/Pex6p: Ubiquitinated

Pex5p accumulates at the peroxisomal membrane and is recognized by the autophagy

receptor NBR1. NBR1 also interacts with LC3 proteins to connect the phagophore to the

peroxisome. (Right) Amino acid starvation inhibits mTORC1, which causes increased

ubiquitination of PMPs by Pex2p. The autophagic receptor NBR1 recognizes the

ubiquitinated PMPs and interacts with LC3 to form the PAS.

It is interesting to note that these recent reports on the role of ubiquitinated Pex5p

in pexophagy have shed new light on diseases resulting from deficiencies in Pex1p

(Nordgren et al, 2015). There is now strong evidence that patients with mutations in

PEX1 display symptoms because of an increase in macro-pexophagy caused by the

accumulation of ubiquitinated Pex5p on peroxisomes, rather than from a defect in the

import of matrix proteins into peroxisomes, as was previously thought.

5. Protein import into peroxisomes

Because peroxisomes lack DNA, they rely on several protein import pathways to obtain

the proteins required for function. Hence, peroxisomal protein import plays a crucial

role in determining peroxisome function.

5.1 Peroxisomal membrane protein (PMP) import into peroxisomes

There are two classes of sorting pathways for targeting PMPs to peroxisomes; Pex19p

dependent (known as Class-I) and Pex19p independent (known as Class-II). In Class-I

sorting, a PMP that is translated in the cytosol contains a membrane peroxisomal

targeting signal (mPTS). This mPTS is recognized by the cytosolic receptor protein

Pex19p (Jones et al, 2004) through the C-terminal region of Pex19p (Schueller et al,

2010). The Pex19p-PMP complex then targets to the peroxisomal membrane, where

Pex19p interacts with the PMP Pex3p via the N-terminal region in Pex19p (Sato et al,

2010; Schueller et al, 2010). Afterwards, the PMP is inserted into the membrane,

although the mechanism by which this occurs is still unclear (Hettema et al, 2014). A set

of PMPs were proposed to be sorted as Class-I PMPs, including the metabolite

transporters PMP22, PMP34, PMP70, the peroxisomal RING proteins, Pex11p and

Pex16p (Brosius et al, 2002; Jones et al, 2001; Jones et al, 2004; Sacksteder et al, 2000).

In the absence of Pex19p, many of the levels of these proteins are dramatically reduced

(Hettema et al, 2000), possibly because they are degraded if their targeting is inhibited.

In addition, Pex19p undergoes a post-translational modification called farnesylation at

Introduction ONE

19

its C-terminus, which induces a conformational change in Pex19p and facilitates the

recognition of conserved side chains in PMPs (Emmanouilidis et al, 2017). In S.

cerevisiae mutants blocking Pex19p farnesylation, levels of the RING proteins, Pex11p

and Pxa1p (a PMP involved in fatty acid transport) were dramatically reduced

(Rucktaschel et al, 2009), indicating that Pex19p farnesylation is important for Pex19p

function.

The Class-II PMPs are targeted to peroxisome via a different mechanism but

currently we know very little about this mechanism and also which PMPs can be

described at Class-II is unclear. Some reports have suggested that Class-II PMPs target

to peroxisomes via the ER and because under certain conditions Pex15p (Lam et al,

2010), Pex8p (van der Zand et al, 2010), Pex13p (van der Zand et al, 2010) and Pex3p

(Kim et al, 2006) in S. cerevisiae have been observed in the ER, these proteins were

classed as Class-II PMPs. However, many of these observations were based on work in

pex3 cells which were assumed to lack functional peroxisomes (Baerends et al, 1997).

The recent observation that H. polymorpha pex3 and pex19 cells as well as S. cerevisiae

pex3 cells contain PPVs (see section Peroxisome Biogenesis) that harbour a subset of

PMPs (including Pex8p, Pex13p, Pex14p, Pex15p, Pex17p, Pex25p and Pex22p

(Knoops et al, 2014; Otzen et al, 2004; Wroblewska et al, 2017)) indicates that it is not

clear whether these proteins target to peroxisomes via the ER or via a different

mechanism.

5.2 Mechanism of peroxisomal matrix protein (MAT) import

MATs are synthesized, folded and, when required, oligomerize in the cytosol prior to

being imported into peroxisomes. The import of MATs, similar to PMPs, relies on

peroxisomal targeting signals (PTSs). These signals are recognised by receptor proteins

in the cytosol and allow the proteins containing them to be targeted to peroxisomes.

Generally, most MATs possess a PTS type-1 (PTS1) while a small portion of MATs have

a PTS2 sequence. The original definition of the PTS1 sequence was a tri-peptide with

the consensus sequence S-A-C/ K-R-H/ I-L at the extreme C-terminus (Gould et al,

1987). However, later work demonstrated that up to the last 10 amino acids of the MAT

play an important role in recognition by the receptor protein (Otera et al, 1998). The

PTS1 is recognized by the receptor protein Pex5p (Gatto et al, 2003) (Fig. 4), although a

recent study demonstrated that Pex9p, a Pex5-like protein, is a novel peroxisomal import

receptor for certain PTS1 proteins in S. cerevisiae cells (Effelsberg et al, 2016). Pex5p

binds to the PTS1 sequence via its C-terminal Tetratricopeptide repeat (TPR) domain

(Gurvitz et al, 2001). The N-terminal region of Pex5p is involved in the docking and

ONE Introduction

20

receptor recycling steps of import (see below).

The PTS2 sequence is an N-terminal signal with the consensus sequence

R-(L/V/I/Q)-X-X-(L/V/I/H)-(L/S/G/A)-X-(H/Q)-(L/A) (Kunze & Berger, 2015;

Lazarow, 2006; Petriv et al, 2004). PTS2-containing proteins are recognized by the

cytosolic receptor Pex7p. However, unlike Pex5p, which is able to facilitate the targeting

of PTS cargo proteins to peroxisomes independently, Pex7p requires an additional,

co-receptor protein (Fig. 5). This function is fulfilled by members of the Pex20p family

in yeasts (Schliebs & Kunau, 2006) whereas in mammalian cells, an isoform of Pex5p

(Pex5L) is required for Pex7p to target PTS2-containing proteins to peroxisomes

(Braverman et al, 1998; Matsumura et al, 2000). In PTS2 import, Pex7p is responsible

for binding to the cargo protein while the co-receptor is required for docking and (co-)

receptor recycling (see below).

Apart from canonical PTS1 and PTS2 proteins, proteins without a typical PTS

signal can also be imported into peroxisomes. Such proteins may bind to another one

containing a typical PTS, which is recognized by the corresponding receptor protein and

imported. S. cerevisiae Pnc1p, which lacks a PTS, is imported into peroxisomes through

its interaction with the PTS2 protein Gpd1p via such a “piggy-backing” mechanism

(Kumar et al, 2016). However, piggy-backing cannot explain the import of certain

non-PTS1/2 containing proteins into peroxisomes. Peroxisomal

hydratase-dehydrogenase-epimerase (Fox2p) and catalase A (Cta1p) in S. cerevisiae

both contain a PTS1 sequence yet they can be imported into peroxisomes by Pex5p

independently of this signal (Rymer et al, 2018). Furthermore, acyl-CoA oxidase (Pox1p)

in S. cerevisiae lacks a PTS1 but it is imported into peroxisomes in a Pex5p-dependent

manner (Klein et al, 2002). The targeting of non-PTS1 proteins to peroxisomes via

Pex5p has led to the suggestion that a PTS3 pathway exists although a PTS3 consensus

sequence has not been identified yet. Finally, Aat2p in the yeast H. polymorpha lacks a

recognizable PTS sequence but it can target to peroxisomes in a Pex5p and Pex7p

independent manner (Thomas et al, 2018). The targeting of Aat2p instead requires the

PTS2 co-receptor Pex20p. Based on these observations, it seems very likely that there

are as yet uncharacterized PTS signals.

After the recognition of MATs in the cytosol, the cargo-receptor complex then

targets to the peroxisomal membrane where it docks. The peroxisomal docking complex

consists of the PMPs Pex13p and Pex14p. Another PMP, Pex17p, is also part of the

docking complex in yeast and a recent study showed that Pex17p is required for the

assembly of high molecular weight complexes between Pex14p and the Dynein light

chain protein Dyn2p, which are important for MATs import (Chan et al, 2016) although

Introduction ONE

21

the role of Pex17p in MAT import is still rather enigmatic.

Pex5p interacts directly with both Pex14p and Pex13p (Urquhart et al, 2000) while

Pex13p and Pex14p also interact directly with each other at multiple points (Williams &

Distel, 2006). The Pex5p-Pex14p interaction is facilitated by WxxxF/Y motifs present in

the N-terminal region of Pex5p (Otera et al, 2002). Such motifs can be found in all Pex5

proteins to date, and are also present in Pex20p family members, indicating that

common mechanisms govern the import of both PTS1 and PTS2 proteins. Pex14p

interacts with Pex5p through two different regions; its N-terminal domain as well as the

C-terminal region and both are required for PTS1 protein import (Williams et al, 2005).

Pex7p, the PTS2 receptor protein also binds to the C-terminal region of Pex14p

(Niederhoff et al, 2005), again indicating the conservation between the mechanisms of

PTS1 and PTS2 protein import.

The Pex5p-Pex14p interaction is enhanced in the presence of a PTS1 cargo protein

while the Pex5p-Pex13p interaction is stronger in the absence of a cargo protein

(Urquhart et al, 2000). This has led to a model where Pex14p acts as the first point of

contact for the Pex5p-Cargo complex and that Pex13p is actually involved in a

post-docking function (Bottger et al, 2000). However, Pex5p and Pex14p can bind to the

SRC Homology 3 (SH3) domain of Pex13p simultaneously (Pires et al, 2003),

indicating that the individual roles played by Pex13p, Pex14p and Pex5p in the import

process are very strongly interconnected.

Fig 4. Model depicting the steps of PTS1 protein import into peroxisomes.

(1) MATs harbouring a PTS1 signal at the C-terminus are synthesized in the cytosol and

recognized by the cytosolic receptor Pex5p. (2) The receptor-cargo complex targets to the

docking complex composed of Pex13p and Pex14p (with its co-partner Pex17p in yeast) at

the peroxisomal membrane. (3) A transient import pore is formed consisting of the Pex5p

receptor and the docking proteins. (4) After the cargo translocation and cargo release, the

ONE Introduction

22

receptor is ubiquitinated and (5) either recycled by the AAA-ATPase complex back to the

cytosol for next round of import or degraded by the proteasome.

In order to translocate a cargo protein across the peroxisomal membrane and into

the matrix, a pore is needed (Fig. 5). Such a pore needs to be large enough to

accommodate folded and even oligomeric proteins but at the same time the pore cannot

allow small molecules and proteins to escape out of the peroxisome. To date no

peroxisomal pore has been observed using techniques such as electron microscopy

(Meinecke et al, 2016), which has led to the hypothesis of a transient import pore that

forms when required and then dissociates after cargo protein import. Evidence to

support this hypothesis comes from elegant studies using electrophysiological

approaches (Montilla-Martinez et al, 2015). In these reports, the authors utilized purified

components to reconstitute the import pore or “importomer”, demonstrating that a

complex of Pex5p, cargo and Pex14p was sufficient to form a pore in a membrane

capable of opening and closing (Montilla-Martinez et al, 2015). The size of the pore that

formed was largely determined by cargo protein size, indicating that the importomer is

dynamic in nature and can adapt according to the type of cargo being translocated. In

follow on studies, the same authors identified a distinct PTS2 specific pore that

contained the PTS2 co-receptor Pex18p as well as Pex14p and Pex17p

(Montilla-Martinez et al, 2015), which led to the hypothesis that the import of PTS1 and

PTS2 proteins does in fact not converge at the peroxisomal membrane, as was

previously thought (Hettema et al, 1999). Together, these data indicate that complexes of

the receptor, cargo and Pex14p (with Pex17p for the PTS2 pore) were sufficient for pore

forming activity in vitro. However, where Pex13p and, to a certain extent Pex17p, fit

into the model describing receptor docking and translocation still remains to be

determined.

One aspect of the MAT import process that we know very little about is that of

cargo release into the peroxisomal matrix. In yeast, a role in cargo release has been

attributed to the protein Pex8p, for two reasons; Pex8p is able to bind to Pex5p-cargo

complexes in vitro and facilitate release of the cargo protein from the complex (Rehling

et al, 2000b) and Pex8p is present on the inside of the peroxisomal membrane (Deckers

et al, 2010). Pex8p also binds to the docking factor Pex13p as well as to PMPs involved

in receptor recycling (see below), which brings both the docking and receptor recycling

steps in the import process together (Agne et al, 2003). However, Pex8p had to date not

been identified in mammals (Smith & Aitchison, 2013a), which has led some to question

this potential role in cargo release. It is possible that Pex14p plays a role (either together

Introduction ONE

23

with Pex8p or alone) in the cargo dissociation process (Lanyon-Hogg et al, 2014) while

the fact that Pex13p binds more tightly to Pex5p without cargo may also suggest a role

for Pex13p in cargo release. Furthermore, recent reports suggest that the interaction

between Pex5p and cargo may be redox-regulated (Ma et al, 2013), leading to the

hypothesis that cargo release could be facilitated by the reducing environment of the

peroxisomal lumen (Ma et al, 2013), although a later study reported that redox

conditions did not impact on Pex5p-cargo interactions in their experimental setup

(Walton et al, 2017).

Fig 5. Distinct pores for peroxisomal import of PTS1 and PTS2 proteins

(Montilla-Martinez et al, 2015).

The figure shows two kinds of PTS-specific pores at the peroxisomal membrane for MATs

import. (left) A PTS1 import pore contains Pex5p and Pex14p as major components. (right)

A PTS2 import pore contains PTS2 co-receptor Pex18p, Pex14p and Pex17p as major

components.

After cargo translocation across the peroxisomal membrane and cargo release, the

receptor protein (or receptor/co-receptor complex) is recycled to the cytosol, to take part

in another round of import. Recycling of the (co-) receptor requires the receptor to

undergo a post translational modification called mono-ubiquitination. Ubiquitination

involves the attachment of the 8kDa protein ubiquitin to a substrate and the attachment

of a single ubiquitin molecule to the substrate is known as mono-ubiquitination whereas

attachment of a chain of ubiquitin molecules is referred to as poly-ubiquitination (see

section The ubiquitination cascade). Mono-ubiquitination occurs on a well conserved

cysteine residue very close to the N-terminus of Pex5p/Pex20p family members (Leon

& Subramani, 2007; Williams et al, 2007). In yeast it depends on the action of Pex4p

(together with its membrane anchor Pex22p) (Koller et al, 1999; Van der Klei et al,

ONE Introduction

24

1998), a peroxisome-associated ubiquitin conjugating enzyme (E2), and a complex of

Pex2p, Pex10p and Pex12p (El Magraoui et al, 2012), three PMPs that all contain a

really interesting new gene (RING) domain (Borden & Freemont, 1996) and function as

ubiquitin ligases (E3s). The RING proteins are also involved in Pex5p

mono-ubiquitination in mammals but a different E2 (members of the Ube2D family) is

required (Grou et al, 2008). The actual recycling step, the removal of the receptor out of

the membrane, requires the action of Pex1p and Pex6p, two AAA-ATPases that form a

hetero-hexameric complex, and the PMP Pex15p (Pex26p in mammals), which is

required to bring the mostly cytosolic Pex1p/Pex6p complex to the peroxisomal

membrane (Fujiki et al, 2008). The Pex1p/Pex6p complex recognises the

mono-ubiquitinated (co-) receptor protein and uses ATP hydrolysis to extract it from the

peroxisomal membrane (Platta et al, 2008). During the membrane extraction process, the

ubiquitin is removed from mono-ubiquitinated Pex5p (and likely Pex20p family

members) by Ubp15p in yeast (Debelyy et al, 2011) and USP9X in mammals (Grou et al,

2012), which allows the protein to take part in another round of import.

In certain cases, the (co-) receptor proteins can undergo poly-ubiquitination. This is

mostly seen in mutants lacking PEX4 or PEX1/PEX6 or when the conserved cysteine

residue in the (co-) receptor is mutated (Léon & Subramani, 2007; Williams et al, 2007).

(Co-) receptor poly-ubiquitination often leads to degradation of the (co-) receptor via the

proteasome (see section The proteasome), likely to stop the accumulation of proteins

on the peroxisomal membrane that are unable to recycle. Poly-ubiquitination of the (co-)

receptors, which occurs on conserved lysine residues in the N-terminal region (Liu &

Subramani, 2013), also requires the RING protein complex (Platta et al, 2009; Williams

et al, 2008) but some substrate specificity is observed when it comes to the E2 involved.

Pex5p and Pex18p poly-ubiquitination in S. cerevisiae require Ubc4p yet Pex20p

poly-ubiquitination in P. pastoris requires Pex4p (Liu & Subramani, 2013; Williams et

al, 2008). The E2 responsible for Pex5p poly-ubiquitination is currently unknown but it

remains feasible that members of the Ube2D family of E2 are involved in both the

mono- and poly-ubiquitination of Pex5p (Stewart et al, 2016).

Removal of the poly-ubiquitinated (co-) receptors out of the peroxisomal

membrane is required for them to be degraded via the proteasome. In S. cerevisiae it is

believed that this is facilitated by the Pex1p/Pex6p complex (Platta et al, 2008) yet the

observation that Pex5p is almost undetectable in P. pastoris cells lacking Pex1p or

Pex6p (Collins et al, 2000) would suggest that alternative mechanisms exist to remove

poly-ubiquitinated proteins from the peroxisomal membrane and target them for

degradation via the proteasome.

Introduction ONE

25

Finally, a recent report demonstrated that an alternative form of Pex5p

mono-ubiquitination in mammals protects Pex5p from degradation via the proteasome

(Wang et al, 2017). This modification required the E3 ligase TRIM37 and members of

the Ube2D family of E2s and occurs in the C-terminal region of Pex5p. The mechanism

underlying how this form of mono-ubiquitination protects Pex5p from proteasomal

degradation remains to be determined but together with the reports mentioned above, it

clearly demonstrates the important role ubiquitin and ubiquitination plays in peroxisome

biology.

6. Protein degradation – the Ubiquitin-proteasome system

The ubiquitin proteasome system (UPS) is the major protein degradation pathway in

eukaryotic cells (Bett, 2016). The UPS pathway consists of the ubiquitination cascade

and the proteasome.

6.1 The ubiquitination cascade

In the ubiquitination process, a ubiquitin molecule, a 76-amino acid globular protein, is

attached to a substrate protein, usually on a lysine residue in the substrate (Swatek &

Komander, 2016). Attachment of a single ubiquitin to a substrate is referred to as

mono-ubiquitination and mono-ubiquitination has been linked to several cellular

processes, such as regulating the substrates interactions with other proteins or in its

localisation (Pickart, 2001). However lysine residues in the ubiquitin molecule itself can

also be the target of ubiquitin attachment, resulting in the formation of ubiquitin chains,

which is referred to as poly-ubiquitination. Seven different types of ubiquitin chain can

be formed, based on seven internal lysine residues in ubiquitin (Table 1). Furthermore,

the C-terminus of one ubiquitin molecule can be attached to the N-terminal methionine

of another ubiquitin molecule, forming a linear poly-ubiquitination chain (Table 1).

Probably the most common form of poly-ubiquitin chain in the cell is linked via lysine

48 (K48) on ubiquitin. K48-linked poly-ubiquitinated substrates undergo proteasomal

degradation. The ubiquitin chain acts as a tag that allows the substrate to be transported

to the proteasome, for degradation. However, not all ubiquitination events are for

degradation and several non-proteolytic functions are regulated by the attachment of

different types of poly-ubiquitin chains. For example, K6-linked chains are involved in

DNA damage repair while K11-linked chains play a role in cell cycle regulation and

K27-linked chains are involved in T-cell development (Ikeda et al, 2010; McDowell &

Philpott, 2013).

ONE Introduction

26

Linkage type Function/ Processes involved in

Linear Signal transduction

K6 DNA damage

K11 Cell cycle regulation,

membrane trafficking,

TNF signaling

K27 Mitophagy,

T-cell development,

signal transduction

K29 AMPK regulation

K33 AMPK regulation

TCR signaling

K48 Proteasomal degradation

K63 Signal transduction

Table 1. Functional roles of the different linkage types of polyubiquitination.

The ubiquitination cascade (Fig. 6), which facilitates the ligation of ubiquitin to a

substrate protein requires the sequential action of three enzymes (Hershko &

Ciechanover, 1998). It begins with a ubiquitin activating enzyme (E1, step-1), which

activates a ubiquitin molecule by conjugating the C-terminal Gly residue of ubiquitin

onto an active site cysteine in an ATP-dependent manner. The activated ubiquitin will

then be transferred to an active Cys residue of a ubiquitin-conjugating enzyme (E2,

step-2). Catalysed by a ubiquitin-protein ligase (E3, Step-3), ubiquitin is linked to the

ε-amino group of a lysine residue in the substrate protein. In the case that the substrate is

poly-ubiquitinated, this process is repeated, using a lysine residue in ubiquitin. The

ubiquitin cascade is pyramidal in organisation (Hochstrasser, 1996). Cells contain a

single E1, several E2s (~11 in yeast but around 35 in humans) and a larger number of

E3s. E3s provide much of the selectivity of ubiquitin-protein ligation and therefore

protein degradation (Hershko & Ciechanover, 1998) and many target specific substrates

or groups of substrates. It is estimated that yeast contains around 50 E3s while humans

are thought to possess maybe up to 1000 different E3s (Zheng & Shabek, 2017).

Introduction ONE

27

Fig 6. Schematic overview over the enzymatic cascade catalyzing ubiquitination.

Ubiquitin is first activated by a ubiquitin-activating enzyme (E1) with ATP hydrolysis.

Next, the E1 transfers the ubiquitin to a ubiquitin-conjugating enzyme (E2), then with the

aid of a ubiquitin ligase (E3) which plays an important role in specifying the substrate,

ubiquitin is eventually transferred to a substrate. HECT-E3s conjugate the ubiquitin onto

an active site before attaching it to a substrate while RING-E3 serves as a bridge to

enable ubiquitin to be passed directly from the E2 to the substrate. Substrate proteins can

be either mono- or poly-ubiquitinated.

Two different types of E3 ligase are known, those of the RING family and those of

the HECT family. These different types of E3s utilize different mechanisms to transfer

ubiquitin to the substrate. A RING (Really Interesting New Gene) E3 contains a RING

finger domain, consisting of a C3HC4 amino acid motif (seven cysteines and one

histidine arranged non-consecutively) which binds to two zinc cations (Borden &

Freemont, 1996; Freemont et al, 1991). There are around 600 E3 enzyme from the

RING type in the human genome (Vittal et al, 2015). RING E3 ligases bind

simultaneously to an E2 with ubiquitin on its active site and an appropriate substrate,

which allows the ubiquitin to be transferred to the protein substrate (Hershko &

Ciechanover, 1998). HECT E3s, on the other hand possess a HECT (Homologous to the

E6-AP Carboxyl Terminus) domain, conjugate ubiquitin onto an active site in the HECT

domain and then transfer this ubiquitin to the protein substrate (Hershko & Ciechanover,

1998).

While many ubiquitination events require only an E3, certain substrates need an

adaptor protein, to allow efficient transfer of ubiquitin from the E3. One such family is

the Cullins, which are scaffold proteins that provide support for E3 ligases (Petroski &

Deshaies, 2004; Petroski & Deshaies, 2005). Furthermore, some of these adaptor

proteins have been assigned the name E4 and they work in association with E1, E2 and

E3 enzymes by catalysing the extension of ubiquitin chains (Hoppe, 2005). It is still

ONE Introduction

28

under discussion whether it is a new class of enzymes, or a subclass of E3. The ubiquitin

fusion enzyme Ufd2 is one of the few identified E4s so far (Koegl et al, 1999) and

belongs to a family of proteins in eukaryotes that contain a conserved U-box at their

C-terminus, which is generally considered essential for E4 function (Hatakeyama &

Kei-ichi, 2003). A U-box is structurally related to the RING finger domain (Aravind &

Koonin, 2000; Tu et al, 2007).

Substrate ubiquitination is not a one way process and the removal of ubiquitin from

substrates (deubiquitination) can be as important as the ubiquitination process itself. The

deubiquitination of substrates is mediated by a deubiquitinase (DUB). DUBs are

enzymes that hydrolyze the isopeptide or peptide bond between the ubiquitin C-terminus

and the substrate (Mevissen & Komander, 2017). The DUBs can be categorized into two

families, a group of small proteins of ~30kD mainly for the removal of ubiquitin from

peptides and small adducts, like Yuh1 in yeast, and a group of larger proteins to cleave

ubiquitin off protein substrates (reviewed in (Hochstrasser, 1996)). The latter family of

DUBs are also termed as Ubps, including various large proteins of ~100kD which have

conserved Cys and His boxes (Wilkinson et al, 1995). Interestingly DUBs outnumber

E2s in the cell (e.g. 16 Ubps in S. cerevisiae compared to 11 E2 enzymes (Hochstrasser,

1996; Ye & Rape, 2009)), indicating their importance in the cell. Indeed, mutations in

the DUB Faf, the gene of which is required for eye development in Drosophila, leads to

null phenotypes in transgenic flies, demonstrating the importance of DUBs in biological

function (Huang et al, 1995). However, several yeast ubp mutants do not display a clear

phenotype, possibly because either these Ubps function under specific conditions or they

are redundant (Baker et al, 1992).

Furthermore, DUBs are not simply there for the negative regulation of

ubiquitination. DUBs help to generate ubiquitin monomers, required to keep the

intracellular pool of free ubiquitin sufficiently high to allow substrate ubiquitin to

proceed efficiently (Pickart & Rose, 1985). DUBs disassemble the ubiquitin chains from

E3 to prevent excessive binding and accumulation of inhibitory ubiquitin oligomers

(Hershko & Ciechanover, 1992). Furthermore, ubiquitinated substrates destined for

proteasomal degradation are deubiquitinated prior to degradation (Hu et al, 2005; Verma

et al, 2002), likely to stop the ubiquitin conjugate from blocking the proteasome during

the degradation process and also to allow the ubiquitin molecule to be recycled.

As can be seen, the ubiquitination cascade is a highly complex system that contains

many points at which substrate ubiquitination can be regulated and controlled

6.2 The proteasome – the protein waste disposal system in the cell

Introduction ONE

29

The 20S proteasome is a huge, multi-subunit protease found in many organisms ranging

from the oldest bacteria (archaea), to modern plants and animals. The whole eukaryotic

20S proteasome is about 16 nm in height and has a diameter of about 10 nm (Tomisugi

et al, 2000). The structure of the 20S proteasome consists of four rings containing seven

subunits in each ring. The rings are arranged in the order of α-β-β-α (Fig. 7). In archaea,

there is only one type of α-subunit and one type of β-subunit and each β-subunit displays

comparable proteolytic activity while in eukaryotic cells, there are seven different types

of subunits found in the α-rings and β-rings (Fig. 7A-B) and only three β-subunits (β1,

β2 and β5) have proteolytic activity (Fig. 7C). Subunit β1 cleaves after acidic amino

acids, β2 after basic amino acids and β5 after neutral amino acids. The proteolytic

activity of β5 is considerably higher than that of β2 and β1. The inside of the 20S

proteasome is subdivided into three chambers (Fig. 7D), two antechambers form

between an α and a β ring, and one main proteolytic chamber formed between two β

rings. The gate through which substrates enter into the chambers is comprised of the last

ten amino acids of the N-terminus of subunits α2, α3 and α4. Structures of the 20S

proteasome have demonstrated that the N-terminus of subunit α3 blocks the gate and

currently it is not well understood how substrates pass through the gate of the 20S

proteasome (Jung & Grune, 2008).

Fig 7. The structure of proteasome.

(A) the ball model of Archaea proteasome. (B) the ball model of 20S part of proteasome in

eukaryotic cells, take yeast S. cerevisiae as example. (C) the view of a single β-ring of (B).

(D) the structure of eukaryotic proteasome, showing the 20S part.

By binding with different (often inducible) subunits or regulatory proteins, the 20S

proteasome upgrades itself and gains new functions or to change its substrate specificity

and activity (Jung & Grune, 2013). For example, the immunoproteasome (consisting of

two 11S and one 20S components and termed i20S) is fast acting and is involved in the

ONE Introduction

30

immune response to pathogens or inflammatory processes (Piccinini et al, 2003;

Stratford et al, 2006) while the hybrid-proteasome (19S-20S-11S components) is

possibly involved in the production of oligo-peptides for MHC-I presentation in immune

response.

The major form of the proteasome in eukaryotes is the 26S proteasome (two 19S

and one 20S components) and it is this form that facilitates the degradation of most

substrates of the UPS. The 26S proteasome can degrade natively folded proteins

whereas the 20S proteasome is only able to recognize and degrade proteins that are

already unfolded (DeMartino et al, 1994; Liu et al, 2002). This ability comes from the

19S component, a 700 kD protein complex consisting of six Rpt subunits (Rpt1-6) that

display ATPase activity and 13 non ATPase Rpn subunits (Rpn1-3, 5-13 and 15) that

captures ubiquitinated substrates, unfolds them and then feeds to the 20S proteolytic

core (Thrower et al, 2000). The poly-ubiquitin chain is removed by the action of a DUB

associated with the 19S component (Kim et al, 2018).

Unlike with the 20S proteasome, the mechanism by which substrates gain access to

the inner chamber of the 26S proteasome has been elucidated. The C-terminus region of

the 19S ATPases, which contain a specific HbYX (hydrophobic residue, tyrosine, X)

motif, inserts into the pockets between neighbouring alpha subunits. This interaction

induces a rotation in the alpha subunits and displacement of a reverse-turn loop that

stabilizes the open-gate conformation (Rabl et al, 2008). This binding stimulates the

opening of the gate of the 20S upon ATP binding to the ATPase subunits, similar to the

way in which a key in a lock opens a door (Smith et al, 2007).

6.3 The UPS-dependent degradation of organellar membrane proteins

The correct folding, location and amount of any protein is fundamentally important for

its function in the cell. This means that proteins that become misfolded or damaged,

mislocalized or are present in too high amounts may cause problems in the cell and it is

for this reason that pathways such as the UPS facilitate the degradation of unwanted

proteins. This also extends to the degradation of membrane proteins present on

organelles.

One of the most well studied pathways that targets organelle membrane proteins for

degradation is that of ER-Associated Degradation (ERAD), which targets ER membrane

proteins for ubiquitination and degradation by the proteasome. About one-fourth of

eukaryotic genomes encode for integral membrane proteins and the ER is the site of

initial assembly for a large number of them (Shao & Hegde, 2011). Because the folding

and correct assembly of membrane proteins is a challenge, the ERAD pathway ensures

Introduction ONE

31

that membrane proteins that become terminally unfolded do not accumulate in the ER

but are instead degraded. Likewise, ERAD also targets proteins that are incorrectly

glycosylated or damaged as well as a number of redundant ER membrane proteins.

Substrates of the ERAD pathway are first recognized as unwanted and

ubiquitinated by E2s and E3s. This is a part of the ERAD pathway that is still not well

understood. In certain cases substrate recognition occurs through the action of chaperone

proteins such as OS-9, XTP3-B and SEL1L (reviewed in (Hebert & Molinari, 2012)

while the E3s themselves also possess the capability to recognize substrates (Stein et al,

2014). In the case where redundant proteins are targeted for degradation, a “degron”

sequence in the substrate often allows the protein to be recognised and degraded (Ravid

et al, 2006; Smith et al, 2016). Such sequences often lack structure and it is thought that

they mimic unfolded domains and are recognised as misfolded proteins and

subsequently degraded (Ravid & Hochstrasser, 2008).

Two well conserved RING E3s in S. cerevisiae, Hrd1p and Doa10p, are involved in

the degradation of most yeast ERAD substrates (Bays et al, 2001; Swanson et al, 2001),

working with the E2s Ubc6p and Ubc7p (Bazirgan & Hampton, 2008) to ubiquitinate

substrates. After ubiquitination, the substrate membrane protein is extracted from the ER

membrane in an ATP-dependent retro-translocation process and delivered to the

proteasome, which is usually present in the cytosol, for degradation (Christianson & Ye,

2014; Erzberger & Berger, 2006; Sauer & Baker, 2011). In humans, at least four E3

ligases are involved in the ERAD pathway, including CHIP, RMA1, gp78 and HRD1

(similar to yeast Hrd1p) (Kawaguchi & Ng, 2007), working together with four E2s

(UBE2G1, -G2, -J1 and- J2) to promote substrate ubiquitination and degradation (Ye &

Rape, 2009).

Retro-translocation relies on the ATPase Cdc48p (p97 in mammalian cells), which

utilizes ATP hydrolysis to wrench the substrate membrane protein out of its favoured

environment, the ER membrane. Cdc48p also binds to a number of additional factors,

such as Npl4p and Ufd1p and it is thought that these are adaptor proteins that help in

substrate recognition (Meyer et al, 2000). In an interesting variation to the role of

Cdc48p in the retro-translocation step of ERAD, a recent report on the

ERAD-dependent degradation of the cadmium sensing protein Pca1p (Smith et al, 2016)

demonstrated that Cdc48 played a role in recruiting the 26S proteasome to the ER

membrane, to facilitate the degradation of Pca1. The authors suggested that such

mechanisms may enhance the efficiency by which Pca1 degradation proceeds while also

negating the requirement to protect the hydrophobic regions of Pca1 from the cytosol

while being transported to the proteasome. In addition, similar observations were

ONE Introduction

32

reported for a subset of additional ER membrane proteins and it will be interesting to

investigate further whether this is a general or specific mechanism for the degradation of

membrane proteins.

The ERAD pathway is only one of a number of pathways that target membrane

proteins for UPS-mediated degradation. Indeed, several years ago, Heo et al identified a

pathway that facilitates the degradation of membrane proteins on mitochondria exposed

to stress (Heo & Rutter, 2011). This pathway, which they termed Mitochondrial

Associated Degradation (MAD), also requires the ATPase Cdc48p as well as Vms1p, an

evolutionary conserved cytosolic protein that recruits Cdc48p to the mitochondria under

stress conditions, to facilitate degradation. Since this time, several reports have

identified additional substrates of the MAD pathway as well as MAD specific factors

required for the turnover of mitochondrial membrane proteins (Wu et al, 2016).

Likewise, membrane proteins present on chloroplasts can also be targeted for

degradation. In a recent paper, Ling et al. demonstrated that the chloroplast

membrane-bound RING E3 ligase SP1 was involved in the selective UPS-mediated

degradation of members of the Translocon at the Outer envelope of Chloroplasts (TOC)

complexes, which facilitate protein import into chloroplasts (Ling & Jarvis, 2015).

Degradation of these TOC components allows chloroplasts to reorganize their import

machinery, to regulate the import of proteins into chloroplasts.

In conclusion, the degradation of unwanted organellar membrane proteins is crucial

for organelle function but many questions still remain concerning how for example

substrates of these pathways are recognized and how the removal of the hydrophobic

regions of a membrane proteins is facilitated without generating disturbances to the

membrane itself.

6.4. Degradation of peroxisomal proteins

The wealth of information on the degradation of organellar membrane proteins from for

example the ER is in sharp contrast to what is known on the degradation of peroxisomal

membrane proteins (PMPs). To date, there are only two PMPs that are known to be

targeted for USP-mediated degradation: Pex3p in the yeast H. polymorpha (Williams &

van der Klei, 2013a) and Pex13p in plants (Pan et al, 2016). Methanol-grown H.

polymorpha cells exposed to glucose degrade all but one of their peroxisomes via

pexophagy (see above) and initiation of pexophagy requires that the PMP Pex3p is

ubiquitinated and degraded in a process involving the peroxisomal E3 ligase complex

and the UPS (Bellu et al, 2002; Williams & van der Klei, 2013a). In the case of plant

Pex13p, the RING E3 ligase SP1 was reported to localise not only to the chloroplast but

Introduction ONE

33

also the peroxisomal membrane and to facilitate UPS-mediated Pex13p degradation

(Pan et al, 2016), although the localisation of SP1 is still under discussion (Ling et al,

2017; Pan & Hu, 2018). While not confirmed, several reports in the literature suggest

that additional PMPs are targeted for degradation via the UPS. For example, levels of

the peroxisome inheritance factors Inp1p and Inp2p are regulated in a cell-cycle

dependent manner (Fagarasanu et al, 2006; Kumar et al, 2017). Furthermore,

ubiquitinated peptides of Pex14p have been found in S. cerevisiae (Mayor et al, 2007;

Seyfried et al, 2008; Tagwerker et al, 2006) and human cells (Kim et al, 2011),

suggesting that this PMP too undergoes UPS-mediated degradation. Clearly PMP

degradation pathways also exist but this field is still in its infancy.

However, it has been known for some time that the UPS plays a role in peroxisome

biology, through the degradation of poly-ubiquitinated Pex5p/Pex18p/Pex20p (see

above). In all cases the peroxisomal ubiquitination machinery was required, although the

mechanisms were varied. In addition, it was recently reported that the PTS2 co-receptor

Pex7p also undergoes UPS-mediated degradation in the yeast P. pastoris (Hagstrom et al,

2014) and in humans (Miyauchi-Nanri et al, 2014). The peroxisomal ubiquitination

machinery seemed not to be required for Pex7p degradation in either organism whereas

the cytosolic E3 ligase complex CRL4A (Cullin4A-RING Ub E3 ligase) was required

for Pex7p ubiquitination/degradation in humans. In both cases, the authors reported that

non-functional Pex7p was targeted for degradation, defining these degradation events as

quality control related.

Another example of quality control at the peroxisomal membrane concerns the

AAA-ATPase Msp1p. This membrane anchored protein targets to both peroxisomes and

mitochondria and seems to play a role in removing incorrectly targeted tail anchored

membrane proteins for degradation (Chen, 2014; Okreglak, 2014; Weir et al, 2017;

Wohlever et al, 2017). Currently it is not known whether Msp1p also targets other

classes of membrane proteins nor whether the UPS is involved in these degradation

events.

While it is clear that the peroxisomal ubiquitination machinery can target certain

peroxisomal proteins for UPS-mediated degradation, the role of Msp1p and CRL4A in

the degradation of peroxisomal proteins indicates that pathways targeting peroxisomal

proteins are integral into general cellular degradation systems and are not stand alone

pathways exclusively targeting peroxisomal proteins.

7. Peroxisomal proteomics

Cells adapt the protein content of peroxisomes depending on their metabolic

ONE Introduction

34

requirements because the proteins that are present in a particular peroxisome determine

its function, whether they are the enzymes of the different metabolic pathways housed

inside peroxisomes or the PMPs involved in the import of proteins or small molecules

(Hazra et al, 2002; Van den Bosch et al, 1992). Hence, obtaining information on which

proteins are present in peroxisomes at a given time or under a given condition provides

an invaluable insight into the role of peroxisomes in cell biology. Indeed, many

peroxisome functions have been determined using microscopy and/or biochemical

methods. However, in recent years the use of mass spectrometry (MS) to study

peroxisomal proteomics has led to the identification of many new peroxisomal proteins

and hence new peroxisome functions (Schäfer et al, 2001; Yi et al, 2002). This has

resulted in a better understanding of how peroxisomes are integrated into the metabolic

and regulatory networks in cells. New MS-based proteomics approaches are being

developed all the time, that allow for better sensitivity and the reduction of false

positives and it is fair to say that through the use of such techniques, new insights into

peroxisomal function are undoubtedly on the horizon.

8. Perspectives

While our understanding of the processes that regulate peroxisome functions has

increased dramatically over the last 10 years, there are still many things about these

processes that we do not understand. For example, do the growth and division and de

novo pathways work simultaneously in wild type cells and if so, how are they regulated

and coordinated under various conditions? In addition, how the targeting of peroxisomal

membrane proteins (PMPs) to peroxisomes is achieved is still poorly understood.

Finally several studies have indicated a role for the endomembrane system in

peroxisome biogenesis and PMP import while others refute this, demonstrating that we

as yet do not understand enough about these processes to derive one all-inclusive model

that describes all the available data.

Peroxisomal matrix proteins (MATs) are imported via their peroxisomal targeting

sequence (PTS), either a PTS1 or PTS2. However, a number of studies demonstrate that

some MATs that lack a recognizable PTS sequence can also be imported into

peroxisomes. It is proposed that these proteins can bind to other MATs with a defined

PTS signal, or that they contain an as yet unidentified PTS required for targeting. Hence,

the use of bioinformatics to identify PTS1/PTS2 signals in putative MATs is not

sufficient to obtain an overview of which matrix proteins target to peroxisomes and

instead top down techniques such as mass spectrometry based organellar proteomics are

required. Furthermore, studies that aim to define how MATs that lack a PTS target to

Introduction ONE

35

peroxisomes will undoubtedly result in the identification of additional peroxisomally

localised metabolic pathways which, when taken together with mass spec based

approaches, will increase our understanding of the role of peroxisomes in cellular

metabolism.

Peroxisomal protein import is vital for peroxisomal function and likewise the

removal and degradation of certain peroxisomal proteins will also likely impact on

peroxisome biology. Unlike the degradation of membrane proteins from other organelles,

little is known about the turnover of PMPs. The degradation of specific PMPs via the

ubiquitin-proteasome system (UPS) rather than the selective autophagy of peroxisome

(pexophagy) provides the possibility that PMPs can be selectively degraded without

interfering other metabolism pathways. To date Pex3p in H. polymorpha and Pex13p in

plants are the only PMPs known to be targeted for degradation via the UPS (Bellu et al,

2002; Pan et al, 2016; Williams & van der Klei, 2013a) and the question remains which

other PMPs are degraded via the UPS and why? Furthermore, the mechanisms of Pex3p

and Pex13p degradation appear to differ quite dramatically, which raises the question

whether different pathways (and hence different ubiquitin-conjugating enzymes and E3

ligases) exits to target PMPs for UPS-mediated degradation. TRIM37, a peroxisomally

localised E3 ligase in mammals, ubiquitinates Pex5p to protect it from proteasomal

degradation (Wang et al, 2017). It will be interesting to see whether TRIM37

ubiquitinates other peroxisomal proteins. Finally, how the removal of Pex3p and Pex13p

(as well as other putative PMPs) from the peroxisomal membrane is achieved is

currently unknown. In the case of H. polymorpha Pex3p, the AAA-ATPase Pex1p was

not required, suggesting the involvement of another AAA-ATPase in dissociating Pex3p

from the membrane.

9. Aim and outline of this thesis

Peroxisomes are single membrane bound organelles found in virtually all eukaryotic

cells. They are involved in multiple metabolic functions including the decomposition of

reactive oxygen species and the oxidation of fatty acids, but many more peroxisomal

functions are known. Peroxisomal functions depends on the matrix and membrane

proteins present in peroxisomes and regulating which proteins are present in a given

peroxisome at a given time allows peroxisome function to be finely tuned.

Peroxisomes lack DNA, which means that they import all the peroxisomal matrix

and membrane proteins required for function. Hence, the import of peroxisomal proteins

plays an important role in defining peroxisome function. Likewise, the removal and

degradation of peroxisomal proteins can also be expected to impact on peroxisomal

ONE Introduction

36

function yet to date little is known on how or why peroxisomal protein degradation

occurs.

The aim of the research presented in this thesis is to provide the first insights into

peroxisomal membrane protein (PMP) degradation. The presence of an intricate

ubiquitination machinery on the peroxisomal membrane suggests that this machinery

targets PMPs for ubiquitination and degradation, as do similar machineries on other

organelles, yet to date the only PMP substrate of this machinery is Pex3p in the yeast H.

polymorpha. The identification of additional substrates of the peroxisomal

ubiquitination machinery will therefore allow us to better understand the role of this

machinery in peroxisome function. Likewise, since protein degradation can occur for

different reasons, understanding why PMPs are targeted for degradation will also

provide information on the importance of PMP degradation in peroxisome function. To

address these issues, the research presented here utilizes a multi-disciplinary approach to

investigate some of the underlying mechanisms and cellular functions of PMP

degradation in yeast.

In Chapter one, we presented an overview of processes that regulate peroxisome

function. In addition, the Ubiquitin proteasome system is discussed, as was as how

organelle membrane protein degradation is regulated and facilitated.

Previous findings suggested that the peroxisomal ubiquitination machinery is

involved in the degradation of the PMP Pex3p degradation in the yeast H. polymorpha.

In Chapter two we aimed to identify additional substrates of this machinery in PMP

degradation using H. polymorpha as model organism. Our data demonstrate that levels

of the PMP Pex13p build up in cells lacking members of the peroxisomal ubiquitination

machinery and also establish that Pex13p undergoes rapid degradation in wild type cells.

Furthermore, we show that Pex13p is ubiquitinated in wild type cells and also establish

that Pex13p ubiquitination is reduced in cells lacking a functional peroxisomal E3 ligase

complex. Finally, deletion of PEX2 causes Pex13p to build up at the peroxisomal

membrane. Taken together, our data suggest that Pex13p degradation regulates

peroxisomal matrix protein import. Furthermore, this study provides further evidence

that the role of the peroxisomal ubiquitination machinery in peroxisome biology goes

much deeper than receptor recycling alone.

Pex13p in the yeast H. polymorpha undergoes rapid degradation in a process that

requires the peroxisomal E3 ligase Pex2p. However, the underlying reason why Pex13p

undergoes degradations remained unknown. In Chapter three we have investigated the

degradation of H. polymorpha Pex13p further, aiming to understand the underlying

reasons why Pex13p undergoes rapid degradation. Our data indicate that

Introduction ONE

37

Pex2p-dependent turnover of Pex13p also occurs under peroxisome non-inducing

condition, demonstrating that Pex13p degradation is a general and not a media-specific

event. In addition, our studies indicate that blocking Pex5p recycling leads to increased

Pex13p levels, suggesting that Pex5p recycling is functionally linked to Pex13p turnover.

Furthermore, we identify a mutant version of Pex13p that is inhibited in degradation and

we also establish that inhibiting Pex13p degradation can impact negatively on cell

growth on methanol-containing media. Based on these results, we outline possible

functions of Pex13p degradation in relation to the import of peroxisomal matrix

proteins.

The link between Pex13p degradation and peroxisomal matrix protein import

identified in Chapter three suggests that this degradation event may be a general trait for

peroxisomes. Hence, we aimed to investigate whether Pex13p degradation is a

conserved process across species, choosing the yeast S. cerevisiae as model organism.

Furthermore, we aimed to utilise the high-throughput screening techniques available for

this organism to identify additional factors that are required for Pex13p degradation. In

Chapter four, we demonstrate that UPS-mediated Pex13p degradation also occurs in

the yeast S. cerevisiae, likely via similar mechanisms to that in H. polymorpha.

Furthermore, inactivation of the ATPase Cdc48p, which plays a role in degrading

mitochondrial and ER membrane proteins, does not result in stabilization of Pex13p in

vivo, establishing that Pex13p degradation probably occurs via a different mechanism to

that of other organellar membrane proteins. Additionally, we utilize a tandem fluorescent

protein timer approach to identify which additional factors are involved in Pex13p

degradation, establishing that cytosolic E2 and E3 enzymes may also play a role in

Pex13p turnover. Together, these data provide further evidence that Pex13p degradation

is a conserved process while also uncovering novel components of the UPS that play a

role in Pex13p degradation. We discuss the implications of our findings.

The proteins that are present in peroxisomes determine peroxisomal function.

These are the matrix involved in the different peroxisomally localised pathways or the

membrane proteins that transport metabolites or proteins across the peroxisomal

membrane. Additional peroxisomal proteins are involved in organelle biogenesis and

dynamics. Therefore, obtaining a complete overview of the proteins present in

peroxisomes at a given time or under a given growth condition provides invaluable

insights into peroxisome function. In Chapter five we provide an overview of how mass

spectrometry based proteomics studies have provided valuable new and novel insights

into peroxisomal function and we outline how innovative new techniques and

approaches may lead to new discoveries in the future.

38

2

Chapter 2

Insights into the role of the peroxisomal ubiquitination machinery in Pex13p

degradation in the yeast Hansenula polymorpha

Xin Chen, Srishti Devarajan, Natasha Danda and Chris Williams

This chapter has been published: (Featured Article)

Chen, X., Devarajan, S., Danda, N., & Williams, C. (2018). Insights into the role of the

peroxisomal ubiquitination machinery in Pex13p degradation in the yeast Hansenula

polymorpha. Journal of molecular biology, 430(11), 1545-1558.

Author contributions

CW conceived and supervised the project. CW, SD, ND and XC designed the

experiments. XC, SD, ND and CW analysed the data. XC performed biochemical and

FM experiments, with support from SD and ND. All authors discussed the results. XC

and CW wrote the manuscript, with contributions from all authors.

TWO Pex13p degradation in H. polymorpha

40

Insights into the role of the peroxisomal ubiquitination machinery in Pex13p

degradation in the yeast Hansenula polymorpha

Xin Chen1, Srishti Devarajan

1, Natasha Danda

1,2 and Chris Williams

1,*

1Molecular Cell Biology, Groningen Biomolecular Sciences and Biotechnology Institute,

University of Groningen, 9747AG, the Netherlands 2Current address: Institut du Cerveau et de la Moelle épinière (ICM), Hôpital

Pitié-Salpêtrière, 47 bd de l'Hôpital, 75013 Paris, France

*Corresponding author (c.p.williams@rug.nl)

Abstract

The import of matrix proteins into peroxisomes in yeast requires the action of the

ubiquitin conjugating enzyme Pex4p and a complex consisting of the ubiquitin E3

ligases Pex2p, Pex10p and Pex12p. Together, this peroxisomal ubiquitination machinery

is thought to ubiquitinate the cycling receptor protein Pex5p and members of the Pex20p

family of co-receptors, a modification that is required for receptor recycling. However,

recent reports have demonstrated that this machinery plays a role in additional

peroxisome-associated processes. Hence, our understanding of the function of these

proteins in peroxisome biology is still incomplete. Here, we identify a role for the

peroxisomal ubiquitination machinery in the degradation of the peroxisomal membrane

protein Pex13p. Our data demonstrate that Pex13p levels build up in cells lacking

members of this machinery and also establish that Pex13p undergoes rapid degradation

in wild type cells. Furthermore, we show that Pex13p is ubiquitinated in wild type cells

and also establish that Pex13p ubiquitination is reduced in cells lacking a functional

peroxisomal E3 ligase complex. Finally, deletion of PEX2 causes Pex13p to build up at

the peroxisomal membrane. Taken together, our data provide further evidence that the

role of the peroxisomal ubiquitination machinery in peroxisome biology goes much

deeper than receptor recycling alone.

Keywords: Peroxisome/protein degradation/ubiquitin proteasome

system/PMP/peroxisomal membrane protein

Pex13p degradation in H. polymorpha TWO

41

Introduction

Peroxisomes are highly versatile eukaryotic organelles that play a vital role in regulating

cellular metabolism, providing compartments where metabolic pathways can be

contained and controlled. Their versatility is demonstrated by the wide range of

metabolic pathways contained in peroxisomes. Some well-known peroxisomal processes

include the oxidation of fatty acids and the biosynthesis of plasmalogens and penicillin,

but many more exist (Gabaldon, 2010). Their importance in cell vitality is underscored

by a number of inherited developmental brain disorders caused by defects in peroxisome

biogenesis (Walker et al, 2002). Peroxisomes require protein import systems to obtain

both peroxisomal membrane (PMP) and matrix proteins, via the use of peroxisomal

targeting signals (PTS) in the cargo protein. The mechanisms of PMP import are not

well understood, although important roles for the PMP Pex3p and the cytosolic receptor

protein Pex19p have been demonstrated (Ferreira et al, 2015; Jung & Grune, 2013). In

contrast, our understanding of the mechanisms that underlie matrix protein import is

much more developed (Baker et al, 2016). Matrix proteins containing a C-terminal PTS1

can be recognized by the cytosolic receptor Pex5p while matrix proteins with an

N-terminal PTS2 are recognized by Pex7p (Lazarow, 2006; Williams & Stanley, 2010).

In yeasts, Pex7p requires members of the Pex20p family of co-receptor proteins to

facilitate import, whereas this function is fulfilled by an isoform of Pex5p in higher

eukaryotes (Schliebs & Kunau, 2006). Pex5p shuttles between the cytosol and

peroxisomal membrane during the transport of PTS1-cargo proteins. The cargo-Pex5p

complex, which forms in the cytosol, travels to the peroxisomal membrane, where it

contacts the docking complex consisting of the PMPs Pex13p and Pex14p. After

translocation of the cargo to the peroxisomal matrix in a process involving Pex8p, Pex5p

is ubiquitinated, which facilitates its removal from the peroxisomal membrane (for a

review on matrix protein import, see (Baker et al, 2016)).

Ubiquitination is a posttranslational modification that requires the activity of a

three-step enzyme cascade (Komander & Rape, 2012). The ubiquitin-activating enzyme

(E1) activates the small protein ubiquitin (Ub) via ATP hydrolysis and transfers it to the

active site Cysteine of an ubiquitin-conjugation enzyme (E2). The final step requires the

activity of an ubiquitin ligase (E3). Two classes of E3s exist. Members of the HECT

class, much like E2s, accept Ub onto an active site Cysteine and then transfer Ub to a

substrate, whereas RING E3 ligases act as bridge between E2 and substrate, positioning

the E2 active site in close proximity to the modification site in the substrate, allowing

Ub transfer to occur .

Two distinct types of Pex5p ubiquitination have been reported.

TWO Pex13p degradation in H. polymorpha

42

Mono-ubiquitination of Pex5p on a conserved Cysteine residue in its N-terminal region

by the E2 Pex4p allows Pex5p to recycle to the cytosol, ready to take part in another

import round (Grou et al, 2009; Platta et al, 2007; Williams et al, 2007).

Poly-ubiquitination of Pex5p on Lysine residues by the E2 Ubc4p, on the other hand,

targets Pex5p for degradation via the proteasome (Kiel et al, 2005a; Platta et al, 2004).

For both types of Pex5p ubiquitination, a complex consisting of three peroxisomal

RING E3s (Pex2p, Pex10p and Pex12p) is required (El Magraoui et al, 2014; Williams

et al, 2008) while extraction of ubiquitinated Pex5p from the membrane depends on a

complex of the AAA-ATPase proteins Pex1p and Pex6p (Platta et al, 2008). Pex20p

family members can also undergo ubiquitination, either for recycling or degradation, in

a similar fashion as mentioned for Pex5p (Leon et al, 2006).

It is evident that the peroxisomal ubiquitination machinery (Pex4p, Pex2p, Pex10p

and Pex12p) is important for peroxisome function because of its role in receptor

ubiquitination. However, recent reports link this machinery to the ubiquitination and/or

degradation of additional peroxisomal proteins. For example, the PMP Pex3p from the

yeast Hansenula polymorpha is ubiquitinated and degraded by the proteasome when

cells are shifted from methanol to glucose containing media (Williams & van der Klei,

2013b). Pex3p degradation, which is inhibited in pex2Δ and pex10Δ cells, initiates the

autophagic degradation of peroxisomes via pexophagy (Bellu et al, 2002). Pex2p is

implicated in PMP70 ubiquitination in mammalian cells, which is also linked to

pexophagy (Knoblach et al, 2013), while Pex4p is involved in the degradation of the

PTS2 co/receptor protein Pex18p in Saccharomyces cerevisiae (Purdue & Lazarow,

2001). These reports demonstrate that the list of substrates targeted by the peroxisomal

ubiquitination machinery is likely to be far from complete.

In this manuscript, we have investigated the role of the peroxisomal ubiquitination

machinery in the degradation of the PMP Pex13p. Cells deleted for components of the

peroxisomal ubiquitination machinery display enhanced Pex13p levels while we also

demonstrate that Pex13p is degraded in wild type (WT) cells. Furthermore, we show

that Pex13p is ubiquitinated in WT cells and that Pex13p ubiquitination is inhibited in

cells lacking a functional peroxisomal E3 ligase complex. Finally, we demonstrate that

deletion of PEX2 causes Pex13p to build up on the peroxisomal membrane. Taken

together, our data provide further evidence to support the suggestion that the role of the

peroxisomal ubiquitination machinery goes much deeper than receptor ubiquitination

alone.

Pex13p degradation in H. polymorpha TWO

43

Results

Pex13p levels are increased in cells deleted for components of the peroxisome

ubiquitination machinery

While a role for the peroxisome ubiquitination machinery in receptor ubiquitination is

well established, recent reports strongly suggest that this machinery targets additional

peroxisomal proteins. Therefore, we set out to identify potential new substrates of this

machinery in the yeast H. polymorpha and were particularly interested in which PMPs

may be targeted, since little is known about PMP degradation (Williams, 2014).

We reasoned that PMPs targeted for degradation by the peroxisomal ubiquitination

machinery may display increased levels in cells deleted for components of this

machinery. Therefore, we assessed the levels of a selection of PMPs in cells deleted for

PEX2, PEX4, PEX10 or PEX12 grown on methanol/ glycerol containing media, which

induces peroxisome proliferation. These PMPs, which are involved in different

peroxisomal functions, included Pex13p and Pex14p (both involved in matrix protein

import (Azevedo & Schliebs, 2006; Williams & Distel, 2006)), Pex3p (involved in PMP

import (Tomisugi et al, 2000)) and Pex11p (involved in peroxisomal fission

(Maupin-Furlow et al, 2005)). We observed that Pex13p levels were increased in all the

tested strains compared to WT cells (Figure 1A) and Pex13p levels appeared particularly

enhanced in cells deleted for PEX2, PEX10 or PEX12. Similarly, cells expressing the

K48R mutant form of Ub also displayed enhanced Pex13p levels, although not to the

same extent as those deleted for one of the peroxisomal E3 ligases (Figure 1A).

Ub-K48R inhibits proteasomal mediated degradation by blocking Ub chain formation on

substrates (Thrower et al, 2000), suggesting a link between Pex13p levels and the

ubiquitin-proteasome system (UPS). An increase in Pex3p and Pex14p levels in these

deletion strains was also observed (Figure 1A). A role for the peroxisomal ubiquitination

machinery in Pex3p degradation has already been proposed (Williams & van der Klei,

2013b) although Pex3p degradation was shown to occur under different growth

conditions than those used here. Pex11p levels appeared largely unaffected in the

deletion strains (Figure 1A).

TWO Pex13p degradation in H. polymorpha

44

Figure 1. H. polymorpha Pex13p levels are elevated in cells deleted for components

of the peroxisomal ubiquitination machinery

A WT cells, together with pex2Δ, pex10Δ, pex12Δ and pex4Δ cells and WT cells producing

Pex13p degradation in H. polymorpha TWO

45

Ub-K48R grown for 16 hrs on methanol/glycerol media were lysed and samples were

subjected to SDS-PAGE and immunoblotting using antibodies directed against Pex3p,

Pex13p, Pex14p, Pex11p and Pyc. * Denotes anti-Pex13p cross reactive species. L.E.

stands for longer exposure.

B Bar chart displaying Pex13p, Pex14p and Pex11p levels in WT, pex2Δ and pex4Δ cells.

Values were derived from quantifying western blots of samples prepared as in A. Protein

levels were normalized to Pyc (loading control) and plotted against the levels in WT

cells (set to 1). Values represent the mean ± standard deviation of three independent

experiments. Asterisks denote statistically significant increases in protein levels

compared to those in WT samples (*P < 0.05, **P < 0.01, ***P < 0.001).

C Representative western blots of Pex13p, Pex14p, Pex11p and Pyc levels in WT, pex13Δ

and aoxΔ cells grown and treated as in A. * Denotes anti-Pex13p cross reactive species.

The right panel displays the quantification of Pex13p, Pex14p and Pex11p levels,

normalized to the loading control Pyc. Protein levels in WT cells were set to 1. Values

represent the mean ± SD of three independent experiments.

D WT and mutant cells expressing mGFP under control of the PEX13 promoter (PPEX13)

were grown for 16 hrs on methanol/glycerol containing media, lysed and samples were

probed with SDS-PAGE and immunoblotting using antibodies against mGFP and Pyc.

E TCA lysates of WT cells, WT cells producing Ub-K48R and atg1 cells grown on

methanol/glycerol media for 16 hrs were subjected to SDS-PAGE, immunoblotting and

probed with antibodies directed against Pex11p, Pex13p, Pex14p and Pyc. * Denotes

anti-Pex13p cross reactive species.

To gain insight into the extent to which Pex13p levels were increased in these

deletion strains compared to WT cells, we performed quantitative western blotting,

assessing the fold increase in Pex13p levels in pex4Δ and pex2Δ cells (Figure 1B).

Deletion of either PEX2, PEX10 or PEX12 results in inactivation of the entire E3 ligase

complex (Agne et al, 2003), hence our choice to assess Pex13p levels in pex2Δ cells

only. Pex13p levels increased around 4fold in pex4Δ cells and around 12fold in pex2Δ

cells, compared to WT. Quantification of our western blots also confirmed that Pex14p

levels were increased in pex2Δ or pex4Δ cells compared to WT cells, although to a much

lower extent than for Pex13p (Figure 1B). As already suggested by Figure 1A, Pex11p

levels were not significantly affected by deletion of PEX2 or PEX4 (Figure 1B).

Because of the dramatic effect on Pex13p levels caused by these deletions, we chose to

investigate Pex13p further.

TWO Pex13p degradation in H. polymorpha

46

Deletion of PEX2, PEX4, PEX10 or PEX12 inhibits the import of matrix proteins

into peroxisomes (Baker et al, 2016). Since the oxidation of methanol occurs inside

peroxisomes and targeting the enzymes required for methanol metabolism to the cytosol

inhibits cells in their ability to grow on methanol, strains where matrix protein import is

inhibited cannot be grown on methanol (Cregg et al, 1990). Therefore, we investigated

whether the increased Pex13p levels in our deletion strains stem from an inability of

these strains to grow on methanol/ glycerol containing media. We compared the levels of

Pex13p in WT cells against cells deleted for alcohol oxidase (AOX). AOX is required

for methanol oxidation and cells deleted for AOX cannot be grown on methanol

(Bridges et al, 2016). We observed no increase in Pex13p levels in aoxΔ cells (Figure

1C), indicating that the increased Pex13p levels in cells deleted for PEX2, PEX4,

PEX10 or PEX12 are not caused by an inability of these cells to grow on methanol

containing media.

Next, to verify that the increased levels of Pex13p in these mutant strains were not

a result of increased Pex13p expression, we placed mGFP under control of the PEX13

promoter and assessed mGFP levels in our deletion and Ub-K48R mutant strains. The

level of mGFP in all mutants was comparable to that in WT cells (Figure 1D). These

data demonstrate that PEX13 expression is not up-regulated in these strains.

The major protein degradation pathway in eukaryotic cells is the UPS (Rowland et

al, 2014). However, certain proteins can be degraded via autophagy (Maupin-Furlow et

al, 2003) and although these two pathways are separate entities, crosstalk between the

two pathways is well established (Liu et al, 2002). For example, ubiquitination of

PMP70 by Pex2p initiates pexophagy in mammalian cells (Knoblach et al, 2013) while

we previously demonstrated that Pex10p plays a role in degradation of Pex3p, which in

turn initiates pexophagy in H. polymorpha (Williams & van der Klei, 2013b). Hence, we

considered the possibility that the effect on Pex13p levels in our deletion strains may

result as a consequence of disturbances to pexophagy. To investigate this, we assessed

the levels of Pex13p in an atg1Δ strain, in which pexophagy is inhibited (Knoops et al,

2014). We did not observe an increase in Pex13p levels in atg1Δ cells (Figure 1E),

demonstrating that increased Pex13p levels do not stem from inhibiting pexophagy. It

suggests that increased Pex13p levels stem from a block in UPS-dependent Pex13p

degradation. Together, our data suggest that Pex13p is a potential substrate of the

peroxisomal ubiquitination machinery.

Pex13p degradation in H. polymorpha TWO

47

Figure 2. H. polymorpha Pex13p is actively degraded in WT cells.

A WT cells were grown on methanol/glycerol media for 12 hrs and then treated with DMSO

(Ctrl) or Cycloheximide (CHX). TCA samples were taken at the indicated time (hrs) after

DMSO/CHX addition and probed by SDS-PAGE and immunoblotting with antibodies

against Pex13p, Pex14p, Pex11p and Pyc. * Denotes anti-Pex13p cross reactive species.

B Quantification of Pex13p, Pex14p and Pex11p levels in WT cells treated with DMSO

(Ctrl) or Cycloheximide (CHX). Protein levels were normalized to Pyc. Protein levels at

T0 were set to 1. Values represent the mean ± SD of three independent experiments.

C Representative western blots of WT cells expressing Pex13-mGFP grown and treated as

in A. Western blots were probed using antibodies against Pex14p, Pex11p, Pyc and

mGFP.

D Quantification of protein levels in WT cells expressing Pex13-mGFP after DMSO/CHX

addition. The data were generated as in B.

Pex13p is degraded in WT cells and Pex13p degradation requires a functional

peroxisomal E3 ligase complex

Since deleting components of the peroxisomal ubiquitination machinery seem to block

Pex13p degradation (Figure 1), our next step was to investigate whether Pex13p is

actively degraded in WT cells. To achieve this, we assessed the stability of Pex13p in

WT cells treated with the protein synthesis inhibitor cycloheximide (CHX). We

observed rapid decrease of Pex13p levels after CHX treatment (Figure 2A and B) while

TWO Pex13p degradation in H. polymorpha

48

similar behaviour was evident with Pex13-mGFP (Figure 2C and D), establishing that

Pex13p is actively degraded in WT cells. The Pex13-mGFP used here could not only

give similar degradation behavior and clearer signal, but important for the later

fluorescence microscopy (Figure 6). In contrast, Pex13-mGFP turnover was reduced in

cells expressing Ub-K48R (Figure 3A and B) and in cells deleted for PEX2 (Figure 3C

and D), supporting our suggestion that Pex13p degradation is inhibited in cells lacking a

functional peroxisomal E3 ligase complex, as well as in cells expressing Ub-K48R

(Figure 1).

We observed that the levels of Pex14p and Pex11p in our CHX experiments

decreased over time, although at a lower rate than Pex13p (Figure 2A-D). Also, Pex11p

and Pex14p appeared stable in cells expressing Ub-K48R (Figure 3A and B) and in

pex2Δ cells (Figure 3C and D). One possible way to interpret these data is that both

Pex11p and Pex14p may also be degraded in a process that requires the peroxisomal E3

ligase complex and Ub, although further study will be required to determine whether

this is indeed the case. Nevertheless, our data strongly suggest that Pex13p is actively

degraded in a process that requires Ub and the peroxisomal E3 ligase complex.

Figure 3. Pex13p degradation is inhibited in pex2Δ or Ub-K48R cells

A Ub-K48R cells expressing Pex13-mGFP were grown on methanol/glycerol media for 12

hrs and treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at

the indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p, Pex11p and Pyc.

Pex13p degradation in H. polymorpha TWO

49

B Quantification of Pex13-mGFP, Pex14p and Pex11p levels in Ub-K48R cells expressing

Pex13-mGFP. Protein levels were normalized to the loading control Pyc. Protein levels

at T0 were set to 1. Values represent the mean ± SD of three independent experiments.

C Representative western blots of pex2Δ cells expressing Pex13-mGFP derived from cells

grown and treated as in A. Samples were probed with SDS-PAGE and immunoblotting

with antibodies against mGFP, Pex11p and Pyc.

D Quantification of protein levels in pex2Δ cells expressing Pex13-mGFP. Protein levels

were normalized to Pyc. Protein levels at T0 were set to 1. Values represent the mean ±

SD of three independent experiments.

Pex13p is ubiquitinated in WT cells while Pex13p ubiquitination is reduced in pex2Δ

cells

To investigate more directly the role of Ub and the peroxisomal E3 ligase complex in

Pex13p degradation, we assessed whether Pex13p is ubiquitinated. To achieve this, we

introduced a C-terminal His6 tagged form of Pex13p into WT and pex2Δ cells and

performed pull-down assays (Figure 4). Cells also co-produced a Myc tagged form of

Ub (Myc-Ub), to aid detection of ubiquitinated proteins. A ladder of Myc-Ub

Pex13-His6 was detected in elution fractions isolated from WT cells co-expressing

Pex13-His6 and Myc-Ub (Figure 4B, lane 4). This ladder was severely reduced in

elution fractions isolated from pex2Δ cells co-expressing Pex13-His6 and Myc-Ub

(Figure 4B, lane 3), providing direct evidence that Pex13p is ubiquitinated in WT cells

and also showing that Pex13p ubiquitination requires the peroxisomal E3 ligase

complex.

TWO Pex13p degradation in H. polymorpha

50

Figure 4. Pex13p is ubiquitinated in WT cells while Pex13p ubiquitination is

reduced in pex2Δ cells.

pex2/Myc-Ub, pex2/Pex13-His, pex2/Pex13-His/Myc-Ub and Pex13-His/Myc-Ub cells were

grown on methanol/glycerol media for 12 hrs and Pex13-His was purified under denaturing

conditions using Ni-NTA resin. Load (A) and elution (B) fractions were subjected to

SDS-PAGE and immunoblotting with antibodies raised against the Myc-tag (upper panels)

or the His tag (lower panels).

Pex13p degradation in H. polymorpha TWO

51

Figure 5. Pex13p levels are elevated in pex5Δ, pex14Δ and pex8Δ cells.

A Representative western blots of samples derived from WT and mutant cells grown for 16

hrs on methanol/glycerol media. Blots were probed with antibodies directed against

Pex13p, Pex14p, Pex11p and Pyc. * Denotes anti-Pex13p cross reactive species.

B Lysates from WT, pex4Δ and pex8Δ cells (grown as in A) were subjected to SDS-PAGE

and immunoblotting using antibodies against Pex13p, Pex14p, Pex11p and Pyc. *

Denotes anti-Pex13p cross reactive species.

C Quantification of protein levels in WT and mutant cells, normalized to the loading

control Pyc. Protein levels in WT cells were set to 1. Values represent the mean ± SD of

three independent experiments. Asterisks denote statistically significant increases in

protein levels compared to those in WT samples (*P < 0.05, **P < 0.01, ***P < 0.001).

TWO Pex13p degradation in H. polymorpha

52

Pex5p, Pex14p and Pex8p play a role in Pex13p degradation

Next we sought to identify whether additional proteins are required for Pex13p

degradation and focussed on proteins that were shown to interact with Pex13p in other

organisms. These included the PTS1 receptor protein Pex5p (Douangamath et al, 2002),

the docking factor Pex14p (Pires et al, 2003), the PTS2 receptor Pex7p (Stein et al, 2002)

and its accompanying co-receptor protein Pex20p (Stein et al, 2002) and the

cargo-dissociation factor Pex8p (Jung et al, 2009). Deletion of genes that encode for

proteins specifically involved in PTS2 protein import did not impact on Pex13p

degradation (Figure 5A and C) whereas Pex13p levels were increased around 3fold in

cells deleted for PEX5 and around 6fold in cells deleted for PEX14 (Figure 5A-C).

Strikingly, PEX8 deletion resulted in a strong inhibition of Pex13p degradation, at a

level comparable with that observed for pex2Δ cells (Figure 5B and C). Pex14p levels

were also increased in cells deleted for PEX8, although to a much lower extent, similar

to in cells deleted for PEX2 (Figure 1B and 5C). Deletion of PEX5, PEX8 or PEX14 did

not affect PEX13 promotor activity (Figure 1D), indicating that the increased levels of

Pex13p indeed stem from inhibited protein degradation. We also observed what

appeared to be modified forms of Pex13p in samples derived from pex5Δ, pex14Δ,

pex2Δ or pex8Δ cells (denoted with a # in Figure 5A and B). We consider it highly

unlikely that these represent ubiquitinated forms of Pex13p, because deletion of PEX2

inhibits Pex13p ubiquitination (Figure 4), which leaves us to conclude that they

represent another modified form of Pex13p that becomes visible because Pex13p levels

are increased in these deletion strains. We can only speculate as to which modification

this could represent but since phosphorylated Pex13p peptides have been found in

mammalian cells (Schluter, 2006), it may represent phosphorylated Pex13p.

Taken together, these observations demonstrate that additional factors are likely to

play a role in Pex13p degradation.

Pex13-mGFP builds up at the peroxisomal membrane in pex2Δ cells

Our data could suggest that Pex13p is ubiquitinated by the peroxisomal ubiquitination

machinery for proteasomal mediated degradation. Since this machinery is present at the

peroxisomal membrane and proteasomes are mostly cytosolic (Lee et al, 2017), we

considered it likely that Pex13p would build up on the peroxisomal membrane when its

degradation is inhibited. To investigate this further, we compared the behaviour of

Pex13-mGFP in WT and pex2Δ cells using fluorescence microscopy (FM). Cells also

co-produced Pex14-mKate2, to mark peroxisomes. As expected, both Pex13-mGFP and

Pex14-mKate2 co-localised in WT cells (Figure 6A and B). In Figure 6A, fluorescence

Pex13p degradation in H. polymorpha TWO

53

images were processed with each optimal settings to clearly show signals, while in

Figure 6B, images were processed with a common setting to reflect the difference of

fluorescence intensities in two strains. pex2Δ cells lack functional peroxisomes, because

Pex2p is required for matrix protein import (Koek et al, 2007). Instead, pex2Δ cells

contain peroxisome “ghosts”, which are small peroxisomal membrane structures that

contain most PMPs but very few matrix proteins (Koek et al, 2007). Pex13-mGFP

co-localized with Pex14-mKate2 in peroxisomal ghosts in pex2Δ cells (Figure 6 A and

B). As expected, Pex13-mGFP was present at higher levels in pex2Δ cells, as can be

seen from the increased GFP signal in cells (Figure 6C), as well as protein levels (Figure

6D) in pex2Δ cells compared to WT cells. Taken together, these results indicate that

Pex13-mGFP builds up on the peroxisomal membrane in the absence of a functional

peroxisomal E3 ligase complex.

Figure 6. Pex13-mGFP accumulates on the peroxisomal membrane in pex2Δ cells.

A WT and pex2Δ cells producing Pex13-mGFP and Pex14-mKate2 were grown on

methanol/glycerol media to an OD600 of 1.0 and fluorescence microscopy images were

TWO Pex13p degradation in H. polymorpha

54

taken. Images of Pex13-mGFP were processed using ImageJ with optimal settings to

show signals in WT and pex2Δ. Pex14-mKate2 was used as peroxisomal membrane

marker. The following settings were used: for WT cells mGFP (255, 2500) and mKate2

(219, 3000); for pex2 cells mGFP (255, 7000) and mKate2 (219, 4700). Scale bar: 5μm.

B Fluorescence images of Pex13-mGFP in WT or pex2Δ shown in (A) were processed

using ImageJ with the same settings: mGFP (255, 5000), mKate2 (219, 4000). Scale bar:

5μm.

C Box plot showing quantification of mGFP and mKate2 fluorescence intensity at the

peroxisomal membrane in WT and pex2Δ cells producing Pex13-mGFP and

Pex14-mKate2. Fluorescence intensities (auxiliary units) were measured using ImageJ.

The box represents values from the 25 percentile to the 75 percentile; the horizontal line

through the box represents the median value. Whiskers indicate maximum and minimum

values. Pex13-mGFP and Pex14-mKate2 measurements were taken as described in the

Materials and Methods section.

D The intensity ratio of mGFP/ mKate calculated based on the same cells from Fig-6C.

The maximum intensity of Pex13-mGFP was divided by the corresponding maximum

intensity of Pex14-mKate2 in each cell. The dataset subjected to the two-tail t-test

resulting P-value 0.001 .

E WT and pex2Δ cells producing Pex13-mGFP grown on methanol/glycerol media and

TCA samples were taken when the cultures reached an OD600 of 1.0. Samples were

subjected to SDS-PAGE and immunoblotting using antibodies against mGFP and Pyc.

Discussion

The molecular function of the peroxisomal ubiquitination machinery was long thought

to be restricted to cycling receptor ubiquitination. However, several recent reports have

identified additional roles for this machinery in peroxisome biology. Here, we present

data that suggest a role for the E2 Pex4p and the RING E3 ligases Pex2p, Pex10p and

Pex12p in the degradation of Pex13p while we also provide evidence that Pex13p is

ubiquitinated in a manner that requires a functional peroxisomal E3 ligase complex.

Following this line of reasoning, our data suggest a model where Pex13p is

ubiquitinated by Pex4p and the peroxisomal E3 ligase complex to target Pex13p for

proteasomal mediated degradation. While this model is an attractive proposal, it remains

hypothetical at the current time because we have not shown that the peroxisomal

ubiquitination machinery is directly involved in Pex13p ubiquitination. Such evidence

will likely come from the use of assays that reconstitute the ubiquitination of Pex13p in

Pex13p degradation in H. polymorpha TWO

55

vitro. Nevertheless our data, when coupled together with the observations that Pex5p

(Kiel et al, 2005a; Platta et al, 2004), members of the Pex20p family (Liu & Subramani,

2013; Purdue & Lazarow, 2001) and Pex7p (Hagstrom et al, 2014) can all be

ubiquitinated for proteasomal mediated degradation, indicate that the UPS is involved in

targeting a range of peroxisomal proteins for degradation, suggesting a determining role

for the UPS in regulating peroxisome function.

This leads to the question why is Pex13p targeted for degradation? Currently, it is

only possible to speculate on this. Since Pex13p is essential for peroxisomal matrix

protein import (Williams & Distel, 2006), degradation of Pex13p would likely inhibit

the import process. In this light, an interesting comparison can be drawn with recent

work on Arabidopsis Pex13p (Helle et al, 2013). Here, the authors reported that

Arabidopsis Pex13p can be degraded by the RING E3 Ligase SP1 in vivo. SP1 also

facilitates the ubiquitination and degradation of TOC (translocon at the outer envelope

of chloroplasts) complexes, controlling the import of proteins into chloroplasts

(Knoblach & Rachubinski, 2015). While a role for SP1 in peroxisomes remains

controversial (Huh, 2003; Rabellino et al, 2017), our data would fit a model similar to

the one proposed by Pan et al, which suggests that Pex13p degradation negatively

regulates peroxisomal matrix protein import by downregulating import complexes on

the peroxisomal membrane (Helle et al, 2013). Alternatively, the peroxisomal

ubiquitination machinery may target damaged or incorrectly folded Pex13p for

degradation, in a similar way to the endoplasmic reticulum associated degradation

(ERAD) pathway (Smith et al, 2011). Either way, we predict that Pex13p degradation

will impact on peroxisomal matrix protein import, making it an interesting topic for

further study.

Our data also indicate a role for the cycling receptor Pex5p, the docking protein

Pex14p and the intraperoxisomal protein Pex8p in Pex13p degradation. How these

proteins may be involved in Pex13p degradation is unclear at the current time, although

the involvement of Pex5p and Pex14p could suggest that Pex13p degradation is linked

to PTS1 protein import. Likewise, the effect of deleting PEX8 on Pex13p degradation

could also suggest a link to PTS1 protein import. However, this may stem from a

different reason. Pex13p binds to Pex8p and this interaction was proposed to allow the

docking complex, consisting of Pex13p, Pex14p and Pex17p, to contact the E3 ligase

complex consisting of Pex2p, Pex10p and Pex12p (Agne et al, 2003). Such a model

would suggest that Pex13p and the E3 ligase complex are unable to associate in cells

deleted for PEX8, which may result in a block to Pex13p ubiquitination and hence,

degradation. The increase in Pex13p levels in pex8Δ and pex2Δ cells are comparable

TWO Pex13p degradation in H. polymorpha

56

(Figure 5), which may suggest that deleting PEX2 or PEX8 impacts on the same aspect

of Pex13p degradation, although further data will be required to validate this theory.

Deletion of PEX4 does not impact on Pex13p levels to the same extent as deletion of

a member of the peroxisomal E3 ligase complex (Figure 1). Pex13p degradation appears

completely blocked in pex2Δ cells (Figure 3), which leads us to conclude that Pex13p

degradation is not fully inhibited in cells lacking Pex4p. This could suggest that another

E2 enzyme, together with the peroxisomal E3 ligase complex, promotes Pex13p

ubiquitination and degradation in pex4Δ cells, albeit at an apparently lower level. While

we can only speculate as to the identity of the E2 in this model, the fact that Ubc4p has

been implicated in the ubiquitination and degradation of peroxisomal proteins and can

serve as E2 with the peroxisomal E3 ligase complex (El Magraoui et al, 2013; Platta et

al, 2009; Williams et al, 2008) makes it a possible candidate.

In summary, our results add strong support to the idea that the peroxisomal

ubiquitination machinery is not only required for ubiquitinating Pex5p and members of

the Pex20p family but also targets additional peroxisomal proteins. Indeed, members of

the peroxisomal E3 ligase complex are now linked to the ubiquitination/degradation of

Pex13p (this study), pexophagy induced Pex3p ubiquitination/degradation in H.

polymorpha (Williams & van der Klei, 2013b) and the ubiquitination of PMP70 in

mammals (Knoblach et al, 2013). In addition, Pex4p is required for the degradation of

the peroxisomal matrix proteins ICL and MLS in plants (Lingard et al, 2009), Pex18p

degradation in Saccharomyces cerevisiae (Purdue & Lazarow, 2001) and Pex20p

degradation in Pichia pastoris (Liu & Subramani, 2013) while when in complex with its

membrane anchor Pex22p, Pex4p from both S. cerevisiae and H. polymorpha is able to

produce K48 linked Ub chains in vitro (Kurochkin, 2005; Williams et al, 2012), which

suggests a role for Pex4p in proteasomal mediated degradation. However as with

Pex13p, further evidence that these proteins are bona fide substrates of the peroxisomal

ubiquitination machinery is still required. Nevertheless the results presented here,

together the above mentioned reports, lead us to propose that the peroxisomal

ubiquitination machinery, rather than simply being involved in receptor recycling, in fact

functions as a platform that facilitates the ubiquitination of an array of peroxisomal

proteins, regulating peroxisome biology through the ubiquitination/degradation of

peroxisomal proteins. Therefore, we anticipate that many more substrates of this

machinery remain to be discovered.

Pex13p degradation in H. polymorpha TWO

57

Materials and Methods

Molecular techniques and construction of H. polymorpha strains

Transformation of H. polymorpha was performed by electroporation as described

previously (Faber et al, 1994). H. polymorpha strains used in list study are listed in

Table 1. The plasmids and primers used in this study are listed in Table 2 and 3

respectively. Phusion DNA polymerase (Thermo Scientific) was used to produce gene

fragments.

The E. coli vector for expression of the SH3 domain of Pex13p, complete with

N-terminal His6- tag (pCW360) was made as follows: PCR was performed on H.

polymorpha genomic DNA using the primer combinations P13 SH3 F and P13 SH3 R,

the resulting fragment was digested with NcoI and HindIII and ligated into NcoI-HindIII

digested pETM11.

The H. polymorpha aox strain was made by Gateway cloning (Invitrogen). The

5’fragment of the AOX promoter (AOXp) was amplified with from genomic DNA using

primers attAOXp- 5’ UP and attAOXp- 5’ DN. The 3’fragment of AOXp, complete with

start of the coding region on the AOX gene was amplified with H. polymorpha genomic

DNA and primers att-AOX- 3’ UP and att-AOX- 3’ DN. Each PCR product was used for

the BP reaction to ligate into pENTR to generate pENTR-AOXp and pENTR-3’AOXp.

Plasmids pENTR-AOXp, pENTR-URA, pENTR-3’AOXp and pDEST-R4R3 were used

for LR reaction to generate pDEST-deltaAOX(URA). The product was digested with

PstI and BglII to generate two fragments of 2.3kb and 2.5kb. The 2.3kb fragment was

used for H.polymorpha transformation.

To construct pHIPZ20-mGFP, the PEX13 promoter (PPEX13) was amplified from

WT genomic DNA with primers Pro-P13-NotI-F and Pro-P13-SalI-R, and cloned into

pHIPZ6-Pex3-His6 (Williams & van der Klei, 2013b) replacing the PPEX3-Pex3-His6

fragment between NotI and SalI sites to generate pHIPZ20. mGFP was amplified from

Pex13-mGFP with primers SalI-GFP-F and GFP-XbaI-R and cloned into pHIPZ20

between SalI and XbaI sites. To construct pHIPZ20-Pex13-His6, a Pex13 fragment of

was amplified from WT genomic DNA with primers SalI-P13-F and P13-His6-XbaI-R,

which incorportated a sequence encoding for a C-terminal His6 tag into the DNA

fragment, and cloned into pHIPZ20-mGFP, replacing mGFP between the SalI and XbaI

sites. All plasmids containing PPEX13 were linearized with NheI prior to transformation

into H. polymorpha cells.

The plasmid pHIPH-Pex14-mKate2 was constructed as follows: PCR was

performed on the plasmid pFA6 yomKate2-CaURA3 (Addgene plasmid # 44878) using

primers yomKate2 fw and yomKate2 rev and the resulting mKate2 DNA fragment was

TWO Pex13p degradation in H. polymorpha

58

digested with BglII and SphI and ligated into BglII-SphI digested pSNA12 (Cepinska et

al, 2011), producing pHIPZ-Pex14-mKate2. This vector was linearized with PstI and

transformed into H. polymorpha WT cells. Next, genomic DNA was isolated from WT

Pex14-mKate2 (Zeo) cells and used as template for a PCR reaction using primers

Pex14-F and Pex14-SpeI-R and the DNA fragment was digested with BamHI and XmaI

and ligated into BamHI-XmaI digested pSEM04 (Knoops et al, 2014), producing

pHIPH5-Pex14-mKate2. This vector was then digested with NotI and BamHI to remove

AMO promoter fragment and the product was treated with Klenow fragment to produce

blunt-ends. Following this, the blunt ends were ligated together, forming the plasmid

pHIPH-Pex14-mKate2. pHIPH-Pex14-mKate2 was linearized with Bpu1102I prior to

transformation into H. polymorpha cells.

The pHIPZ-Pex13-mGFP plasmid (Knoops et al, 2014) was linearized with ApaI

prior to transformation into H. polymorpha cells.

All integrations were confirmed by colony PCR using Phire Hot Start II (Thermo

Scientific) and pex2 pHIPZ20-mGFP, pex4 pHIPZ20-mGFP, pex5 pHIPZ20-mGFP,

pex8 pHIPZ20-mGFP, pex14 pHIPZ20-mGFP, Myc-Ub-K48R pHIPZ20-mGFP, WT

pHIPZ20-mGFP and PEX13-His6 were further checked with Southern blotting.

Southern blotting

Southern blotting analysis was performed using the ECL Direct Nucleic Acid Labelling

and Detection system (Thermo Scientific) according to the established methods. H.

polymorpha genomic DNA containing the integrated plasmid PHIPZ20-mGFP was

digested with NdeI (Thermo Scientific) while H. polymorpha genomic DNA containing

the integrated pHIPZ20-Pex13-His6 plasmid was digested with EcoRI (Thermo

Scientific). The probe for PPEX13-mGFP, consisting of a 0.5 kb fragment upstream to

PEX13, was amplified using Pp13GFP-S-ProbeF and Pp13GFP-S-ProbeR. The probe

for Pex13-His6, consisting of a 0.5 kb fragment 1 kb-upstream, was amplified using

primers Sthn-13(R)CSProbF and Sthn-13(R)CSProbR. The probe recognises a 2.5 kb

fragment in pex13Δ cells and an ~8 kb fragment in one-copy mutant cells.

Strains and growth conditions

Yeast transformants were selected on YPD plates containing 2% agar and 100 μg/ml

Zeocin (Invitrogen) or 300 μg/ml Hygromycin (Invitrogen) or on YND plates containing

2% agar, for production of the aox deletion strain. The E. coli strain DH5α was used for

cloning purposes. E. coli cells were grown in LB supplemented with 100 μg/ml

Ampicillin at 37 °C. H. polymorpha cells were grown in batch cultures at 37 °C on

Pex13p degradation in H. polymorpha TWO

59

mineral media supplemented with 0.25% glucose or 0.5% methanol with 0.05% glycerol

as carbon source and 0.25% ammonium sulphate or 0.25% methylamine as nitrogen

source. Leucine, when required, was added to a final concentration of 30 μg/ml.

Cycloheximide (CHX) when used, was added to a final concentration of 6 mg/ml.

Preparation of yeasts TCA lysates

Cell extracts of TCA-treated cells were prepared for SDS-PAGE as detailed previously

(Baerends et al, 2000). Equal amounts of protein were loaded per lane and blots were

probed with rabbit polyclonal antisera raised against the Myc tag (Santa Cruz Biotech,

sc-789), Pex13p (Figure S1), Pex14p (Komori et al, 1997), Pex11p (Knoops et al, 2014)

or pyruvate carboxylase 1 (Pyc1) (Fahimi et al, 1993) or mouse monoclonal antisera

raised against penta-His tag (Qiagen, 34660) or mGFP (Santa Cruz Biotech, sc-9996).

Secondary goat anti-rabbit (31460) or goat anti-mouse (31430) antibodies conjugated to

horseradish peroxidase (Thermo Fisher Scientific) were used for detection. Pyc1 was

used as a loading control. Note that the anti-Pex14p can recognise both the

phosphorylated (upper band) and unphosphorylated (lower band) forms of Pex14p.

Expression and purification of Pex13p SH3 for antibody production

The SH3 domain of H. polymorpha Pex13p with a cleavable His6- tag was produced in

the E. coli strain BL21 (DE3) RIL. Cells were grown at 37°C to an OD600 of 1.0 in

Terrific Broth (TB) medium supplemented with antibiotics, transferred to 20°C and

grown until an OD600 of 1.5. Protein expression was then induced with 0.04mM IPTG

(Invitrogen) for 16 hrs and cells were harvested by centrifugation. E. coli cell pellets

expressing His6-Pex13 SH3 were thawed in lysis buffer (50 mM Tris-HCl pH 7.5, 300

mM NaCl, 10 mM Imidazole, 2 mM β-mercaptoethanol) and passed through a French

press. Cell debris was removed by centrifugation and lysates were loaded onto

glutathione Ni-NTA resin (Fisher Scientific) pre-equilibrated with lysis buffer. The resin

was extensively washed with lysis buffer, wash buffer 1 (50mM Tris,1M NaCl, 20 mM

Imidazole and 1 mM β-mercaptoethanol) and wash buffer 2 (50 mM Tris, 300 mM NaCl,

40 mM Imidazole and 1mM β-mercaptoethanol) and His6-Pex13 SH3 was eluted with

elution buffer (50 mM Tris, 150 mM NaCl, 330 mM imidazole and 1mM

β-mercaptoethanol). Finally, purified His6-Pex13 SH3 was passed over a PD10 column

(GE Healthcare) equilibrated in PD10 buffer (50 mM Tris, 150 mM NaCl and 1mM

β-mercaptoethanol) to remove the imidazole. After confirming presence of the purified

protein using SDS-PAGE, protein samples were sent for antibody production

(Eurogentec). The properties of the resulting anti-Pex13p antibodies are shown in Figure

TWO Pex13p degradation in H. polymorpha

60

S1.

Quantification of Western blots

Blots were scanned by using a densitometer (GS-710; Bio-Rad Laboratories) and

protein levels were quantified using Image Studio Lite Ver5.2 software (LI-COR

Biosciences). In the case of Pex14p blots, both the phosphorylated and

unphosphorylated forms were included in the calculation if both forms were visible. The

value obtained for each band was normalized by dividing it by the value of the

corresponding Pyc band (loading control). For comparison of absolute protein levels

(Figures 1 and 5), normalized values obtained for Pex13p, Pex14p and Pex11p levels in

WT cells were set to 1 and the levels of these proteins in mutant cells are displayed

relative to WT. For CHX experiments (Figures 2 and 3), the normalized values of T0

samples were set to 1.0 and values obtained from the T1-T3 samples are displayed as a

fraction of T0 values. Standard deviations were calculated using Excel. Significance was

determined using IBM SPSS Statistics 23 software (IBM), employing the function

analyse-compare means-independent samples t-test (with Levene test for deviation

homogeneity). * represents P-values < 0.05, ** represents P-values < 0.01 and ***

represents P-values < 0.001. The data presented are derived from three independent

experiments.

Pull-down assay

Cells were grown at 37°C to the mid-exponential growth phase (~8 hrs) in 200 mL

mineral medium containing 0.5% methanol and 0.05% glycerol and fifty OD600 units of

cells of each strain were harvested by centrifugation. Cells were washed once with

demineralized water and resuspended in Equilibrium buffer (50 mM potassium

phosphate buffer pH7.2, 10 mM imidazole, 10 mM iodoacetamide, 5 mM

N-ethymaleimide, 1 mM PMSF added just prior to use, and 2.5 μg/mL leupeptin). The

preparation of crude extracts of yeast cells using glass beads was performed as

previously described (Waterham et al, 1994). Samples of cell homogenates were then

treated for 30 min at room temperature with final concentration of 8 M urea and 1.0%

Triton X-100 (Sigma) to denature proteins and solubilize membranes. Samples were

briefly centrifuged at 4000×g to remove unbroken cells and lysates were incubated with

Ni-NTA resin (QIAGEN) for 60 min at room temperature, with gentle shaking. The

resin was then sequentially washed with Wash buffer 1 (50 mM potassium phosphate

buffer pH7.2, 40 mM imidazole, 6 M urea, 10 mM iodoacetamide, 5 mM

N-ethymaleimide, 1 mM PMSF added just prior to use, and 2.5 μg/mL leupeptin) and

Pex13p degradation in H. polymorpha TWO

61

Wash buffer 2 (50 mM potassium phosphate buffer pH7.2, 40 mM imidazole, 6 M urea,

1.0% Triton X-100, 10 mM iodoacetamide, 5 mM N-ethymaleimide, 1 mM PMSF

added just prior to use, and 2.5 μg/mL leupeptin). The resin was then transferred to new

tube, all liquid was removed with syringe and proteins were eluted with SDS-PAGE

loading buffer (without β-mercaptoethanol) at 37°C for 10 min.

Fluorescence Microscopy

All fluorescence microscopy images were acquired using a 100×1.30 NA Plan-Neofluar

objective (Carl Zeiss). Wide-field microscopy images were captured by an inverted

microscope (Axio Scope A1, Carl Zeiss) using Micro-Manager software and a digital

camera (CoolSNAP HQ2; Photometrics). GFP signal was visualized with a 470/440-nm

band pass excitation filter, a 495-nm dichromatic mirror, and 525/550-nm band pass

emission filter.

For images taken of Pex13-mGFP in WT grown on methanol/glycerol mineral

medium, the optimal settings were mGFP (255, 2500) and mKate2 (219, 3000), and in

pex2, the optimal settings mGFP (255, 7000) and mKate2 (219, 4700) were applied for

processing. The general settings used to compare the signal of Pex13-mGFP in WT and

pex2, mGFP (255, 5000) and mKate2 (219, 4000) were applied for processing.

For quantification of the Pex13-mGFP signal in WT or pex2 cells, a rectangular

area was drawn using the “rectangular tool” from ImageJ (Abramoff et al, 2004) to

envelope the region containing the Pex13-mGFP spot and pixel intensity inside the area

was measured. The measured maximum fluorescence intensity of GFP on peroxisomes

was corrected for the background intensity and a box plot was made using Microsoft

Excel. The box represents values from the 25 percentile to the 75 percentile; the

horizontal line through the box represents the median value. Whiskers indicate

maximum and minimum values. The intensity ratio of mGFP/ mKate was calculated

based on the same cells from Figure 6C. The maximum intensity of Pex13-mGFP was

divided by the corresponding maximum intensity of Pex14-mKate2 in each cell. The

dataset was subjected to the two-tail t-test using Microsoft Excel 2010. * represents

P-values < 0.05, ** represents P-values < 0.01 and *** represents P-values < 0.001.

Acknowledgements

The authors thank Ida van der Klei, Thomas Schroeter, Jessica Kluemper, Wolfgang

Schliebs and Ralf Erdmann for helpful discussions, Arjen Krikken for advice with

processing of fluorescence microscopy images and Jan Kiel for critically reading the

manuscript. This work was funded by a VIDI Fellowship (723.013.004) from the

TWO Pex13p degradation in H. polymorpha

62

Netherlands Organisation for Scientific Research (NWO), awarded to CW.

Conflict of interest

The authors declare no conflict of interest.

Figure S1. Specificity of H. polymorpha Pex13p antibodies.

Western blots of lysates of WT and pex13 cells probed with pre-immune sera (left panel) or

sera isolated from a rabbit immunogenized with the purified SH3 domain of Pex13p (right

panel). * Denotes anti-Pex13p cross reactive species.

Pex13p degradation in H. polymorpha TWO

63

Table 1, H. polymorpha strains used in this study

Strain Description Reference

WT Hp WT (NCYC495), leu1.1 (Gleeson

&

Sudbery,

1988)

Myc-Ub-K48R Hp WT with pRDV2 (hygR), leu1.1 (Williams

& van der

Klei,

2013b)

WT Pex14-mKate2 (Zeo) Hp WT with pHIPZ-Pex14-mKate2

(zeoR)

This study

WT Pex13-mGFP Hp WT with pHIPZ-Pex13-mGFP

(zeoR), leu1.1

This study

Myc-Ub-K48R Pex13-mGFP Hp WT with pRDV2 (hygR) and

pHIPZ-Pex13-mGFP (zeoR), leu1.1

This study

pex2 pex2 disruption strain, leu1.1 (Koek et

al, 2007)

pex10 pex10 disruption strain (Tan et al,

1995)

pex12 pex12 disruption strain, leu1.1 (Koek et

al, 2007)

pex4 pex4 disruption strain, leu1.1 (Van der

Klei et al,

1998)

pex13 pex13 disruption strain, leu1.1 (Koek et

al, 2007)

pex5 pex5 disruption strain, leu1.1 (Van der

Klei et al,

1995)

pex14 pex14 disruption strain, leu1.1 (Komori

et al,

1997)

pex20 pex20 disruption strain, leu1.1 (Otzen et

al, 2005)

TWO Pex13p degradation in H. polymorpha

64

pex7 pex7 disruption strain, leu1.1 (Koek et

al, 2007)

pex8 pex8 disruption strain, leu1.1 (Haan et

al, 2002)

aox Hp NCYC deltaAOX (AOX::URA),

leu1.1

This study

atg1 Hp atg1 deletion strain, leu1.1 (Nakai,

2007)

pex2 Pex13-mGFP+

Pex14-mKate2 (Hyg)

pex2 with pHIPZ-Pex13-mGFP (zeoR)

and pHIPH-Pex14-mKate2 (hygR), leu1.1

This study

pex2 + Pex13-mGFP pex2 with pHIPZ-Pex13-mGFP (zeoR),

leu1.1

This study

WT Pex13-mGFP+

Pex14-mKate2 (Hyg)

WT with pHIPZ-Pex13-mGFP (zeoR)

and pHIPH-Pex14-mKate2 (hygR), leu1.1

This study

WT + Pex13-mGFP WT with pHIPZ-Pex13-mGFP (zeoR),

leu1.1

This study

pex2 PPEX13 mGFP Δpex2 with pHIPZ20 mGFP (zeoR),

leu1.1

This study

pex4 PPEX13 mGFP Δpex4 with pHIPZ20 mGFP (zeoR),

leu1.1

This study

pex5 PPEX13 mGFP Δpex5 with pHIPZ20 mGFP (zeoR),

leu1.1

This study

pex8 PPEX13 mGFP Δpex8 with pHIPZ20 mGFP (zeoR),

leu1.1

This study

pex14 PPEX13 mGFP Δpex14 with pHIPZ20-mGFP (zeoR),

leu1.1

This study

Myc-Ub-K48R PPEX13 mGFP Myc-Ub-K48R with pHIPZ20-mGFP

(zeoR , leu1.1

This study

WT PPEX13 mGFP WT with pHIPZ20-mGFP (zeoR), leu1.1 This study

Pex13-His WT with pHIPZ20-Pex13-His6 (zeoR),

leu1.1

This study

Pex13-His/Myc-Ub pex13 with pHIPZ20-Pex13-His6 (zeoR)

and pRDV1 (hygR), leu1.1

This study

pex2/Myc-Ub pex2 with pRDV1 (hygR), leu1.1 This study

pex2/Pex13-His pex2 with pHIPZ20-Pex13-His6 (zeoR),

leu1.1

This study

Pex13p degradation in H. polymorpha TWO

65

pex2/Pex13-His/Myc-Ub pex2 with pHIPZ20-Pex13-His6 (zeoR)

and pRDV1 (hygR), leu1.1

This study

Table 2, plasmids used in this study

Plasmid Description Reference

pETM11 N-terminal His6 tag, kanR EMBL

collection#

pCW360 Pex13-SH3 domain with N-terminal His6 tag

for E. coli expression, kanR

This study

pRDV1 Myc tagged ubiquitin under control of

DHAS promoter, zeoR

; ampR

(Williams &

van der Klei,

2013b)

pRDV2 Myc tagged ubiquitin mutate (Ub-K48R)

under control of DHAS promoter, zeoR

;

ampR

(Williams &

van der Klei,

2013b)

pHIPZ6-Pex3-His6 Pex3-His6 under control of its endogenous

promoter, zeoR

(Williams &

van der Klei,

2013b)

pHIPZ-Pex13-mGFP C-terminal part of Pex13 fused with mGFP,

zeoR

; ampR

(Knoops et

al, 2014)

pSNA12 C-terminal part of Pex14 fused with mGFP,

zeoR

; ampR

(Cepinska et

al, 2011)

pHIPZ-Pex14-mKate2 Plasmid containing the C-terminal region of

H. polymorpha PEX14 fused to mKate2;

hygR

; ampR

This study

pSEM04 Plasmid containing PEX3 under control of

the AMO promoter, hygR, amp

R

(Knoops et

al, 2014)

pHIPH5-Pex14-mKate2 Plasmid containing the full length H.

polymorpha PEX14 fused to mKate2, under

control of the AMO promotor, hygR

; ampR

This study

pHIPH-Pex14-mKate2 Plasmid containing the C-terminal region of

H. polymorpha PEX14 fused to mKate2;

hygR

; ampR

This study

pDEST-deltaAOX(URA) pDEST vector containing URA fragment This study

TWO Pex13p degradation in H. polymorpha

66

with regions homologous to 5’ and 3’

regions of AOX gene, ampR

pHIPZ20 Plasmid containing PEX13 endogenous

promoter, zeoR

; ampR

This study

pHIPZ20-mGFP mGFP under control of PEX13 promoter,

zeoR

; ampR

This study

pHIPZ20-Pex13-His6 Pex13 fused to a 6*His tag at its C-terminus,

under control of PEX13 promoter, zeoR

;

ampR

This study

#https://www.embl.de/pepcore/pepcore_services/cloning/choice_vector/ecoli/embl/popu

p_emblvectors/

Table 3, primers used in this study

Primer Sequence Description

P13 SH3 F GCGCCCATGGAGTTTGCGC

GGGCGCTATC

To clone the Pex13 SH3 domain,

forward primer

P13 SH3 R CGCGAAGCTTTAGATCAAT

AGCTTTTGATCTTTCTTG

To clone the Pex13 SH3 domain,

reverse primer

SalI-P13-F ACGCGTCGACATGACTACA

CCACGTCCAAAG

To clone the Pex13 gene,

forward primer

P13-His6-XbaI-R CTAGTCTAGATCAGTGATG

GTGATGGTGATGGATCAAA

AGCTTTTGATCTTTCTTG

To clone the Pex13 gene with

His6 tag, reverse primer, used to

make construct

pHIPZ20-Pex13-His6

Sthn-13(R)CSPro

bF

CAACAACGAATCTAGATTC

AAGAC

To clone the probe for Pex13-His

Southern blotting, forward

primer

Sthn-13(R)CSPro

bR

TCGTTACCTGTGATGCTACA

G

To clone the probe for Pex13-His

Southern blotting, reverse primer

attAOXp-5’ UP GGGGACAACTTTGTATAGA

AAAGTTGTCTGCAGCCGCA

ACCGAACTTTTCGC

To clone the 5’ fragment of AOX

promoter, forward primer, used

to make aox

attAOXp- 5’ DN GGGGACTGCTTTTTTGTACA

AACTTGGATTGATGTCACC

To clone the 5’ fragment of AOX

promoter, reverse primer, used to

Pex13p degradation in H. polymorpha TWO

67

ACCGTGCACTGGC make aox

attAOXp- 3’ UP GGGGACAGCTTTCTTGTAC

AAAGTGGTTCCACGTGACC

TCCAACCAAGTCC

To clone the 3’ fragment of AOX

promoter and N-terminal,

forward primer, used to make

aox

attAOXp- 3’ DN GGGGACAACTTTGTATAAT

AAAGTTGTTAGAATCTGGC

AAGTCCGGTCTCC

To clone the 3’ fragment of AOX

promoter and N-terminal, reverse

primer, used to make aox

Pro-P13-NotI-F ATAAGAATGCGGCCGCGCT

TAAATTTTCAAAGCTCCAA

G

To clone the Pex13 endogenous

promoter, forward primer

Pro-P13-SalI-R ACGCGTCGACGGAAGAACG

ATTTTCTTGTTTTTTTTC

To clone the Pex13 endogenous

promoter, reverse primer, used to

make construct pHIPZ20-mGFP

SalI-GFP-F ACGCGTCGACATGGTGAGC

AAGGGCG

To clone the mGFP fragment

with start codon, forward primer

GFP-XbaI-R CTAGTCTAGATCACTTGTAC

AGCTCGTCCATG

To clone the mGFP fragment

with stop codon, reverse primer

yomKate2 fw CGCAGATCTATGGTTTCTGA

ACTCATCAAG

To clone mKate2 fragment,

forward primer

yomKate2 rev CTAAGTTGGGACACAGATA

AGCATGCCGC

To clone mKate2 fragment,

reverse primer

Pp13GFP-S-Probe

F

TCAAGCAGTTCTTCTGTAGC

ATC

To clone the probe for

PPEX13-mGFP Southern blotting,

forward primer

Pp13GFP-S-Probe

R

GTCTTGAGCAGCGGTCTC To clone the probe for

PPEX13-mGFP Southern blotting,

reverse primer

Pex14-F GTCCTTCATATCGTACAGG

ATCCATGTCTCAACAGCCA

GCAACGACC

To clone the Pex14-mKate2,

forward primer, used to make

construct

pHIPH5-Pex14-mKate2

Pex14-SpeI-R GAAGGCTGGATGTCCAGGC

CCGGGTTACCGGTGTCCCA

ACTTAGATGGCAAATCACA

G

To clone the Pex14-mKate2,

reverse primer, used to make

construct

pHIPH5-Pex14-mKate2

68

3

Chapter 3

Further insights into Pex13p degradation in the yeast Hansenula polymorpha

Xin Chen and Chris Williams

Author contributions

CW supervised the project. CW and XC conceived the project and designed the

experiments. XC and CW analysed the data. XC performed biochemical and FM

experiments. XC and CW wrote the manuscript.

THREE Further insights into Pex13p degradation

70

Further insights into Pex13p degradation in the yeast Hansenula polymorpha

Xin Chen1 and Chris Williams

1,*

1Cell Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute,

University of Groningen, 9747AG, the Netherlands

Abstract

The peroxisomal membrane protein Pex13p is required for the import of matrix proteins

into peroxisomes. Previously we reported that Pex13p in the yeast Hansenula

polymorpha undergoes rapid degradation. Furthermore, H. polymorpha Pex13p is

ubiquitinated and degraded in a process that requires the peroxisomal E3 ligase Pex2p.

However, the underlying reason why Pex13p undergoes degradation remained unknown.

Therefore, we sought to shed light on the function of Pex13p degradation in H.

polymorpha. In this study, we demonstrate that Pex2p-dependent turnover of Pex13p

also occurs under peroxisome non-inducing condition, demonstrating that Pex13p

degradation is a general and not a media-specific event. Furthermore, we show that

blocking the recycling of the type 1 peroxisomal matrix protein receptor Pex5p led to

increased Pex13p levels, suggesting Pex5p recycling is linked to Pex13p degradation.

Additionally, we identify a Pex13p mutant that is inhibited in degradation. We

demonstrate that inhibiting Pex13p degradation can impact negatively on the ability of

cells to grow on methanol-containing media. Based on our results, we discuss possible

functions of Pex13p degradation in relation to peroxisomal matrix protein import.

Keywords: Peroxisome/ protein degradation/ Hansenula polymorpha/ PMP/ Pex13p

Further insights into Pex13p degradation THREE

71

Introduction

The peroxisome is a single membrane bounded compartment present in the cytoplasm of

nearly all eukaryotes that plays an essential role in cellular metabolism (Gabaldon,

2010). Many metabolic processes can be found in peroxisomes, depending on organism

and cell type. A few examples include the decomposition of fatty acids in mammalian

cells and the yeast Saccharomyces cerevisiae (Lazarow, 1978; Van Roermund et al,

1998), the biosynthesis of plasmalogens in mammalian cells (Zoeller et al, 1992), the

reduction of reactive oxygen species, especially hydrogen peroxide (Bonekamp et al,

2009; Wanders & Waterham, 2006), the synthesis of penicillin in the fungus Penicillium

chrysogenum (Kiel et al, 2005c) and the oxidation of methanol in the yeast Hansenula

polymorpha (Van Dijken et al, 1975). However, there are many more. Dysfunctional

peroxisomes are known to cause a spectrum of physiological, often fatal disorders in

humans (Waterham et al, 2016), demonstrating their importance in cellular metabolism.

The soluble proteins inside the peroxisomal matrix, most often enzymes, determine

the function of the peroxisome. All peroxisomal matrix proteins are made in the cytosol

and imported post-translationally, through the aid of a peroxisomal targeting signal (PTS)

(Hasan, 2013). A minor portion of matrix proteins contain an N-terminal PTS2 signal

(Lazarow, 2006) whereas most peroxisomal matrix proteins harbour a PTS1 signal at the

C-terminus of the protein (Miura et al, 1992). Each PTS requires a separate receptor that

binds to the PTS and transports the PTS-containing cargo protein to the peroxisome. For

PTS1 containing proteins Pex5p acts as receptor whereas PTS2-containing proteins

require a protein complex, consisting of the cargo-binding protein Pex7p and a

co-receptor protein, which in yeast is a member of the Pex20p family and in mammalian

cells is an isoform of Pex5p (Dodt & Gould, 1996; Sichting et al, 2003). After binding

the cargo in the cytosol, the receptors transport the cargo to the peroxisomal membrane,

where they come into contact with the docking complex, consisting of Pex14p, Pex13p

and, in yeast, Pex17p (Hasan, 2013; Johnson et al, 2001; Snyder et al, 1999). Next, the

cargo is translocated into the peroxisomal matrix in a process that is not well understood

but one that likely requires the action of the intra-peroxisomal protein Pex8p (Agne et al,

2003; Rehling et al, 2000a). Finally, the receptors are ubiquitinated and recycled to the

cytosol by the AAA-ATPases Pex1p and Pex6p (Platta et al, 2008).

Ubiquitination is a post-translational modification involving the attachment of

ubiquitin, a 76-amino acid globular protein, to a substrate protein (Hershko, 1996).

Ubiquitination occurs in three steps; first ubiquitin is activated by the ubiquitin

activating enzyme (E1) with the consumption of ATP. Next, ubiquitin is transferred to a

ubiquitin-conjugating enzyme (E2) and finally, with the help of either a HECT ubiquitin

THREE Further insights into Pex13p degradation

72

ligase (HECT E3), which conjugates ubiquitin in much the same way as an E2, or a

RING E3, which functions as a bridge between E2 and the substrate, the ubiquitin is

conjugated to the substrate (Scheffner et al, 1995). The number of E1, E2 and E3

enzymes varies from organism to organism but a pyramidal structure is common, with a

single E1, tens of E2s and up to a hundred or more E3s (Hershko & Ciechanover, 1998).

Protein ubiquitination serves many functions and the particular function often depends

on the number of ubiquitin molecules attached to a substrate (Sadowski et al, 2012). The

attachment of a chain of ubiquitin molecules to a substrate, referred to as

poly-ubiquitination, often targets substrates for degradation by the proteasome whereas

the attachment of one or two ubiquitin molecules, often called mono-ubiquitination, is

usually for non-proteolytic functions (Polo et al, 2002; Yau & Rape, 2016).

The receptor protein Pex5p can be ubiquitinated in two ways, resulting in different

outcomes. Pex5p can be mono-ubiquitinated on a conserved cysteine close to the

N-terminus or poly-ubiquitinated on lysine residues downstream of the cysteine (Kiel et

al, 2005b; Platta et al, 2004; Williams et al, 2007). Pex5p mono-ubiquitination requires

the E2 Pex4p and the peroxisomal E3 ligase complex, consisting of the RING E3s

Pex2p, Pex10p, Pex12p and plays a role in Pex5p recycling (Grou et al, 2009; Platta et

al, 2007; Williams et al, 2007). On the other hand, Pex5p poly-ubiquitination is

performed by the E2 Ubc4p, together with the peroxisomal E3 ligase complex, resulting

in the degradation of Pex5p via the proteasome (Kiel et al, 2005a; Platta et al, 2004).

In all organisms to date, the PMP Pex13p was shown to play an essential role in the

import of matrix proteins containing either a PTS1 or a PTS2 because cells depleted of

Pex13p exhibit a matrix protein import defect (Cross et al, 2016; Toyama et al, 1999;

Williams & Distel, 2006). Pex13p is a member of the docking complex at the

peroxisomal membrane. The docking complex is composed of Pex14p and Pex13p (and

Pex17p in yeast, see below) and its function is to allow the cytosolic receptor proteins

carrying cargo to associate with the peroxisomal membrane (Hasan, 2013; Johnson et al,

2001; Snyder et al, 1999), although it is believed to also play a role in the cargo

translocation step (Girzalsky et al, 2010). Pex13p was the first PMP identified as

“docking factor” for the cycling receptors (Elgersma et al, 1996; Erdmann & Blobel,

1996; Gould et al, 1996). However, later data raised questions as to whether this simple

description was sufficient. The Pex5p-Pex14p interaction appears stronger in the

presence of a PTS1 cargo bound to Pex5p, whereas the Pex5p-Pex13p interaction

appears stronger in the absence of cargo (Otera et al, 2002; Urquhart et al, 2000).

Furthermore, the peroxisomal docking complex in yeast, in addition to Pex13p and

Pex14p, contains a third identified component, Pex17p (Snyder et al, 1999). Pex17p

Further insights into Pex13p degradation THREE

73

directly binds to Pex14p and, based on immunoprecipitation experiments, Pex14p and

Pex17p coprecipitate with both PTS receptors in the absence of Pex13p (Huhse et al,

1998). All these data have led to the conclusion that Pex14p is the first “point of

contact” at the peroxisomal membrane for the cargo-bound receptors and that Pex13p is

involved in the cargo translocation or receptor recycling steps of matrix protein import.

Nevertheless, further information on this is lacking (Williams & Distel, 2006). Recently,

it was reported that Pex13p is required for selective autophagy of Sindbis virus particles

(virophagy) and of damaged mitochondria (mitophagy) in mammalian cells but whether

this is linked to its role in peroxisomal matrix protein import or if it is a general function

of Pex13p is not known (Lassen & Xavier, 2018; Lee et al, 2017; Rahim et al, 2016).

Previously we demonstrated that H. polymorpha Pex13p is degraded via the

ubiquitin-proteasome system (UPS) in a Pex2p dependent manner (Chen et al, 2018).

However, the underlying reason why Pex13p undergoes rapid degradation remained

unknown. Therefore, we sought to shed further light on Pex13p degradation in H.

polymorpha. We demonstrate that Pex13p degradation is a general, rather than media

specific process and we provide evidence that links Pex5p recycling to Pex13p

degradation. In addition, we identify a Pex13p mutant that displays a reduced turnover

and elevated protein levels and, using this mutant, we demonstrate that inhibition of

Pex13p degradation can impact negatively on the ability of cells to grow on

methanol-containing media. Finally, we provide evidence that Pex14p levels play a

determining role in the degradation of Pex13p. We discuss our results in the context of

Pex13p and peroxisome function.

THREE Further insights into Pex13p degradation

74

Results

Pex13p has a relatively short half-life on glucose

Previously, we demonstrated that Pex13p undergoes rapid UPS-mediated degradation in

H. polymorpha cells grown on methanol, conditions which require peroxisome function

for growth (Chen et al, 2018). To determine whether Pex13p degradation is a methanol

specific or more general occurrence, we investigated Pex13p degradation in cells grown

on glucose, a condition where peroxisome function is not required for growth. We used

strains expressing Pex13p tagged with mGFP (Pex13-mGFP), to allow us to assess both

the degradation (with western blotting) and subcellular localization (with fluorescence

microscopy) of Pex13p. As with wild type (WT) Pex13p, Pex13-mGFP also undergoes

UPS-mediated degradation (Chen et al, 2018). To determine whether Pex13-mGFP is

actively degraded in cells grown on glucose, we assessed the stability of Pex13-mGFP in

both WT and pex2 (deletion of a ubiquitin ligase E3 PEX2) cells treated with

Cycloheximide (CHX). CHX is a ribosome inhibitor that blocks protein production and

then protein degradation in CHX-treated cells can be followed using western blotting.

We observed that Pex13-mGFP is actively degraded in WT cells grown on glucose, but

not in pex2 cells, establishing that Pex13-mGFP degradation occurs on glucose and

requires a functional peroxisomal E3 ligase complex (Fig. 1A-D). Furthermore,

Pex13-mGFP levels are elevated in pex2 and pex4 (Pex4p is a peroxisome-associated E2)

cells grown on glucose, relative to WT cells (Fig. 2A & B), similar to the results we

obtained with methanol-grown cells (Chen et al, 2018). Finally, we investigated where

Pex13-mGFP builds up in glucose-grown cells, when its degradation is inhibited.

According to our fluorescence microscopy images, Pex13-mGFP co-localizes with

Pex14-mKate2 (used here as marker for peroxisomes) in both WT and pex2 cells and

accumulates at the peroxisomal membrane in pex2 cells (Fig. 2C & D). Additionally,

pex2 cells displayed an increase in GFP intensity (Fig. 2E) as well as an increased

mGFP/mKate2 intensity ratio (Fig. 2F) compared to WT cells. These data demonstrate

that Pex2p-dependent Pex13p degradation occurs on glucose, establishing that it is a

general, rather than a methanol-specific process.

Pex13p degradation is linked to the recycling of Pex5p

Our previous data indicated that Pex13p degradation was inhibited in cells lacking

Pex5p, the PTS1 protein import receptor, but not in cells lacking Pex7p or Pex20p, the

PTS2 (co-)import receptors (Chen et al, 2018). This, coupled with the observation that

Pex13p degradation is a general process (see above), led us to suspect that Pex13p

degradation could be involved in the import of PTS1 proteins. Originally Pex13p was

Further insights into Pex13p degradation THREE

75

described as a docking factor for the cycling receptors (Elgersma et al, 1996; Erdmann

& Blobel, 1996; Gould et al, 1996). However, later reports demonstrated that Pex13p

binds more strongly to Pex5p when not in complex with a PTS1 cargo protein, whereas

the Pex5p-Pex14p interaction is enhanced when Pex5p is bound to a PTS1 protein

(Otera et al, 2002; Urquhart et al, 2000). In addition, Pex13p binds to Pex8p (Deckers et

al, 2010) and this interaction allows the docking complex, consisting of Pex13p, Pex14p

and Pex17p, to contact the peroxisomal E3 ligase complex, which is required for

receptor ubiquitination and the following recycling (Agne et al, 2003). Together, these

data suggest that Pex13p could play a role in Pex5p recycling. Therefore, we

investigated the link between Pex5p recycling and Pex13p degradation.

The recycling of Pex5p from the peroxisomal membrane requires Pex5p to be

mono-ubiquitinated by the E2 Pex4p on a conserved cysteine residue close to its

N-terminus (Grou et al, 2008; Platta et al, 2007; Williams et al, 2007). In cases where

Pex5p mono-ubiquitination in inhibited (through mutation of the conserved cysteine or

deletion of PEX4), Pex5p is poly-ubiquitinated on lysine residues in its N-terminal

region by the E2 Ubc4p and subsequently degraded via the proteasome (Kiel et al,

2005b; Williams et al, 2007). Inhibition of both Pex4p- and Ubc4p-dependent

ubiquitination causes a block in both Pex5p recycling and Pex5p degradation and

consequently a build-up of Pex5p on the peroxisomal membrane (Platta et al, 2008;

Platta et al, 2007). In H. polymorpha, the conserved residues are Cys-9 and Lys-21 (Kiel

et al, 2005b). To investigate the link between Pex5p recycling and Pex13p degradation,

we assessed the levels of Pex13p in cells expressing Pex5p point mutants blocking

either Pex5p recycling (Pex5-C9S), Pex5p degradation (Pex5-K21R) or both

(Pex5-C9S.K21R). In Pex5-K21R, the degradation is inhibited while the recycling is

still functional, and Pex5p level in this mutant is comparable to WT. As can be seen

from Fig 3, inhibition of Pex5p recycling results in increased Pex13p levels, an effect

that was enhanced when Pex5-C9S degradation was additionally blocked by the K21R

mutation (Fig. 3A,B). It is worthy to note here that Pex13p levels appear elevated in

pex5 cells, where no Pex5p is present and in Pex5-C9S.K21R cells, where Pex5p levels

are enhanced (see Fig. 3). Because of this apparent contradiction, we assessed Pex13p

levels in pex4 cells expressing Pex5-K21R. Both the Pex4p- and the Ubc4p-dependent

ubiquitination of Pex5p is inhibited in these cells, similar to in Pex5-C9S.K21R cells.

We observed that Pex13p levels were also elevated in pex4 cells expressing Pex5-K21R

(Fig. 3), validating the results obtained with Pex5-C9S.K21R cells. Together, our data

suggest that Pex13p degradation is functionally linked to Pex5p recycling.

THREE Further insights into Pex13p degradation

76

The PEST sequence in Pex13p is not required for its degradation

Pex13p is constitutively degraded in cells grown on glucose and on methanol containing

media while Pex14p, a Pex13p binding partner and fellow member of the docking

complex, is relatively stable under these conditions (see Fig. 1 and (Chen et al, 2018)).

This demonstrates that the levels of these two proteins are regulated differently and

could indicate that Pex13p contains a “degron” encoded in its sequence (Bachmair &

Varshavsky, 1989; Varshavsky, 1997). Such sequences facilitate protein degradation and

one well-studied degron is the PEST sequence. A PEST sequence is an unstructured

region in a protein rich in proline (P), glutamate (E), serine (S) and threonine (T)

residues that targets the protein for degradation (Rogers et al, 1986).

Analysing the H. polymorpha Pex13p sequence, we found a putative PEST

sequence in proximity to the N-terminus, based on the prediction program epestfind

(http://emboss.bioinformatics.nl/cgi-bin/emboss/epestfind), with a score of 13.1 (Fig.

4A). A score above 5 is considered significant. To investigate whether the putative PEST

sequence in Pex13p is involved in its degradation, we constructed a strain expressing

Pex13p deleted for the PEST sequence (Δpest), under control of its endogenous

promoter. Because we do not know which epitopes in Pex13p are recognized by our

Pex13p antibody, we also added a C-terminal His6 tag and followed the degradation of

WT and Δpest Pex13p using anti-His antibodies. We followed WT and Δpest

Pex13-His6 levels over-time in CHX treated cells grown on methanol media containing

(Fig. 4B-E). However, the removal of the putative PEST sequence in Pex13p did not

inhibit Pex13p turnover, suggesting that it is not involved in Pex13p degradation.

Further insights into Pex13p degradation THREE

77

Fig. 1 Pex13-mGFP degradation occurs in H. polymorpha cells grown on glucose.

A WT cells expressing Pex13-mGFP were grown on glucose media for 4 hrs and treated

with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the indicated

time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and immunoblotting

with antibodies against mGFP, Pex14p and Pyc.

B Representative western blots of pex2 cells expressing Pex13-mGFP derived from cells

grown and treated as in A. Samples were probed with SDS-PAGE and immunoblotting

with antibodies against mGFP, Pex14p and Pyc.

C Quantification of Pex13-mGFP levels in WT and pex2 cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control Pyc at the corresponding time

point. Protein levels at T0 were set to 1. Values represent the mean ± SD of three

THREE Further insights into Pex13p degradation

78

independent experiments. The asterisks denotes statistically significant differences in

protein levels compared to those in WT samples (*P < 0.05, **P < 0.01).

D Quantification of Pex14p levels in WT and pex2 cells expressing Pex13-mGFP. Protein

levels were normalized to Pyc at the corresponding time point. Protein levels at T0 were

set to 1. Values represent the mean ± SD of three independent experiments.

Further insights into Pex13p degradation THREE

79

Fig. 2 Pex13-mGFP accumulates on peroxisomes in H. polymorpha pex2 cells grown

on glucose.

A WT and pex2 cells producing Pex13-mGFP were grown on glucose media and TCA

samples were taken when the cultures reached an OD600 of 1.0. Samples were subjected

to SDS-PAGE and immunoblotting using antibodies against mGFP, Pex14p and Pyc.

B Quantification of protein levels in WT and mutant cells, normalized to the loading

control Pyc. Protein levels in WT cells were set to 1. Values represent the mean ± SD of

three independent experiments. An Asterisks denotes statistically significant increases in

protein levels compared to those in WT samples (*P < 0.05, **P < 0.01).

C WT and pex2 cells producing Pex13-mGFP and Pex14-mKate2 were grown on glucose

media to an OD600 of 1.0 and fluorescence microscopy images were taken. Images of

Pex13-mGFP were processed using ImageJ with optimal settings to show signals in WT

and pex2 cells. Pex14-mKate2 was used as peroxisomal membrane marker. The

following settings were used: for WT cells mGFP (255, 800) and mKate2 (219, 1200);

for pex2 cells mGFP (255, 3000) and mKate2 (219, 2200). Scale bar: 5μm.

D Fluorescence images of Pex13-mGFP in WT or pex2 cells shown in (A) were processed

using ImageJ with the same settings: mGFP (255, 2000), mKate2 (219, 1700). Scale bar:

5μm.

E Box plot showing quantification of mGFP and mKate2 fluorescence intensity at the

peroxisomal membrane in WT and pex2 cells producing Pex13-mGFP and

Pex14-mKate2. Fluorescence intensities (auxiliary units) were measured using ImageJ.

The box represents values from the 25 percentile to the 75 percentile; the horizontal line

through the box represents the median value. Whiskers indicate maximum and minimum

values. mGFP and mKate2 measurements were taken as described in the Materials and

Methods section.

F Average ratio ± SD of mGFP to mKate intensities in 40 WT and pex2 cells. *P<0.1, **P

< 0.01.

THREE Further insights into Pex13p degradation

80

Fig. 3 Pex13p degradation is linked to the recycling of Pex5p.

A Representative western blots of samples derived from WT and mutant cells grown for 14

hrs on methanol/glycerol media. Blots were probed with antibodies directed against

Pex5p, Pex13p, Pex14p, Pex11p and Pyc. * Denotes anti-Pex13p cross reactive species.

B Quantification of protein levels in WT and mutant cells, normalized to the loading

control Pyc at the corresponding time point. Protein levels in WT cells were set to 1.

Values represent the mean ± SD of three independent experiments. Asterisks denote

statistically significant increases in protein levels compared to those in WT samples (*P

< 0.05, **P < 0.01, ***P < 0.001).

Further insights into Pex13p degradation THREE

81

The N-terminus and lysine residues are involved in Pex13p degradation

Because deletion of the putative PEST sequence in Pex13p did not impact on Pex13p

turnover (see Fig. 4), we sought an alternative method to inhibit Pex13p degradation, to

investigate the role of Pex13p degradation in matrix protein import. Previously we

reported that Pex13p is ubiquitinated (Chen et al, 2018) and because protein

ubiquitination usually occurs on NH2 groups in the protein (Chau et al, 1989;

Ciechanover & Ben-Saadon, 2004), our strategy was to block NH2 groups in Pex13p. To

achieve this, we developed several Pex13p constructs in which the NH2 groups were

blocked. One construct had all lysines replaced by arginine residues (Pex13-KR).

Another construct contained the amino acids serine and glutamic acid directly after the

start codon (Pex13-NT), which was predicted to result in the acetylation of the

N-terminal NH2 group and therefore block ubiquitin attachment (Kiemer et al, 2004;

Perrot et al, 2008). The final construct was the combination of the previous two, with

both lysine residues and the N-terminal NH2 group blocked (Pex13-KRNT). Similar to

our Pex13 Δpest construct, all NH2 blocking constructs contained a His6 tag, either at

the N-terminal (Pex13-NT, Pex13-KRNT) or C-terminal (Pex13, Pex13-KR) and protein

levels were probed using anti-His6 antibodies, to rule out any potential differences in the

way in which the Pex13p antibodies may recognize the different versions of Pex13p.

Our data demonstrate that Pex13-His6 levels were comparable in cells expressing

Pex13-KR, Pex13-NT and WT forms of Pex13-His6 grown on methanol containing

media (Fig. 5A & B), suggesting that blocking the N-terminus or lysine residues was

insufficient to inhibit Pex13p degradation. However, Pex13-His6 levels were

dramatically elevated in cells expressing Pex13p-KRNT grown under the same

conditions (Fig. 5A & B). To assess whether the increased levels of Pex13-KRNT stem

from an inhibition in degradation, we followed Pex13-KRNT turnover in CHX treated

cells, observing that Pex13-KRNT degradation was indeed slower than that of the WT

protein (Fig. 6), although we note that degradation was not completely blocked. Taken

together, our data demonstrate that blocking NH2 groups in Pex13p inhibit its rapid

degradation.

THREE Further insights into Pex13p degradation

82

Fig. 4 Pex13p degradation is not inhibited in H. polymorpha Pex13 (Δpest) cells.

A Schematic diagram of H. polymorpha Pex13p, showing the position of the putative

PEST sequence (DNNA TTST DNSS APPE LPT). TM depicts transmembrane domains

while SH3 depicts the SH3 domain in Pex13p.

Further insights into Pex13p degradation THREE

83

B WT cells expressing Pex13-His6 were grown on methanol/glycerol media for 12 hrs and

treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against His6-tag, Pex14p, Pex11p and Pyc.

C Representative western blots of samples from Pex13-His6(Δpest) cells grown and

treated as in A. Samples were probed with SDS-PAGE and immunoblotting with

antibodies against His6-tag, Pex11p and Pyc.

D Quantification of Pex13-His6 levels in WT and Pex13 (Δpest) cells. Protein levels were

normalized to the loading control Pyc at the corresponding time point. Protein levels at

T0 were set to 1. Values represent the mean ± SD of three independent experiments.

E Quantification of Pex14p and Pex11p levels in WT and Pex13 (Δpest) cells. Protein

levels were normalized to Pyc at the corresponding time point. Protein levels at T0 were

set to 1. Values represent the mean ± SD of three independent experiments.

Fig. 5 Blocking NH2 groups in Pex13p results in enhanced protein levels.

A Representative western blots of samples derived from WT and mutant cells grown for 16

hrs on methanol/glycerol media. Blots were probed with antibodies directed against the

His6-tag, Pex14p, Pex11p and Pyc.

B Quantification of protein in WT and mutant cells, normalized to the loading control Pyc

at the corresponding time point. Protein levels in WT cells were set to 1. Values

represent the mean ± SD of three independent experiments. An asterisks denotes

THREE Further insights into Pex13p degradation

84

statistically significant increases in protein levels compared to those in WT samples

(**P < 0.01).

Inhibiting Pex13p degradation reduces cell growth on methanol containing media

To investigate whether inhibiting Pex13p degradation affected the function of the

protein, we assessed the ability of cells expressing Pex13-KRNT to grow on methanol

containing media. Note that all versions of Pex13p used in these growth assays

contained a His6-tag, allowing direct comparisons. Growth was assessed by measuring

the optical density at 600nm (OD600) of cultures grown on methanol media and

methanol/ glycerol media after 16 hours. Cells expressing Pex13-KRNT, under control

of the endogenous PEX13 promoter, did not display a growth defect when grown on

media containing methanol as sole carbon source (Fig. 7A). Both strains also grew

comparably well on methanol media containing glycerol (Fig. 7A). At first glance, these

data could suggest that inhibiting Pex13p degradation does not affect peroxisome

function. However, we suspected that overproduction of Pex13-KRNT may prove more

successful for two reasons: (1) we noted that Pex13p degradation was reduced but not

completely abolished by the KRNT mutations (Fig. 6A-C) and (2) we deemed it

possible that the amount of Pex13p in cells expressing Pex13-KRNT under control of

the PEX13 promoter may not have reached a critical point. Therefore, we made

constructs in which His6-tagged Pex13 or Pex13-KRNT was under control of the strong

AOX promoter and we assessed the growth of these cells on methanol and methanol/

glycerol media. Our data indicate that overproduction of WT Pex13-His6 reduces the

ability of cells to grow on both types of media (Fig. 7A), an observation that is

consistent with previous work in S. cerevisiae (Bottger et al, 2000). However, we also

observed that the growth of cells overproducing Pex13-KRNT was consistently poorer

than that of cells overproducing WT Pex13-His6 (Fig 7A). Western blotting analysis

confirmed that Pex13-His was overproduced in both strains (Fig. 7B). To investigate

further the effect of overproducing Pex13-His6 on cell growth, we performed growth

curve experiments (Fig. 7C & D), confirming that cells overproducing Pex13-KRNT

display a slower growth rate than those overproducing WT Pex13-His6.

Pex13p degradation exhibits a synergistic relationship with Pex14p levels

Overproduction of either Pex13p or Pex14p inhibits peroxisome function in both S.

cerevisiae (Bottger et al, 2000) and H. polymorpha (Fig. 7 and (Komori et al, 1997))

whereas co-overproduction of Pex13p and Pex14p in S. cerevisiae does not (Bottger et

Further insights into Pex13p degradation THREE

85

al, 2000), indicating that the balance between Pex13p and Pex14p levels are important

for peroxisome function. However, we observed that Pex14p levels are largely

unaffected by either deletion or overexpression of PEX13 (Fig. 3 and (Chen et al, 2018)),

whereas Pex13p levels are increased in cells deleted for PEX14 (Fig. 3 and (Chen et al,

2018)). Taken together, these data could suggest that the level of Pex13p depends on that

of Pex14p, rather than vice versa. In this assumption, the degradation of Pex13p would

undergo a correlative change in cells overproducing Pex14p. Therefore, we determined

Pex13p levels in cells expressing Pex14p under control of AMO promoter grown on

methanol/ glycerol media. Pex13p levels were increased in cells overproducing Pex14p

(Fig. 8), suggesting that Pex13p degradation is reduced in these cells and that Pex13p

degradation is dependent on Pex14p levels. Together, these results identify a synergistic

relationship between Pex13p degradation and Pex14p levels.

THREE Further insights into Pex13p degradation

86

Fig. 6 Pex13p with blocked NH2 groups displays a reduced turnover.

A WT cells expressing Pex13-His6 were grown on methanol/glycerol media for 12 hrs and

treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (min) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against His6-tag, Pex14p, Pex11p and Pyc.

B Representative western blots of samples derived from cells grown and treated as in A

expressing His6-tagged Pex13-KRNT. Samples were probed with SDS-PAGE and

Further insights into Pex13p degradation THREE

87

immunoblotting with antibodies against His6-tag, Pex14p, Pex11p and Pyc.

C Quantification of His6-tagged Pex13 levels in WT and Pex13-KRNT cells. Protein

levels were normalized to the loading control Pyc at the corresponding time point.

Protein levels at T0 were set to 1. Values represent the mean ± SD of three independent

experiments (*P < 0.05).

D Quantification of Pex14p and Pex11p levels in WT and Pex13-KRNT cells. Protein

levels were normalized to Pyc at the corresponding time point. Protein levels at T0 were

set to 1. Values represent the mean ± SD of three independent experiments.

THREE Further insights into Pex13p degradation

88

Fig. 7 Overproduction of Pex13-KRNT impacts on the ability of cells to grown on

methanol containing media.

A OD600 measurements of cells grown on methanol or methanol/ glycerol media for 16 hrs.

Cells were grown on glucose to exponential phase before shifting to methanol mineral

medium. Values represent the mean ± SD of two independent experiments. An asterisks

denotes a statistically significant difference in the OD value (*P < 0.05, **P < 0.01,

***P < 0.001) compared to that of the WT strain (above the column) or between the

Paox-Pex13 and Paox-Pex13-KRNT strains (indicated with a line).

B Confirmation of Pex13p overproduction. Representative western blots of samples

derived cells grown for 16 hrs on methanol/ glycerol media. Blots were probed with

antibodies directed against the His6-tag, Pex14p, Pex11p and Pyc. L.E. stands for long

exposure.

C Growth curve of cells grown on methanol (left panel) or methanol/glycerol (right panel)

media over a 16 hour period. Cells were grown on glucose to exponential phase before

shifting to methanol containing media.

Fig. 8 Pex13p levels exhibit a synergistic increase with Pex14p overexpression.

A Representative western blots of samples derived cells grown for 16 hrs on methanol/

glycerol media. Blots were probed with antibodies directed against Pex13p, Pex14p,

Pex11p and Pyc.

B Quantification of protein levels in WT and mutant cells, normalized to the loading

Further insights into Pex13p degradation THREE

89

control Pyc at the corresponding time point. Protein levels in WT cells were set to 1.

Values represent the mean ± SD of three independent experiments. An asterisks denotes

statistically significant increases in protein levels compared to those in WT samples

(*P<0.05, **P < 0.01).

Discussion

At some point during their lifetime, all the proteins in a cell will undergo protein

degradation. This may be because they are “worn out” by chemical modifications,

because they become unfolded or because they are no longer needed. Protein

degradation needs to be regulated, otherwise unwanted degradation events may occur or

unwanted proteins start to build up in the cell. Hence, understanding how and why

proteins are degraded allows us to better understand the role of protein degradation in a

cellular context.

The PMP Pex13p is a member of the peroxisomal docking complex and it plays an

essential role in the import of PTS1 and PTS2 containing proteins into peroxisomes.

Previously we demonstrated that Pex13p undergoes UPS-mediated degradation in the

yeast H. polymorpha (Chen et al, 2018). Here, we have investigated further the Pex13p

degradation event in H. polymorpha. We provide evidence that Pex5p recycling is linked

to Pex13p degradation. Pex5p shuttles between the cytosol and the peroxisomal

membrane and its recycling from the membrane requires Pex5p to be

mono-ubiquitinated (Platta et al, 2007). When Pex5p mono-ubiquitination is inhibited

(through mutation of the conserved cysteine in Pex5p or in pex4 cells), Pex5p is

degraded (Kiel et al, 2005b; Leon & Subramani, 2007). The level of Pex13p was

increased in cells where the recycling of Pex5p was inhibited (Pex5-C9S mutant), while

the levels of Pex13p were even more elevated in cells where both Pex5p recycling and

degradation were blocked (Pex5-C9S.K21R and pex4 cells expressing Pex5-K21R). In

this mutant, Pex5p cannot be mono- or poly-ubiquitinated (Kiel et al, 2005b; Williams et

al, 2007), leading to a buildup of Pex5p on the peroxisomal membrane (Platta et al,

2007). One possible explanation for our data is that Pex5p removal from the membrane

is coupled to Pex13p degradation and that maybe both proteins can leave the

peroxisomal membrane together. An alternative theory is that Pex5-C9S.K21R simply

blocks the interaction between Pex13p and the counterpart proteins required for its

ubiquitination/degradation. However, we note here that although our data establish a

link between Pex5p recycling and Pex13p degradation, inhibiting Pex5p recycling also

blocks PTS1 protein import (Williams et al, 2007), meaning that we cannot rule out that

THREE Further insights into Pex13p degradation

90

the increased levels of Pex13p in the Pex5-C9S.K21R mutant stem from a decrease in

PTS1 protein import. In addition, levels are increased in pex14 and pex5 cells (Chen et

al, 2018), suggesting that Pex13p degradation requires a fully functional matrix import

pathway. Therefore, further study into the role of Pex5p cycling in Pex13p degradation

is required.

Blocking all the NH2 groups in Pex13p, the likely sites of Pex13p ubiquitination,

results in elevated Pex13p levels and a reduced turnover rate. However, we note that the

degradation of Pex13p is not completely inhibited by these mutations (see Fig. 6),

leaving the question of how this may be facilitated? In the absence of NH2 groups, it is

possible that Pex13p ubiquitination may occur on additional residues, such as serine,

threonine or cysteine residues. Ubiquitination of these residues has been reported (Wang

et al, 2007; Williams et al, 2007). This would allow Pex13p degradation to still occur,

although this may occur at a reduced rate, explaining the effect of the Pex13-KRNT

mutant. Alternatively, certain substrates of the proteasome can be recognized and

degraded without a prior need to be ubiquitinated (Sheaff et al, 2000; Shringarpure et al,

2003), which could suggest that Pex13p is still degraded even though it cannot be

ubiquitinated efficiently. Gaining information on the ubiquitination status of

Pex13-KRNT will shed light on this.

Overproduction of WT Pex13p results in reduced cell growth on methanol media,

likely because of a blockage to matrix protein import. Interestingly, this phenotype is

enhanced in cells overproducing Pex13-KRNT, suggesting that inhibiting Pex13p

degradation in these cells impacted negatively on peroxisome function. However, no

growth defect was seen with cells producing Pex13-KRNT under the control of the

endogenous PEX13 promoter. This presents a model in which a critical level of Pex13p

exists and if Pex13p levels stay under this point, peroxisome function can occur

normally. If Pex13p levels go above this point, peroxisome function is disturbed.

Comparably, cells overexpressing PEX14 from the AOX promoter display a matrix

protein import defect whereas peroxisomes in cells overexpressing PEX14 from the

weaker amine oxidase (AMO) promoter are still able to import matrix proteins (Komori

et al, 1997). Hence, our data suggest that the degradation of Pex13p in cells

overproducing Pex13p countered, to a certain extent, the detrimental effects of Pex13p

overproduction, indicating that the ability to degrade Pex13p can be an asset.

Our latest results, together with our previous report (Chen et al, 2018), demonstrate

that Pex13p degradation occurs in cells grown both on glucose and methanol containing

media. In addition, degradation under both growth conditions requires a functional

peroxisomal E3 ligase complex. Together, our data establish that Pex13p degradation is

Further insights into Pex13p degradation THREE

91

a general process and not a condition specific one, indicating that rather than a quality

control mechanism that removes faulty proteins, Pex13p degradation is more likely to be

a targeted degradation event. Comparably, we previously reported that degradation of

the PMP Pex3p is required before peroxisomes undergo autophagic degradation

(Williams & van der Klei, 2013b). So, what could the function of Pex13p degradation be?

Pex13p is constitutively degraded while its binding partner Pex14p is more stable (see

Fig. 1 and (Chen et al, 2018)). These data suggest that the levels of these two proteins

are regulated differently. Hence, Pex13p may harbour a degron-like signal to mediate its

degradation yet the putative PEST sequence in the N-terminal region appears not to be

involved in Pex13p turnover (Fig. 4). However, our data suggest that Pex14p levels play

a determining role in Pex13p degradation (Fig. 8) yet varying Pex13p levels have little

or no effect on Pex14p levels (Fig. 7 and (Chen et al, 2018)). This, coupled with the fact

that overproduction of Pex13p and Pex14p together has no effect on the ability of S.

cerevisiae cells to grow on oleate-containing media (Bottger et al, 2000), could suggest

that Pex13p levels (and hence Pex13p degradation) are regulated depending on those of

its binding partner Pex14p. While Pex14p complexes lacking Pex13p have been isolated

from cells (Meinecke et al, 2010), we suspect that a large portion of Pex14p will be

bound to Pex13p at any one time, because of the many different interactions these

proteins have with each other (Girzalsky et al, 1999; Schell-Steven et al, 2005). In this

respect, perhaps Pex13p degradation represents a way in which excess Pex13p that is

not bound to Pex14p can be removed from the cell. Inhibiting Pex13p degradation can

impact negatively on peroxisome function (Fig. 7). However, if an important part of

Pex13p function is to keep Pex14p in complex, why degrade Pex13p in the first place?

Blocking Pex13p degradation did not impact on peroxisome function when Pex13p was

not overproduced (Fig. 7), suggesting that the cell can handle a modest increase in

Pex13p levels. Therefore, we suspect that the removal of excess Pex13p from the

peroxisomal membrane is a plausible reason for why Pex13p is degraded, but we also

consider it likely that the rapid degradation of Pex13p may serve several purposes.

Following on from this, perhaps Pex13p degradation could also serve to negatively

regulate matrix protein import. Pan et al proposed a similar theory, based on their data

on Pex13p degradation in plants (Pan et al, 2016). Rapid degradation of Pex13p could

disconnect the docking complex from the downstream components required for PTS1

protein import, such as the RING E3 complex or the AAA-ATPases Pex1p and Pex6p,

which would undoubtedly inhibit PTS1 protein import. Such negative regulation of

import could be relevant in fully grown or mature peroxisomes because it can be

imagined that such peroxisomes need to import way less matrix proteins (Kumar et al,

THREE Further insights into Pex13p degradation

92

2017; Legakis et al, 2002). Indeed, Pex13p levels are dynamic over time, peaking at

around 6-8 hours in cells grown on methanol/ glycerol containing media and then

declining at later time-points (Knoops et al, 2014), which may suggest that Pex13p is

surplus to requirements at later stages of cell growth.

However, Pex13p degradation is a rapid and general event, which might not be

explained by the notion of negative regulation of matrix protein import. This, coupled

with the observation that Pex13p degradation is linked to Pex5p recycling, could suggest

that Pex13p degradation may instead positively regulate PTS1 protein import. A possible

function for Pex13p degradation may be to dissociate the importomer complex. The

importomer is a transient protein complex at the peroxisomal membrane, consisting of

the docking complex (Pex13p, Pex14p and Pex17p), the receptor plus cargo and proteins

involved in Pex5p recycling (RING E3 ligases, Pex1p, Pex6p and Pex15p) (Oeljeklaus

et al, 2012). The importomer forms after docking of the receptor-cargo complex on the

peroxisomal membrane and is required for transport of matrix proteins into the

peroxisomal lumen (Deckers et al, 2010; Meinecke et al, 2010; Oeljeklaus et al, 2012).

Because of the transient nature of the importomer complex, it could be envisaged that

removal of Pex13p out of the importomer complex may destabilize the importomer and

lead to the release of cargo proteins into the lumen or alternatively to the recycling

Pex5p to the cytosol. Such a model would fit with a role for Pex13p in the cargo

translocation or receptor recycling steps of matrix protein import, as was previously

suggested (Williams & Distel, 2006). Furthermore, we demonstrated that blocking

Pex13p degradation can impact on cell growth (Fig. 7), which would support a model

where Pex13p degradation regulated PTS1 protein import in a positive manner. Hence,

further work that addresses the role of Pex13p degradation in matrix protein import is

required.

Finally, while the function of Pex13p degradation remains unclear, we note that

Pex13p in the yeast S. cerevisiae is also degraded via the UPS (see Chapter 4 of this

thesis). Furthermore, Pan et al demonstrated that Pex13p in plants undergoes

UPS-mediated degradation (Pan et al, 2016), although the mechanisms that facilitate this

degradation event remain controversial (Ling et al, 2017; Pan & Hu, 2018). Therefore,

Pex13p degradation occurs in at least three different organisms, demonstrating that it is a

conserved process and we anticipate that the regulated degradation of Pex13p is a

fundamental property of peroxisomes.

Further insights into Pex13p degradation THREE

93

Materials and Methods

Molecular techniques and construction of H. polymorpha strains

Transformation of H. polymorpha was performed by electroporation, as described

previously (Faber et al, 1994). H. polymorpha strains used in this study are listed in

Table 1. The plasmids and primers used in this study are listed in Table 2 and 3

respectively. Phusion DNA polymerase (Thermo Scientific) was used to produce gene

fragments.

The pHIPZ-Pex13-mGFP plasmid (Knoops et al, 2014) was linearized with ApaI

prior to transformation into H. polymorpha cells. pHIPH-Pex14-mKate2 (Chen et al,

2018) was linearized with Bpu1102I prior to transformation into H. polymorpha cells.

Plasmids containing the PEX13 promoter (see below) were linearized with NheI prior to

transformation into H. polymorpha cells.

To construct pHIPZ20-Pex13(K-R)-His6, a synthetic gene fragment of PEX13 with

all lysine coding sequences changed to arginine coding sequences was ordered from

BaseClear (Leiden, The Netherlands). PCR was performed on this gene fragment using

primers SalI-P13R-F and P13R-His6-XbaI-R, and the resulting Pex13(K-R)-His6 DNA

fragment was digested with SalI and XbaI and ligated into SalI-XbaI digested

pHIPZ20-mGFP (Chen et al, 2018), producing pHIPZ20-Pex13(K-R)- His6.

The plasmid pHIPZ20-Pex13(Δpest)-His6 was constructed as follows: A fragment

of 240 bp of Pex13, without the region encoding for the putative PEST sequence (amino

acids 25-43) and containing SalI and NdeI sites was obtained from Integrated DNA

Technologies (https://eu.idtdna.com/pages/home). The fragment was digested with SalI

and NdeI and ligated into SalI-NdeI digested pHIPZ20-Pex13- His6 (Chen et al, 2018),

producing pHIPZ20-Pex13(Δpest)-His6.

The plasmid pHIPZ20-MSE-His6-Pex13 was constructed by PCR on the plasmid

pHIPZ20-Pex13-His6 (Chen et al, 2018) using primers SalI-His6-Pex13-F and

Pex13-XbaI-R, and the resulting MSE-His6-Pex13 fragment was digested with SalI and

XbaI and cloned into pHIPZ20-Pex13-His6 between SalI and XbaI sites.

Plasmid pHIPZ20-MSE-His6-Pex13(K-R) was constructed as follows: PCR was

performed on the plasmid pHIPZ20-Pex13(K-R)-His6 using primers

SalI-His6-Pex13(K-R)-F and Pex13R-XhoI-R, and the resulting MSE-His6-Pex13(K-R)

fragment was digested with SalI and XhoI and cloned into pHIPZ20-Pex13-His6

between SalI and XhoI sites.

To construct plasmid pHIPZ4-Pex13-His6, PCR was performed on the plasmid

pHIPX4 (Gietl et al, 1994) using primers NotI-Paox-F and Paox-SalI-R, and the

resulting AOX promoter was digested with NotI and SalI and cloned into

THREE Further insights into Pex13p degradation

94

pHIPZ20-Pex13-His6 between NotI and SalI sites. The construct

pHIPZ4-MSE-His6-Pex13-(K-R) was made in similar way. Plasmids containing the

AOX promoter were linearized with Ppu10I prior to transformation into H. polymorpha

cells.

To construct pHIPZ12-Pex5-C9S, a 596 bp PCR fragment consisting of the PEX5

promoter and the 5’ end of PEX5, introducing the C9S mutation, was first produced by

PCR using pRBG56-2 (Kiel et al, 2005b) as template and with primers Universal

M13/pUC and Pex5-C9S-R. The resulting DNA fragment was used as forward primer,

together with primer Pex5-return, and pRBG56-2 as template to produce a fragment

harbouring an XhoI restriction site. This 754 bp fragment was then cloned into

pHIPX4-Pex5 (Van der Klei et al, 1995) between NotI and XhoI. The product was

digested with NotI and NheI and the PEX5 containing fragment of 3156 bp was cloned

into pHIPZ4 (Salomons et al, 2000) between NotI and XbaI. The

pHIPZ12-Pex5-C9S.K21R plasmid was produced in the same manner as described but

instead pHIPZ12-Pex5-K21R was used as template. Plasmids containing the PEX5

promoter were linearized with BsiWI prior to transformation into H. polymorpha cells.

All integrations were confirmed by colony PCR using Phire Hot Start II (Thermo

Scientific) and strains containing Pex13(K-R)-His6, Pex13(Δpest)-His6, Pex13-NT,

Pex13-KRNT, Pex5-C9S or Pex5-C9S.K21R were further checked with Southern

blotting.

Southern blotting

Southern blotting analysis was performed using the ECL Direct Nucleic Acid Labelling

and Detection system (Thermo Scientific) according to the established methods. H.

polymorpha genomic DNA containing the integrated pHIPZ20-based plasmids was

digested with EcoRI (Thermo Scientific). The probe for Pex13(K-R)-His6, consisting of

a 0.5 kb fragment 1 kb-upstream, was amplified using primers Sthn-13(R)CSProbF and

Sthn-13(R)CSProbR. The probe recognises a 2.5 kb fragment in pex13 cells and an ~8

kb fragment in one-copy mutant cells.

H. polymorpha genomic DNA containing the integrated pHIPZ12-Pex5-C9S or

pHIPZ12-Pex5-C9S.K21R plasmid was digested with HindIII (Thermo Scientific). The

probe for Pex5-C9S or Pex5-C9S.K21R, consisting of a 0.5 kb fragment 1kb-upstream,

was amplified using primers Sthn-d5-Probe-F and Sthn-d5-Probe-R. The probe

recognizes a 2.5 kb fragment in pex5 cells and a ~10 kb fragment in one-copy mutant

cells.

Further insights into Pex13p degradation THREE

95

Prediction of PEST sequence in Pex13p

The full-length H. polymorpha Pex13p sequence was obtained from the NCBI website

(https://www.ncbi.nlm.nih.gov/gene/25771723) and the program epestfind

(http://emboss.bioinformatics.nl/cgi-bin/emboss/epestfind) was used to search the

sequence for putative PEST sequences. A putative PEST sequence

(DNNATTSTDNSSAPPELPT) was found between residues NSLDK and RPSSL,

displaying a score of 13.1. PEST motifs below the threshold score (5.0) are considered

as poor, while PEST scores above the threshold are considered significant.

Prediction of N-terminal acetylation

The sequence of the first ten amino acids at the N-terminus of H.polymorpha Pex13p is

MTTPRPKPWE, which is not predicted to be acetylated, according to NetAcet

(http://www.cbs.dtu.dk/services/NetAcet/). To inhibit the potential ubiquitination of NH2

group at the N-terminus, we made a mutant version of Pex13p that was predicted to be

acetylated (Kiemer et al, 2004). To achieve this, we added a sequence encoding for

serine and glutamic acid after the start codon (MSE), followed by a sequence encoding

for a 6*His tag and then the full-length PEX13. The resulting amino sequence (MSEHH)

was predicted to be acetylated using NetAcet (http://www.cbs.dtu.dk/services/NetAcet/).

Strains and growth conditions

Yeast transformants were selected on YPD plates containing 2% agar and 100 μg/ml

Zeocin (Invitrogen) or 300 μg/ml Hygromycin (Invitrogen). The E. coli strain DH5α

was used for cloning purposes. E. coli cells were grown in LB supplemented with

100 μg/ml Ampicillin at 37 °C. H. polymorpha cells were grown in batch cultures at

37 °C on mineral media supplemented with 0.25% glucose or 0.5% methanol (either

with or without 0.05% glycerol) as carbon source and 0.25% ammonium sulphate or

0.25% methylamine as nitrogen source. Leucine, when required, was added to a final

concentration of 30 μg/ml. Cycloheximide (CHX) when used, was added to a final

concentration of 6 mg/ml.

Preparation of yeasts TCA lysates

Cell extracts of TCA-treated cells were prepared for SDS-PAGE as detailed previously

(Baerends et al, 2000). Equal amounts of protein were loaded per lane and blots were

probed with rabbit polyclonal antisera raised against the Myc tag (Santa Cruz Biotech,

sc-789), Pex5p (Kiel et al, 2005b), Pex13p (Chen et al, 2018), Pex14p (Komori et al,

1997), Pex11p (Knoops et al, 2014) or pyruvate carboxylase 1 (Pyc1) (Fahimi et al,

THREE Further insights into Pex13p degradation

96

1993) or mouse monoclonal antisera raised against penta-His tag (Qiagen, 34660) or

mGFP (Santa Cruz Biotech, sc-9996). Secondary goat anti-rabbit (31460) or goat

anti-mouse (31430) antibodies conjugated to horseradish peroxidase (Thermo Fisher

Scientific) were used for detection. Pyc1 was used as a loading control. Note that the

anti-Pex14p can recognise both the phosphorylated (upper band) and unphosphorylated

(lower band) forms of Pex14p.

Quantification of Western blots

Blots were scanned by using a densitometer (GS-710; Bio-Rad Laboratories) and

protein levels were quantified using Image Studio Lite Ver5.2 software (LI-COR

Biosciences). In the case of Pex14p blots, both the phosphorylated and

unphosphorylated forms were included in the calculation if both forms were visible. The

value obtained for each band was normalized by dividing it by the value of the

corresponding Pyc band (loading control). For comparison of absolute protein levels

(Figures 1, 3 and 5), normalized values obtained for Pex13p, Pex14p and Pex11p levels

in WT cells were set to 1 and the levels of these proteins in mutant cells are displayed

relative to WT. For CHX experiments (Figures 2, 4 and 6), the normalized values of T0

samples were set to 1.0 and values obtained from the T1-T3 samples are displayed as a

fraction of T0 values. Standard deviations and significance were calculated using Excel.

* represents P-values < 0.05, ** represents P-values < 0.01 and *** represents P-values

< 0.001. The data presented are derived from three independent experiments.

Fluorescence Microscopy

All fluorescence microscopy images were acquired using a 100×1.30 NA Plan-Neofluar

objective (Carl Zeiss). Wide-field microscopy images were captured by an inverted

microscope (Axio Scope A1, Carl Zeiss) using Micro-Manager software and a digital

camera (CoolSNAP HQ2; Photometrics). GFP signal was visualized with a 470/440-nm

band pass excitation filter, a 495-nm dichromatic mirror, and 525/550-nm band pass

emission filter.

For images taken of Pex13-mGFP in WT grown on glucose mineral medium, the

optimal settings were mGFP (255, 800) and mKate2 (219, 1200), and in pex2, the

optimal settings mGFP (255, 3000) and mKate2 (219, 2200) were applied for processing.

The general settings used to compare the signal of Pex13-mGFP in WT and pex2, mGFP

(255, 2000) and mKate2 (219, 1700) were applied for processing.

For quantification of the Pex13-mGFP signal in WT or pex2 cells, a rectangular

area was drawn using the “rectangular tool” from ImageJ (Abramoff et al, 2004) to

Further insights into Pex13p degradation THREE

97

envelope the region containing the Pex13-mGFP spot and pixel intensity inside the area

was measured. The measured maximum fluorescence intensity of GFP on peroxisomes

was corrected for the background intensity and a box plot was made using Microsoft

Excel. The box represents values from the 25 percentile to the 75 percentile; the

horizontal line through the box represents the median value. Whiskers indicate

maximum and minimum values.

Acknowledgements

The authors thank Thomas Schroeter, Jessica Kluemper, Wolfgang Schliebs and Ralf

Erdmann for helpful discussions and Arjen Krikken for advice with processing of

fluorescence microscopy images. This work was funded by a VIDI Fellowship

(723.013.004) from the Netherlands Organisation for Scientific Research (NWO),

awarded to CW.

THREE Further insights into Pex13p degradation

98

Table 1, H. polymorpha strains used in this study

Strain Description Reference

WT Hp WT (NCYC495), leu1.1 (Gleeson &

Sudbery,

1988)

WT Pex13-mGFP Hp WT with pHIPZ-Pex13-mGFP (zeoR),

leu1.1

(Chen et al,

2018)

pex2 pex2 disruption strain, leu1.1 (Koek et al,

2007)

pex2+ Pex13-mGFP pex2 with pHIPZ-Pex13-mGFP (zeoR), leu1.1 (Chen et al,

2018)

pex2+ Pex13-mGFP+

Pex14-mKate2

pex2 with pHIPZ-Pex13-mGFP (zeoR) and

pHIPH-Pex14-mKate2 (hygR), leu1.1

(Chen et al,

2018)

pex4 pex4 disruption strain, leu1.1 (Van der

Klei et al,

1998)

pex4+ Pex13-mGFP pex4 with pHIPZ-Pex13-mGFP (zeoR), leu1.1 This study

pex4+ Pex13-mGFP+

Pex14-mKate2

pex4 with pHIPZ-Pex13-mGFP (zeoR) and

pHIPH-Pex14-mKate2 (hygR), leu1.1

This study

pex13 pex13 disruption strain, leu1.1 (Koek et al,

2007)

pex14 pex14 disruption strain, leu1.1 (Komori et

al, 1997)

Pex5-C9S pex5 with one copy of plasmid

pHIPZ12-Pex5-C9S (zeoR) integrated

This study

Pex5-K21R pex5 with one copy of plasmid

pHIPZ12-Pex5-K21R (zeoR) integrated

(Kiel et al,

2005b)

Pex5-C9S.K21R pex5 with one copy of plasmid

pHIPZ12-Pex5-C9S.K21R (zeoR) integrated

This study

pex4+ Pex5-K21R pex4 with one copy of plasmid

pHIPZ12-Pex5-K21R (zeoR) integrated

This study

pex5 pex5 disruption strain, leu1.1 (Van der

Klei et al,

1995)

Pex13-His6 pex13 with one copy of plasmid (Chen et al,

Further insights into Pex13p degradation THREE

99

pHIPZ20-Pex13-His6 (zeoR), leu1.1 2018)

Pex13(Δpest)-His6 pex13 with one copy of plasmid

pHIPZ20-Pex13(Δpest)-His6 (zeoR), leu1.1

This study

Pex13-KR-His6 pex13 with one copy of plasmid

pHIPZ20-Pex13(K-R)-His6 (zeoR), leu1.1

This study

Pex13-NT-His6 pex13 with one copy of plasmid

pHIPZ20-MSE-His6-Pex13 (zeoR), leu1.1

This study

Pex13-KRNT-His6 pex13 with one copy of plasmid

pHIPZ20-MSE-His6-Pex13(K-R) (zeoR),

leu1.1

This study

Paox-Pex13-His6 pex13 with one copy of plasmid

pHIPZ4-Pex13-His6 (zeoR), leu1.1, under

control of AOX promoter

This study

Paox-Pex13-KRNT-

His6

pex13 with one copy of plasmid

pHIPZ4-MSE-His6-Pex13(K-R) (zeoR),

leu1.1, under control of AOX promoter

This study

Table 2, plasmids used in this study

Plasmid Description Reference

pHIPZ-Pex13-mGFP C-terminal part of PEX13 fused with

mGFP, zeoR

; ampR

(Knoops et

al, 2014)

pHIPH-Pex14-mKate2 Plasmid containing the C-terminal

region of PEX14 fused to mKate2;

hygR

; ampR

(Chen et al,

2018)

pHIPZ20-mGFP mGFP under control of PEX13

promoter, zeoR

; ampR

(Chen et al,

2018)

pHIPZ12-Pex5-C9S Plasmid containing Pex5 in which the

Cysteine-9 was changed to Serine

residue, under control of PEX5

promoter, zeoR, kan

R

This study

pHIPZ12-Pex5-K21R Plasmid containing Pex5 with the

Lysine-21 changed to Arginine, under

control of PEX5 promoter, zeoR, kan

R

(Kiel et al,

2005b)

pHIPZ12-Pex5-C9S.K21R Plasmid containing Pex5 with the This study

THREE Further insights into Pex13p degradation

100

Cysteine-9 changed to Serine residue

and Lysine-21 to Arginine, under

control of PEX5 promoter, zeoR, kan

R

pHIPZ20-Pex13-His6 Pex13 fused to a 6*His tag at its

C-terminus, under control of PEX13

promoter, zeoR

; ampR

(Chen et al,

2018)

pHIPZ20-Pex13(K-R)-His6 Pex13 with all lysine residues

changed to arginine ones fused to a

6*His tag at its C-terminus, under

control of PEX13 promoter, zeoR

;

ampR

This study

pHIPZ0-Pex13(Δpest)-His6 Pex13 without PEST sequence fused

to a 6*His tag at its C-terminus, under

control of PEX13 promoter, zeoR;

ampR

This study

pHIPZ20-MSE-His6-Pex13 Pex13 fused to MSE and a 6*His tag

at its N-terminus, under control of

PEX13 promoter, zeoR; amp

R; also

written as (Pp13-)Pex13-NT

This study

pHIPZ20-MSE-His6-Pex13(K-R) Pex13 with all lysine residues

changed to arginine ones fused to

MSE and a 6*His tag at its

N-terminus, under control of PEX13

promoter, zeoR; amp

R; also written as

(Pp13-)Pex13-KRNT

This study

pHIPX4 Plasmid with H. polymorpha

AOX promoter and AMO terminator;

kanR, ScLEU2

(Gietl et al,

1994)

pHIPZ4-Pex13-His6 Pex13 fused to a 6*His tag at its

C-terminus, under control of AOX

promoter, zeoR

; ampR

This study

pHIPZ4-MSE-His6-Pex13(K-R) Pex13 with all lysine residues

changed to arginine ones fused to

MSE and a 6*His tag at its

N-terminus, under control of AOX

promoter, zeoR; amp

R; also written as

This study

Further insights into Pex13p degradation THREE

101

Paox-Pex13-KRNT

Table 3, primers used in this study

Primer Sequence Description

SalI-P13-F ACGCGTCGACATGACTACA

CCACGTCCAAAG

To clone the Pex13 gene,

forward primer, used to make

construct

pHIPZ20-Pex13(Δpest)-His6

SalI-P13R-F ACGCGTCGACATGACTACA

CCACGTCCACG

To clone the Pex13(K-R) gene,

forward primer, used to make

construct

pHIPZ20-Pex13(K-R)-His6

P13-His6-XbaI-R CTAGTCTAGATCAGTGATG

GTGATGGTGATGGATCAAA

AGCTTTTGATCTTTCTTG

To clone the Pex13 gene with

His*6 tag, reverse primer, used

to make construct

pHIPZ20-Pex13-His6

P13R-His6-XbaI-

R

CTAGTCTAGATCAGTGATG

GTGATGGTGATGGATCAAA

AGACGTTGATCACG

To clone the Pex13(K-R) gene

with His*6 tag on its C-terminus,

reverse primer, used to make

construct

pHIPZ20-Pex13(K-R)-His6

SalI-His6-Pex13(

K-R)-F

ACGCGTCGACATGAGTGAA

CATCACCATCACCATCACA

CTACACCACGTCCACGTC

To clone the Pex13(K-R) gene

fused to M (the start codon

ATG)-SE and His*6 tag at its

N-terminus, forward primer, used

to make construct

pHIPZ20-MSE-His6-Pex13(K-R

) and

pHIPZ4-MSE-His6-Pex13(K-R)

Pex13R-XhoI-R GGCCTCGAGTCAGATCAAA

AGACGTTGATCAC

To clone the Pex13(K-R) gene,

reverse primer, used to make

construct

pHIPZ20-MSE-His6-Pex13(K-R

) and

THREE Further insights into Pex13p degradation

102

pHIPZ4-MSE-His6-Pex13(K-R)

NotI-Paox-F ATAAGAATGCGGCCGCTCG

ACGCGGAGAACG

To clone the AOX promoter,

forward primer, used to make

construct pHIPZ4- Pex13-His6

and

pHIPZ4-MSE-His6-Pex13(K-R)

Paox-SalI-R ACGCGTCGACGTTTTTGTAC

TTTAGATTGATGTCACCACC

To clone the AOX promoter,

reverse primer, used to make

construct pHIPZ4- Pex13-His6

and

pHIPZ4-MSE-His6-Pex13(K-R)

SalI-His6-Pex13-

F

ACGCGTCGACATGAGTGAA

CATCACCATCACCATCACA

CTACACCACGTCCAAAGC

To clone the Pex13 gene fused to

M (the start codon ATG)-SE and

His*6 tag at its N-terminus,

forward primer, used to make

construct

pHIPZ20-MSE-His6-Pex13

Pex13-XbaI-R CTAGTCTAGATCAGATCAA

AAGCTTTTGATCTTTC

To clone the Pex13 gene, reverse

primer, used to make construct

pHIPZ20-MSE-His6-Pex13

Sthn-13(R)CSPro

bF

CAACAACGAATCTAGATTC

AAGAC

To clone the probe for

Pex13*-His Southern blotting,

forward primer

Sthn-13(R)CSPro

bR

TCGTTACCTGTGATGCTACA

G

To clone the probe for

Pex13*-His Southern blotting,

reverse primer

Sthn-d5-Probe-F AGCAAAGACGAAAGGTGC To clone the probe for Pex5

mutants Southern blotting,

forward primer

Sthn-d5-Probe-R CACAAACATGTATAAGATG

ACCAG

To clone the probe for Pex5

mutants Southern blotting,

reverse primer

Universal

M13/pUC

GTTTTCCCAGTCACGAC To clone a 596 bp PCR fragment

consisting of the PEX5 promoter

and the 5’ end of PEX5,

introducing the C9S mutation,

Further insights into Pex13p degradation THREE

103

forward primer, used to make

construct pHIPZ12-Pex5- C9S

Pex5-C9S-R GGCGTTGGCAGCAGACTCG

GATCCTCCCAGA

To clone a 596 bp PCR fragment

consisting of the PEX5 promoter

and the 5’ end of PEX5,

introducing the C9S mutation,

reverse primer for first step, used

to make construct

pHIPZ12-Pex5-C9S

Pex5-return CTTTCGGCCTCGTTCATAGC To clone a 754 bp PCR fragment

consisting of the PEX5 promoter

and the PEX5-C9S, reverse

primer for second step, used to

make construct

pHIPZ12-Pex5-C9S

104

4

Chapter 4

Investigating Pex13p degradation in the yeast Saccharomyces cerevisiae

Xin Chen, Srishti Devarajan, Matthias Meurer, Michael Knop and Chris Williams

Author contributions

CW and MK conceived and supervised the project. CW, XC, SD, MM and MK designed

the experiments. XC, SD and CW analysed the data. XC performed biochemical and FM

experiments. SD performed the spot assay, SD and MM performed tFT analysis and data

processing. All authors discussed the results. XC and CW wrote the manuscript, with

contributions from all authors.

FOUR Pex13p degradation in S. cerevisiae

106

Investigating Pex13p degradation in the yeast Saccharomyces cerevisiae

Xin Chen1, Srishti Devarajan

1, Matthias Meurer

2, Michael Knop

2 and Chris Williams

1*

1Cell Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute,

University of Groningen, 9747AG, the Netherlands 2 Centre for Molecular Biology, University of Heidelberg, Germany

*Corresponding author (c.p.williams@rug.nl)

Abstract

Pex13p is a member of docking complex required for the import of peroxisomal matrix

proteins. We previously demonstrated that Pex13p is rapidly degraded via the

ubiquitination proteasome system (UPS) in a Pex2p-dependent manner in the yeast

Hansenula polymorpha. However, whether Pex13p degradation is conserved in other

species and which additional factors may be involved remains unclear. In this study, we

demonstrate that UPS-mediated Pex13p degradation occurs in the yeast Saccharomyces

cerevisiae and that the mechanisms of Pex13p degradation are similar to in H.

polymorpha. Additionally, inactivation of Cdc48p, an ATPase involved in degrading

mitochondrial and ER membrane proteins, does not result in stabilization of Pex13p in

vivo, indicating that Pex13p degradation likely occurs via a different mechanism than

other organellar membrane proteins. Furthermore, we utilize a tandem fluorescent

protein timer approach to identify additional factors involved in Pex13p degradation.

Our data demonstrate that cytosolic E2 and E3 enzymes play a role in Pex13p

degradation. Taken together, our data provide further evidence that Pex13p degradation

is conserved throughout evolution while they also uncover novel components of the

UPS that are involved in Pex13p degradation. The implications of our findings are

discussed.

Keywords: Peroxisome/ protein degradation/ Saccharomyces cerevisiae/

ubiquitination/ peroxisomal membrane protein

Pex13p degradation in S. cerevisiae FOUR

107

Introduction

Peroxisomes are cellular compartments in eukaryotic cells that house metabolic

pathways. Common functions of peroxisomes include the β-oxidation of fatty acids and

the decomposition of oxygen reactive species, although many species- and cell-specific

peroxisomal functions are known (Gabaldon, 2010). Defects in peroxisome function can

cause a spectrum of inherited developmental brain disorders (Walker et al, 2002).

Peroxisome function depends on which peroxisomal membrane proteins (PMP) and

peroxisomal matrix proteins (MAT) are present in the peroxisome. Both PMPs and

MATs are post-translationally transported to peroxisomes with the aid of receptor

proteins. MATs can be targeted to peroxisomes in one of two different ways: MATs with

a C-terminal peroxisomal targeting signal type-1 (PTS1) sequence can be recognized by

the cytosolic receptor Pex5p, while MATs containing an N-terminal PTS2 signal can be

recognized by Pex7p (Braverman et al, 1997; Mukai et al, 2002). PTS2 protein import

also requires the action of additional co-receptor proteins (Sichting et al, 2003). After

recognition, the receptor-cargo complex binds to the docking complex on the

peroxisomal membrane, consisting of Pex14p and Pex13p (Elgersma et al, 1996;

Johnson et al, 2001). After cargo translocation and release, a process that is poorly

understood (Girzalsky et al, 2010), the receptor Pex5p is ubiquitinated at the peroxisome

by the peroxisomal ubiquitination machinery, consisting of the ubiquitin-conjugating

enzyme Pex4p and the RING finger ubiquitin ligases Pex2p, Pex10p and Pex12p (Platta

et al, 2007; Williams et al, 2008), which allows it to be recycled back to the cytosol,

with the aid of Pex1p and Pex6p, two AAA-ATPases (Platta et al, 2008). The

co-receptor proteins that function with Pex7p in the import of PTS2 proteins can also be

ubiquitinated in similar way during the import cycle (El Magraoui et al, 2013).

Previously, we demonstrated that Hansenula polymorpha Pex13p is degraded via the

ubiquitination proteasome system (UPS), and its degradation requires the peroxisomal

ubiquitination machinery mentioned above (Chen et al, 2018). The UPS-mediated

degradation of proteins occurs in a stepwise fashion (Hershko, 1996). Ubiquitin, a

globular protein of ~8kDa, is first activated by a ubiquitin activating enzyme (E1)

consuming ATP as energy. The activated ubiquitin was then transferred to the Cysteine

residue of a ubiquitin conjugating enzyme (E2). Ubiquitin can then be either passed on

to the active Cysteine of a HECT-class ubiquitin ligase (E3) and subsequently

transferred to a specific substrate, or be transferred to a substrate directly from the E2

with the help of a RING E3 ligase (Scheffner et al, 1995). Attachment of ubiquitin to a

substrate usually occurs via lysine residues on the substrate (Rodriguez, 1996), although

ubiquitin attachment to cysteine, serine and threonine residues has been reported (Wang

FOUR Pex13p degradation in S. cerevisiae

108

et al, 2007; Williams et al, 2007). In yeast, around 11 E2s and more than 60 E3s are

involved in the ubiquitination process (Finley et al, 2012; Ravid & Hochstrasser, 2007).

While ubiquitination serves many functions, UPS-mediated protein degradation often

requires the attachment of a chain of ubiquitin molecules (referred to as

poly-ubiquitination). Is this case, ubiquitin itself becomes a substrate for ubiquitination

and a common linkage involved in UPS-mediated protein degradation is via Lysine-48

(K48) on ubiquitin (Hershko & Ciechanover, 1998).

In this manuscript, we have investigated the stability of Pex13p in the yeast

Saccharomyces cerevisiae, to establish how conserved the Pex13p degradation process

is across evolution. We demonstrate that Pex13p undergoes rapid degradation in wild

type S. cerevisiae cells and also establish that Pex13p degradation is inhibited when

poly-ubiquitin chain formation is blocked. Furthermore, Pex13p turnover is inhibited in

pex2 and pex4 cells, indicating that the mechanism by which H. polymorpha and S.

cerevisiae Pex13p is degraded is likely to be conserved. Furthermore, we show that the

function of Cdc48p, an AAA-ATPase involved in the degradation of ER and

mitochondrial membrane proteins, is not required for Pex13p degradation. Finally, we

use a high throughput screening approach, combined with a tandem fluorescent timer

(tFT) (Khmelinskii et al, 2014; Khmelinskii et al, 2012), to identify additional proteins

involved in Pex13p degradation. Our tFT and subsequent biochemical analysis identifies

a role for cytosolic E2 and E3 enzymes in Pex13p degradation, providing a solid

platform for future studies aimed at understanding the molecular mechanisms and

underlying functions of Pex13p degradation.

Pex13p degradation in S. cerevisiae FOUR

109

Results

The rapid degradation of Pex13p is conserved in S. cerevisiae

Previously we demonstrated that Pex13p in the yeast H. polymorpha undergoes rapid

degradation via the UPS (Chen et al, 2018). In addition, UPS-mediated Pex13p

degradation was reported to occur in plants (Pan et al, 2016), although this degradation

event remain controversial (Ling et al, 2017; Pan & Hu, 2018). Therefore, we decided to

investigate whether Pex13p degradation occurs in other organisms and chose the yeast S.

cerevisiae for this. We utilized Pex13p fused to mGFP, which allowed us to detect the

protein on western blot using anti-GFP antibodies as well as to follow the subcellular

localization of Pex13p using fluorescence microscopy. Cells expressing Pex13-mGFP

are able to grow on media containing oleic acid as sole carbon source (Fig. 1A), a

condition that requires peroxisome function for growth, indicating that Pex13-mGFP is a

functional protein.

To investigate Pex13p turnover, we treated cells expressing Pex13-mGFP with

cycloheximide (CHX). Treatment of cells with CHX blocks protein production and it is

commonly used to investigate the kinetics of protein degradation. Cells were grown on

oleic acid containing media, to stimulate peroxisome proliferation. Pex13-mGFP levels

rapidly decreased after addition of CHX while Pex14p levels remained largely unaltered

(Fig. 1B, D & E), indicating that Pex13-mGFP undergoes protein degradation, similar to

our data in the yeast H. polymorpha (Chen et al, 2018). Next, we investigated the role of

the UPS in Pex13-mGFP degradation. To achieve this, we co-expressed the K48R

mutant form of ubiquitin (Ub) in cells expressing Pex13-mGFP. This Ub-K48R mutant

inhibits the formation of poly-ubiquitination chain on substrates and therefore inhibits

UPS-mediated protein degradation (Thrower et al, 2000). Our data demonstrate that

Pex13-mGFP turnover is significantly reduced in cells expressing Ub-K48R compared

to wild-type (P<0.01), indicating that the UPS is involved in its degradation (Fig. 1C &

D). These data demonstrate that, similar to in H. polymorpha, Pex13p undergoes rapid,

UPS-mediated degradation in S. cerevisiae.

FOUR Pex13p degradation in S. cerevisiae

110

Fig.1 Rapid degradation of Pex13-mGFP via the UPS occurs in S. cerevisiae.

A Spot assay to test the growth of cells expressing Pex13-tFT or Pex13-mGFP. S.

cerevisiae cells were spotted onto oleic acid plates and cultured at 30℃ for 7 days.

B WT cells expressing Pex13-mGFP were grown on oleic acid containing media for 12 hrs

Pex13p degradation in S. cerevisiae FOUR

111

and treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p (indicated Pyc).

C Representative western blots of Ub-K48R cells expressing Pex13-mGFP derived from

cells grown and treated as in A. Samples were probed with SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

D Quantification of Pex13-mGFP levels in WT and Ub-K48R cells expressing

Pex13-mGFP. Protein levels were normalized to the loading control (Pyc1p) at the

corresponding time point and to the protein levels at T0. Values represent the mean ± SD

of three independent experiments. Asterisks denote statistically significant increases in

protein levels compared to those in WT samples (*P < 0.05, **P < 0.01).

E Quantification of Pex14p levels in WT and Ub-K48R cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control (Pyc1p) at the corresponding time

point and to the protein levels at T0. Values represent the mean ± SD of three

independent experiments.

The peroxisomal ubiquitination machinery is required for Pex13p degradation in S.

cerevisiae

Previously, we demonstrated that Pex13p in the yeast H. polymorpha was stabilized

when components of the peroxisomal ubiquitination machinery, such as the E3 ligase

Pex2p or the E2 Pex4p are absent (Chen et al, 2018). Therefore, we investigated whether

the mechanism by which Pex13p degradation occurs was also conserved in S. cerevisiae.

We introduced Pex13-mGFP into pex2 or pex4 cells and followed Pex13p-mGFP

degradation in CHX-treated cells grown on oleic acid containing media (Fig. 2).

Compared to WT, Pex13-mGFP turnover was clearly inhibited in pex2 (Fig. 2A & B)

and pex4 (Fig. 2 D & E) cells (P<0.001), suggesting that Pex2p and Pex4p play a role in

Pex13p degradation. Next, we investigated the subcellular localization of Pex13-mGFP

in WT and pex2 cells grown on oleic acid containing media. Pex13-mGFP co-localizes

with Pex3-mKate (a stable peroxisomal membrane protein, used as the peroxisomal

membrane marker) on the peroxisomal membrane in pex2 cells (Fig. 3A & B) and

mGFP intensity is significantly increased in pex2 cells (Fig. 3A-D). Furthermore,

Pex13-mGFP levels are significantly elevated in pex2 cells compared to wild-type cells

(Fig. 3E & F), again indicating Pex13-mGFP degradation is inhibited in pex2 cells.

These data strongly suggest that Pex13p degradation in both H. polymorpha and S.

cerevisiae proceeds via a similar mechanism.

FOUR Pex13p degradation in S. cerevisiae

112

Pex13p degradation in S. cerevisiae FOUR

113

Fig.2 Pex13-mGFP degradation is inhibited in cells lacking members of the

peroxisomal ubiquitination machinery

A Representative western blots of pex2 cells expressing Pex13-mGFP derived from cells

grown and treated as in (Fig. 1B). Samples were probed with SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

B Quantification of Pex13-mGFP levels in WT and pex2 cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control (Pyc1p) at the corresponding time

point and to the protein levels at T0. Values represent the mean ± SD of three

independent experiments. Values of WT were taken from (Fig. 1A). Asterisks denote

statistically significant increases in protein levels compared to those in WT samples (*P

< 0.05, **P < 0.01, ***P < 0.001).

C Quantification of Pex14p levels in WT and pex2 cells. Protein levels were normalized to

the loading control (Pyc1p) at the corresponding time point and to the protein levels at

T0. Values represent the mean ± SD of three independent experiments. Values of WT

were taken from Fig. 1B.

D Representative western blots of pex4 cells expressing Pex13-mGFP derived from cells

grown and treated as in (A). Samples were probed with SDS-PAGE and immunoblotting

with antibodies against mGFP, Pex14p and Pyc1p.

E Quantification of Pex13-mGFP levels in WT and pex4 cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control (Pyc1p) at the corresponding time

point and to the protein levels at T0. Values represent the mean ± SD of three

independent experiments. Values of WT were same as in (Fig. 1B). Asterisks denote

statistically significant increases in protein levels compared to those in WT samples (*P

< 0.05, **P < 0.01, ***P < 0.001).

F Quantification of Pex14p levels in WT and pex4 cells. Protein levels were normalized to

the loading control (Pyc1p) at the corresponding time point and to the protein levels at

T0. Values represent the mean ± SD of three independent experiments. Values of WT

were same as in (Fig. 1B).

FOUR Pex13p degradation in S. cerevisiae

114

Fig.3 Pex13-mGFP accumulates on peroxisomes in pex2 cells.

A WT and pex2 cells producing Pex13-mGFP and Pex3-mKate2 were grown on oleic acid

containing media to an OD600 of 1.0 and fluorescence microscopy images were taken.

Images of Pex13-mGFP were processed using ImageJ with optimal settings to show

signals in WT and pex2. Pex3-mKate2 was used as peroxisomal membrane marker. The

following settings were used: for WT cells mGFP (290, 650) and mKate2 (225, 600); for

pex2 cells mGFP (290, 2900) and mKate2 (225, 630). Scale bar: 5μm.

B Fluorescence images of Pex13-mGFP in WT or pex2 shown in (A) were processed using

Pex13p degradation in S. cerevisiae FOUR

115

ImageJ with the same settings: mGFP (300, 2000), mKate2 (225, 620). Scale bar: 5μm.

C Box plot showing quantification of mGFP fluorescence intensity at the peroxisomal

membrane in WT and pex2 cells producing Pex13-mGFP. Fluorescence intensities

(arbitrary units) were measured using ImageJ. The box represents values from the 25

percentile to the 75 percentile; the horizontal line through the box represents the median

value. Whiskers indicate maximum and minimum values. Pex13-mGFP measurements

were taken as described in the Materials and Methods section.

D Average ratio ± SD per cell (n = 40) of mGFP to mKate intensities in WT and pex2 cells.

***P < 0.001.

E WT and pex2 cells producing Pex13-mGFP grown on oleic acid media and TCA samples

were taken when the cultures reached an OD600 of 1.0. Samples were subjected to

SDS-PAGE and immunoblotting using antibodies against mGFP, Pex14p and Pyc1p.

F Quantification of protein levels in WT and pex2 cells, normalized to the loading control

Pyc1p. Protein levels in WT cells were set to 1. Values represent the mean ± SD of three

independent experiments. Asterisks denote statistically significant increases in protein

levels compared to those in WT samples (**P < 0.01).

Cdc48p function is not required for Pex13p degradation

Membrane proteins need to be removed from their native membrane environment before

they can be degraded by the proteasome and the AAA-ATPase Cdc48p (p97 in humans)

is known to extract membrane proteins from both the endoplasmic reticulum (ER) and

mitochondrial membranes and deliver them to the proteasome for degradation (Cao et al,

2003; Wolf & Stolz, 2012). Therefore, we considered the possibility that Cdc48p could

be involved in extracting Pex13p out of the peroxisomal membrane and delivering it to

the proteasome, for degradation. To investigate this, we utilized a temperature sensitive

mutant form of Cdc48p (cdc48-3), since CDC48 is an essential gene (Dargemont &

Ossareh-Nazari, 2012; Wolf & Stolz, 2012; Yamanaka et al, 2012). The mutant Cdc48

protein is active when cells are grown at the permissive temperature of 23℃ but is

inactive when cells are grown at the restrictive temperature of 37℃. We used Cdc5p as a

control substrate. Cdc5p is a serine/threonine-protein kinase required for the cell cycle

and its degradation requires Cdc48p (Cao et al, 2003). We introduced Pex13-mGFP or

Cdc5-HA6 into cdc48-3 cells and followed the degradation of these proteins in oleic

acid-grown cells treated with CHX, at both 23℃ and 37℃ (Fig. 4). Cdc5-HA6

degradation was observed in cells grown at the permissive temperature while Cdc5-HA6

turnover was inhibited in cells growing at the restrictive temperature (Fig. 4A-C).

FOUR Pex13p degradation in S. cerevisiae

116

Significantly, Pex13-mGFP was degraded at a similar rate in cells grown at both the

permissive and the restrictive temperatures (Fig. 4D-K), suggesting that Cdc48p

function is not required for Pex13p degradation.

(main text continued in p.119)

Fig.4 Cdc48p function is not required for Pex13p degradation.

A Representative western blots of cdc48-3 cells expressing Cdc5-HA6 derived from cells

grown and treated as in (A). Samples were probed with SDS-PAGE and immunoblotting

with antibodies against HA and Pyc1p.

B Representative western blots of cdc48-3 cells expressing Cdc5-HA6 derived from cells

grown and treated as in (E). Samples were probed with SDS-PAGE and immunoblotting

with antibodies against HA and Pyc1p.

C Quantification of Cdc5-HA6 levels in cdc48-3 cells at permissive temperature 23℃ or

restrictive temperature 37℃ expressing. Protein levels were normalized to the loading

control (Pyc1p) at the corresponding time point and to the protein levels at T0. Values

represent the mean ± SD of three independent experiments. (*P < 0.05)

D WT cells expressing Pex13-mGFP were grown on oleic acid media at 23℃ for 18 hrs and

treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

(Fig. 4D, continued in next page)

Pex13p degradation in S. cerevisiae FOUR

117

(Fig.4D, continued from previous page)

E Representative western blots of cdc48-3 cells expressing Pex13-mGFP derived from

cells grown and treated as in (A). Samples were probed with SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

F Quantification of Pex13-mGFP in (A) and (B). Protein levels were normalized to the

loading control (Pyc1p) at the corresponding time point and to the protein levels at T0.

Values represent the mean ± SD of three independent experiments.

G Quantification of Pex14p levels in WT and cdc48-3 cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control (Pyc1p) at the corresponding time

point and to the protein levels at T0. Values represent the mean ± SD of three

independent experiments.

(Fig. 4H, continued in next page)

FOUR Pex13p degradation in S. cerevisiae

118

(Fig.4D, continued from previous page)

H WT cells expressing Pex13-mGFP were grown on oleic acid media at 23℃ for 17 hrs,

then shifted to 37℃ for 1 hr, and treated with DMSO (Ctrl) or Cycloheximide (CHX).

TCA samples were taken at the indicated time (hrs) after DMSO/CHX addition and

probed by SDS-PAGE and immunoblotting with antibodies against mGFP, Pex14p and

Pyc1p.

I Representative western blots of WT cells expressing Pex13-mGFP derived from cells

grown and treated as in (E). Samples were probed with SDS-PAGE and immunoblotting

with antibodies against mGFP, Pex14p and Pyc1p.

J Quantification of Pex13-mGFP in (E) and (F). Protein levels were normalized to the

loading control (Pyc1p) at the corresponding time point and to the protein levels at T0.

Values represent the mean ± SD of three independent experiments.

K Quantification of Pex14p levels in WT and cdc48-3 cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control (Pyc1p) at the corresponding time

point and to the protein levels at T0. Values represent the mean ± SD of three

independent experiments.

Pex13p degradation in S. cerevisiae FOUR

119

Investigating Pex13p degradation with a tandem fluorescent timer

While our data demonstrate a role for the peroxisomal ubiquitination machinery in the

degradation of S. cerevisiae Pex13p (Fig. 2 and 3), we sought to identify which

additional factors may regulate Pex13p degradation. To achieve this we utilized a

tandem fluorescent timer (tFT) approach, which has been previously used to study

protein stability in S. cerevisiae cells (Khmelinskii et al, 2014). The tFT tag consists of

mCherry and sfGFP, which have maturation half times of around 45 and 5 minutes,

respectively (in S. cerevisiae cells grown at 30°C). Measuring the red and green

fluorescent intensities directly in cells can provide information on the relative stability

of the tFT-tagged protein in an in vivo setting. A high mCherry/sfGFP intensity ratio

indicates that the tagged protein is stable while a low mCherry/sfGFP ratio indicates an

unstable protein (Khmelinskii et al, 2012). Cells expressing Pex13-tFT only (and hence

not the WT version of the protein) can grow on oleic acid (Fig. 1A), suggesting that the

Pex13-tFT protein is functional. Furthermore, Pex13-tFT was rapidly degraded in cells

treated with CHX (Fig. 5), demonstrating that Pex13-tFT can be used to study Pex13p

degradation.

Figure 5. Pex13-tFT is rapidly degraded in S. cerevisiae cells treated with CHX.

A Representative western blots of samples derived from cells expressing Pex13-tFT or

FOUR Pex13p degradation in S. cerevisiae

120

Pex11-tFT grown for 12 hrs on oleic acid media. Blots were probed with antibodies

directed against mGFP and Pyc1p. * Denotes a hydrolysed product of mature mCherry

during SDS-sample preparation due to chemical breakage of the fluorophore. This cuts

mCherry into two pieces, at around position 69 of mCherry, thereby generating a

fragment containing the C-term mCherry and sfGFP of approximately 45 kDa. #

Denotes an incomplete degradation product of sfGFP due to its rigid fold. This 33 kDa

band often appears as a doublet. The presence of this band is a strong signature that the

tFT tagged protein is degraded by the proteasome (Khmelinskii et al, 2016).

B Quantification of Pex13-tFT and Pex11-tFT levels of blots in the left. Protein levels

were normalized to the loading control (Pyc1p) at the corresponding time point and to

the protein levels at T0. Values represent the mean ± SD of three independent

experiments.

Next, we created a library of 152 strains made by synthetic genetic array (SGA)

expressing Pex13-tFT that either lacked a gene involved in protein degradation or which

contained a mutant version of a protein involved in protein degradation (in case the

deletion was lethal) (Tong & Boone, 2006). Gene deletion and gene tagging were

validated by PCR (data not shown). Mutant cells expressing Pex13-tFT were grown on

synthetic complete media plates containing 0.1% oleic acid and 0.1% glucose for seven

days at 30°C. Colonies (four technical replicates for each mutant strain plus controls)

were imaged every day to determine mCherry and GFP fluorescence intensities and the

average ratio of mCherry to sfGFP intensities was determined for each strain on each

day. These ratios were normalized to the ratio measured in WT cells expressing

Pex13-tFT and the Z-score, the deviation of the ratio for a particular mutant strain

compared to the average ratio across all strains, was calculated for each strain (Fig. 6).

Further details on how the images were taken and the data were processed can be found

in the Materials and Methods section.

We considered mutant strains that displayed an increase in Z-score of more than 1.0

on each of the seven days potentially interesting. These strains, which include cells

deleted for PEX4, PEX2, PEX10, PEX12 and UBI4 (which depletes the amount of

ubiquitin available in the cell, but does not result in an absence of ubiquitin completely

because of the presence of additional copies of the UBI gene), display an increase in

Pex13-tFT stability on each of the seven days (Fig. 6). A role for these factors in Pex13p

degradation was already shown (Fig. 1, 2 & 3), validating our tFT approach. In addition,

cells deleted for UBR2, UFD4, RCY1, YUH1, UBP6 and UBC4 all displayed increased

Pex13p degradation in S. cerevisiae FOUR

121

Pex13-tFT stability on each of the seven days (Fig. 6). Ufd4p is a cytosolic HECT E3

ligase which regulates the degradation of misfolded proteins (Theodoraki et al, 2012).

Interestingly, Ufd4p is also involved in the degradation of Pxa1p (Devarajan et al, in

preparation), a peroxisomal membrane protein involved in the import of activated

long-chain fatty acids from the cytosol to the peroxisomal matrix (Shani et al, 1995).

Ubc4p is a ubiquitin-conjugating enzyme (E2) involved in the degradation of abnormal

or excess proteins while it also mediates the ubiquitination of Pex5p (Seufert & Jentsch,

1990; Williams et al, 2007). Ubc4p is known to work with Ufd4p in the ubiquitination

of certain substrates (Bao, 2015). Ubr2p is a cytosolic RING E3 ligase which like Ufd4p,

is involved in the degradation of misfolded proteins (Nillegoda et al, 2010). S. cerevisiae

cells depleted of Ubr2p cannot grow on oleic acid containing media (Lockshon et al,

2007; Saleem et al, 2010), although the underlying peroxisomal defect in these cells is

unknown. Ubp6p is a de-ubiquitinating enzyme that associates with the proteasome and

can negatively regulate proteasomal activity (Hanna et al, 2006) and it is also involved

in Pxa1p degradation (Devarajan et al, in preparation). Rcy1p is involved in recycling

plasma membrane proteins internalized by endocytosis (Wiederkehr et al, 2000) and is

required for recycling of the v-SNARE Snc1p (Galan et al, 2001). Yuh1p is a

de-ubiquitinating enzyme that regulates cellular ubiquitin levels (Miller et al, 1989).

Taken together, our tFT analysis identifies additional factors potentially involved in

Pex13p degradation.

Ufd4p, Ubc4p and Ubr2p facilitate the targeted degradation of Pex13p

Our tFT data identified six additional candidates that could play a role in Pex13p

degradation and we chose to investigate the role of three of these candidates in Pex13p

turnover. These were the cytosolic E2 Ubc4p and the cytosolic E3 ligases Ufd4p and

Ubr2p. As negative control we chose atg12 cells, since no increase in Pex13-tFT

stability was observed in these cells (Fig. 6). We introduced Pex13-mGFP into ufd4,

ubc4, ubr2 and atg12 cells and investigated Pex13-mGFP steady state levels in cells

grown on oleic acid containing media, establishing that Pex13-mGFP levels are

significantly elevated ufd4, ubr2 and ubc4 cells (Fig. 7). In addition, degradation of

Pex13-mGFP proceeded at a significantly lower rate in CHX treated ufd4 (Fig. 8), ubc4

(Fig. 9) and ubr2 (Fig. 10) cells, supporting our data on the steady state levels of

Pex13-mGFP in these mutant strains (Fig. 7A,B). Taken together, these data provide

further evidence for a role for Ufd4p, Ubc4p and Ubr2p in Pex13-mGFP degradation.

FOUR Pex13p degradation in S. cerevisiae

122

Pex13p degradation in S. cerevisiae FOUR

123

Fig.6 tFT analysis identifies additional factors involved in Pex13p degradation.

Heat-map indicating relative Pex13-tFT stability in different mutant yeast strains. Strains

expressing Pex13-tFT were grown for seven days at 30℃ on oleic acid plates with 0.1%

glucose (w/v). The mCherry and sfGFP fluorescence intensities were measured for colonies

from each strain on each day and the mCherry/sfGFP ratio was calculated and used to

determine the Z-score, the deviation of the ratio for a particular strain on a particular day

compared to the average ratio across all strains on that day. Increases in Z-score are colour

coded, ranging from 1.0 or less (green) to 5.0 (red). The data for each square in the heat map

are derived from four technical replicates.

Fig.7 Pex13-mGFP levels are increased in ufd4, ubr2 and ubc4 cells.

A Representative western blots of samples derived from WT and mutant cells grown for 12

hrs on oleic acid media. The atg12 strain was used as a negative control. Blots were

probed with antibodies directed against mGFP, Pex14p and Pyc1p.

B Quantification of protein levels in WT and mutant cells, normalized to the loading

FOUR Pex13p degradation in S. cerevisiae

124

control Pyc1p. Protein levels in WT cells were set to 1. Values represent the mean ± SD

of three independent experiments. Asterisks denote statistically significant increases in

protein levels compared to those in WT samples (*P < 0.05, **P < 0.01).

Fig.8 Cells lacking the cytosolic E3 Ufd4p display enhanced Pex13-mGFP stability.

A The ufd4 cells expressing Pex13-mGFP were grown on oleic acid media for 12 hrs and

treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

B Quantification of Pex13-mGFP level in ufd4 cells expressing Pex13-mGFP. Protein

Pex13p degradation in S. cerevisiae FOUR

125

levels were normalized to the loading control (Pyc1p) at the corresponding time point

and to the protein levels at T0. Values represent the mean ± SD of three independent

experiments. Values of WT were same as in (Fig. 1B). Asterisks denote statistically

significant increases in protein levels compared to those in WT samples (*P < 0.05).

C Quantification of Pex14p level in ufd4 cells expressing Pex13-mGFP. Protein levels

were normalized to the loading control (Pyc1p) at the corresponding time point and to

the protein levels at T0. Values represent the mean ± SD of three independent

experiments. Values of WT were same as in (Fig. 1B).

Fig.9 The cytosolic E2 Ubc4 is involved in Pex13-mGFP degradation.

A The ubc4 cells expressing Pex13-mGFP were grown on oleic acid media for 12 hrs and

FOUR Pex13p degradation in S. cerevisiae

126

treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

(Fig. 9B, continued in next page)

Fig.10 Deletion of UBR2, which encodes for a cytosolic RING E3 ligase, impacts on

Pex13-mGFP degradation.

A The ubr2 cells expressing Pex13-mGFP were grown on oleic acid media for 12 hrs and

treated with DMSO (Ctrl) or Cycloheximide (CHX). TCA samples were taken at the

indicated time (hrs) after DMSO/CHX addition and probed by SDS-PAGE and

Pex13p degradation in S. cerevisiae FOUR

127

immunoblotting with antibodies against mGFP, Pex14p and Pyc1p.

B Quantification of Pex13-mGFP levels in WT and ubr2 cells expressing Pex13-mGFP.

Protein levels were normalized to the loading control (Pyc1p) at the corresponding time

point and to the protein levels at T0. Values represent the mean ± SD of three

independent experiments. Values of WT were same as in (Fig. 1B). Asterisks denote

statistically significant increases in protein levels compared to those in WT samples (*P

< 0.05, **P < 0.01).

C Quantification of Pex14p levels in WT and ubr2 cells expressing Pex13-mGFP. Protein

levels were normalized to the loading control (Pyc1p) at the corresponding time point

and to the protein levels at T0. Values represent the mean ± SD of three independent

experiments. Values of WT were same as in (Fig. 1B).

__________________

(Fig. 9B, continued from previous page)

B Quantification of Pex13-mGFP level in ubc4 cells expressing Pex13-mGFP. Protein

levels were normalized to the loading control (Pyc1p) at the corresponding time point

and to the protein levels at T0. Values represent the mean ± SD of three independent

experiments. Values of WT were same as in (Fig. 1B). Asterisks denote statistically

significant increases in protein levels compared to those in WT samples (*P < 0.05).

C Quantification of Pex14p level in ubc4 cells expressing Pex13-mGFP. Protein levels

were normalized to the loading control (Pyc1p) at the corresponding time point and to

the protein levels at T0. Values represent the mean ± SD of three independent

experiments. Values of WT were same as in (Fig. 1B).

Discussion

Pex13p is a PMP and member of the peroxisomal docking complex which is required for

MAT import, although its actual role in the import process is still unclear. Pex13p has a

relatively short half-life in the yeast H. polymorpha and it is degraded via the UPS in a

Pex2p-dependent manner (Chen et al, 2018) In addition Arabidopsis Pex13p can be

degraded by the UPS, in a process involving the RING E3 Ligase SP1 (Pan et al, 2016).

Together, these reports suggest that UPS-mediated Pex13p degradation is a conserved

process, which led us to investigate Pex13p degradation in the yeast S. cerevisiae. Our

data clearly establish that Pex13p is degraded in S. cerevisiae while additionally

demonstrating that Pex13p degradation likely proceeds via a similar UPS-mediated

mechanism to that in H. polymorpha. Although the function of Pex13p degradation

remains unclear (see Chapter 3 of this thesis), the fact that it has been shown to occur in

FOUR Pex13p degradation in S. cerevisiae

128

three different organisms strongly suggests that Pex13p degradation is fundamental to

peroxisomes. This poses the question as to whether Pex13p degradation also occurs in

humans and if so, what would be the impact of blocking Pex13p degradation on human

health? Mutations in Pex2p, Pex10p or Pex12p have been reported in patients suffering

from peroxisome biogenesis disorders (Gootjes et al, 2004a; Gootjes et al, 2004b;

Warren et al, 2000). In many cases the RING E3 complex members displayed reduced

activity or loss of function, which resulted in defects in peroxisomal MAT import

(Krause et al, 2006). It is probable that many of the defects exhibited by these patients

are caused by inhibitions to Pex5p recycling. Nevertheless, because the peroxisomal E3

ligases are clearly involved in Pex13p degradation, it is feasible that some of the effects

displayed by patients with reduced peroxisomal E3 ligase activity may stem from

blocking Pex13p degradation.

Cdc48p is an AAA-ATPase involved in protein degradation and it is able to extract

ubiquitinated substrates from the ER and mitochondrial membranes and target them to

the proteasome for degradation (Wolf & Stolz, 2012). However, since our data establish

that Cdc48p function is not required for Pex13p degradation, it remains unknown how

ubiquitinated Pex13p may target to the proteasome. One possibility is that another

AAA-ATPase regulates the transport of Pex13p towards the proteasome. Pex1p and

Pex6p are two such ATPases that form a complex and can extract ubiquitinated Pex5p

from the peroxisomal membrane (Platta et al, 2008), although Pex3p degradation in H.

polymorpha did not require Pex1p (Williams & van der Klei, 2013b). This may argue

against a role for the Pex1p/Pex6p complex in Pex13p degradation. Similarly the

membrane bound AAA-ATPase Msp1p, which was reported to extract tail anchored

proteins out of the peroxisomal membrane for degradation (Weir et al, 2017), is also a

potential candidate to fulfil this function. Another possibility is that the cytosolic

proteasome approaches ubiquitinated Pex13p while still at the peroxisomal membrane.

The proteasome can associate with the ER membrane (Lipson et al, 2008; Mayer et al,

1998), which led Mayer et al. to propose that dislocation and degradation are coupled

(Mayer et al, 1998). They further proposed that Cdc48p and Rpt4p (a subunit of 19S

regulatory particle of the proteasome) might work in parallel, due to their structural

(both are hexameric AAA-ATPases) and functional (both can bind ubiquitin conjugates)

similarities (Dai & Li, 2001; Elsasser & Finley, 2005; Lam et al, 2002). In such a model,

the proteasome may not require the action of an additional AAA-ATPase to facilitate

Pex13p degradation. Clearly further work is needed to investigate how ubiquitinated

Pex13p is extracted from the peroxisomal membrane.

Using a tandem fluorescent timer (tFT) and high throughput screening approach,

Pex13p degradation in S. cerevisiae FOUR

129

we observed that, in addition to in cells lacking members of the peroxisomal

ubiquitination machinery, Pex13-tFT stability was also increased in cells lacking Ufd4p,

Ubc4p or Ubr2p. Furthermore the steady state levels of Pex13-mGFP was increased

while Pex13-mGFP degradation was reduced in each of these deletion strains. Together

these data strongly suggest that Ufd4p, Ubr2p and Ubc4p play a role in Pex13-mGFP

degradation. This raises the question what is the relationship between the different E2s

and E3s that play a role in Pex13p degradation? One possibility is that several pathways

act in parallel on Pex13p. One pathway may rely on the peroxisomal ubiquitination

machinery while another may require Ubc4p as E2 and Ufd4p or Ubr2p as E3. Ubc4p is

known to act as E2 for Ufd4p (Bao, 2015). However, another option is that all these

factors act together in ubiquitinating Pex13p. Ufd4p can associate with the RING E3

ligase Ubr1p, which allows the rapid formation of poly-ubiquitin chains on substrates

(Hwang et al, 2010). Perhaps this is also the case for Pex13p, with Ufd4p, Ubr2p and

Ubc4p “joining forces” with Pex4p and the peroxisomal E3 ligases to promote the rapid

formation of poly-ubiquitinated Pex13p, to facilitate its degradation. Nevertheless,

deletion of PEX2 or PEX4 has a dramatic effect on Pex13-mGFP degradation (Fig. 2)

whereas deletion of UFD4, UBR2 or UBC4 has a smaller impact on Pex13-mGFP

degradation (Fig. 7-10). These data could suggest that the peroxisomal ubiquitination

machinery is the major player in Pex13p degradation, while the cytosolic factors Ufd4p,

Ubc4p and Ubr2p play a more minor role (Fig. 11). However, further investigations are

required, including the potential roles of the other factors identified in our tFT analysis

in Pex13p degradation.

In summary, our results demonstrate that Pex13p degradation is a general process

conserved across different organisms yet occurring likely via similar mechanisms while

they also identify roles for additional, cytosolic E2s and E3s in Pex13p degradation.

However, further study is required before the mechanisms that underlie Pex13p

degradation become clear.

FOUR Pex13p degradation in S. cerevisiae

130

Fig.11 A schematic model of Pex13p degradation.

The ubiquitination machinery at the peroxisomal membrane, including Pex4p (E2) and

RING complex Pex2p/ Pex10p/ Pex12p (E3), plays a major role in Pex13p ubiquitination.

The cytosolic factors Ufd4p, Ubc4p and Ubr2p play a more minor role, possibly involved in

a later step of poly-ubiquitination chain formation.

Pex13p degradation in S. cerevisiae FOUR

131

Materials and Methods

Molecular techniques and construction of S. cerevisiae strains

S. cerevisiae strains used in this study are listed in Table 1. Strains used in tFT analysis

were constructed as described previously (Khmelinskii et al, 2014). The plasmids and

primers used in this study are listed in Table 2 and 3 respectively. Phusion DNA

polymerase (Thermo Scientific) was used to produce gene fragments.

Competent cells of S. cerevisiae were prepared as follows: Cells were inoculated in

20 mL YPD liquid media and incubated with shaking of 200 rpm overnight at 30℃. The

OD 600 of the overnight culture was measured and cells were diluted to 0.25 in 50 mL

YPD. The cells were harvested at 5000 rpm for 5 min when the OD 600 reached 0.8~

1.0. Cells were washed twice with sterile water, once with 5 mL of 1 M Sorbitol, and

suspended in 300 μL of 1 M Sorbitol. The competent cells were aliquoted into 50 μL and

frozen at -80℃.

For S. cerevisiae transformation, 15 μL of PCR product, 40 μL of denatured salmon

sperm DNA (100℃ for 10 min, and immediately cooled on ice-water) and 300 μL of

PEG/ LiAc/ TE solution (0.8 mL 50% PEG-3350, 0.1 mL 100 mM Tris-HCl pH7.5 with

10 mM EDTA, 0.1 mL 1M Lithium acetate) were mixed with 50 μL of cells and shaken

for 30 min at 30℃. Cells were mixed with 40 μL DMSO and heat shocked for 15 min at

42℃. Cells were cooled on ice for 1 min and washed once with 1mL YPD. Cells were

finally resuspended in 5 mL YPD, shaken for 2~ 3 hr at 30℃ and plated on either YPD

plates containing appropriate antibiotics or, for cells expressing Ub-K48R, on YND

plates without Uracil. Plates were grown at 30℃ for 2 to 3 days.

The Pex13-mGFP fragment was prepared as follows: The plasmid

pHIPZ-Pex13-mGFP containing H. polymorpha Pex13-mGFP and Zeocin resistance

gene was used as the template. The Zeocin fragment together with its promoter and

terminator was obtained by PCR using the primers ScPex13-mGFP-F and

Tcyc1-dnScP13-R, resulting in a product of 2240 bp with homologous region of

upstream and downstream to PEX13 at both ends. This PCR-based fragment was used

for transformation to obtain strains expressing Pex13-mGFP.

To produce the Pex3-mKate fragment, the plasmid pHIPH-Pex14-mKate2

containing H. polymorpha Pex14-mKate2 and Hygromycin resistance gene was used as

template. The Hygromycin fragment, together with its promoter and terminator, was

obtained by PCR using the primers ScPex3-mKate-F_SRI and ScPex3-mKate-R_SRI,

resulting in a product of 2858 bp with homologous region of upstream and downstream

to PEX3. This fragment was transformed into yeast, to obtains strains expressing

Pex3-mKate.

FOUR Pex13p degradation in S. cerevisiae

132

The Cdc5-HA6 fragment was prepared as follows: A HA6 fragment and

Hygromycin cassette, together with its promoter and terminator sequences, was obtained

by PCR using the primers ScCdc5-HA6-F and HYG-dnCdc5-R and the plasmid

pHIPH-AID-HA6 as template. The resulting 1724 bp product, containing sequences

homologous to the upstream and downstream regions of S. cerevisiae CDC5, was used

for transformation, to obtain a cdc48-3 strain expressing Cdc5-HA6.

The episomal plasmid Yep-Pcup1-myc-Ub-K48R has myc-Ub-K48R cassette under

control of Copper promoter (Pcup1-overexpression promoter), with URA3 marker for

selection in yeast. Yeast episomal plasmids, unlike genome integration, are high copy

plasmids and remain free in the cell. PCR of CUP1 promoter was performed on the

plasmid pCGCN-FAA4-mGFP using primers NotI-CUP1-F and CUP1-BamHI-R,

resulting a fragment of 347 bp. The fragment was further digested with NotI and BamHI,

and cloned into NotI/ BamHI digested pRDV2 vector, generating

pHIPH-Pcup1-myc-Ub-K48R. PCR was performed on the plasmid

pHIPH-Pcup1-myc-Ub-K48R with primers NotI-CUP1-F and UbKR-SacI-R, resulting a

632 bp fragment which was digested with NotI and SacI and cloned into NotI/ SacI

digested pRG226 (ADDGENE), producing a plasmid of 5979 bp, termed as

Yep-Pcup1-myc-Ub-K48R.

PEX11 and PEX13 were endogenously and seamlessly tagged by PCR targeting

with tFT as previously described (Khmelinskii et al, 2014; Khmelinskii et al, 2011).

All integrations were confirmed by colony PCR using Phire Hot Start II (Thermo

Scientific). Strains containing Pex13-mGFP were further checked by fluorescence

microscopy and Western blotting and strains containing Pex3-mKate were further

checked by fluorescence microscopy.

Strains and growth conditions

Yeast transformants were selected on YPD plates containing 2% agar and 100 μg/ml

Zeocin (Invitrogen) or 300 μg/ml Hygromycin (Invitrogen) or on YND plates (6.7g/L

Yeast Nitrogen base w/o Amino acids (DIFCO), 5g/L Glucose (BOOM B.V.)) containing

2% agar, for the Ub-K48R strain. The E. coli strain DH5α was used for cloning

purposes. E. coli cells were grown in LB supplemented with 100 μg/ml Ampicillin at

37 °C. For selection of auxotrophic transformants, selective minimal medium was

supplemented with 2% glucose and the required amino acids mixture. Cycloheximide

(CHX) when used, was added to a final concentration of 6 mg/ml.

All S. cerevisiae liquid cultures were gown while shaking at 200 rpm. S. cerevisiae

cells for TCA lysates, CHX assays and fluorescence microscopy were grown on YM2

Pex13p degradation in S. cerevisiae FOUR

133

media (6.7g/L Yeast Nitrogen base w/o Amino acids (DIFCO), 10g/L Casein hydrolysate

(Sigma), 0.06g/L Uracil (Sigma) and 0.06g/L L-Tryptophan (Sigma)). Cells were first

grown on YM2 supplemented with 2% glucose at 30℃ overnight, then transfer to YM2

plus 0.3% glucose at 2pm on day-2 and grown at 30℃ for 8 hr. Finally cells were

transferred to YM2 plus 0.1% oleic acid (Sigma), 0.1% glucose and 0.05% Tween-80

(YM2O) and grown at 30℃ till an OD600 of around 1.0 (~10-12hr), after which cells

were either harvested for TCA lysates or CHX/fluorescence microscopy experiments

were performed.

For experiments using the Cdc48 temperature sensitive strain cdc48-3, cells

expressing Pex13-mGFP were grown on YM2 plus 2% glucose at 23℃ overnight, then

at 10am on day-2 cells were transferred to YM2 plus 0.3% glucose and grown at 23℃

for 12hr. Finally, cells were transferred to YM2O media and grown further at 23℃. After

17hrs of growth, cells were split into two groups, those for CHX treatment at the

permissive (23℃) temperature and those for CHX treatment at the restrictive (37℃)

temperature. For permissive-temperature growth, cells were grown on YM2O media for

a further 1hr at 23℃ and treated with DMSO or CHX. For restrictive temperature growth,

cells were shifted to 37℃ for 1 hr, treated with DMSO or CHX and grown further at 37℃.

Preparation of yeasts TCA lysates

Cell extracts of TCA-treated cells were prepared for SDS-PAGE as detailed previously

(Baerends et al, 2000). Three OD600 units of cells from each culture (at each time point)

were taken for TCA lysis so that the amount of cells is constant, and after TCA lysis,

equal volume (10μL) of each sample was loaded per lane and blots were probed with

rabbit polyclonal antisera raised against the Myc tag (Santa Cruz Biotech, sc-789),

Pex14p (Bottger et al, 2000), or pyruvate carboxylase 1 (Pyc1p) (Fahimi et al, 1993) or

mouse monoclonal antisera raised against HA tag (Sigma, H3663) or mGFP (Santa Cruz

Biotech, sc-9996). Secondary goat anti-rabbit (31460) or goat anti-mouse (31430)

antibodies conjugated to horseradish peroxidase (Thermo Fisher Scientific) were used

for detection. Pyc1p was used as a loading control.

Quantification of Western blots

Blots were scanned by using a densitometer (GS-710; Bio-Rad Laboratories) and

protein levels were quantified using Image Studio Lite Ver5.2 software (LI-COR

Biosciences). In the case of Pex14p blots, both the phosphorylated and

unphosphorylated forms were included in the calculation if both forms were visible. The

value obtained for each band was normalized by dividing it by the value of the

FOUR Pex13p degradation in S. cerevisiae

134

corresponding Pyc1p band (loading control). For comparison of absolute protein levels

(Figures 2 and 4), normalized values obtained for Pex13p and Pex14p levels in WT cells

were set to 1 and the levels of these proteins in mutant cells are displayed relative to WT.

For CHX experiments (Figures 1, 5, 6 and 7), the normalized values of T0 samples were

set to 1.0 and values obtained from the T1-T3 samples are displayed as a fraction of T0

values. Standard deviations were calculated using Excel. * represents P-values < 0.05,

** represents P-values < 0.01 and *** represents P-values < 0.001. The data presented

are derived from three independent experiments.

Fluorescence Microscopy

All fluorescence microscopy images were acquired using a 100×1.30 NA Plan-Neofluar

objective (Carl Zeiss). Wide-field microscopy images were captured by an inverted

microscope (Axio Scope A1, Carl Zeiss) using Micro-Manager software and a digital

camera (CoolSNAP HQ2; Photometrics). GFP signal was visualized with a 470/440-nm

band pass excitation filter, a 495-nm dichromatic mirror, and a 525/550-nm band pass

emission filter. mKate signal was visualized with a 587/525-nm band pass excitation

filter, a 605-nm dichromatic mirror, and a 647/670-nm band-pass emission filter.

For images taken of Pex13-mGFP in WT grown on oleic acid containing medium,

the optimal settings were mGFP (290, 650) and mKate2 (225, 600), and in pex2, the

optimal settings mGFP (290, 2900) and mKate2 (225, 630) were applied for processing.

The general settings used to compare the signal of Pex13-mGFP in WT and pex2, mGFP

(300, 2000) and mKate2 (225, 620) were applied for processing.

For quantification of the Pex13-mGFP signal in WT or pex2 cells, a rectangular

area was drawn using the “rectangular tool” from ImageJ (Abramoff et al, 2004) to

envelope the region containing the Pex13-mGFP spot and pixel intensity inside the area

was measured. The measured maximum fluorescence intensity of GFP on peroxisomes

was corrected for the background intensity and a box plot was made using Microsoft

Excel. The box represents values from the 25 percentile to the 75 percentile; the

horizontal line through the box represents the median value. Whiskers indicate

maximum and minimum values.

Spot assay

The yeast cells were grown while shaking overnight at 30 °C on YM2 medium

containing 2% glucose. Cells were harvested and washed with water. Each strain with

cells diluted to an OD600nm of 0.1 for the first dilution. The following dilutions were

made successively with 10 μL of previous dilution liquid and 90 μL water. Then 5 μL of

Pex13p degradation in S. cerevisiae FOUR

135

ten-fold serial dilutions of each yeast culture was spotted onto oleic acid plates (YM2O).

The gradient dilution concentrations are specified in figure legends. Growth difference

was measured after incubation at 30 °C for 48 h.

Tandem fluorescent timer (tFT) analysis

The tFT analysis in this study is mainly based on previous established tFT technique,

and the following procedure is adapted from the detailed protocols already published

(Khmelinskii et al, 2014; Khmelinskii et al, 2012). Chromosomal gene tagging and gene

deletion were performed using standard procedures based on PCR targeting as

previously described (Janke et al, 2004). Gene deletion and gene tagging were validated

by PCR. Expression of Pex13p fused to tFT tag which consists of two fluorescent

proteins mCherry and sfGFP was validated using immunoblotting and confirmed with

fluorescence microscopy.

Pex13-tFT was crossed using the synthetic genetic array method (Tong & Boone,

2006) with a yeast strain library which consisted of 152 strains that either lacked a gene

involved in protein degradation or which contained a mutant version of a protein

involved in protein degradation (in case the deletion was lethal), resulting in a library

expressing Pex13-tFT in each mutant. All the colonies used for imaging were prepared

fresh every time. WT and mutant strains expressing Pex13-tFT were first grown on YPD

plates with 2% agar at 30 °C. From agar plates, they were pinned together (Singer

Instruments) on a single plate for mating and diploid selection. Colonies were then

plated on sporulation plates (Potassium Acetate (Sigma) 20g/L, agar 2%). After

sporulation, yeast strains expressing Pex13-tFT fusions were grown at 30 °C in synthetic

complete medium (yeast nitrogen base with amino acid supplements, Sigma)

(Khmelinskii et al, 2012) with 0.1% glucose, 0.1% oleic acid, 0.5% tween and 2% agar.

The tFT library used in this study consists of one WT strain without Pex13-tFT

(used to correct the background signal), one WT with Pex13-tFT fluorescent fusion

protein (used as negative control), and 152 mutants in each of which a gene from UPS

system is disrupted either by deletion for non-essential genes or by mutations for

essential genes. Each plate had 1536 colonies, including Pex13-tFT crossed with UPS

mutants, non-functional fluorescent protein crossed with UPS mutants used for

background correction, and Pex13-tFT crossed with WT as control, with four technical

replicates for each strain. Strains were grown for 7 days, and images were taken every

day. The plates were imaged with an M1000 Pro plate reader equipped with automatic

plate loading stackers (Tecan) and custom temperature control chambers. Measurements

were taken with 10 flashes each for sfGFP (488/10nm excitation, 510/10 nm emission)

FOUR Pex13p degradation in S. cerevisiae

136

and mCherry (587/10 nm excitation, 610/10 nm emission).

The mCherry/ sfGFP ratio of each mutant was the average of four colonies of the

same strain. For the further calculation of Z-score (see below), ratios of fluorescent

intensities were normalized to the WT expressing Pex13-tFT on the same plate on the

same day, and the ratio in WT expressing Pex13-tFT was set to 1.

A Z-score, also known as a standard score, indicates how many standard deviations

an element is from the mean. A Z-score can be calculated from the formula: Z= (X - μ) /

σ. In the formula, Z is the Z-score, X is the value of the element (the average of four

mCherry/ sfGFP intensity ratios of one strain on the plate on the same day), μ is the

population mean (the average of all ratios on the same plate on the same day), and σ is

the standard deviation (the standard deviation of all ratios on the same plate on the same

day). The mCherry and sfGFP fluorescence intensities were measured for colonies from

each strain on each day and the mCherry/sfGFP ratio was calculated and used to

determine the Z-score, the deviation of the ratio for a particular strain on a particular day

compared to the average ratio across all strains on that day. Increases in Z-score are

colour coded, ranging from 1.0 or less (green) to 5.0 (red). The data for each square in

the heat map are derived from four technical replicates. We applied a cut-off of 1 to

screen out most of the background. As for the interpretation of Z-scores, a Z-score less

than 0 represents an element less than the mean and a Z-score greater than 0 represents

an element greater than the mean. A Z-score equal to 1 represents an element that is one

standard deviation greater than the mean while -1 represents one standard deviation less

than the mean.

Acknowledgements

The authors thank Peter van Haastert and Maarten Linskens for helpful discussions and

Arjen Krikken for advice with processing of fluorescence microscopy images. This

work was funded by a VIDI Fellowship (723.013.004) from the Netherlands

Organisation for Scientific Research (NWO), awarded to CW.

Conflict of interest

The authors declare no conflict of interest.

Pex13p degradation in S. cerevisiae FOUR

137

Table 1, S. cerevisiae strains used in this study

Strain Description Reference

WT The SGA entry strain Y8205 (MATα

can1Δ::STE2pr-SpHIS5 lyp1Δ::STE3pr-LEU2

his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) with the genetic

elements (natR) required for seamless protein

tagging, generating the library background strain

yMaM330.

(Khmelinskii

et al, 2014)

(Knop lab)

Pex11-tFT yMaM330, PEX11::mCherry-I-SceIsite-

SpCYC1term-ScURA3-I-SceIsite-mCherryΔN-sfGFP

Knop lab

Pex13-tFT yMaM330, PEX13::mCherry-I-SceIsite-

SpCYC1term-ScURA3-I-SceIsite-mCherryΔN-sfGFP

Knop lab

WT

Pex13-mGFP

Sc WT with Pex13-mGFP (zeoR) This study

WT

Pex13-mGFP+

Pex3-mKate

Sc WT with Pex13-mGFP (zeoR) and Pex3-mKate

(hygR)

This study

WT

myc-Ub-K48R+

Pex13-mGFP

Sc WT with myc tagged Ub-K8R (URA) and

Pex13-mGFP (zeoR)

This study

BY4741 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 (Khmelinskii

et al, 2014)

(Knop lab)

UPS deletion

library

BY4741, goi deletions::kanMX (Khmelinskii

et al, 2014)

(Knop lab)

pex2 Sc WT cell deleted PEX2 (BY4741, pex2::kanMX) Knop lab

pex2+

Pex13-mGFP

pex2 with Pex13-mGFP (zeoR) This study

pex2+

Pex13-mGFP+

Pex3-mKate

pex2 with Pex13-mGFP (zeoR) and Pex3-mKate

(hygR)

This study

pex4 Sc WT cell deleted PEX4 (BY4741, pex4::kanMX) Knop lab

pex4+

Pex13-mGFP

pex4 with Pex13-mGFP (zeoR) This study

FOUR Pex13p degradation in S. cerevisiae

138

ufd4 Sc WT cell deleted UFD4 (BY4741, ufd4::kanMX) Knop lab

ufd4+

Pex13-mGFP

ufd4 with Pex13-mGFP (zeoR) This study

ubc4 Sc WT cell deleted UBC4 (BY4741, ubc4::kanMX) Knop lab

ubc4+

Pex13-mGFP

ubc4 with Pex13-mGFP (zeoR) This study

atg12 Sc WT cell deleted ATG12 (BY4741,atg12::kanMX) Knop lab

atg12+

Pex13-mGFP

atg12 with Pex13-mGFP (zeoR) This study

ubr2 Sc WT cell deleted UBR2 (BY4741, ubr2::kanMX) Knop lab

ubr2+

Pex13-mGFP

ubr2 with Pex13-mGFP (zeoR) This study

cdc48-3 Temperature sensitive (ts) mutant cdc48-3 contains

a heat-sensitive allele of CDC48, with permissive

(23℃) or the restrictive temperature (37℃)

(Cao et al,

2003)

cdc48-3+

Pex13-mGFP

cdc48-3 with Pex13-mGFP (zeoR) This study

cdc48-3+

Cdc5-HA6

cdc48-3 expressing Cdc5 with HA6 tag fused to its

C-terminus, hygR

This study

Table 2, plasmids used in this study

Plasmid Description Reference

pHIPZ-Pex13-mGFP C-terminal part of Pex13 fused

with mGFP, zeoR

; ampR

(Knoops et al,

2014)

pHIPH-Pex14-mKate2 Plasmid containing the C-terminal

region of H. polymorpha PEX14

fused to mKate2; hygR

; ampR

(Chen et al, 2018)

Yep Pcup1-myc-Ub-K48R Yeast episomal plasmid (URA)

containing Ub-K48R fused to myc

tag on its N-terminus, under

control of Copper ion inducible

promoter

This study

pCGCN-FAA4-mGFP Plasmid for S. cerevisiae

containing Pcup1, FAA4, mGFP,

(Saraya et al,

2010)

Pex13p degradation in S. cerevisiae FOUR

139

natR, amp

R

pRDV2 Myc tagged ubiquitin mutate

(Ub-K48R) under control of

DHAS promoter, zeoR

; ampR

(Williams & van

der Klei, 2013b)

pHIPH-Pcup1-Myc-Ub-K48R Plasmid containing myc tagged

Ub-K48R under control of CUP1

promoter, hygR

; ampR

This study

pRG226 The episomal E. coli/ S. cerevisiae

shuttle vector (empty backbone),

URA ; ampR

(Gnügge et al,

2016)

pHIPH-AID-HA6 Plasmid containing Auxin

Inducible Degron (AID) with

6xHA tag at its C-terminus, hygR

;

ampR

(Morawska &

Ulrich, 2013)

Table 3, primers used in this study

Primer Sequence Description

ScPex3-mKate-F_SRI AGCGCCAGCGTATACAG

CAACTTTGGCGTCTCCA

GCTCGTTTTCCTTCAAG

CCTATGGTTTCTGAACT

CATCAAGGA

To clone a fragment of 2858

bp containing 3’end of S.

cerevisiae PEX3 fused to

mKate with Hygromycin

resistance, forward primer,

used to make strain

Pex3-mKate

ScPex3-mKate-R_SRI TACGCTATATATATATATA

TTCTGGTGTGAGTGTCA

GTACTTATTCAGAGATTA

CGTTTTCGACACTGGAT

GGCGGC

To clone a fragment of 2858

bp containing 3’end of S.

cerevisiae PEX3 fused to

mKate Hygromycin

resistance, reverse primer,

used to make strain

Pex3-mKate

Pex3mKate-cPCR-F1 GGCAGCGTGAACGAAT

AC

To check the positive colonies

containing Pex3-mKate in the

colony PCR, forward primer

FOUR Pex13p degradation in S. cerevisiae

140

Pex3mKate-cPCR-R1 CTAGCCACTGCCACTTC

G

To check the positive colonies

containing Pex3-mKate in the

colony PCR, reverse primer

ScPex13-mGFP-F TAAAAAGACGGAAGAA

AATTGAGCATGTTGATG

ATGAAACGCGTACACAC

AGATCTGTGAGCAAGG

GC

To clone a fragment of 2240

bp containing 3’end of S.

cerevisiae PEX13 fused to

mGFP with Zeocin resistance,

forward primer, used to make

strain Pex13-mGFP

Tcyc1-dnScP13-R TAGATTTTACTATATATAT

ATGCGAATATATGTGTGC

AAATATTGATGCACTGT

ACAGAAAAAAAAGAAA

AATTTG

To clone a fragment of 2240

bp containing 3’end of S.

cerevisiae PEX13 fused to

mGFP with Zeocin resistance,

reverse primer, used to make

strain Pex13-mGFP

ScPex13-F TACGGTGCAGGAGCG To check the positive colonies

containing Pex13-mGFP in the

colony PCR, forward primer

mGFP-reverse_SRI AAGTCGTGCTGCTTCAT

GTG

To check the positive colonies

containing Pex13-mGFP in the

colony PCR, reverse primer

NotI-CUP1-F GCATGCGGCCGCCCCTT

TATTTCAGGCTGAT

To clone the 347 bp of CUP1

promoter, forward primer

CUP1-BamHI-R GTGCGGATCCTTTATGT

GATGATTGATTGATTGAT

To clone the 347 bp of CUP1

promoter, reverse primer

UbKR-SacI-R GTGCGAGCTCTCAACCA

CCTCTTAGTCTTAAG

To clone a 632 bp fragment

containing Pcup1 and

myc-Ub- K48R, reverse

primer

ScCdc5-HA6-F CTTTGATAAAGGAAGGT

TTGAAGCAGAAGTCCA

CAATTGTTACCGTAGATT

ACCCATACGATGTTCCT

GACTATGC

To clone a fragment of 1724

bp containing 3’end of S.

cerevisiae CDC5 fused to HA6

tag with Hygromycin

resistance, forward primer,

used to make strain

Cdc5-HA6, forward primer

Pex13p degradation in S. cerevisiae FOUR

141

HYG-dnCdc5-R CAATGGACTGGTAATTT

CGTATTCGTATTTCTTTC

TACTTTAATATTGGTTCG

AGATTATTCCTTTGCCCT

CGG

To clone a fragment of 1724

bp containing 3’end of S.

cerevisiae CDC5 fused to HA6

tag with Hygromycin

resistance, forward primer,

used to make strain

Cdc5-HA6, reverse primer

142

5

Chapter 5

Insights into fungal peroxisome function gained from organellar proteomics based

approaches

Xin Chen and Chris Williams

This chapter has been published as a book chapter:

Chen, X., & Williams, C. (2018). Fungal Peroxisomes Proteomics. In Proteomics of

Peroxisomes (pp. 67-83). Springer, Singapore.

FIVE Proteomics of fungal peroxisomes

144

Insights into fungal peroxisome function gained from organellar proteomics based

approaches

Xin Chen and Chris Williams*

1Molecular Cell Biology, Groningen Biomolecular Sciences and Biotechnology Institute,

University of Groningen, 9747AG, the Netherlands.

*Corresponding author (c.p.williams@rug.nl)

Abstract

Peroxisomes in fungi are involved in a huge number of different metabolic processes. In

addition, non-metabolic functions have also been identified. The proteins that are present

in a particular peroxisome determine its metabolic function, whether they are the matrix

localized enzymes of the different metabolic pathways or the membrane proteins

involved in transport of metabolites across the peroxisomal membrane. Other

peroxisomal proteins play a role in organelle biogenesis and dynamics, such as fission,

transport and inheritance. Hence, obtaining a complete overview of which proteins are

present in peroxisomes at a given time or under a given growth condition provides

invaluable insights into peroxisome biology. Bottom up approaches are ideal to follow

one or a few proteins at a time but they are not able to give a global view of the content

of peroxisomes. To gain such information, top down approaches are required and one

that has provided valuable insights into peroxisome function is mass spectrometry based

organellar proteomics. Here, we discuss the findings of several such studies in yeast and

filamentous fungi and outline new insights into peroxisomal function that were gained

from these studies.

Keywords: Proteomics, Peroxisome, Fungi, Yeast, Mass spectrometry, Protein

localization

Proteomics of fungal peroxisomes FIVE

145

Abbreviations:

APEX Ascorbate peroxidase

DDA Data-dependent Acquisition

DIA Data-independent Acquisition

ESI Electro-spray Ionization

GFP Green fluorescent protein

GPF Gas Phase Fractionation

ICAT Isotope-coded affinity tags

MALDI Matrix Assisted Laser Desorption Ionization

MS Mass Spectrometry

MS/MS Tandem Mass Spectrometry

µLC Micro Liquid chromatography

nHPLC High performance liquid chromatography

nLC Nano Liquid chromatography

PMP Peroxisomal membrane protein

PNS Post nuclear supernatant

PTS Peroxisomal targeting signal

ROS Reactive oxygen species

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

SGD Saccharomyces cerevisiae Genome Database

SILAC Stable Isotope Labeling by Amino acids in Cell culture

FIVE Proteomics of fungal peroxisomes

146

1 Introduction

Peroxisomes are eukaryotic organelles that are involved in a wide range of metabolic

functions. Some general peroxisomal functions are the oxidation of fatty acids and

detoxification of hydrogen peroxide (Smith & Aitchison, 2013b). Specific functions

include the synthesis of plasmalogens, cholesterol and bile acids in mammals (Van den

Bosch et al, 1992) while plant peroxisomes can house enzymes involved in amongst

others, the glyoxylate cycle or photorespiration (Mano & Nishimura, 2005). In this

chapter, we will discuss on fungal peroxisomes, focussing particularly on peroxisomes

in unicellular yeasts and filamentous fungi.

A very well-known species of yeast is Saccharomyces cerevisiae, which is used in the

bakery, winery and brewery industries. S. cerevisiae is also widely used as model

organism to study a huge range of biochemical, genetic and cell biological processes and

much of our understanding on the biogenesis and function of yeast peroxisomes comes

from studies in S. cerevisiae. However, the study of peroxisomes in yeast is not limited

to this organism and a plethora of data are available from studies conducted with other

yeast species, including Cryptococcus neoformans, Candida albicans, Candida boidinii,

Ustilago maydis, Yarrowia lipolytica, Hansenula polymorpha and Pichia pastoris.

Filamentous fungi are multicellular organisms that grow in a branched (filamentous)

form, termed hyphae. A number of filamentous fungi are utilized for food production,

such as certain species of Aspergillus that are used to produce Japanese Sake while

another, Penicillium chrysogenum, is used to produce penicillin, as well as a range of

bioactive secondary metabolites.

Like peroxisomes from other organisms, fungal peroxisomes also house a wide range

of metabolic pathways, allowing them to be involved in many different cellular

functions. In many yeasts, fatty acid β-oxidation takes place exclusively in peroxisomes,

as opposed to in higher eukaryotes (Kindl, 1993; Kunau et al, 1988). In this respect,

filamentous fungi are somewhat different. Aspergillus nidulans, supplementary to its

peroxisomal β-oxidation system, is able to perform β-oxidation of fatty acids in the

mitochondria (Flavell & Woodward, 1971) while the closely related Neurospora crassa

degrades fatty acids in glyoxysomes, a specialized form of peroxisome found in plants

and certain fungi (Kionka & Kunau, 1985). N. crassa (as well as several other

filamentous fungi) is particularly interesting because it contains, additional to

glyoxysomes, another specialized type of peroxisome called a Woronin body. In case of

hyphal injury, Woronin bodies act as a plug to stop leakage of the cytoplasm (Jedd &

Chua, 2000), a fascinating, non-metabolic role for peroxisomes in cell vitality. Some

additional peroxisomal functions in yeasts include the oxidation of methanol (Van

Proteomics of fungal peroxisomes FIVE

147

Dijkan et al, 1982) and the metabolism of primary amines (Zwart et al, 1983) while

peroxisomes from the filamentous fungus P. chrysogenum contain the enzymes that

produce penicillin (Müller et al, 1992; Müller et al, 1991), one of the most important

drugs of all time.

2 Organellar Proteomics on Peroxisomes in Fungi

In fungi peroxisome function is extremely diverse and depends heavily on species as

well as the growth conditions. To obtain a complete understanding of the function(s) of

the peroxisome in a given cell under a given condition, a comprehensive overview of the

proteins present in these peroxisomes is crucial. The peroxisomal localization of many

metabolic pathways has been determined through bottom up approaches, using cell

fractionation methods or microscopy approaches (immunofluorescence,

immunolabelling, genetic tagging with fluorescent proteins). However, these methods

require prior knowledge of the protein in question, such as protein sequence, the

presence of targeting signals, putative function etc. and may therefore not be applicable

when the goal is to identify novel peroxisomal pathways. Furthermore, cells sometimes

house certain enzymes of a metabolic pathway in different compartments, potentially

making it a challenge to say that the localization of one protein from the pathway is

representative for the entire pathway.

Such situations call for the use of top down approaches and mass spectrometry (MS)

based proteomics methods have proved invaluable when studying the peroxisomal

proteome. Here, we summarize the findings of several MS based organellar proteomics

studies in yeast and filamentous fungi, outlining the new insights into peroxisomal

metabolism and function gained from these studies.

2.1 Organellar Proteomics on Peroxisomes from S. Cerevisiae

The earliest characterization of S. cerevisiae peroxisomes using proteomics was

performed by Schäfer et al. (Schäfer et al, 2001). Peroxisomes were isolated from oleate

grown cells through the use of differential centrifugation, followed by sucrose and

Accudenz density gradient centrifugation. Peroxisomes were lysed by osmotic shock

and peroxisomal membrane fractions were extracted and subjected to sodium dodecyl

sulphate polyacrylamide gel electrophoresis (SDS-PAGE) analysis. Following in gel

digestion, peptides were extracted and analysed with three different types of mass

spectrometry: matrix assisted laser desorption ionization (MALDI) MS, micro liquid

chromatography electrospray ionization (µLC-ESI) MS and nano liquid chromatography

ESI-MS (nLC-ESI-MS). A total of 6 known peroxisomal membrane proteins (PMPs)

FIVE Proteomics of fungal peroxisomes

148

were identified, as well as 19 known peroxisomal matrix proteins, even though

peroxisomal membrane fractions were analysed. The authors did not comment further

on this aspect, but it may suggest that certain peroxisomal matrix proteins are associated

with the membrane. Indeed, a previous report suggested that the matrix protein Fat2p

(also known as Pcs60p), one of the proteins identified in this proteomics approach, is

membrane associated (Blobel & Erdmann, 1996). What this could mean in terms of

peroxisome function remains unclear.

Another interesting observation in this work was the identification of a phos-

phorylation site at Threonine 711 in the long chain fatty acid CoA ligase2 (Faa2p).

Peptides corresponding to both the phosphorylated and unphosphorylated forms were

identified, with the phosphorylated form displaying a lower signal. This could suggest

that the unphosphorylated form is the major species in vivo, although this difference in

signal intensity may be due to poor ionisation of phosphorylated peptides compared to

unphosphorylated peptides, as has been reported before (Steen et al, 2006). In a later

high throughput study, the phosphorylation status of Faa2 was confirmed (Albuquerque

et al, 2008) yet the function of this post-translational modification remains unknown.

The success of proteomics approaches is influenced by protein abundance, with

highly abundant proteins providing the majority of peptides present in a given sample,

which may in turn potentially mask lower abundant ones. Since peroxisomal matrix

proteins are likely to be much more abundant that most PMPs, approaches that regress

this balance can be extremely helpful when studying the proteome of peroxisomes. In

the above-mentioned study, Schäfer and colleagues analysed membrane fractions, rather

than whole organelles, to aid in the identification of low abundant PMPs. A similar

approach was utilised in (Yi et al, 2002). However, in order to enhance the recovery of

peptides for proteomics analysis, the authors performed tryptic digestion directly on the

isolated peroxisomal membrane fractions, rather than on gel pieces after electrophoresis.

Their approach was further enhanced through the use of gas-phase fractionation (GPF)

in combination with nLC-ESI-MS/MS. GPF relies on the separation of peptide ions in

the gas-phase of the mass spectrometer, according to their m/z value, which allows for

increased peptide coverage and reproducibility (Davis et al, 2001; Spahr et al, 2001). Yi

et al. identified 181 proteins, including 38 known peroxisomal proteins. At this time, 41

proteins were either identified or predicted to be peroxisomal, demonstrating that the

authors has a coverage of ~90% with their analysis. Of note is the identification of

Pex5p in their study. Pex5p only transiently associates with peroxisomes during the

matrix protein import cycle (Kragt et al, 2005), indicating the sensitivity of their

approach.

Proteomics of fungal peroxisomes FIVE

149

While these two publications (Schäfer et al, 2001; Yi et al, 2002) clearly established

that it was possible to isolate peroxisomes for proteomics based study, they also

demonstrated one of the major drawbacks when it comes to such approaches, namely

that of contamination. Indeed, ~45% of the proteins identified in peroxisomal membrane

fractions by Schäfer et al. (2001) and ~75% of those identified in Yi et al. (2002) were

not described as peroxisomal, based on experimental evidence or prediction programs,

which raises the question whether these proteins are previously uncharacterised

peroxisomal proteins or contaminants? In the case of proteins such as the mitochondrial

membrane proteins Cyt1p and Tom40p, contamination is very probably the explanation

for their presence. However, the situation is less clear for other proteins. For example,

both studies identified Cat2p, a carnitine acetyl transferase, in their analysis. Cat2p

displays dual localisation in the peroxisome and mitochondria (Elgersma et al, 1995),

raising the question whether this protein can be considered a genuine peroxisomal

protein or a contaminant when identified in proteomics approaches? Furthermore,

Schäfer et al. classified the glycerol-3-phosphate dehydrogenase1protein (Gpd1p) as a

cytosolic contaminant while later studies demonstrated that this protein does indeed

localise to peroxisomes (see below) (Jung et al, 2010; Kumar et al, 2016; Marelli et al,

2004). Hence, methods that allow for the discrimination of contaminants from bona fide

peroxisomal proteins can aid enormously in organellar proteomics approaches by

narrowing down the number of potential peroxisomal proteins that require further

validation. With this in mind, the chapter by Islinger et al. in this book is of interest

(Islinger et al, 2018).

To tackle this, Marelli et al. utilized quantitative mass spectrometry to identify novel

peroxisomal proteins in S. cerevisiae (Marelli et al, 2004). In this study, the authors

combined isopycnic density gradient fractionation with isotope-coded affinity tags

(ICAT) to discriminate between peroxisomal proteins and contaminants. ICAT is an

approach that relies on the chemical labelling of proteins from two different fractions

with chemically identical but isotopically different tags (Gygi et al, 1999). The two

fractions are then mixed and the relative abundance of isotopically labelled peptides can

be determined using MS analysis. The relative ratio between peptides in the two

fractions will give information on whether these peptides, and hence the proteins from

which they are derived, are enriched in one fraction compared to the other. Marelli et al.

took two approaches: in the first (ICAT I), membrane fractions isolated from

peroxisomes and mitochondria derived from oleate grown cells were differentially

treated with ICAT reagents and subjected to µLC-ESI-MS/MS analysis (Fig. 1).

FIVE Proteomics of fungal peroxisomes

150

Fig.1 Schematic depiction of the use of isotope-coded affinity tag (ICAT) reagents to

identify mitochondrial contaminants in peroxisomal fractions, as described in (Marelli et

al, 2004).

Peroxisomes (depicted in green) and mitochondria (in blue) were individually isolated and a

membrane fraction was prepared. Proteins isolated from the mitochondrial fraction (blue

hexagons) were treated with light ICAT reagent (red), while those isolated from the

peroxisomal fraction (green bars) were treated with heavy ICAT reagent (yellow). Next the

treated fractions were mixed and subjected to trypsin digest and mass spectrometry and the

ratio between heavy and light versions of peptides were calculated. A high heavy to light

ratio indicates that the peptide is much more abundant in the peroxisomal fraction compared

to the mitochondrial fraction, identifying this peptide as likely originating from a bona fide

peroxisomal protein. A low heavy to light ratio indicates that the peptide is not enriched in

the peroxisomal fraction, identifying it as likely contaminant.

In the second approach (ICAT II), a peroxisomal membrane fraction was isolated

from oleate grown cells that produced a Protein-A tagged version of the PMP Pex11p.

This fraction was split into two and one fraction was subjected to affinity purification

using IgG beads. Both this affinity-purified fraction, together with the untreated

membrane fraction were differentially treated with ICAT reagents and subjected to

µLC-ESI-MS/MS. ICAT I identified a total of 346 proteins, of which 23 were known

peroxisomal components according to the Saccharomyces genome database (SGD)

while 134 were described as mitochondrial. However, comparison of the relative peptide

ratios suggested that 57 of the 346 were in fact peroxisomal proteins. Of these 57, 18

were previously described as peroxisomal and none as mitochondrial, demonstrating

that the ICAT I approach can be effectively used to discriminate between genuine

Proteomics of fungal peroxisomes FIVE

151

peroxisomal proteins and mitochondrial contaminants. ICAT II identified 365 proteins

but when the peptide ratios were taken into consideration, 98 proteins were suggested to

be peroxisomal, with 28 annotated as peroxisomal in the SGD. These data indicate that

ICAT II was able to identify more proteins than ICAT I, likely because the mixture was

less complex due to the affinity purification step. However, the authors state that ICAT I

would not help in identifying proteins that target to both peroxisomes and mitochondria

because such proteins would be considered mitochondrial contaminants in this approach.

ICAT II on the other hand would be able to identify such dually localised proteins but

was less efficient at identifying mitochondrial contaminants.

The authors integrated the ICAT I data into the list of 98 proteins suggested to be

peroxisomal based on the ICAT II approach and split the list of candidate proteins into

three groups. Group 1 contained 25 proteins with high peroxisomal abundance ratios

based on ICAT I. Group 2 consisted of 27 proteins with high peroxisomal abundance

ratios in ICAT I but low ratios in ICAT II. The authors concluded that these were in fact

mitochondrial contaminants. Group 3 contained 46 proteins that were predicted to be

peroxisomal in ICAT II but were not identified in ICAT I. To validate their findings the

authors tagged three proteins from Group 1 (Ybr159w, Rho1p and Faa1p) and five from

Group 3 (Erg6p, Emp24p, Gdp1p, Erg1p and Spf1p) with Protein-A and determined

their sub-cellular localisation using isopycnic density gradient fractionation. These eight

candidates were chosen because they are known to localise to different cellular

compartments, including the cytosol (Gdp1p), the ER (Spf1p, Ybr159w and Emp24p),

lipid bodies (Faa1p, Erg1p and Erg6p) and plasma/ endo-membranes (Rho1p). The

fractionation data clearly demonstrated that all eight proteins targeted partially to

peroxisomes while additional fluorescence microscopy analysis of green fluorescent

protein (GFP) fusions of Rho1p, Gdp1p and Emp24p further confirmed that these

proteins can partially localise to peroxisomes. The localisation of Erg1p-GFP was

unclear but appeared to be close to peroxisomes.

Localisation is one thing, but the question remained as to what the function of these

proteins in or at peroxisomes could be. To address this aspect, the authors chose to study

the role of Rho1p, a small, ras-related GTPase, in peroxisome biology. Rho1p functions

in signal transduction and has been shown to regulate actin reorganisation (Fujiwara et

al, 1998; Nonaka et al, 1995; Yamochi et al, 1994). The authors demonstrated that

Rho1p targets to peroxisomes in cells grown on oleate and not on glucose, which led

them to suggest that the reason Rho1pwas not previously localised to peroxisomes was

because most studies of Rho1p were performed with glucose grown cells. Peroxisomes

were smaller and lower in number in cells containing a temperature sensitive mutant

FIVE Proteomics of fungal peroxisomes

152

form of rho1 while Rho1p interacts with the peroxisome biogenesis factor Pex25p and

requires Pex25p for its peroxisomal localisation, suggesting a link between Rho1p and

peroxisome fission/ biogenesis. Finally, the authors demonstrated that actin disassembly

at peroxisomes is controlled by Rho1p and Pex25p, leading to the suggestion that Rho1p

plays a role in peroxisome fission by dissembling actin at fission sites in order to allow

Pex11p and other proteins involved in peroxisomal fission to finalise the fission event.

Taken together, this report elegantly demonstrates that quantitative proteomics can be

used to identify previously unknown peroxisomal proteins in order to shed new light

onto peroxisome biogenesis.

It is worthy to note here that isotope labelling of proteins can also be performed

metabolically, using a method called Stable Isotope Labelling by Amino acids in Cell

culture (SILAC). Rather than using a chemical approach to modify proteins or peptides

after isolation, as ICAT does, SILAC relies on the cells themselves to incorporate the

isotopically labelled amino acids Lysine and Arginine residues into proteins. Cells are

grown in the presence of “heavy” or “light” versions of these amino acids, samples are

mixed and subjected to MS and the relative ratios of the heavy and light forms of the

peptides can be used to identify contaminants. Although this method has not been used

in organellar proteomics on fungi, it has been successfully used when investigating the

interaction partners of yeast peroxisomal proteins (David et al, 2013; Oeljeklaus et al,

2012; Piechura et al, 2012).

Because peroxisomes are metabolic organelles, the protein content of peroxisomes

depends very much on the metabolic needs of the cell. Peroxisomes contain an import

system that can react to the metabolic needs of the cell (Nonaka et al, 1995; Yifrach et al,

2016), which means that peroxisomal protein content is dynamic and condition specific.

Measuring the change in subcellular localisation with bottom up approaches such as live

cell imaging can provide invaluable information on the dynamic properties of a given

protein. However, such properties are challenging to measure in top down approaches

that seek to characterise global changes in protein localisation. One reason for this is the

difficulty that is encountered when comparing samples of different origins, such as

peroxisomes isolated from cells grown on glucose compared to peroxisomes isolated

from cells grown on oleate. Classical MS approaches often rely on the data-dependent

acquisition (DDA) method, a semi-random process that effectively selects ionized

peptides with high signal to noise ratios for further analysis. Because of this, ions of low

signal to noise ratio may be “ignored” by the detector. Hence, a given peptide ion may

have a low signal to noise ratio in one sample, meaning that it is underrepresented, while

the same peptide ion may have a high signal to noise ratio in another sample, meaning

Proteomics of fungal peroxisomes FIVE

153

that it is overrepresented. Because of this bias in sampling, valuable data may become

lost. To address this issue, Jung et al. (2010) employed a data independent acquisition

(DIA) approach to investigate global differences in protein distribution in cells grown on

glucose compared to those grown on oleate. Although they did not focus on peroxisomes

in this report, their data did elegantly demonstrate that protein redistribution can occur

on many different levels. Enzymes involved in metabolic processes associated with fatty

acid processing underwent strong upregulation and redistribution to organelles in

response to exposure to oleate whereas proteins involved in peroxisomal organisation

(such as the docking factors Pex3p and Pex14p) also redistributed to organelles in

response to oleate treatment yet they were not strongly upregulated. While this may not

seem surprising at first glance, it does provide a very interesting insight into the

behaviour of these different classes of proteins on a global scale and it also provides a

benchmark that can be utilised to assess the role of proteins with unknown functions.

2.2 The Proteome of Peroxisomes in N. Crassa

The filamentous fungus N. crassa possesses two types of peroxisomes: glyoxysomes and

Woronin bodies. Glyoxysomes in N. crassa, like peroxisomes in many organisms, house

enzymes required for β-oxidation. However, they also contain enzymes of the glyoxylate

cycle, a metabolic pathway that allows for the conversion of acetyl-CoA to succinate,

which is then used further for carbohydrate production (Flavell & Woodward, 1971).

The β-oxidation pathway in glyoxysomes is somewhat different from that in other yeasts.

Rather than relying on an acyl-CoA oxidase to perform the dehydration of the fatty

acyl-CoA species, the first step in the β-oxidation pathway, glyoxysomes instead use

acyl-CoA dehydrogenase to perform this function. This alternative mechanism does not

generate hydrogen peroxide and subsequently, glyoxysomes from N. crassa do not

contain catalase, the major detoxifier of hydrogen peroxide in peroxisomes (Schliebs et

al, 2006). Woronin bodies, on the other hand, perform a non-metabolic function. They

stop the loss of cytoplasm upon hyphal injury by acting as a plug (Jedd & Chua, 2000).

Interestingly, Woronin bodies seem to form from glyoxysomes. First the protein

Hexagonal 1 (HEX1) is imported to glyoxysomes through its Peroxisomal targeting

signal type 1 (PTS1), after which it forms a large, hexagonal crystal. The Woronin body,

complete with HEX1 crystal, then buds off from the glyoxysome through fission (Liu et

al, 2008; Managadze et al, 2007).

In order to gain a better understanding of the protein content of these two specialized

forms of peroxisomes, Managadze et al. performed organellar proteomics upon isolated

glyoxysomes and Woronin bodies from N. crassa (Managadze et al, 2010). Woronin

FIVE Proteomics of fungal peroxisomes

154

bodies were purified from a post nuclear supernatant (PNS) isolated from sucrose grown

cells through the use of a linear sucrose gradient. Samples were subjected to SDS-PAGE

and fractions that contained the most amount of the Woronin body marker protein HEX1

and the least amount of glyoxysomal and mitochondrial contaminants were pooled and

subjected to SDS-PAGE and coomassie staining. The authors observed 15 protein bands

on the gel after these steps and these 15 bands were excised, subjected to in-gel

digestion and peptides were analysed by nano High-Performance Liquid

Chromatography (nHPLC) ESI-MS/ MS. As could be expected, the major component

identified was HEX1. The authors did identify a number of additional proteins but since

these corresponded to ribosomal and mitochondrial proteins, they concluded that these

likely represented contaminants. However, this approach did identify NCU00627, a

protein of unknown function with homologues in other filamentous fungi. Whether this

is a bona fide Woronin protein and if so, what its role might be, are questions that remain

to be answered.

The authors had more luck with their organellar proteomics approach on glyoxysomes.

Glyoxysomes were isolated from a PNS derived from oleate grown cells and subjected

to “density barrier centrifugation”. In this approach, the organellar pellet was mixed

with iodixanol to a final concentration of 23.5% and this mix was layered onto a denser

solution of iodixanol (35%). After centrifugation, glyoxysomes concentrate at the

interface between the two densities; the “barrier”. Glyoxysomes were then disrupted

with SDS and heating and the resulting protein fraction was subjected to reverse phase

chromatography, SDS-PAGE analysis and coomassie staining. Visible protein bands

were excised and subjected to in gel digestion and the peptides were analysed by

nHPLC-ESI-MS/MS. This approach led to the identification of 191 proteins. Amongst

this list, the authors noted that 16 proteins contained a putative PTS1 sequence while 3

contained a putative PTS2 sequence and although the rest lacked a recognisable

targeting sequence, they noted a number of proteins that were functionally linked to

glyoxysomes, such as isocitrate lyase (ICL), which was shown to be peroxisomal in

Aspergillus nidulans (Valenciano et al, 1998).

The authors validated their results through the use of fluorescence microscopy,

showing that three candidates from the list of PTS1 proteins indeed targeted to

peroxisomes. The three proteins they chose were NCU02287, NCU08924 and

NCU04803. The first two are putative acyl-CoA dehydrogenases (which the authors

named ACD1 and ACD2) and confirmation of their glyoxysomal localisation was

significant because up until this point, the identity of the acyl-CoA dehydrogenase

required for β-oxidation in glyoxysomes was unknown. Interestingly, the authors also

Proteomics of fungal peroxisomes FIVE

155

identified a fumarate reductase homologue in the list of the 191 putative glyoxysomal

proteins. As mentioned, the first step of β-oxidation in glyoxysomes is a dehydration

reaction, performed by acyl-CoA dehydrogenase. The authors speculate that this

fumarate reductase enzyme could be involved in the re-oxidation of the co-factor that is

required by acyl-CoA dehydrogenase.

The third candidate which the authors tagged with GFP for localisation studies was a

2-nitropropane dioxygenase (now referred to as nitronate monooxygenase), which they

named NPD1. Another protein (NCU09931), which possessed similar domain structure

as well as a PTS1, was identified in the proteomics screen. The authors termed this

candidate NPD2 and propose that these enzymes are involved in the detoxification of

nitroalkanes, which may play a role in protecting N. crassa against nitroalkanes excreted

by other organisms (Alston et al, 1977; Hipkin et al, 1999). Taken together, these data

identified a novel enzymatic activity housed within peroxisomes, expanding the role of

peroxisomes in cell metabolism.

2.3 Identification of Peroxisomal Matrix Proteins in P. Chrysogenum

Peroxisomes in the filamentous fungus P. chrysogenum are important to the medical and

industrial sectors because they house the enzymes that produce penicillin (Müller et al,

1992; Müller et al, 1991). With this in mind, knowledge on the protein content of

peroxisomes in this organism can help in understanding how penicillin and other

secondary metabolites are produced. This led Kiel and colleagues to investigate the

proteome of peroxisomes in P. chrysogenum (Kiel et al, 2009). Peroxisomes were

isolated with a sucrose density gradient from a PNS, lysed by osmotic shock and the

matrix protein fraction was analysed by SDS-PAGE, coomassie staining and in-gel

digestion. The subsequent peptide mix was subjected to nHPLC-MS/MS, leading to the

identification of more than 500 proteins. A significant portion of these (119) were

involved in translation, which could represent a large amount of ribosomal

contamination. However, the authors demonstrated with electron microscopy analysis

that ribosomes sometimes associated with isolated peroxisomes. The authors therefore

suggested that rather than representing contamination, these may be ribosomes

translating peroxisomal proteins at the peroxisomal membrane. Since this study, Zipor et

al. demonstrated that mRNA translation of peroxisomal proteins can indeed occur in

close proximity to peroxisomes in S. cerevisiae (Zipor et al, 2009), which could validate

the authors theory.

The remaining proteins were manually annotated and classified based on their

potential localisation within the cell and the authors listed a total of 89 putative

FIVE Proteomics of fungal peroxisomes

156

peroxisomal proteins. Many proteins contained a PTS1 (69) while 10 more contained a

putative PTS2, strongly suggesting that they indeed target to peroxisomes. A further 10

proteins that lacked a PTS were deemed likely to be peroxisomal, either because they

were particularly abundant in the preparation, because of function (e.g. several were

involved in b-oxidation, which is often a peroxisomal process) or because of previous

data on their localisation, such as ICL (see above).

Of the 89 putative peroxisomal proteins, many were enzymes that take part in

metabolic pathways, such as penicillin production, fatty acid β-oxidation, the glyoxylate

cycle and nitrogen metabolism. Furthermore, a number of enzymes involved in the

detoxification of ROS were identified, as were several thioesterases. Finally, the

peroxisomal role of around 35 of the 89 enzymes identified in the approach was not

clear from their putative function, which was defined by their homology to other

enzymes. It is worthy to note that the authors identified one acyl-CoA oxidase and four

acyl-CoA dehydrogenases in their proteomic approach. As mentioned, fatty acid

β-oxidation generates hydrogen peroxide when acyl-CoA oxidase catalyses the first step

in the cascade whereas this is not the case when the first step is catalysed by acyl-CoA

dehydrogenase. This high number of acyl-CoA dehydrogenases could suggest that fatty

acid β-oxidation occurs via a dehydration step in P. chrysogenum peroxisomes. In

support of this, the author also identified a Fumarate reductase homologue (Pc12g0390)

in their proteomic approach and confirmed its localisation using GFP tagging and

fluorescence microscopy. This enzyme may play a role in the re-oxidation of co-factors

required by acyl-CoA dehydrogenase for fatty acid β-oxidation, as was suggested for the

N. crassa orthologue (see above). However, the authors also identified several catalase

like enzymes in their proteomics approach, indicating that P. chrysogenum peroxisomes

are a likely site of hydrogen peroxide production. Furthermore, later studies

demonstrated that additional acyl-CoA oxidases target to peroxisomes and that these

enzymes are involved in fatty acid β-oxidation (Veiga et al, 2012). Clearly further

studies are required to investigate the intricate nature of peroxisomal fatty acid

β-oxidation in P. chrysogenum.

The wide range of functions displayed by the 89 putative peroxisomal proteins led the

authors to conclude that peroxisomes in P. chrysogenum are not simply penicillin

production factories but are instead multi-purpose organelles that house many different

metabolic pathways. Nevertheless, since the peroxisomes used in this study were

isolated from cells growing on media that stimulates the production of penicillin, these

data laid down a solid basis for further study into the role of peroxisomes in the

production of penicillin.

Proteomics of fungal peroxisomes FIVE

157

3 Perspectives

Advances in the sensitivity and speed of mass spectrometers, the development of

methods to identify contaminants, as well as in statistical methods to analyse the huge

amount of data generated by these approaches have allowed organellar proteomics to

make invaluable contributions to peroxisomal research. However, a number of PMPs are

relatively low in abundance (Reguenga et al, 2001), making their detection using MS

still tricky, while it remains a challenge to investigate proteins displaying a dual

localisation using MS because the issue of contamination still arises (Schäfer et al, 2001;

Yi et al, 2002). Finally, the preparation of peroxisomal fractions for MS analysis remains

a long and often challenging process (as discussed in (Islinger et al, 2018; Saleem et al,

2006)). Because the success of an organellar proteomics approach depends heavily on

the quality and purity of the samples being analysed, we will end by discussing two

recent developments that may allow isolation procedures for future MS based studies to

be simplified.

Recently, Peikert et al. Reported a method they termed ImportOmics, which relies on

RNA inhibition (RNAi) of the docking factor Pex14p in the parasite T. brucei (Peikert et

al, 2017). The inhibition of Pex14p production blocked the import of matrix proteins

into the glycosome, a specialized type of peroxisome involved in the breakdown of

glucose in this organism (Bauer & Morris, 2017). The authors elegantly demonstrated

that matrix proteins became mistargeted in cells where Pex14p was targeted with RNAi,

allowing them to directly compare the levels of certain proteins in the organellar pellet

fraction of untreated cells versus an organelle pellet isolated from cells where Pex14p

was targeted. This was possible using a simple differential centrifugation approach,

negating the requirement for density centrifugation and greatly shortening and

simplifying the isolation procedure. Although RNAi has not been used extensively in

yeast or filamentous fungi, alternative approaches such as the Degron based system have

been used successfully to down-regulate peroxisomal proteins (Knoops et al, 2015;

Motley et al, 2015; Nuttall et al, 2014), which would allow such experiments to be

performed in these organisms. Furthermore, the authors noticed that blocking the import

of proteins into mitochondria through the same RNAi based approach not only resulted

in mitochondrial protein mistargeting to the cytosol but also to their proteasomal based

degradation, allowing the authors to gain information on whether a given protein targets

to the mitochondria or not based on their absolute levels in total cell lysates. Therefore

the authors could identify proteins that target to mitochondria using a single step

isolation procedure. While this may not be applicable for peroxisomal matrix proteins,

FIVE Proteomics of fungal peroxisomes

158

because proteasomal degradation of mistargeted matrix proteins has not, to the best of

our knowledge, been reported for yeast matrix proteins, this would certainly be an

interesting possibility when PMPs are being studied. Several PMPs are degraded when

mistargeted (Knoops et al, 2014) meaning that in principle downregulating Pex19p, the

receptor protein for PMPs (Neufeld et al, 2009; Rucktaschel et al, 2009), would result in

decreased levels of proteins that require Pex19p for targeting to peroxisomes. This could

allow for the identification of novel PMPs using a single step isolation procedure.

Fig.2 Schematic depiction of in vivo proximity labelling of proteins using an engineered

form ascorbate peroxidase (APEX).

Targeting of APEX to an organelle will result in the modification of proteins present in the

organelle. APEX converts biotin-phenol substrates into highly reactive biotin-phenol radicals

that become covalently attached to neighbouring proteins on tyrosine residues. Following

cell lysis, modified proteins can be extracted using streptavidin beads (if required, under

denaturing conditions), the samples can be subjected to trypsin digest and the resulting

peptides can be analysed with mass spectrometry.

The second development we mention concerns the use of proximity labelling, a

chemical biology based approach that utilises a labelling enzyme to modify proteins

with an affinity tag in vivo (Kim & Roux, 2016). This affinity tag can then be employed

to fish out modified proteins for further analysis. Targeting the labelling enzyme to a

particular compartment (through the use of a targeting signal or by fusing it to an

abundant protein present in that compartment) results in the specific modification of

proteins in that compartment (Fig. 2). A commonly used labelling enzyme is an

engineered version of ascorbate peroxidase (APEX) from plants (Martell et al, 2012)

Proteomics of fungal peroxisomes FIVE

159

and this enzyme was successfully employed by Rhee and co-workers to identify novel

mitochondrial proteins in mammalian cells (Rhee et al, 2013). Another recent report

demonstrated that a similar system can be used in yeast (Hwang & Espenshade, 2016).

APEX oxidizes biotin-phenol in the presence of hydrogen peroxide, which generates

short-lived biotin-derivative radicals that can covalently react with tyrosine residues in

proteins in the near vicinity. Both biotin-phenol and hydrogen peroxide are added

externally, meaning that the amount as well as the time at which protein labelling occurs

can be regulated. Because the isolation of organelles is not required, proteins (or

peptides resulting from tryptic digestion) modified with biotin can be isolated directly

from cell lysates with streptavidin beads and analysed by MS, speeding up and

simplifying extraction procedures. Furthermore, since streptavidin can bind to biotin

under denaturing conditions, the isolation of biotinylated proteins can be performed

under denaturing conditions, which dramatically reduces the loss of material due to the

action of cellular proteases. Finally, such approaches have the potential to identify

transient residents of an organelle, which is still highly challenging with alternative

approaches (Jung et al, 2010). Needless to say, we eagerly await the first report on the

use of proximity labelling in the study of the proteome of fungal peroxisomes.

To conclude, the use of organellar proteomics to study fungal peroxisomes has

provided valuable insights into the role of peroxisomes in the cell. The new

developments listed above, together with others not mentioned here, will help to make

isolation procedures both quicker and easier, allowing organellar proteomics approaches

to continue to make important contributions to the study of peroxisome function in the

future.

Acknowledgements C.W. is supported by a VIDI Grant (723.013.004) from the

Netherlands Organization for Scientific Research (NWO).

References

160

References

Abramoff MD, Magelhaes PJ, Ram SJ (2004) Image Processing with ImageJ. Biophotonics International

11: 36-42

Agne B, Meindl NM, Niederhoff K, Einwachter H, Rehling P, Sickmann A, Meyer HE, Girzalsky W, Kunau

WH (2003) Pex8p: an intraperoxisomal organizer of the peroxisomal import machinery.

Molecular Cell 11: 635-646

Agrawal G, Joshi S, Subramani S (2011) Cell-free sorting of peroxisomal membrane proteins from the

endoplasmic reticulum. Proceedings of the National Academy of Sciences 108: 9113-9118

Agrawal G, Subramani S (2016) De novo peroxisome biogenesis: Evolving concepts and conundrums.

Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1863: 892-901

Albuquerque CP, Smolka MB, Payne SH, Bafna V, Eng J, Zhou H (2008) A multidimensional

chromatography technology for in-depth phosphoproteome analysis. Molecular & Cellular

Proteomics 7: 1389-1396

Alston TA, Mela L, Bright HJ (1977) 3-Nitropropionate, the toxic substance of Indigofera, is a suicide

inactivator of succinate dehydrogenase. Proceedings of the National Academy of Sciences 74:

3767-3771

Aravind L, Koonin EV (2000) The U box is a modified RING finger—a common domain in ubiquitination.

Current Biology 10: R132-R134

Azevedo JE, Schliebs W (2006) Pex14p, more than just a docking protein. Biochim Biophys Acta 1763:

1574-1584

Bachmair A, Varshavsky A (1989) The degradation signal in a short-lived protein. Cell 56: 1019-1032

Baerends RJ, Faber KN, Kram AM, Kiel JA, van der Klei IJ, Veenhuis M (2000) A stretch of positively

charged amino acids at the N terminus of Hansenula polymorpha Pex3p is involved in

incorporation of the protein into the peroxisomal membrane. Journal of Biological Chemistry

275: 9986-9995

Baerends RJ, Rasmussen SW, Hilbrands RE, van der Heide M, Faber KN, Reuvekamp PT, ..., Veenhuis M

(1996) The Hansenula polymorpha PER9 gene encodes a peroxisomal membrane protein

essential for peroxisome assembly and integrity. Journal of Biological Chemistry 271:

8887-8894

Baerends RJ, Salomons FA, Faber KN, Kiel JA, Van der Klei IJ, Veenhuis M (1997) Deviant Pex3p levels

affect normal peroxisome formation in Hansenula polymorpha: high steady-state levels of the

protein fully abolish matrix protein import. Yeast 13: 1437-1448

Baker A, Hogg TL, Warriner SL (2016) Peroxisome protein import: a complex journey. Biochemical

Society Transactions 44: 783-789

Baker RT, Tobias JW, Varshavsky A (1992) Ubiquitin-specific proteases of Saccharomyces cerevisiae.

References

161

Cloning of UBP2 and UBP3, and functional analysis of the UBP gene family. Journal of Biological

Chemistry 267: 23364-23375

Bao X, Johnson, J. L., & Rao, H. (2015) Rad25 is targeted for degradation by the Ubc4-Ufd4 pathway.

Journal of Biological Chemistry

Bauer S, Morris MT (2017) Glycosome biogenesis in trypanosomes and the de novo dilemma. PLoS

neglected tropical diseases 11: e0005333

Bays NW, Gardner RG, Seelig LP, Joazeiro CA, Hampton RY (2001) Hrd1p/Der3p is a

membrane-anchored ubiquitin ligase required for ER-associated degradation. Nature cell

biology 3: 24

Bazirgan OA, Hampton RY (2008) Cue1p is an activator of Ubc7p E2 activity in vitro and in vivo. Journal

of Biological Chemistry 283: 12797-12810

Bellu AR, Komori M, van der Klei IJ, Kiel JA, Veenhuis M (2001) Peroxisome biogenesis and selective

degradation converge at Pex14p. Journal of Biological Chemistry 276: 44570-44574

Bellu AR, Salomons FA, Kiel JA, Veenhuis M, Van Der Klei IJ (2002) Removal of Pex3p is an important

initial stage in selective peroxisome degradation in Hansenula polymorpha. Journal of

Biological Chemistry 277: 42875-42880

Bett JS (2016) Proteostasis regulation by the ubiquitin system. Essays in biochemistry 60: 143-151

Blobel F, Erdmann R (1996) Identification of a yeast peroxisomal member of the family of AMP-binding

proteins. European journal of biochemistry 240: 468-476

Boardman NK, Linnane AW, Smillie RM, (Eds.). (1971) Autonomy and biogenesis of mitochondria and

chloroplasts. Amsterdam: North-Holland

Bonekamp N, Volkl A, Fahimi H, Schrader M (2009) Reactive oxygen species and peroxisomes:

struggling for balance. Biofactors 35: 346-355

Borden KL, Freemont PS (1996) The RING finger domain: a recent example of a sequence—structure

family. Current opinion in structural biology 6: 395-401

Bottger G, Barnett P, Klein AT, Kragt A, Tabak HF, Distel B (2000) Saccharomyces cerevisiae PTS1

receptor Pex5p interacts with the SH3 domain of the peroxisomal membrane protein Pex13p in

an unconventional, non-PXXP-related manner. Molecular Biology of the Cell 11: 3963-3976

Braverman N, Dodt G, Gould SJ, Valle D (1998) An isoform of pex5p, the human PTS1 receptor, is

required for the import of PTS2 proteins into peroxisomes. Human molecular genetics 7:

1195-1205

Braverman N, Steel G, Obie C, Moser A, Moser H, Gould SJ, Valle D (1997) Human PEX7 encodes the

peroxisomal PTS2 receptor and is responsible for rhizomelic chondrodysplasia punctata.

Nature genetics 15: 369-376

Bridges RG, Sohn SY, Wright J, Leppard KN, Hearing P (2016) The adenovirus E4-ORF3 protein

stimulates SUMOylation of general transcription factor TFII-I to direct proteasomal degradation.

References

162

mBio 7: e02184-02115

Brosius U, Dehmel T, Gärtner J (2002) Two different targeting signals direct human peroxisomal

membrane protein 22 to peroxisomes. Journal of Biological Chemistry 277: 774-784

Cao K, Nakajima R, Meyer HH, Zheng Y (2003) The AAA-ATPase Cdc48/p97 regulates spindle

disassembly at the end of mitosis. Cell 115: 355-367

Cepinska MN, Veenhuis M, van der Klei IJ, Nagotu S (2011) Peroxisome fission is associated with

reorganization of specific membrane proteins. Traffic 12: 925-937

Chan A, Schummer A, Fischer S, Schröter T, Cruz-Zaragoza LD, Bender J, ..., Warscheid B (2016)

Pex17p-dependent assembly of Pex14p/Dyn2p-subcomplexes of the peroxisomal protein

import machinery. European journal of cell biology 95: 585-597

Chau V, Tobias JW, Bachmair A, Marriott D, Ecker DJ, Gonda DK, Varshavsky A (1989) A multiubiquitin

chain is confined to specific lysine in a targeted short-lived protein. Science 243: 1576-1583

Chen X, Devarajan S, Danda N, Williams C (2018) Insights into the role of the peroxisomal

ubiquitination machinery in Pex13p degradation in the yeast Hansenula polymorpha. Journal

of molecular biology 430: 1545-1558

Chen YC, Umanah, G. K., Dephoure, N., Andrabi, S. A., Gygi, S. P., Dawson, T. M., ... & Rutter, J. (2014)

Msp1/ATAD1 maintains mitochondrial function by facilitating the degradation of mislocalized

tail-anchored proteins. The EMBO journal 33: 1548-1564

Christianson JC, Ye Y (2014) Cleaning up in the endoplasmic reticulum: ubiquitin in charge. Nature

Structural and Molecular Biology 21: 325

Ciechanover A, Ben-Saadon R (2004) N-terminal ubiquitination: more protein substrates join in. Trends

in cell biology 14: 103-106

Collins CS, Kalish JE, Morrell JC, McCaffery JM, Gould SJ (2000) The peroxisome biogenesis factors

pex4p, pex22p, pex1p, and pex6p act in the terminal steps of peroxisomal matrix protein

import. Molecular and cellular biology 20: 7516-7526

Cregg JM, van der Klei IJ, Sulter GJ, Veenhuis M, Harder W (1990) Peroxisome deficient mutants of

Hansenula polymorpha. Yeast 6: 87-97

Cross LL, Ebeed HT, Baker A (2016) Peroxisome biogenesis, protein targeting mechanisms and PEX

gene functions in plants. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1863:

850-862

Dai RM, Li CCH (2001) Valosin-containing protein is a multi-ubiquitin chain-targeting factor required in

ubiquitin–proteasome degradation. Nature cell biology 3: 740

Dargemont C, Ossareh-Nazari B (2012) Cdc48/p97, a key actor in the interplay between autophagy and

ubiquitin/proteasome catabolic pathways. Biochimica et Biophysica Acta (BBA)-Molecular Cell

Research 1823: 138-144

David C, Koch J, Oeljeklaus S, Laernsack A, Melchior S, Wiese S, Schummer A, Erdmann R, Warscheid B,

References

163

Brocard C (2013) A combined approach of quantitative interaction proteomics and live-cell

imaging reveals a regulatory role for ER reticulon homology proteins in peroxisome biogenesis.

Molecular & Cellular Proteomics

Davis MT, Spahr CS, McGinley MD, Robinson JH, Bures EJ, Beierle J, ..., Patterson SD (2001) Towards

defining the urinary proteome using liquid chromatography-tandem mass spectrometry II.

Limitations of complex mixture analyses. Proteomics 1: 108-117

De Duve C, Baudhuin P (1966) Peroxisomes (microbodies and related particles). Physiological reviews

46: 323-357.

Debelyy MO, Platta HW, Saffian D, Hensel A, Thoms S, Meyer HE, Warscheid B, Girzalsky W, Erdmann R

(2011) Ubp15p, a ubiquitin hydrolase associated with the peroxisomal export machinery.

Journal of Biological Chemistry 286: 28223-28234

Deckers M, Emmrich K, Girzalsky W, Awa WL, Kunau WH, Erdmann R (2010) Targeting of Pex8p to the

peroxisomal importomer. European journal of cell biology 89: 924-931

DeMartino GN, Moomaw CR, Zagnitko OP, Proske RJ, Chu-Ping M, Afendis SJ, ..., Slaughter CA (1994)

PA700, an ATP-dependent activator of the 20 S proteasome, is an ATPase containing multiple

members of a nucleotide-binding protein family. Journal of Biological Chemistry 269:

20878-20884

Deosaran E, Larsen KB, Hua R, Sargent G, Wang Y, Kim S, ..., Brech A (2013) NBR1 acts as an autophagy

receptor for peroxisomes. Journal of Cell Science 126: 939-952

Dodt G, Gould SJ (1996) Multiple PEX genes are required for proper subcellular distribution and

stability of Pex5p, the PTS1 receptor: evidence that PTS1 protein import is mediated by a

cycling receptor. The Journal of Cell Biology 135: 1763-1774

Douangamath A, Filipp FV, Klein AT, Barnett P, Zou P, Voorn-Brouwer T, Vega MC, Mayans OM, Sattler

M, Distel B, Wilmanns M (2002) Topography for independent binding of alpha-helical and

PPII-helical ligands to a peroxisomal SH3 domain. Molecular cell 10: 1007-1017

Eberhart T, Kovacs WJ (2018) Pexophagy in yeast and mammals: an update on mysteries.

Histochemistry and cell biology: 1-16

Effelsberg D, Cruz-Zaragoza LD, Schliebs W, Erdmann R (2016) Pex9p is a new yeast peroxisomal import

receptor for PTS1-containing proteins. Journal of Cell Science 129: 4057-4066

El Magraoui F, Baumer BE, Platta HW, Baumann JS, Girzalsky W, Erdmann R (2012) The RING-type

ubiquitin ligases Pex2p, Pex10p and Pex12p form a heteromeric complex that displays

enhanced activity in an ubiquitin conjugating enzyme-selective manner. The FEBS Journal 279:

2060-2070

El Magraoui F, Brinkmeier R, Schrotter A, Girzalsky W, Muller T, Marcus K, Meyer HE, Erdmann R, Platta

HW (2013) Distinct ubiquitination cascades act on the peroxisomal targeting signal type 2

co-receptor Pex18p. Traffic 14: 1290-1301

References

164

El Magraoui F, Schrotter A, Brinkmeier R, Kunst L, Mastalski T, Muller T, Marcus K, Meyer HE, Girzalsky

W, Erdmann R, Platta HW (2014) The cytosolic domain of Pex22p stimulates the

Pex4p-dependent ubiquitination of the PTS1-receptor. PLoS One 9: e105894

Elgersma Y, Kwast L, Klein A, Voorn-Brouwer T, van den Berg M, Metzig B, America T, Tabak HF, Distel B

(1996) The SH3 domain of the Saccharomyces cerevisiae peroxisomal membrane protein

Pex13p functions as a docking site for Pex5p, a mobile receptor for the import PTS1-containing

proteins. The Journal of Cell Biology 135: 97-109

Elgersma Y, van Roermund CW, Wanders RJ, Tabak HF (1995) Peroxisomal and mitochondrial carnitine

acetyltransferases of Saccharomyces cerevisiae are encoded by a single gene. The EMBO

Journal 14: 3472-3479

Elsasser S, Finley D (2005) Delivery of ubiquitinated substrates to protein-unfolding machines. Nature

cell biology 7: 742

Emmanouilidis L, Schütz U, Tripsianes K, Madl T, Radke J, Rucktäschel R, ..., Sattler M (2017) Allosteric

modulation of peroxisomal membrane protein recognition by farnesylation of the peroxisomal

import receptor PEX19. Nature communications 8

Erdmann R, Blobel G (1995) Giant peroxisomes in oleic acid-induced Saccharomyces cerevisiae lacking

the peroxisomal membrane protein Pmp27p. The Journal of cell biology 128: 509-523

Erdmann R, Blobel G (1996) Identification of Pex13p a peroxisomal membrane receptor for the PTS1

recognition factor. The Journal of Cell Biology 135: 111-121

Erzberger JP, Berger JM (2006) Evolutionary relationships and structural mechanisms of AAA+ proteins.

Annual Review of Biophysics and Biomolecular Structure 35: 93-114

Faber KN, Haima P, Harder W, Veenhuis M, Ab G (1994) Highly-efficient electrotransformation of the

yeast Hansenula polymorpha. Current genetics 25: 305-310

Fagarasanu A, Fagarasanu M, Eitzen GA, Aitchison JD, Rachubinski RA (2006) The peroxisomal

membrane protein Inp2p is the peroxisome-specific receptor for the myosin V motor Myo2p of

Saccharomyces cerevisiae. Developmental cell 10: 587-600

Fahimi HD, Baumgart E, Völkl A (1993) Ultrastructural aspects of the biogenesis of peroxisomes in rat

liver. Biochimie 75: 201-208

Fakieh MH, Drake PJ, Lacey J, Munck JM, Motley AM, Hettema EH (2013) Intra-ER sorting of the

peroxisomal membrane protein Pex3 relies on its luminal domain. Biology open BIO20134788

Farré JC, Burkenroad A, Burnett SF, Subramani S (2013) Phosphorylation of mitophagy and pexophagy

receptors coordinates their interaction with Atg8 and Atg11. EMBO reports 14: 441-449

Farré JC, Subramani S (2004) Peroxisome turnover by micropexophagy: an autophagy-related process.

Trends in cell biology 14: 515-523

Farré JC, Subramani S (2016) Mechanistic insights into selective autophagy pathways: lessons from

yeast. Nature reviews Molecular cell biology 17: 537

References

165

Ferreira RT, Menezes RA, Rodrigues-Pousada C (2015) E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and

modulates arsenic stress responses independent of the U-box motif. Biology open bio-010405

Finley D, Ulrich HD, Sommer T, Kaiser P (2012) The ubiquitin-proteasome system of Saccharomyces

cerevisiae. Genetics 192: 319-360

Flavell RB, Woodward DO (1971) Metabolic role, regulation of synthesis, cellular localization, and

genetic control of the glyoxylate cycle enzymes in Neurospora crassa. Journal of bacteriology

105: 200-210

Freemont PS, Hanson IM, Trowsdale J (1991) A novel cysteine-rich sequence motif. Cell 64 483–484

Fujiki Y, Miyata N, Matsumoto N, Tamura S (2008) Dynamic and functional assembly of the AAA

peroxins, Pex1p and Pex6p, and their membrane receptor Pex26p involved in shuttling of the

PTS1 receptor Pex5p in peroxisome biogenesis. Biochemical Society Transactions 36: 109-113

Fujiwara T, Tanaka K, Mino A, Kikyo M, Takahashi K, Shimizu K, Takai Y (1998) Rho1p-Bni1p-Spa2p

interactions: implication in localization of Bni1p at the bud site and regulation of the actin

cytoskeleton in Saccharomyces cerevisiae. Molecular biology of the cell 9: 1221-1233

Gabaldon T (2010) Peroxisome diversity and evolution. Philosophical Transactions of the Royal Society

B: Biological Sciences 365: 765-773

Galan JM, Wiederkehr A, Seol JH, Haguenauer-Tsapis R, Deshaies RJ, Riezman H, Peter M (2001) Skp1p

and the F-box protein Rcy1p form a non-SCF complex involved in recycling of the SNARE Snc1p

in yeast. Molecular and cellular biology 21: 3105-3117

Gatto GJ, Jr., Maynard EL, Guerrerio AL, Geisbrecht BV, Gould SJ, Berg JM (2003) Correlating structure

and affinity for PEX5:PTS1 complexes. Biochemistry 42: 1660-1666

Gietl C, Faber KN, van der Klei IJ, Veenhuis M (1994) Mutational analysis of the N-terminal topogenic

signal of watermelon glyoxysomal malate dehydrogenase using the heterologous host

Hansenula polymorpha. Proceedings of the National Academy of Sciences 91: 3151-3155

Girzalsky W, Rehling P, Stein K, Kipper J, Blank L, Kunau WH, Erdmann R (1999) Involvement of Pex13p

in Pex14p localization and peroxisomal targeting signal 2-dependent protein import into

peroxisomes. The Journal of cell biology 144: 1151-1162

Girzalsky W, Saffian D, Erdmann R (2010) Peroxisomal protein translocation. Biochim Biophys Acta

Gleeson M, Sudbery PE (1988) Genetic analysis in the methylotrophic yeast Hansenula polymorpha.

Yeast 4: 293-303

Gnügge R, Liphardt T, Rudolf F (2016) A shuttle vector series for precise genetic engineering of

Saccharomyces cerevisiae. Yeast 33: 83-98

Gootjes J, Elpeleg O, Eyskens F, Mandel H, Mitanchez D, Shimozawa N, ..., Wanders RJ (2004a) Novel

mutations in the PEX2 gene of four unrelated patients with a peroxisome biogenesis disorder.

Pediatric research 55: 431

Gootjes J, Schmohl F, Waterham HR, Wanders RJ (2004b) Novel mutations in the PEX12 gene of

References

166

patients with a peroxisome biogenesis disorder. European journal of human genetics 12: 115

Gould SJ, Kalish JE, Morrell JC, Bjorkman J, Urquhart AJ, Crane DI (1996) Pex13p is an SH3 protein of

the peroxisome membrane and a docking factor for the predominantly cytoplasmic PTS1

receptor. The Journal of Cell Biology 135: 85-95

Gould SJ, Keller GA, Subramani S (1987) Identification of a peroxisomal targeting signal at the carboxy

terminus of firefly luciferase. The Journal of cell biology 105: 2923-2931

Gould SJ, Valle D (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends in Genetics

16: 340-345

Grou CP, Carvalho AF, Pinto MP, Huybrechts SJ, Sa-Miranda C, Fransen M, Azevedo JE (2009) Properties

of the ubiquitin-pex5p thiol ester conjugate. Journal of Biological Chemistry 284: 10504-10513

Grou CP, Carvalho AF, Pinto MP, Wiese S, Piechura H, Meyer HE, Warscheid B, Sa-Miranda C, Azevedo

JE (2008) Members of the E2D (UbcH5) family mediate the ubiquitination of the conserved

cysteine of Pex5p, the peroxisomal import receptor. Journal of Biological Chemistry 283:

14190-14197

Grou CP, Francisco T, Rodrigues TA, Freitas MO, Pinto MP, Carvalho AF, Domingues P, Wood SA,

Rodriguez-Borges JE, Sa-Miranda C, Fransen M, Azevedo JE (2012) Identification of

ubiquitin-specific protease 9X (USP9X) as a deubiquitinase acting on ubiquitin-peroxin 5 (PEX5)

thioester conjugate. Journal of biological chemistry 287: 12815-12827

Grunau S, Lay D, Mindthoff S, Platta HW, Girzalsky W, Just WW, Erdmann R (2010) The

phosphoinositide 3-kinase Vps34p is required for pexophagy in Saccharomyces cerevisiae.

Biochemical Journal 434: 161-170

Gurvitz A, Wabnegger L, Langer S, Hamilton B, Ruis H, Hartig A (2001) The tetratricopeptide repeat

domains of human, tobacco, and nematode PEX5 proteins are functionally interchangeable

with the analogous native domain for peroxisomal import of PTS1-terminated proteins in yeast.

Molecular Genetics and Genomics 265: 276-286

Gygi SP, Rist B, Gerber SA, Turecek F, Gelb MH, Aebersold R (1999) Quantitative analysis of complex

protein mixtures using isotope-coded affinity tags. Nature biotechnology 17: 994

Haan GJ, Faber KN, Baerends RJ, Koek A, Krikken A, Kiel JA, van der Klei IJ, Veenhuis M (2002)

Hansenula polymorpha Pex3p is a peripheral component of the peroxisomal membrane.

Journal of Biological Chemistry 277: 26609-26617

Hagstrom D, Ma C, Guha-Polley S, Subramani S (2014) The unique degradation pathway of the PTS2

receptor, Pex7, is dependent on the PTS receptor/coreceptor, Pex5 and Pex20. Molecular

biology of the cell 25: 2634-2643

Hanna J, Hathaway NA, Tone Y, Crosas B, Elsasser S, Kirkpatrick DS, ..., Finley D (2006) Deubiquitinating

enzyme Ubp6 functions noncatalytically to delay proteasomal degradation. Cell 127: 99-111

Harris N (1986) Organization of the endomembrane system. Annual Review of Plant Physiology 37:

References

167

73-92

Hasan S, Platta, H. W., & Erdmann, R. (2013) Import of proteins into the peroxisomal matrix. Frontiers

in physiology 4

Hatakeyama S, Kei-ichi IN (2003) U-box proteins as a new family of ubiquitin ligases. Biochemical and

biophysical research communications 302: 635-645

Hazra PP, Suriapranata I, Snyder WB, Subramani S (2002) Peroxisome remnants in pex3delta cells and

the requirement of Pex3p for interactions between the peroxisomal docking and translocation

subcomplexes. Traffic 3: 560-574

Hebert DN, Molinari M (2012) Flagging and docking: dual roles for N-glycans in protein quality control

and cellular proteostasis. Trends in biochemical sciences 37: 404-410

Helle SC, Kanfer G, Kolar K, Lang A, Michel AH, Kornmann B (2013) Organization and function of

membrane contact sites. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1833:

2526-2541

Heo JM, Rutter J (2011) Ubiquitin-dependent mitochondrial protein degradation. The international

journal of biochemistry & cell biology 43: 1422-1426

Hershko A (1996) Lessons from the discovery ofthe ubiquitin system. Trends in biochemical sciences 21:

445-449

Hershko A, Ciechanover A (1992) The ubiquitin system for protein degradation. Annual review of

biochemistry 61: 761-807

Hershko A, Ciechanover A (1998) The ubiquitin system for protein degradation. Annual Review of

Biochemistry 67: 425-479

Hettema EH, Distel B, Tabak HF (1999) Import of proteins into peroxisomes. Biochimica et Biophysica

Acta (BBA)-Molecular Cell Research 1451: 17-34

Hettema EH, Erdmann R, van der Klei I, Veenhuis M (2014) Evolving models for peroxisome biogenesis.

Current opinion in cell biology 29: 25-30

Hettema EH, Girzalsky W, van Den Berg M, Erdmann R, Distel B (2000) Saccharomyces cerevisiae

pex3p and pex19p are required for proper localization and stability of peroxisomal membrane

proteins. The EMBO Journal 19: 223-233

Hipkin CR, Salem MA, Simpson D, Wainwright SJ (1999) 3-Nitropropionic acid oxidase from horseshoe

vetch (Hippocrepis comosa): a novel plant enzyme. Biochemical Journal 340: 491-495

Hochstrasser M (1996) Ubiquitin-dependent protein degradation. Annual review of genetics 30:

405-439

Hoepfner D, Van Den Berg M, Philippsen P, Tabak HF, Hettema EH (2001) A role for Vps1p, actin, and

the Myo2p motor in peroxisome abundance and inheritance in Saccharomyces cerevisiae. The

Journal of Cell Biology 155: 979-990

Hoppe T (2005) Multiubiquitylation by E4 enzymes:‘one size’doesn't fit all. Trends in biochemical

References

168

sciences 30: 183-187

Hu M, Li P, Song L, Jeffrey PD, Chernova TA, Wilkinson KD, ..., Shi Y (2005) Structure and mechanisms

of the proteasome‐associated deubiquitinating enzyme USP14. The EMBO journal 24:

3747-3756

Huang Y, Baker RT, Fischer-Vize JA (1995) Control of cell fate by a deubiquitinating enzyme encoded by

the fat facets gene. Science 270: 1828-1831

Huber A, Koch J, Kragler F, Brocard C, Hartig A (2012) A subtle interplay between three Pex11 proteins

shapes de novo formation and fission of peroxisomes. Traffic 13: 157-167

Huh WK, Falvo, J. V., Gerke, L. C., & Carroll, A. S. (2003) Global analysis of protein localization in

budding yeast. Nature 425: 686

Huhse B, Rehling P, Albertini M, Blank L, Meller K, Kunau WH (1998) Pex17p of Saccharomyces

cerevisiae is a novel peroxin and component of the peroxisomal protein translocation

machinery. The Journal of cell biology 140: 49-60

Hutchins MU, Veenhuis M, Klionsky DJ (1999) Peroxisome degradation in Saccharomyces cerevisiae is

dependent on machinery of macroautophagy and the Cvt pathway. Journal of Cell Science 112:

4079-4087

Hwang CS, Shemorry A, Auerbach D, Varshavsky A (2010) The N-end rule pathway is mediated by a

complex of the RING-type Ubr1 and HECT-type Ufd4 ubiquitin ligases. Nature cell biology 12:

1177

Hwang J, Espenshade PJ (2016) Proximity-dependent biotin labeling in yeast using the engineered

ascorbate peroxidase APEX2. Biochemical Journal BCJ20160106

Ikeda F, Crosetto N, Dikic I (2010) What determines the specificity and outcomes of ubiquitin signaling?

Cell 143: 677-681

Islinger M, Cardoso MJ, Schrader M (2010) Be different--the diversity of peroxisomes in the animal

kingdom. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1803: 881-897

Islinger M, Manner A, Völkl A (2018) The craft of peroxisome purification—a technical survey through

the decades. Springer, Singapore: 85-122

Itoyama A, Michiyuki S, Honsho M, Yamamoto T, Moser A, Yoshida Y, Fujiki Y (2013) Mff functions with

Pex11pbeta and DLP1 in peroxisomal fission. Biology open 2: 998-1006

Janke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, ..., Knop M (2004) A versatile

toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and

promoter substitution cassettes. Yeast 21: 947-962

Jedd G, Chua NH (2000) A new self-assembled peroxisomal vesicle required for efficient resealing of

the plasma membrane. Nature Cell Biol 2: 226-231

Johnson MA, Snyder WB, Cereghino JL, Veenhuis M, Subramani S, Cregg JM (2001) Pichia pastoris

Pex14p, a phosphorylated peroxisomal membrane protein, is part of a PTS-receptor docking

References

169

complex and interacts with many peroxins. Yeast 18: 621-641.

Jones JM, Morrell JC, Gould SJ (2001) Multiple distinct targeting signals in integral peroxisomal

membrane proteins. J Cell Biol 153: 1141-1150.

Jones JM, Morrell JC, Gould SJ (2004) PEX19 is a predominantly cytosolic chaperone and import

receptor for class 1 peroxisomal membrane proteins. J Cell Biol 164: 57-67

Jung S, Marelli M, Rachubinski RA, Goodlett DR, Aitchison JD (2010) Dynamic changes in the

subcellular distribution of Gpd1p in response to cell stress. Journal of Biological Chemistry 285:

6739-6749

Jung T, Catalgol B, Grune T (2009) The proteasomal system. Molecular aspects of medicine 30: 191-296

Jung T, Grune T (2008) The proteasome and its role in the degradation of oxidized proteins. IUBMB life

60: 743-752

Jung T, Grune T (2013) The proteasome and the degradation of oxidized proteins: Part I—structure of

proteasomes. Redox biology 1: 178–182

Kawaguchi S, Ng DT (2007) SnapShot: ER-associated protein degradation pathways. Cell 129:

1230-e1231

Keller GA, Krisans S, Gould SJ, Sommer JM, Wang CC, Schliebs W, Kunau W, Brody S, Subramani S (1991)

Evolutionary conservation of a microbody targeting signal that targets proteins to peroxisomes,

glyoxysomes, and glycosomes. The Journal of cell biology 114: 893-904

Khmelinskii A, Blaszczak E, Pantazopoulou M, Fischer B, Omnus DJ, Le Dez G, ..., Kirrmaier D (2014)

Protein quality control at the inner nuclear membrane. Nature 516: 410

Khmelinskii A, Keller PJ, Bartosik A, Meurer M, Barry JD, Mardin BR, Kaufmann A, Trautmann S,

Wachsmuth M, Pereira G, Huber W, Schiebel E, Knop M (2012) Tandem fluorescent protein

timers for in vivo analysis of protein dynamics. Nature biotechnology 30: 708-714

Khmelinskii A, Meurer M, Duishoev N, Delhomme N, Knop M (2011) Seamless gene tagging by

endonuclease-driven homologous recombination. PLoS One 6: e23794

Khmelinskii A, Meurer M, Ho CT, Besenbeck B, Füller J, Lemberg MK, ..., Knop M (2016) Incomplete

proteasomal degradation of green fluorescent proteins in the context of tandem fluorescent

protein timers. Molecular biology of the cell 27: 360-370

Kiel JA, Emmrich K, Meyer HE, Kunau WH (2005a) Ubiquitination of the peroxisomal targeting signal

type 1 receptor, Pex5p, suggests the presence of a quality control mechanism during

peroxisomal matrix protein import. Journal of Biological Chemistry 280: 1921-1930

Kiel JA, Komduur JA, van der Klei IJ, Veenhuis M (2003) Macropexophagy in Hansenula polymorpha:

facts and views. FEBS letters 549: 1-6

Kiel JA, Otzen M, Veenhuis M, van der Klei IJ (2005b) Obstruction of polyubiquitination affects PTS1

peroxisomal matrix protein import. Biochim Biophys Acta 1745: 176-186

Kiel JA, Rechinger KB, van der Klei IJ, Salomons FA, Titorenko VI, Veenhuis M (1999) The Hansenula

References

170

polymorpha PDD1 gene product, essential for the selective degradation of peroxisomes, is a

homologue of Saccharomyces cerevisiae Vps34p. Yeast 15: 741-754

Kiel JA, van den Berg MA, Fusetti F, Poolman B, Bovenberg RA, Veenhuis M, van der Klei IJ (2009)

Matching the proteome to the genome: the microbody of penicillin-producing Penicillium

chrysogenum cells. Functional & integrative genomics 9: 167-184

Kiel JA, van der Klei IJ, van den Berg MA, Bovenberg RA, Veenhuis M (2005c) Overproduction of a

single protein, Pc-Pex11p, results in 2-fold enhanced penicillin production by Penicillium

chrysogenum. Fungal genetics and biology : FG & B 42: 154-164

Kiemer L, Bendtsen JD, Blom N (2004) NetAcet: prediction of N-terminal acetylation sites.

Bioinformatics 21: 1269-1270

Kim DI, Roux KJ (2016) Filling the void: proximity-based labeling of proteins in living cells. Trends in cell

biology 26: 804-817

Kim HT, Collins GA, Goldberg AL (2018) Measurement of the Multiple Activities of 26S Proteasomes.

Humana Press, New York, NY: 289-308

Kim PK, Mullen RT, Schumann U, Lippincott-Schwartz J (2006) The origin and maintenance of

mammalian peroxisomes involves a de novo PEX16-dependent pathway from the ER. The

Journal of cell biology 173: 521-532

Kim W, Bennett EJ, Huttlin EL, Guo A, Li J, Possemato A, Sowa ME, Rad R, Rush J, Comb MJ, Harper JW,

Gygi SP (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome.

Molecular cell 44: 325-340

Kindl H (1993) Fatty acid degradation in plant peroxisomes: function and biosynthesis of the enzymes

involved. Biochimie 75: 225-230

Kionka C, Kunau WH (1985) Inducible beta-oxidation pathway in Neurospora crassa. Journal of

bacteriology 161: 153-157

Kirkin V, McEwan DG, Novak I, Dikic I (2009) A role for ubiquitin in selective autophagy. Molecular cell

34: 259-269

Klein AT, van den Berg M, Bottger G, Tabak HF, Distel B (2002) Saccharomyces cerevisiae acyl-CoA

oxidase follows a novel, non-PTS1, import pathway into peroxisomes that is dependent on

Pex5p. Journal of Biological Chemistry 277: 25011-25019

Klionsky DJ, Schulman BA (2014) Dynamic regulation of macroautophagy by distinctive ubiquitin-like

proteins. Nature structural & molecular biology 21: 336

Knoblach B, Rachubinski RA (2015) Transport and retention mechanisms govern lipid droplet

inheritance in Saccharomyces cerevisiae. Traffic 16: 298-309

Knoblach B, Sun X, Coquelle N, Fagarasanu A, Poirier RL, Rachubinski RA (2013) An ER-peroxisome

tether exerts peroxisome population control in yeast. The EMBO journal 32: 2439-2453

Knoops K, de Boer R, Kram A, van der Klei IJ (2015) Yeast pex1 cells contain peroxisomal ghosts that

References

171

import matrix proteins upon reintroduction of Pex1. The Journal of Cell Biology 211: 955-962

Knoops K, Manivannan S, Cepinska MN, Krikken A, Kram AM, Veenhuis M, Van der Klei IJ (2014)

Preperoxisomal vesicles can form in the absence of Pex3p. J Cell Biol

Kobayashi S, Tanaka A, Fujiki Y (2007) Fis1, DLP1, and Pex11p coordinately regulate peroxisome

morphogenesis. Experimental cell research 313: 1675-1686

Koch A, Thiemann M, Grabenbauer M, Yoon Y, McNiven MA, Schrader M (2003) Dynamin-like protein

1 is involved in peroxisomal fission. Journal of Biological Chemistry 278: 8597-8605

Koch J, Brocard C (2012) PEX11 proteins attract Mff and human Fis1 to coordinate peroxisomal fission.

J Cell Sci 125: 3813-3826

Koch J, Pranjic K, Huber A, Ellinger A, Hartig A, Kragler F, Brocard C (2010) PEX11 family members are

membrane elongation factors that coordinate peroxisome proliferation and maintenance.

Journal of Cell Science 123: 3389-3400

Koegl M, Hoppe T, Schlenker S, Ulrich HD, Mayer TU, Jentsch S (1999) A novel ubiquitination factor, E4,

is involved in multiubiquitin chain assembly. Cell 96: 635-644

Koek A, Komori M, Veenhuis M, van der Klei IJ (2007) A comparative study of peroxisomal structures in

Hansenula polymorpha pex mutants. FEMS yeast research 7: 1126-1133

Koller A, Snyder WB, Faber KN, Wenzel TJ, Rangell L, Keller GA, Subramani S (1999) Pex22p of Pichia

pastoris, essential for peroxisomal matrix protein import, anchors the ubiquitin-conjugating

enzyme, Pex4p, on the peroxisomal membrane. The Journal of cell biology 146: 99-112

Komander D, Rape M (2012) The ubiquitin code. Annual review of biochemistry 81: 203-229

Komori M, Rasmussen SW, Kiel JA, Baerends RJ, Cregg JM, van der Klei IJ, Veenhuis M (1997) The

Hansenula polymorpha PEX14 gene encodes a novel peroxisomal membrane protein essential

for peroxisome biogenesis. The EMBO Journal 16: 44-53

Kragt A, Voorn-Brouwer T, van den Berg M, Distel B (2005) The Saccharomyces cerevisiae peroxisomal

import receptor Pex5p is monoubiquitinated in wild type cells. Journal of Biological Chemistry

280: 7867-7874

Krause C, Rosewich H, Thanos M, Gärtner J (2006) Identification of novel mutations in PEX2, PEX6,

PEX10, PEX12, and PEX13 in Zellweger spectrum patients. Human mutation 27: 1157

Kumar S, de Boer R, van der Klei IJ (2017) Yeast cells contain a heterogeneous population of

peroxisomes that segregate asymmetrically during cell division. Journal of Cell Science

jcs-207522

Kumar S, Singh R, Williams CP, van der Klei IJ (2016) Stress exposure results in increased peroxisomal

levels of yeast Pnc1 and Gpd1, which are imported via a piggy-backing mechanism. Biochimica

et Biophysica Acta (BBA)-Molecular Cell Research 1863: 148-156

Kunau WH, Buhne S, de la Garza M, Kionka C, Mateblowski M, Schultz-Borchard U, Thieringer R (1988)

Comparative enzymology of beta-oxidation. Biochemical Society Transactions 16: 418-420

References

172

Kunze M, Berger J (2015) The similarity between N-terminal targeting signals for protein import into

different organelles and its evolutionary relevance. Frontiers in physiology 6: 259

Kuravi K, Nagotu S, Krikken AM, Sjollema K, Deckers M, Erdmann R, Veenhuis M, van der Klei IJ (2006)

Dynamin-related proteins Vps1p and Dnm1p control peroxisome abundance in Saccharomyces

cerevisiae. Journal of cell science 119: 3994-4001

Kurochkin IV, Nagashima, T., Konagaya, A., & Schönbach, C. (2005) Sequence-based discovery of the

human and rodent peroxisomal proteome. Applied bioinformatics 4: 93-104

Lam SK, Yoda N, Schekman R (2010) A vesicle carrier that mediates peroxisome protein traffic from the

endoplasmic reticulum. Proceedings of the National Academy of Sciences: 13397

Lam YA, Lawson TG, Velayutham M, Zweier JL, Pickart CM (2002) A proteasomal ATPase subunit

recognizes the polyubiquitin degradation signal. Nature 416: 763

Lanyon-Hogg T, Hooper J, Gunn S, Warriner SL, Baker A (2014) PEX14 binding to Arabidopsis PEX5 has

differential effects on PTS1 and PTS2 cargo occupancy of the receptor. FEBS letters 588:

2223-2229

Lassen KG, Xavier RJ (2018) Mechanisms and function of autophagy in intestinal disease. Autophagy

14: 216-220

Law KB, Bronte-Tinkew, D., Di Pietro, E., Snowden, A., Jones, R. O., Moser, A., ... & Kim, P. K. (2017) The

peroxisomal AAA ATPase complex prevents pexophagy and development of peroxisome

biogenesis disorders. Autophagy 13: 868-884

Lazarow PB (1978) Rat liver peroxisomes catalyze the beta oxidation of fatty acids. Journal of Biological

Chemistry 253: 1522-1528

Lazarow PB (2006) The import receptor Pex7p and the PTS2 targeting sequence. Biochimica et

Biophysica Acta (BBA)-Molecular Cell Research 1763: 1599-1604

Leão AN, Kiel JA (2003) Peroxisome homeostasis in Hansenula polymorpha. FEMS yeast research 4:

131-139

Lee MY, Sumpter R, Zou Z, Sirasanagandla S, Wei Y, Mishra P, ..., Levine B (2017) Peroxisomal protein

PEX13 functions in selective autophagy. EMBO reports 18: 48-60

Legakis JE, Koepke JI, Jedeszko C, Barlaskar F, Terlecky LJ, Edwards HJ, ..., Terlecky SR (2002)

Peroxisome senescence in human fibroblasts. Molecular biology of the cell. 13 12

Leon S, Subramani S (2007) A conserved cysteine residue of Pichia pastoris Pex20p is essential for its

recycling from the peroxisome to the cytosol. Journal of Biological Chemistry 282: 7424-7430

Léon S, Subramani S (2007) A conserved cysteine residue of Pichia pastoris Pex20p is essential for its

recycling from the peroxisome to the cytosol. Journal of Biological Chemistry 282: 7424-7430

Leon S, Zhang L, McDonald WH, Yates J, 3rd, Cregg JM, Subramani S (2006) Dynamics of the

peroxisomal import cycle of PpPex20p: ubiquitin-dependent localization and regulation. The

Journal of Cell Biology 172: 67-78

References

173

Ling Q, Jarvis P (2015) Regulation of chloroplast protein import by the ubiquitin E3 ligase SP1 is

important for stress tolerance in plants. Current Biology 25: 2527-2534

Ling Q, Li N, Jarvis P (2017) Chloroplast ubiquitin E3 ligase SP1: does it really function in peroxisomes?

Plant physiology 175: 586-588

Lingard MJ, Monroe-Augustus M, Bartel B (2009) Peroxisome-associated matrix protein degradation in

Arabidopsis. Proceedings of the National Academy of Sciences 106: 4561-4566

Lipson C, Alalouf G, Bajorek M, Rabinovich E, Atir-Lande A, Glickman M, Bar-Nun S (2008) A

proteasomal ATPase contributes to dislocation of endoplasmic reticulum-associated

degradation (ERAD) substrates. Journal of Biological Chemistry 283: 7166-7175

Liu CW, Millen L, Roman TB, Xiong H, Gilbert HF, Noiva R, ..., Thomas PJ (2002) Conformational

remodeling of proteasomal substrates by PA700, the 19 S regulatory complex of the 26 S

proteasome. Journal of Biological Chemistry 277: 26815-26820

Liu F, Ng SK, Lu Y, Low W, Lai J, Jedd G (2008) Making two organelles from one: Woronin body

biogenesis by peroxisomal protein sorting. The Journal of cell biology 180: 325-339

Liu X, Klionsky DJ (2016) The Atg17-Atg31-Atg29 complex and Atg11 regulate autophagosome-vacuole

fusion. Autophagy 12: 894-895

Liu X, Subramani S (2013) Unique requirements for mono- and polyubiquitination of the peroxisomal

targeting signal co-receptor, Pex20. Journal of Biological Chemistry 288: 7230-7240

Lockshon D, Surface LE, Kerr EO, Kaeberlein M, Kennedy BK (2007) The sensitivity of yeast mutants to

oleic acid implicates the peroxisome and other processes in membrane function. Genetics 175:

77-91

Ma C, Hagstrom D, Polley SG, Subramani S (2013) Redox-regulated cargo binding and release by the

peroxisomal targeting signal receptor, Pex5. Journal of Biological Chemistry 288: 27220-27231

Managadze D, Würtz C, Sichting M, Niehaus G, Veenhuis M, Rottensteiner H (2007) The peroxin PEX14

of Neurospora crassa is essential for the biogenesis of both glyoxysomes and Woronin bodies.

Traffic 8: 687-701

Managadze D, Würtz C, Wiese S, Meyer HE, Niehaus G, Erdmann R, ..., Rottensteiner H (2010) A

proteomic approach towards the identification of the matrix protein content of the two types

of microbodies in Neurospora crassa. Proteomics 10: 3222-3234

Mancias JD, Kimmelman AC (2016) Mechanisms of selective autophagy in normal physiology and

cancer. Journal of molecular biology 428: 1659-1680

Mano S, Nishimura M (2005) Plant peroxisomes. Vitamins and hormones 72: 111-154

Marelli M, Smith JJ, Jung S, Yi E, Nesvizhskii AI, Christmas RH, Saleem RA, Tam YY, Fagarasanu A,

Goodlett DR, Aebersold R, Rachubinski RA, Aitchison JD (2004) Quantitative mass spectrometry

reveals a role for the GTPase Rho1p in actin organization on the peroxisome membrane. The

Journal of Cell Biology 167: 1099-1112

References

174

Marshall PA, Krimkevich YI, Lark RH, Dyer JM, Veenhuis M, Goodman JM (1995) Pmp27 promotes

peroxisomal proliferation. The Journal of Cell Biology 129: 345-355

Martell JD, Deerinck TJ, Sancak Y, Poulos TL, Mootha VK, Sosinsky GE, ..., Ting AY (2012) Engineered

ascorbate peroxidase as a genetically encoded reporter for electron microscopy. Nature

biotechnology 30: 1143

Matsumura T, Otera H, Fujiki Y (2000) Disruption of the interaction of the longer isoform of Pex5p,

Pex5pL, with Pex7p abolishes peroxisome targeting signal type 2 protein import in mammals.

Study with a novel Pex5-impaired Chinese hamster ovary cell mutant. Journal of Biological

Chemistry 275: 21715-21721

Maupin-Furlow JA, Gil MA, Humbard MA, Kirkland PA, Li W, Reuter CJ, Wright AJ (2005) Archaeal

proteasomes and other regulatory proteases. Current opinion in microbiology 8: 720-728

Maupin-Furlow JA, Kaczowka SJ, Reuter CJ, Zuobi-Hasona K, Gil MA (2003) Archaeal proteasomes::

potential in metabolic engineering. Metabolic engineering 5: 151-163

Mayer TU, Braun T, Jentsch S (1998) Role of the proteasome in membrane extraction of a short-lived

ER-transmembrane protein. The EMBO Journal 17: 3251-3257

Mayor T, Graumann J, Bryan J, MacCoss MJ, Deshaies RJ (2007) Quantitative profiling of ubiquitylated

proteins reveals proteasome substrates and the substrate repertoire influenced by the Rpn10

receptor pathway. Molecular & Cellular Proteomics 6: 1885-1895

McDowell GS, Philpott A (2013) Non-canonical ubiquitylation: mechanisms and consequences. The

international journal of biochemistry & cell biology 45: 1833-1842

Meinecke M, Bartsch P, Wagner R (2016) Peroxisomal protein import pores. Biochimica Et Biophysica

Acta (BBA)-Molecular Cell Research 1863: 821-827

Meinecke M, Cizmowski C, Schliebs W, Kruger V, Beck S, Wagner R, Erdmann R (2010) The peroxisomal

importomer constitutes a large and highly dynamic pore. Nature Cell Biology 12: 273-277

Mevissen TE, Komander D (2017) Mechanisms of deubiquitinase specificity and regulation. Annual

review of biochemistry 86

Meyer HH, Shorter JG, Seemann J, Pappin D, Warren G (2000) A complex of mammalian ufd1 and npl4

links the AAA-ATPase, p97, to ubiquitin and nuclear transport pathways. The EMBO journal 19:

2181-2192.

Miller HI, Henzel WJ, Ridgway JB, Kuang WJ, Chisholm V, Liu CC (1989) Cloning and expression of a

yeast ubiquitin-protein cleaving activity in Escherichia coli. Nature biotechnology 7: 698

Miura S, Kasuya-Arai I, Mori H, Miyazawa S, Osumi T, Hashimoto T, Fujiki Y (1992) Carboxyl-terminal

consensus Ser-Lys-Leu-related tripeptide of peroxisomal proteins functions in vitro as a

minimal peroxisome-targeting signal. Journal of Biological Chemistry 267: 14405-14411.

Miyauchi-Nanri Y, Mukai S, Kuroda K, Fujiki Y (2014) CUL4A-DDB1-Rbx1 E3 ligase controls the quality of

the PTS2 receptor Pex7p. Biochemical Journal 463: 65-74

References

175

Monastyrska I, Klionsky DJ (2006) Autophagy in organelle homeostasis: peroxisome turnover.

Molecular aspects of medicine 27: 483-494

Monastyrska I, van der Heide M, Krikken AM, Kiel JA, van der Klei IJ, Veenhuis M (2005) Atg8 is

essential for macropexophagy in Hansenula polymorpha. Traffic 6: 66-74

Montilla-Martinez M, Beck S, Klümper J, Meinecke M, Schliebs W, Wagner R, Erdmann R (2015)

Distinct pores for peroxisomal import of PTS1 and PTS2 proteins. Cell reports 13: 2126-2134

Morawska M, Ulrich HD (2013) An expanded tool kit for the auxin-inducible degron system in budding

yeast. Yeast 30: 341-351

Motley AM, Galvin PC, Ekal L, Nuttall JM, Hettema EH (2015) Reevaluation of the role of Pex1 and

dynamin-related proteins in peroxisome membrane biogenesis. The Journal of Cell Biology 211:

1041-1056

Motley AM, Hettema EH (2007) Yeast peroxisomes multiply by growth and division. The Journal of Cell

Biology 178: 399-410

Motley AM, Nuttall JM, Hettema EH (2012) Pex3-anchored Atg36 tags peroxisomes for degradation in

Saccharomyces cerevisiae. The EMBO journal 31: 2852-2868

Motley AM, Ward GP, Hettema EH (2008) Dnm1p-dependent peroxisome fission requires Caf4p,

Mdv1p and Fis1p. Journal of Cell Science 121: 1633-1640

Mukai S, Ghaedi K, Fujiki Y (2002) Intracellular localization, function, and dysfunction of the

peroxisome- targeting signal type 2 receptor, Pex7p, in mammalian cells. Journal of Biological

Chemistry 277: 9548-9561.

Müller WH, Bovenberg RA, Groothuis MH, Kattevilder F, Smaal EB, Van der Voort LH, Verkleij AJ (1992)

Involvement of microbodies in penicillin biosynthesis. Biochimica et Biophysica Acta

(BBA)-General Subjects 1116: 210-213

Müller WH, Van der Krift TP, Krouwer AJ, Wösten HA, Van Der Voort LH, Smaal EB, Verkleij AJ (1991)

Localization of the pathway of the penicillin biosynthesis in Penicillium chrysogenum. The

EMBO journal 10: 489

Nagotu S, Krikken AM, Otzen M, Kiel JA, Veenhuis M, van der Klei IJ (2008a) Peroxisome fission in

Hansenula polymorpha requires Mdv1 and Fis1, two proteins also involved in mitochondrial

fission. Traffic 9: 1471-1484

Nagotu S, Saraya R, Otzen M, Veenhuis M, van der Klei IJ (2008b) Peroxisome proliferation in

Hansenula polymorpha requires Dnm1p which mediates fission but not de novo formation.

Biochim Biophys Acta 1783: 760-769

Nakai K, & Horton, P. (2007) Computational prediction of subcellular localization. Protein Targeting

Protocols: 429-466

Neufeld C, Filipp FV, Simon B, Neuhaus A, Schuller N, David C, Kooshapur H, Madl T, Erdmann R,

Schliebs W, Wilmanns M, Sattler M (2009) Structural basis for competitive interactions of

References

176

Pex14 with the import receptors Pex5 and Pex19. The EMBO Journal 28: 745-754

Nicholson KL, Munson M, Miller RB, Filip TJ, Fairman R, Hughson FM (1998) Regulation of SNARE

complex assembly by an N-terminal domain of the t-SNARE Sso1p. Nature Structural and

Molecular Biology 5: 793

Niederhoff K, Meindl-Beinker NM, Kerssen D, Perband U, Schafer A, Schliebs W, Kunau WH (2005)

Yeast Pex14p possesses two functionally distinct Pex5p and one Pex7p binding sites. Journal of

Biological Chemistry 280: 35571-35578

Nillegoda NB, Theodoraki MA, Mandal AK, Mayo KJ, Ren HY, Sultana R, ..., Caplan AJ (2010) Ubr1 and

Ubr2 function in a quality control pathway for degradation of unfolded cytosolic proteins.

Molecular biology of the cell 21: 2102-2116

Noda NN, Fujioka Y (2015) Atg1 family kinases in autophagy initiation. Cellular and molecular life

sciences 72: 3083-3096

Noda NN, Inagaki F (2015) Mechanisms of autophagy. Annual review of biophysics 44

Nonaka H, Tanaka K, Hirano H, Fujiwara T, Kohno H, Umikawa M, ..., Takai Y (1995) A downstream

target of RHO1 small GTP‐binding protein is PKC1, a homolog of protein kinase C, which leads

to activation of the MAP kinase cascade in Saccharomyces cerevisiae. The EMBO journal 14:

5931-5938

Nordgren M, Francisco T, Lismont C, Hennebel L, Brees C, Wang B, Van Veldhoven PP, Azevedo JE,

Fransen M (2015) Export-deficient monoubiquitinated PEX5 triggers peroxisome removal in

SV40 large T antigen-transformed mouse embryonic fibroblasts. Autophagy 11: 1326-1340

Nuttall JM, Motley AM, Hettema EH (2014) Deficiency of the exportomer components Pex1, Pex6, and

Pex15 causes enhanced pexophagy in Saccharomyces cerevisiae. Autophagy 10: 835-845

Oeljeklaus S, Reinartz BS, Wolf J, Wiese S, Tonillo J, Podwojski K, Kuhlmann K, Stephan C, Meyer HE,

Schliebs W, Brocard C, Erdmann R, Warscheid B (2012) Identification of core components and

transient interactors of the peroxisomal importomer by dual-track stable isotope labeling with

amino acids in cell culture analysis. Journal of proteome research 11: 2567-2580

Okreglak V, & Walter, P. (2014) The conserved AAA-ATPase Msp1 confers organelle specificity to

tail-anchored proteins. Proceedings of the National Academy of Sciences 201405755

Opalinski L, Kiel JA, Williams C, Veenhuis M, van der Klei IJ (2010) Membrane curvature during

peroxisome fission requires Pex11. The EMBO Journal 30: 5-16

Opperdoes FR (1987) Topogenesis of glycolytic enzymes in Trypanosoma brucei. Biochemical Society

symposium 53: 123-129

Orth T, Reumann S, Zhang X, Fan J, Wenzel D, Quan S, Hu J (2007) The PEROXIN11 protein family

controls peroxisome proliferation in Arabidopsis. Plant Cell 19: 333-350

Otera H, Okumoto K, Tateishi K, Ikoma Y, Matsuda E, Nishimura M, ..., Fujiki Y (1998) Peroxisome

Targeting Signal Type 1 (PTS1) Receptor Is Involved in Import of Both PTS1 and PTS2: Studies

References

177

withPEX5-Defective CHO Cell Mutants. Molecular and Cellular Biology 18: 388-399

Otera H, Setoguchi K, Hamasaki M, Kumashiro T, Shimizu N, Fujiki Y (2002) Peroxisomal targeting signal

receptor Pex5p interacts with cargoes and import machinery components in a

spatiotemporally differentiated manner: conserved Pex5p WXXXF/Y motifs are critical for

matrix protein import. Molecular and cellular biology 22: 1639-1655

Otzen M, Perband U, Wang D, Baerends RJ, Kunau WH, Veenhuis M, Van der Klei IJ (2004) Hansenula

polymorpha Pex19p is essential for the formation of functional peroxisomal membranes.

Journal of Biological Chemistry 279: 19181-19190

Otzen M, Wang D, Lunenborg MG, van der Klei IJ (2005) Hansenula polymorpha Pex20p is an oligomer

that binds the peroxisomal targeting signal 2 (PTS2). Journal of Cell Science 118: 3409-3418

Pan R, Hu J (2018) The Arabidopsis E3 ubiquitin ligase SP1 targets to chloroplasts, peroxisomes, and

mitochondria. Plant physiology 176: 480-482

Pan R, Satkovich J, Hu J (2016) E3 ubiquitin ligase SP1 regulates peroxisome biogenesis in Arabidopsis.

Proceedings of the National Academy of Sciences 113: E7307-E7316

Peikert CD, Mani J, Morgenstern M, Käser S, Knapp B, Wenger C, ..., Warscheid B (2017) Charting

organellar importomes by quantitative mass spectrometry. Nature communications 8: 15272

Perrot M, Massoni A, Boucherie H (2008) Sequence requirements for Nα-terminal acetylation of yeast

proteins by NatA. Yeast 25: 513-527

Petriv I, Tang L, Titorenko VI, Rachubinski RA (2004) A new definition for the consensus sequence of

the peroxisome targeting signal type 2. Journal of molecular biology 341: 119-134

Petroski MD, Deshaies RJ (2004) In vitro reconstitution of SCF substrate ubiquitination with purified

proteins. Methods in enzymology 398: 143-158

Petroski MD, Deshaies RJ (2005) Function and regulation of cullin-RING ubiquitin ligases. Nature

reviews Molecular cell biology 6: 9

Piccinini M, Mostert M, Croce S, Baldovino S, Papotti M, Rinaudo MT (2003) Interferon-γ-inducible

subunits are incorporated in human brain 20S proteasome. Journal of neuroimmunology 135:

135-140

Pickart CM (2001) Mechanisms underlying ubiquitination. Annual review of biochemistry 70: 503-533

Pickart CM, Rose IA (1985) Ubiquitin carboxyl-terminal hydrolase acts on ubiquitin carboxyl-terminal

amides. Journal of Biological Chemistry 260: 7903-7910

Piechura H, Oeljeklaus S, Warscheid B (2012) SILAC for the study of mammalian cell lines and yeast

protein complexes. Methods Mol Biol 893: 201-221

Pires JR, Hong X, Brockmann C, Volkmer-Engert R, Schneider-Mergener J, Oschkinat H, Erdmann R

(2003) The ScPex13p SH3 domain exposes two distinct binding sites for Pex5p and Pex14p.

Journal of molecular biology 326: 1427-1435

Platta HW, Debelyy MO, El Magraoui F, Erdmann R (2008) The AAA peroxins Pex1p and Pex6p function

References

178

as dislocases for the ubiquitinated peroxisomal import receptor Pex5p. Biochemical Society

Transactions 36: 99-104

Platta HW, El Magraoui F, Baumer BE, Schlee D, Girzalsky W, Erdmann R (2009) Pex2 and pex12

function as protein-ubiquitin ligases in peroxisomal protein import. Molecular and cellular

biology 29: 5505-5516

Platta HW, El Magraoui F, Schlee D, Grunau S, Girzalsky W, Erdmann R (2007) Ubiquitination of the

peroxisomal import receptor Pex5p is required for its recycling. The Journal of cell biology 177:

197-204

Platta HW, Girzalsky W, Erdmann R (2004) Ubiquitination of the peroxisomal import receptor Pex5p.

Biochemical Journal 384: 37-45

Polo S, Sigismund S, Faretta M, Guidi M, Capua MR, Bossi G, Chen H, De Camilli P, Di Fiore PP (2002) A

single motif responsible for ubiquitin recognition and monoubiquitination in endocytic

proteins. Nature 416: 451-455

Purdue PE, Lazarow PB (2001) Pex18p is constitutively degraded during peroxisome biogenesis.

Journal of Biological Chemistry 276: 47684-47689

Rabellino A, Andreani C, Scaglioni PP (2017) The Role of PIAS SUMO E3-Ligases in Cancer. Cancer

Research 77: 1542-1547

Rabl J, Smith DM, Yu Y, Chang SC, Goldberg AL, Cheng Y (2008) Mechanism of gate opening in the 20S

proteasome by the proteasomal ATPases. Molecular cell 30: 360-368

Rahim RS, Chen M, Nourse CC, Meedeniya AC, Crane DI (2016) Mitochondrial changes and oxidative

stress in a mouse model of Zellweger syndrome neuropathogenesis. Neuroscience 334

Ravid T, Hochstrasser M (2007) Autoregulation of an E2 enzyme by ubiquitin-chain assembly on its

catalytic residue. Nature cell biology 9: 422

Ravid T, Hochstrasser M (2008) Diversity of degradation signals in the ubiquitin–proteasome system.

Nature reviews Molecular cell biology 9: 679

Ravid T, Kreft SG, Hochstrasser M (2006) Membrane and soluble substrates of the Doa10 ubiquitin

ligase are degraded by distinct pathways. The EMBO journal 25: 533-543

Raymond GV, Watkins P, Steinberg S, Powers J (2009) Peroxisomal disorders. In Handbook of

Neurochemistry and Molecular Neurobiology 631-670

Reguenga C, Oliveira ME, Gouveia AM, Sa-Miranda C, Azevedo JE (2001) Characterization of the

mammalian peroxisomal import machinery: Pex2p, Pex5p, Pex12p, and Pex14p are subunits of

the same protein assembly. Journal of Biological Chemistry 276: 29935-29942.

Rehling P, Skaletz-Rorowski A, Girzalsky W, Voorn-Brouwer T, Franse MM, Distel B, Veenhuis M, Kunau

WH, Erdmann R (2000a) Pex8p, an intraperoxisomal peroxin of Saccharomyces cerevisiae

required for protein transport into peroxisomes binds the PTS1 receptor pex5p. J Biol Chem

275: 3593-3602

References

179

Rehling P, Skaletz-Rorowski A, Girzalsky W, Voorn-Brouwer T, Franse MM, Distel B, Veenhuis M, Kunau

WH, Erdmann R (2000b) Pex8p, an intraperoxisomal peroxin of Saccharomyces cerevisiae

required for protein transport into peroxisomes binds the PTS1 receptor pex5p. Journal of

Biological Chemistry 275: 3593-3602

Rhee HW, Zou P, Udeshi ND, Martell JD, Mootha VK, Carr SA, Ting AY (2013) Proteomic mapping of

mitochondria in living cells via spatially restricted enzymatic tagging. Science 339: 1328-1331

Rhodin J (1954) Correlation of ultrastructural organization and function in normal and experimentally

changed proximal convoluted tubule cells of the mouse kidney. Doctoral Thesis, Karolinska

Institutet, Stockholm, Aktiebolaget Godvil, 1

Rodriguez MS, Wright, J., Thompson, J., Thomas, D., Baleux, F., Virelizier, J. L., ... & Arenzana-Seisdedos,

F. (1996) Identification of lysine residues required for signal-induced ubiquitination and

degradation of I kappa B-alpha in vivo. Oncogene 12: 2425-2435

Rogers S, Wells R, Rechsteiner M (1986) Amino acid sequences common to rapidly degraded proteins:

the PEST hypothesis. Science 234: 364-368

Rowland AA, Chitwood PJ, Phillips MJ, Voeltz GK (2014) ER contact sites define the position and timing

of endosome fission. Cell 159: 1027-1041

Rucktaschel R, Thoms S, Sidorovitch V, Halbach A, Pechlivanis M, Volkmer R, Alexandrov K, Kuhlmann J,

Rottensteiner H, Erdmann R (2009) Farnesylation of pex19p is required for its structural

integrity and function in peroxisome biogenesis. Journal of Biological Chemistry 284:

20885-20896

Rymer Ł, Kempiński B, Chełstowska A, Skoneczny M (2018) The budding yeast Pex5p receptor directs

Fox2p and Cta1p into peroxisomes via its N-terminal region near the FxxxW domain. Journal of

Cell Science 131: jcs216986

Sacksteder KA, Jones JM, South ST, Li X, Liu Y, Gould SJ (2000) PEX19 binds multiple peroxisomal

membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane

synthesis. J Cell Biol 148: 931-944.

Sadowski M, Suryadinata R, Tan AR, Roesley SNA, Sarcevic B (2012) Protein monoubiquitination and

polyubiquitination generate structural diversity to control distinct biological processes. IUBMB

life 64: 136-142

Sakai Y, Oku M, van der Klei IJ, Kiel JA (2006) Pexophagy: autophagic degradation of peroxisomes.

Biochim Biophys Acta 1763: 1767-1775

Saleem RA, Long-O'Donnell R, Dilworth DJ, Armstrong AM, Jamakhandi AP, Wan Y, ..., Shmulevich I

(2010) Genome-wide analysis of effectors of peroxisome biogenesis. PLoS One 5: e11953

Saleem RA, Smith JJ, Aitchison JD (2006) Proteomics of the peroxisome. Biochimica et Biophysica Acta

(BBA)-Molecular Cell Research 1763: 1541-1551

Salomons FA, Kiel JA, Faber KN, Veenhuis M, van der Klei IJ (2000) Overproduction of Pex5p stimulates

References

180

import of alcohol oxidase and dihydroxyacetone synthase in a Hansenula polymorpha Pex14

null mutant. Journal of Biological Chemistry 275: 12603-12611.

Saraya R, Cepinska MN, Kiel JA, Veenhuis M, van der Klei IJ (2010) A conserved function for Inp2 in

peroxisome inheritance. Biochim Biophys Acta 1803: 617-622

Sargent G, van Zutphen T, Shatseva T, Zhang L, Di Giovanni V, Bandsma R, Kim PK (2016) PEX2 is the E3

ubiquitin ligase required for pexophagy during starvation. The Journal of Cell Biology

Sato Y, Shibata H, Nakatsu T, Nakano H, Kashiwayama Y, Imanaka T, Kato H (2010) Structural basis for

docking of peroxisomal membrane protein carrier Pex19p onto its receptor Pex3p. Embo J 29:

4083-4093

Sauer RT, Baker TA (2011) AAA+ proteases: ATP-fueled machines of protein destruction. Annual review

of biochemistry 80: 587-612

Schäfer H, Nau K, Sickmann A, Erdmann R, Meyer HE (2001) Identification of peroxisomal membrane

proteins of Saccharomyces cerevisiae by mass spectrometry. Electrophoresis 22: 2955-2968

Scheffner M, Nuber U, Huibregtse JM (1995) Protein ubiquitination involving an E1–E2–E3 enzyme

ubiquitin thioester cascade. Nature 373: 81

Schell-Steven A, Stein K, Amoros M, Landgraf C, Volkmer-Engert R, Rottensteiner H, Erdmann R (2005)

Identification of a novel, intraperoxisomal pex14-binding site in pex13: association of pex13

with the docking complex is essential for peroxisomal matrix protein import. Molecular and

cellular biology 25: 3007-3018

Schliebs W, Kunau WH (2006) PTS2 co-receptors: diverse proteins with common features. Biochim

Biophys Acta 1763: 1605-1612

Schliebs W, Würtz C, Kunau WH, Veenhuis M, Rottensteiner H (2006) A eukaryote without

catalase-containing microbodies: Neurospora crassa exhibits a unique cellular distribution of

its four catalases. Eukaryotic cell 5: 1490-1502

Schluter A, Fourcade, S., Ripp, R., Mandel, J. L., Poch, O., & Pujol, A. (2006) The evolutionary origin of

peroxisomes: an ER-peroxisome connection. Molecular biology and evolution 23: 838-845

Schrader M, Costello JL, Godinho LF, Azadi AS, Islinger M (2016) Proliferation and fission of

peroxisomes—an update. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1863:

971-983

Schrader M, Fahimi HD (2008) The peroxisome: still a mysterious organelle. Histochemistry and cell

biology 129: 421-440

Schrader M, Reuber BE, Morrell JC, Jimenez-Sanchez G, Obie C, Stroh TA, Valle D, Schroer TA, Gould SJ

(1998) Expression of PEX11beta mediates peroxisome proliferation in the absence of

extracellular stimuli. Journal of biological chemistry 273: 29607-29614

Schueller N, Holton SJ, Fodor K, Milewski M, Konarev P, Stanley WA, ..., Wilmanns M (2010) The

peroxisomal receptor Pex19p forms a helical mPTS recognition domain. The EMBO journal 29:

References

181

2491-2500

Seufert W, Jentsch S (1990) Ubiquitin-conjugating enzymes UBC4 and UBC5 mediate selective

degradation of short-lived and abnormal proteins. The EMBO journal 9: 543-550

Seyfried NT, Xu P, Duong DM, Cheng D, Hanfelt J, Peng J (2008) Systematic approach for validating the

ubiquitinated proteome. Analytical chemistry 80: 4161-4169

Shani N, Watkins PA, Valle D (1995) PXA1, a possible Saccharomyces cerevisiae ortholog of the human

adrenoleukodystrophy gene. Proceedings of the National Academy of Sciences 92: 6012-6016

Shao S, Hegde RS (2011) Membrane protein insertion at the endoplasmic reticulum. Annual review of

cell and developmental biology 27

Sheaff RJ, Singer JD, Swanger J, Smitherman M, Roberts JM, Clurman BE (2000) Proteasomal turnover

of p21Cip1 does not require p21Cip1 ubiquitination. Molecular cell 5: 403-410

Shimozawa N, Suzuki Y, Zhang Z, Imamura A, Ghaedi K, Fujiki Y, Kondo N (2000) Identification of PEX3

as the gene mutated in a Zellweger syndrome patient lacking peroxisomal remnant structures.

Human molecular genetics 9: 1995-1999

Shringarpure R, Grune T, Mehlhase J, Davies KJ (2003) Ubiquitin conjugation is not required for the

degradation of oxidized proteins by proteasome. Journal of Biological Chemistry 278: 311-318

Sichting M, Schell-Steven A, Prokisch H, Erdmann R, Rottensteiner H (2003) Pex7p and Pex20p of

Neurospora crassa function together in PTS2-dependent protein import into peroxisomes.

Molecular biology of the cell 14: 810-821

Smith DM, Chang SC, Park S, Finley D, Cheng Y, Goldberg AL (2007) Docking of the proteasomal

ATPases' carboxyl termini in the 20S proteasome's α ring opens the gate for substrate entry.

Molecular cell 27: 731-744

Smith JJ, Aitchison JD (2013a) Peroxisomes take shape. Nat Rev Mol Cell Biol 14: 803-817

Smith JJ, Aitchison JD (2013b) Peroxisomes take shape. Nature reviews Molecular cell biology 14:

803-817

Smith MH, Ploegh HL, Weissman JS (2011) Road to ruin: targeting proteins for degradation in the

endoplasmic reticulum. Science 334: 1086-1090

Smith N, Wei W, Zhao M, Qin X, Seravalli J, Kim H, Lee J (2016) Cadmium and Secondary

Structure-dependent Function of a Degron in Pca1p Cadmium Exporter. Journal of Biological

Chemistry jbc-M116

Snyder WB, Koller A, Choy AJ, Johnson MA, Cregg JM, Rangell L, Keller GA, Subramani S (1999) Pex17p

is required for import of both peroxisome membrane and lumenal proteins and interacts with

Pex19p and the peroxisome targeting signal-receptor docking complex in Pichia pastoris.

Molecular biology of the cell 10: 4005-4019

Spahr CS, Davis MT, McGinley MD, Robinson JH, Bures EJ, Beierle J, ..., Yu W (2001) Towards defining

the urinary proteome using liquid chromatography-tandem mass spectrometry I. Profiling an

References

182

unfractionated tryptic digest. Proteomics 1: 93-107

Steen H, Jebanathirajah JA, Rush J, Morrice N, Kirschner MW (2006) Phosphorylation analysis by mass

spectrometry myths, facts, and the consequences for qualitative and quantitative

measurements. Molecular & Cellular Proteomics 5: 172-181

Stein A, Ruggiano A, Carvalho P, Rapoport TA (2014) Key steps in ERAD of luminal ER proteins

reconstituted with purified components. Cell 158: 1375-1388

Stein K, Schell-Steven A, Erdmann R, Rottensteiner H (2002) Interactions of Pex7p and Pex18p/Pex21p

with the Peroxisomal Docking Machinery: Implications for the First Steps in PTS2 Protein

Import. Molecular and cellular biology 22: 6056-6069.

Steinberg SJ, Dodt G, Raymond GV, Braverman NE, Moser AB, Moser HW (2006) Peroxisome

biogenesis disorders. Biochim Biophys Acta 1763: 1733-1748

Stewart MD, Ritterhoff T, Klevit RE, Brzovic PS (2016) E2 enzymes: more than just middle men. Cell

research 26: 423

Stratford FL, Chondrogianni N, Trougakos IP, Gonos ES, Rivett AJ (2006) Proteasome response to

interferon-γ is altered in senescent human fibroblasts. FEBS letters 580: 3989-3994

Stromhaug PE, Klionsky DJ (2001) Approaching the molecular mechanism of autophagy. Traffic 2:

524-531

Su J, Thomas AS, Grabietz T, Landgraf C, Volkmer R, Marrink SJ, ..., Melo MN (2018) The N-terminal

amphipathic helix of Pex11p self-interacts to induce membrane remodelling during peroxisome

fission. Biochimica et Biophysica Acta (BBA)-Biomembranes 1860: 1292-1300

Subramani S (2015) A mammalian pexophagy target. Nature cell biology 17: 1371

Sugiura A, Mattie S, Prudent J, McBride HM (2017) Newly born peroxisomes are a hybrid of

mitochondrial and ER-derived pre-peroxisomes. Nature 542: 251-254

Suzuki H, Noda NN (2018) Biophysical characterization of Atg11, a scaffold protein essential for

selective autophagy in yeast. FEBS open bio 8: 110-116

Swanson R, Locher M, Hochstrasser M (2001) A conserved ubiquitin ligase of the nuclear

envelope/endoplasmic reticulum that functions in both ER-associated and Matα2 repressor

degradation. Genes & development 15: 2660-2674

Swatek KN, Komander D (2016) Ubiquitin modifications. Cell research 26: 399-422

Tagwerker C, Flick K, Cui M, Guerrero C, Dou Y, Auer B, Baldi P, Huang L, Kaiser P (2006) A tandem

affinity tag for two-step purification under fully denaturing conditions: application in ubiquitin

profiling and protein complex identification combined with in vivo cross-linking. Molecular &

Cellular Proteomics 5: 737-748

Tan X, Waterham HR, Veenhuis M, Cregg JM (1995) The Hansenula polymorpha PER8 gene encodes a

novel peroxisomal integral membrane protein involved in proliferation. The Journal of Cell

Biology 128: 307-319

References

183

Tanaka A, Okumoto K, Fujiki Y (2003) cDNA cloning and characterization of the third isoform of human

peroxin Pex11p. Biochemical and biophysical research communications 300: 819-823

Theodoraki MA, Nillegoda NB, Saini J, Caplan AJ (2012) A network of ubiquitin ligases is important for

the dynamics of misfolded protein aggregates in yeast. Journal of Biological Chemistry

jbc-M112

Thomas AS, Krikken AM, de Boer R, Williams C (2018) Hansenula polymorpha Aat2p is targeted to

peroxisomes via a novel Pex20p dependent pathway. FEBS letters

Thrower JS, Hoffman L, Rechsteiner M, Pickart CM (2000) Recognition of the polyubiquitin proteolytic

signal. The EMBO journal 19: 94-102

Titorenko VI, Rachubinski RA (1998) Mutants of the yeast Yarrowia lipolytica defective in protein exit

from the endoplasmic reticulum are also defective in peroxisome biogenesis. Molecular and

Cellular Biology 18: 2789-2803

Tomisugi Y, Unno M, Mizushima T, Morimoto Y, Tanahashi N, Tanaka K, ..., Yasuoka N (2000) New

crystal forms and low resolution structure analysis of 20 S proteasomes from bovine liver. The

Journal of Biochemistry 127: 941-943

Tong AHY, Boone C (2006) Synthetic genetic array analysis in Saccharomyces cerevisiae. In Yeast

Protocol: 171-191

Toyama R, Mukai S, Itagaki A, Tamura S, Shimozawa N, Suzuki Y, Kondo N, Wanders RJ, Fujiki Y (1999)

Isolation, characterization and mutation analysis of PEX13-defective Chinese hamster ovary

cell mutants. Human molecular genetics 8: 1673-1681.

Tu D, Li W, Ye Y, Brunger AT (2007) Structure and function of the yeast U-box-containing ubiquitin

ligase Ufd2p. Proceedings of the National Academy of Sciences 104: 15599-15606

Tuttle DL, Dunn WA (1995) Divergent modes of autophagy in the methylotrophic yeast Pichia pastoris.

Journal of cell science 108: 25-35

Urquhart AJ, Kennedy D, Gould SJ, Crane DI (2000) Interaction of Pex5p, the type 1 peroxisome

targeting signal receptor, with the peroxisomal membrane proteins Pex14p and Pex13p.

Journal of Biological Chemistry 275: 4127-4136

Valenciano S, De Lucas JR, Van der Klei I, Veenhuis M, Laborda F (1998) Characterization of Aspergillus

nidulans peroxisomes by immunoelectron microscopy. Arch Microbiol 170: 370-376

Van den Bosch H, Schutgens RB, Wanders RJ, Tager JM (1992) Biochemistry of peroxisomes. Annual

review of biochemistry 61: 157-197

Van der Klei IJ, Hilbrands RE, Kiel JA, Rasmussen SW, Cregg JM, Veenhuis M (1998) The

ubiquitin-conjugating enzyme Pex4p of Hansenula polymorpha is required for efficient

functioning of the PTS1 import machinery. The EMBO Journal 17: 3608-3618

Van der Klei IJ, Hilbrands RE, Swaving GJ, Waterham HR, Vrieling EG, Titorenko VI, Cregg JM, Harder W,

Veenhuis M (1995) The Hansenula polymorpha PER3 gene is essential for the import of PTS1

References

184

proteins into the peroxisomal matrix. Journal of Biological Chemistry 270: 17229-17236

van der Zand A, Braakman I, Tabak HF (2010) Peroxisomal membrane proteins insert into the

endoplasmic reticulum. Molecular biology of the cell 21: 2057-2065

van der Zand A, Gent J, Braakman I, Tabak HF (2012) Biochemically distinct vesicles from the

endoplasmic reticulum fuse to form peroxisomes. Cell 149: 397-409

Van Dijkan JP, Veenhuis M, Harder W (1982) Peroxisomes of methanol-grown yeasts. Ann NY Acad Sci

386: 200-216

Van Dijken JP, Veenhuis M, Kreger-van Rij NJ, Harder W (1975) Microbodies in methanol-assimilating

yeasts. Arch Microbiol 102: 41-44

Van Roermund CW, Hettema EH, Kal AJ, van den Berg M, Tabak HF, Wanders RJ (1998) Peroxisomal

beta-oxidation of polyunsaturated fatty acids in Saccharomyces cerevisiae: isocitrate

dehydrogenase provides NADPH for reduction of double bonds at even positions. The EMBO

journal 17: 677-687

van Zutphen T, van der Klei IJ, Kiel JA (2008a) Pexophagy in Hansenula polymorpha. Methods Enzymol

451: 197-215

van Zutphen T, Veenhuis M, van der Klei IJ (2008b) Pex14 is the sole component of the peroxisomal

translocon that is required for pexophagy. Autophagy 4: 63-66

Varshavsky A (1997) The N-end rule pathway of protein degradation. Genes to cells 2: 13-28

Veiga T, Gombert AK, Landes N, Verhoeven MD, Kiel JA, Krikken AM, Nijland JG, Touw H, Luttik MA,

van der Toorn JC, Driessen AJ, Bovenberg RA, van den Berg MA, van der Klei IJ, Pronk JT, Daran

JM (2012) Metabolic engineering of beta-oxidation in Penicillium chrysogenum for improved

semi-synthetic cephalosporin biosynthesis. Metabolic engineering 14: 437-448

Verma R, Aravind L, Oania R, McDonald WH, Yates JR, Koonin EV, Deshaies RJ (2002) Role of Rpn11

metalloprotease in deubiquitination and degradation by the 26S proteasome. Science 298:

611-615

Vittal V, Stewart MD, Brzovic PS, Klevit RE (2015) Regulating the regulators: recent revelations in the

control of E3 ubiquitin ligases. Journal of Biological Chemistry 290

Walker K, Skelton H, Smith K (2002) Cutaneous lesions showing giant yeast forms of Blastomyces

dermatitidis. Journal of cutaneous pathology 29: 616-618

Walton PA, Brees C, Lismont C, Apanasets O, Fransen M (2017) The peroxisomal import receptor PEX5

functions as a stress sensor, retaining catalase in the cytosol in times of oxidative stress.

Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1864: 1833-1843

Wanders RJ, Waterham HR (2006) Biochemistry of mammalian peroxisomes revisited. Annual Review

of Biochemistry 75: 295-332

Wang W, Xia ZJ, Farre JC, Subramani S (2017) TRIM37, a novel E3 ligase for PEX5-mediated peroxisomal

matrix protein import. The Journal of Cell Biology 216: 2843-2858

References

185

Wang X, Herr RA, Chua WJ, Lybarger L, Wiertz EJ, Hansen TH (2007) Ubiquitination of serine,

threonine, or lysine residues on the cytoplasmic tail can induce ERAD of MHC-I by viral E3

ligase mK3. The Journal of cell biology 177: 613-624

Warren DS, Wolfe BD, Gould SJ (2000) Phenotype-genotype relationships in PEX10-deficient

peroxisome biogenesis disorder patients. Human mutation 15: 509-521

Waterham HR, Ebberink MS (2012) Genetics and molecular basis of human peroxisome biogenesis

disorders. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 1822: 1430-1441

Waterham HR, Ferdinandusse S, Wanders RJ (2016) Human disorders of peroxisome metabolism and

biogenesis. Biochimica Et Biophysica Acta (BBA)-Molecular Cell Research 1863: 922-933

Waterham HR, Titorenko VI, Haima P, Cregg JM, Harder W, Veenhuis M (1994) The Hansenula

polymorpha PER1 gene is essential for peroxisome biogenesis and encodes a peroxisomal

matrix protein with both carboxy- and amino-terminal targeting signals. The Journal of Cell

Biology 127: 737-749

Weir NR, Kamber RA, Martenson JS, Denic V (2017) The AAA protein Msp1 mediates clearance of

excess tail-anchored proteins from the peroxisomal membrane. eLife 6

Wiederkehr A, Avaro S, Prescianotto-Baschong C, Haguenauer-Tsapis R, Riezman H (2000) The F-box

protein Rcy1p is involved in endocytic membrane traffic and recycling out of an early

endosome in Saccharomyces cerevisiae. The Journal of cell biology 149: 397-410

Wilkinson KD, Tashayev VL, O'Connor LB, Larsen CN, Kasperek E, Pickart CM (1995) Metabolism of the

polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T.

Biochemistry 34: 14535-14546

Williams C (2014) Going against the flow: A case for peroxisomal protein export. Biochim Biophys Acta

- Molecular Cell Research

Williams C, Distel B (2006) Pex13p: Docking or cargo handling protein? Biochim Biophys Acta 1763:

1585-1591

Williams C, Opalinski L, Landgraf C, Costello J, Schrader M, Krikken AM, Knoops K, Kram AM, Volkmer R,

van der Klei IJ (2015) The membrane remodeling protein Pex11p activates the GTPase Dnm1p

during peroxisomal fission. Proceedings of the National Academy of Sciences 112: 6377-6382

Williams C, Stanley WA (2010) Peroxin 5: A cycling receptor for protein translocation into peroxisomes.

The international journal of biochemistry & cell biology

Williams C, van den Berg M, Distel B (2005) Saccharomyces cerevisiae Pex14p contains two

independent Pex5p binding sites, which are both essential for PTS1 protein import. FEBS letters

579: 3416-3420

Williams C, van den Berg M, Geers E, Distel B (2008) Pex10p functions as an E3 ligase for the

Ubc4p-dependent ubiquitination of Pex5p. Biochemical and biophysical research

communications 374: 620-624

References

186

Williams C, van den Berg M, Panjikar S, Stanley WA, Distel B, Wilmanns M (2012) Insights into

ubiquitin-conjugating enzyme/ co-activator interactions from the structure of the

Pex4p:Pex22p complex. The EMBO journal 31: 391-402

Williams C, van den Berg M, Sprenger RR, Distel B (2007) A conserved cysteine is essential for

Pex4p-dependent ubiquitination of the peroxisomal import receptor Pex5p. Journal of

Biological Chemistry 282: 22534-22543

Williams C, van der Klei I (2014) The Functions of Pex11 Family Proteins in Peroxisome Biology. In

Molecular Machines Involved in Peroxisome Biogenesis and Maintenance, Brocard C, Hartig A

(eds), 19, pp 425-437. Springer Vienna

Williams C, van der Klei IJ (2013a) Pexophagy-linked degradation of the peroxisomal membrane

protein Pex3p involves the ubiquitin–proteasome system. Biochemical and biophysical research

communications 438: 395-401

Williams C, van der Klei IJ (2013b) Pexophagy-linked degradation of the peroxisomal membrane

protein Pex3p involves the ubiquitin–proteasome system. Biochem Biophys Res Commun 438:

395-401

Wohlever ML, Mateja A, McGilvray PT, Day KJ, Keenan RJ (2017) Msp1 is a membrane protein

dislocase for tail-anchored proteins. Molecular cell 67: 194-202

Wolf DH, Stolz A (2012) The Cdc48 machine in endoplasmic reticulum associated protein degradation.

Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1823: 117-124

Woodward AW, Fleming WA, Burkhart SE, Ratzel SE, Bjornson M, Bartel B (2014) A viable Arabidopsis

pex13 missense allele confers severe peroxisomal defects and decreases PEX5 association with

peroxisomes. Plant molecular biology 86: 201-214

Wroblewska JP, Cruz-Zaragoza LD, Yuan W, Schummer A, Chuartzman SG, de Boer R, ..., Erdmann R

(2017) Saccharomyces cerevisiae cells lacking Pex3 contain membrane vesicles that harbor a

subset of peroxisomal membrane proteins. Biochimica et Biophysica Acta (BBA)-Molecular Cell

Research 1864: 1656-1667

Wu X, Li L, Jiang H (2016) Doa1 targets ubiquitinated substrates for mitochondria-associated

degradation. J Cell Biol jcb-201510098

Yamanaka K, Sasagawa Y, Ogura T (2012) Recent advances in p97/VCP/Cdc48 cellular functions.

Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1823: 130-137

Yamochi W, Tanaka K, Nonaka H, Maeda A, Musha T, Takai Y (1994) Growth site localization of Rho1

small GTP-binding protein and its involvement in bud formation in Saccharomyces cerevisiae.

The Journal of Cell Biology 125: 1077-1093

Yau R, Rape M (2016) The increasing complexity of the ubiquitin code. Nature cell biology 18: 579

Ye Y, Rape M (2009) Building ubiquitin chains: E2 enzymes at work. Nat Rev Mol Cell Biol 10: 755-764

Yi EC, Marelli M, Lee H, Purvine SO, Aebersold R, Aitchison JD, Goodlett DR (2002) Approaching

References

187

complete peroxisome characterization by gas-phase fractionation. Electrophoresis 23:

3205-3216

Yifrach E, Chuartzman SG, Dahan N, Maskit S, Zada L, Weill U, ..., Zalckvar E (2016) Characterization of

proteome dynamics in oleate reveals a novel peroxisome targeting receptor. Journal of Cell

Science jcs-195255

Zheng N, Shabek N (2017) Ubiquitin ligases: structure, function, and regulation. Annual review of

biochemistry 86: 129-157

Zipor G, Haim-Vilmovsky L, Gelin-Licht R, Gadir N, Brocard C, Gerst JE (2009) Localization of mRNAs

coding for peroxisomal proteins in the yeast, Saccharomyces cerevisiae. Proceedings of the

National Academy of Sciences 106: 19848-19853

Zoeller RA, Rangaswamy S, Herscovitz H, Rizzo WB, Hajra AK, Das AK, Moser HW, Moser A, Lazarow PB,

Santos MJ (1992) Mutants in a macrophage-like cell line are defective in plasmalogen

biosynthesis, but contain functional peroxisomes. Journal of biological chemistry 267:

8299-8306

Zwart KB, Veenhuis M, Harder W (1983) Significance of yeast peroxisomes in the metabolism of

choline and ethanolamine. Antonie Van Leeuwenhoek 49: 369-385

188

6

Chapter 6

Summary and Discussion

Xin Chen and Chris Williams

SIX Summary

190

Summary and Discussion

Peroxisomes are single membrane bound organelles found in nearly all eukaryotic cells.

Peroxisomes participate in a variety of biological processes, including fatty acid

β-oxidation, the glyoxylate cycle, plasmalogens synthesis, photorespiration and purine

biosynthesis. The function of a peroxisome is determined by the matrix proteins (MATs)

in the peroxisomal lumen, often involved in metabolism and peroxisomal membrane

proteins (PMPs), which are involved in the transport of proteins and small molecules

into peroxisomes, peroxisomal fission and the interplay between peroxisomes and other

organelles. Because peroxisomes post-translationally import all the proteins required for

function, protein transport processes play an important role in defining peroxisome

function. However, at some point during their lifetime, all proteins in the cell undergo

protein degradation. Hence, protein degradation can also be expected to impact on

peroxisomal function. Protein degradation may occur because they are “worn out” by

chemical modifications, because they become unfolded or because they are no longer

needed. Protein degradation needs to be regulated, otherwise unwanted degradation

events may occur or unwanted proteins start to build up in the cell. Understanding how

and why proteins are degraded allows us to better understand the role of protein

degradation in a cellular context.

The ubiquitin-proteasome system (UPS) plays an important role in protein turnover

in many cellular processes, including the cell cycle, the regulation of gene expression

and responses to oxidative stress. The UPS involves the attachment of the 8 kDa protein

ubiquitin (Ub) to a substrate protein in an ATP dependent process, requiring three

distinct enzymes. First, the ubiquitin activating enzyme (E1) activates ubiquitin. Next,

the activated ubiquitin is transferred to the active site cysteine residue of an ubiquitin

conjugating enzyme (E2). Finally, an ubiquitin ligase (E3) allows conjugation of

ubiquitin to the substrate. The ubiquitin attached to the substrate can itself become a

substrate for ubiquitination, resulting in the formation of ubiquitin chains. Such Ub

chains can target substrates for degradation via the proteasome.

Peroxisomes have their own, membrane-associated ubiquitination machinery,

consisting of the ubiquitin conjugating enzyme Pex4p in yeast (or member of the Ube2D

E2 family in mammals) and an E3 ligase complex, containing the RING proteins Pex2p,

Pex10p and Pex12p. The peroxisomal ubiquitination machinery is mostly known for the

ubiquitination of the cycling receptor proteins Pex5p and Pex20p family members.

However, the role of the peroxisomal ubiquitination machinery in peroxisome function

is still not well understood while, unlike other organelles, next to nothing is known

Summary SIX

191

about how PMPs are targeted for degradation. The research described in this thesis

aimed to investigate how and why PMP degradation occurs. Our study focuses on the

degradation of the PMP Pex13p in yeast and the corresponding function of Pex13p

degradation in the context of peroxisome biology and cellular metabolism.

In Chapter one, we present an overview of cellular processes that regulate

peroxisome function, ranging from how peroxisomes are made to how they are degraded.

Furthermore, we discuss the current knowledge on how membrane proteins present on

organelles undergo degradation, the role of the UPS in membrane protein degradation

and finally how PMP degradation may be facilitated.

In Chapter two, we show that the PMP Pex13p undergoes rapid turnover in H.

polymorpha wildtype cells and describe a role of the peroxisomal ubiquitination

machinery in Pex13p turnover. We establish that Pex13p is ubiquitinated in wildtype

cells and that the ubiquitination of Pex13p is reduced in the absence of a functional

peroxisomal E3 ligase complex. Furthermore, cells lacking members of this machinery

display elevated level of Pex13p and accumulate Pex13p at the peroxisomal membrane.

Our results add strong support to the idea that the peroxisomal ubiquitination machinery

is not only required for ubiquitinating Pex5p and members of the Pex20p family but also

targets additional peroxisomal proteins. When taken together, we now know that

members of the peroxisomal E3 ligase complex are involved in the ubiquitination/

degradation of Pex5p and Pex20p, the PMP Pex3p in H. polymorpha and in the

ubiquitination of PMP70 in mammals. This suggests a ubiquitous and important role for

the peroxisomal ubiquitination machinery in peroxisomal proteins

ubiquitination/degradation as well as in peroxisome biology.

In Chapter three, we investigate the potential functions of Pex13p degradation in

the yeast H. polymorpha. We demonstrated that Pex2p-dependent turnover of Pex13p

also occurs under peroxisome non-inducing condition, demonstrating that Pex13p

degradation is a general and not a condition-specific event. We also show that blocking

the recycling of Pex5p inhibits Pex13p degradation, indicating that the removal of

Pex5p from the peroxisomal membrane is linked to Pex13p degradation. Furthermore,

we identify a mutant form of Pex13p that is inhibited in degradation and establish that

blocking Pex13p degradation can negatively impact on peroxisome function in vivo.

Finally, we demonstrate that Pex13p levels increase in cells overproducing Pex14p,

suggesting that Pex13p degradation is reduced in these cells and that Pex13p

degradation is dependent on Pex14p levels. Taken together, these observations strongly

suggest an important coupled relationship between Pex13p degradation and the import

of matrix proteins into peroxisomes. It is possible that Pex13p degradation negatively

SIX Summary

192

regulates matrix protein import by disconnecting the docking complex (of which Pex13p

is a member) from the downstream components required for the recycling of the PTS1

protein import receptor Pex5p, such as the RING E3 complex or the AAA-ATPases

Pex1p and Pex6p. However, since Pex13p degradation is a rapid and general event that

occurs under different growth conditions, the notion that Pex13p degradation negatively

regulates matrix protein import might seem unlikely. Another hypothesis is that Pex13p

degradation is required to dissociate the transient importomer complex. The rapid

association and dissociation of multiple factors in the importomer complex is likely

required for the import process and it could be envisaged that removal of Pex13p out of

the importomer complex may destabilize the importomer and lead to the release of cargo

proteins into the lumen or alternatively to the recycling Pex5p to the cytosol. Hence,

further work that addresses the role of Pex13p degradation in matrix protein import is

required.

In Chapter four, we have investigated Pex13p degradation in the yeast S.

cerevisiae and utilized a tandem fluorescent protein timer (tFT) to identify additional

factors involved in Pex13p degradation. Our data demonstrate that Pex13p rapid

degradation is conserved in S. cerevisiae wild type cells grown on oleic acid media and

that Pex13p is degraded via UPS, again establishing that Pex13p turnover is likely to

play an important role in peroxisome biology. In addition, the peroxisomal

ubiquitination machinery plays a major role in Pex13p turnover, while the additional

cytosolic UPS factors Ufd4p, Ubc4p and Ubr2p play a minor role in Pex13p turnover,

possibly through the formation of poly-ubiquitin chains on Pex13p. The fact that

multiple E2s and E3s appear to play a role in Pex13p degradation suggests that either

several pathways act in parallel on Pex13p to facilitate its degradation or that all these

factors act together in ubiquitinating Pex13p, to target the protein for proteasomal

degradation. Furthermore, these observations indicate that cytosolic UPS factors can

regulate the turnover of PMPs and hence have the potential to impact on peroxisome

function. This, in turn, indicates that the degradation of PMPs, like that of ER and

mitochondrial membrane proteins, is regulated at the level of the general cellular protein

degradation pathways. Finally, our data also demonstrate that the function of Cdc48p is

not required for Pex13p degradation. Since Cdc48p is involved in the degradation of ER

and mitochondrial membrane proteins, this observation sets the degradation of PMPs

apart from that of other organellar membrane proteins and establishes that different

mechanisms exist to facilitate these degradation processes. One possibility is that the

AAA-ATPases Pex1p and Pex6p, which are involved in the extraction of ubiquitinated

Pex5p from the peroxisomal membrane, target ubiquitinated Pex13p to the proteasome.

Summary SIX

193

However, the membrane bound AAA-ATPase Msp1p, which was reported to extract tail

anchored proteins out of the peroxisomal membrane for degradation, can also be seen as

an interesting candidate for further study. Finally, recent reports indicate that the

proteasome can be recruited to membranes to facilitate the degradation of membrane

proteins. Perhaps such a mechanism also controls the degradation of Pex13p. Clearly

further work is needed to investigate how ubiquitinated Pex13p is extracted from the

peroxisomal membrane.

Peroxisome function is extremely diverse and depends on species, cell type and

growth conditions. In order to have a complete understanding of the function(s) of

peroxisomes in a given cell under a given condition, a complete overview of the proteins

present in these peroxisomes is vital. Mass spectrometry based proteomics methods have

proved invaluable when studying the peroxisomal proteome and have provided several

new and novel insights into peroxisome function. In Chapter five we have summarize

the findings of several mass spectrometry-based organellar proteomics studies in yeast

and filamentous fungi and have outlined the new insights into peroxisomal function

gained from the studies.

PMPs are involved in all peroxisomal functions and therefore are vitally important for

cellular metabolism. The further study of PMP degradation will greatly enhance our

understanding of how PMP homeostasis is maintained and how this impacts on

peroxisome function. In this thesis we have investigated the degradation of the PMP

Pex13p in yeast and the contribution of the peroxisomal membrane ubiquitination

machinery, as well as additional components of the UPS, in this process. The fact that

Pex13p undergoes degradation in two different organisms, apparently via similar

mechanisms, strongly suggests that the ability to degrade Pex13p is both a general trait

of peroxisomes and that it is important for the function of Pex13p in the matrix protein

import process. Going one step further, should Pex13p degradation also occur in

mammalian cells, this raises the question how Pex13p degradation may contribute to

human health and whether defects in Pex13p degradation have the potential to cause

human disease. Furthermore, because Pex13p degradation in both organisms requires

the peroxisomal ubiquitination machinery, coupled with previous reports that

demonstrate a role for members of this machinery in the ubiquitination and degradation

of additional PMP, we suspect that the peroxisomal ubiquitination machinery is in fact a

general ubiquitination platform present on the peroxisomal membrane that targets

multiple substrates. Future studies that aim to identify additional substrates of this

machinery will provide invaluable new insights into the role of the machinery in

peroxisomal function.

194

Samenvatting

195

Samenvatting

Peroxisomen zijn enkelmembraan-gebonden organellen die in bijna alle eukaryote cellen

worden aangetroffen. Peroxisomen nemen deel aan een verscheidenheid van biologische

processen, waaronder vetzuur-β-oxidatie, de glyoxylatie cyclus, plasmalogen synthese,

fotorespiratie en purinebiosynthese. De functie van een peroxisoom wordt bepaald door

de matrixeiwitten (MAT's) in het peroxisomale lumen, vaak betrokken bij het

metabolisme, en door de peroxisomale membraaneiwitten (PMP's), die betrokken zijn

bij het transport van eiwitten en kleine moleculen naar peroxisomen, de deling van

peroxisomen en het samenspel tussen peroxisomen en andere organellen. Omdat

peroxisomen alle eiwitten die nodig zijn voor functie post-translationeel importeren,

spelen eiwittransportprocessen een belangrijke rol bij het definiëren van de

peroxisoomfunctie. Alle eiwitten in de cel worden echter ook op enig moment tijdens

hun levensduur afgebroken. Van eiwitafbraak kan daarom ook worden verwacht dat

deze invloed heeft op de peroxisomale functie. Eiwitafbraak kan optreden omdat

eiwitten "versleten" zijn door chemische modificaties, omdat ze ontvouwen worden of

omdat ze niet langer nodig zijn. Eiwitafbraak moet zorgvuldig worden gereguleerd,

anders kunnen ongewenste afbraakgebeurtenissen optreden of beginnen ongewenste

eiwitten zich in de cel op te hopen. Door te begrijpen hoe en waarom eiwitten worden

afgebroken, kunnen we de rol van eiwitafbraak in een cellulaire context beter begrijpen.

Het ubiquitine-proteasome systeem (UPS) speelt een belangrijke rol bij

eiwitomzetting in veel cellulaire processen, waaronder de celcyclus, de regulatie van

genexpressie en reacties op oxidatieve stress. De UPS zorgt voor de koppeling van het 8

kDa eiwit ubiquitine (Ub) aan het af te breken eiwit in een ATP-afhankelijk proces,

waarbij drie verschillende enzymen zijn vereist. Eerst activeert het

ubiquitine-activerende enzym (E1) ubiquitine. Vervolgens wordt het geactiveerde

ubiquitine overgebracht naar het cysteïne residu in de actieve plaats van een

ubiquitine-conjugerend enzym (E2). Ten slotte maakt een ubiquitine-ligase (E3)

conjugatie van ubiquitine aan het substraat mogelijk. Het ubiquitine gehecht aan het

substraat kan zelf een substraat worden voor verdere ubiquitinatie, resulterend in de

vorming van ubiquitine ketens. Dergelijke Ub-ketens kunnen substraten markeren voor

degradatie via het proteasoom.

Peroxisomen hebben hun eigen membraangeassocieerde ubiquitinatie-machinerie,

bestaande uit het ubiquitine-conjugatie-enzym Pex4p in gist (vergelijkbaar met de

Ube2D E2-familie in zoogdieren) en een E3-ligasecomplex, dat de RING-eiwitten

Pex2p, Pex10p en Pex12p bevat. De peroxisomale ubiquitinatie-machinerie is het meest

Samenvatting

196

bestudeerd bij de ubiquitinatie van de cyclische receptoreiwitten uit de Pex5p en

Pex20p-familie. De rol van de peroxisomale ubiquitinatie-machinerie in de

peroxisoomfunctie wordt echter nog steeds niet goed begrepen, terwijl er, in

tegenstelling tot andere organellen, bijna niets bekend is over hoe PMP's worden

gemarkeerd voor afbraak. Het onderzoek beschreven in dit proefschrift heeft als doel na

te gaan hoe en waarom afbraak van PMP optreedt. Onze studie richt zich op de afbraak

van de PMP Pex13p in gist en de functie van deze Pex13p afbraak in de context van

peroxisoombiologie en cellulair metabolisme.

In Hoofdstuk een presenteren we een overzicht van cellulaire processen die de

peroxisoomfunctie reguleren, van hoe peroxisomen worden gemaakt tot hoe ze worden

afgebroken. Verder bespreken we de huidige kennis over hoe membraaneiwitten van

organellen worden afgebroken, de rol van de UPS in afbraak van membraaneiwitten en

tenslotte hoe PMP-degradatie mogelijk kan worden gemaakt.

In Hoofdstuk twee laten we zien dat de PMP Pex13p een snelle turnover ondergaat

in H. polymorpha wildtype cellen en we beschrijven een rol van de peroxisomale

ubiquitinatie-machinerie in Pex13p-turnover. We stellen vast dat Pex13p

ge-ubiquitineerd is in wildtype cellen en dat de ubiquitinering van Pex13p is verminderd

in de afwezigheid van een functioneel peroxisomaal E3-ligasecomplex. Bovendien

vertonen cellen die componenten van deze machinerie missen een verhoogd niveau van

Pex13p en in deze cellen accumuleert Pex13p aan het peroxisomale membraan. Onze

resultaten ondersteunen het idee dat de peroxisomale ubiquitinatie-machinerie niet

alleen nodig is voor het ubiquitineren van Pex5p en eiwitten van de Pex20p-familie,

maar ook gericht is op andere peroxisomale eiwitten. Samenvattend, weten we nu dat

componenten van het peroxisomale E3-ligasecomplex betrokken zijn bij de

ubiquitinatie/afbraak van Pex5p en Pex20p, het PMP Pex3p in H. polymorpha en bij de

ubiquitinering van PMP70 bij zoogdieren. Dit suggereert naast een universele en

belangrijke rol voor de peroxisomale ubiquitinatie-machinerie bij ubiquitinatie/afbraak

van peroxisomale eiwitten ook een rol in peroxisomale biologie.

In Hoofdstuk drie onderzoeken we de mogelijke functies van Pex13p afbraak in

de gist H. polymorpha. We hebben aangetoond dat de Pex2p-afhankelijke turnover van

Pex13p ook optreedt onder peroxisoom niet-inducerende omstandigheden, wat aantoont

dat degradatie van Pex13p een algemene, en geen conditie-specifieke, gebeurtenis is. We

laten ook zien dat het blokkeren van de recycling van Pex5p de afbraak van Pex13p remt,

wat aangeeft dat de verwijdering van Pex5p uit het peroxisomale membraan is

gekoppeld aan degradatie met Pex13p. Verder identificeren we een gemuteerde vorm

van Pex13p die wordt geremd bij afbraak en we stellen vast dat blokkering van Pex13p

Samenvatting

197

afbraak een negatieve invloed kan hebben op de peroxisoomfunctie in vivo. Tenslotte

tonen we aan dat Pex13p-niveaus toenemen in cellen die Pex14p overproductie vertonen,

wat suggereert dat afbraak van Pex13p in deze cellen is verminderd en dat degradatie

van Pex13p afhankelijk is van Pex14p-niveaus. Samenvattend suggereren deze

waarnemingen een belangrijke gekoppelde relatie tussen Pex13p afbraak en de import

van matrixeiwitten in peroxisomen. Het is mogelijk dat afbraak van Pex13p de invoer

van matrixeiwitten negatief reguleert door het docking-complex (waarvan Pex13p

onderdeel is) te ontkoppelen van de stroom-afwaartse componenten die nodig zijn voor

de recycling van de PTS1-eiwitimportreceptor Pex5p, zoals het RING E3-complex of de

AAA- ATPasen Pex1p en Pex6p. Aangezien degradatie van Pex13p een snelle en

algemene gebeurtenis is die zich onder verschillende groeiomstandigheden voordoet,

lijkt het echter onwaarschijnlijk dat de afbraak van Pex13p de invoer van matrixeiwitten

negatief regelt. Een andere hypothese is dat degradatie van Pex13p vereist is om het

tijdelijke importomeer-complex te dissociëren. De snelle associatie en dissociatie van

meerdere factoren in het importomeer-complex is waarschijnlijk vereist voor het

importproces en het is mogelijk dat de verwijdering van Pex13p uit het

importomeer-complex het importomeer kan destabiliseren en kan leiden tot de vrijgave

van de eiwitten uit het lumen of het zou kunnen leiden tot de recycling van Pex5p naar

het cytosol. Vandaar dat verder onderzoek vereist is naar de rol van Pex13p-degradatie

bij de invoer van matrixeiwitten.

In Hoofdstuk vier hebben we de afbraak van Pex13p in de S. cerevisiae van gist

onderzocht en een tandem fluorescente eiwit timer (tFT) gebruikt om bijkomende

factoren te identificeren die betrokken zijn bij de degradatie van Pex13p. Onze gegevens

tonen aan dat snelle afbraak van Pex13p geconserveerd is in S. cerevisiae wildtype

cellen die zijn gekweekt op oliezuurmedia, en dat Pex13p wordt afgebroken via UPS.

Dit laat opnieuw zien dat Pex13p turnover waarschijnlijk een belangrijke rol speelt in de

peroxisoombiologie. Bovendien speelt de peroxisomale ubiquitinatie-machine een

belangrijke rol bij de omzet van Pex13p, terwijl de extra cytosolische UPS-factoren

Ufd4p, Ubc4p en Ubr2p een ondergeschikte rol spelen in de Pex13p-turnover, mogelijk

door de vorming van poly-ubiquitine ketens op Pex13p. Het feit dat meerdere E2s en

E3's een rol lijken te spelen bij de afbraak van Pex13p, suggereert dat ofwel

verschillende paden parallel werken op Pex13p, om de afbraak ervan te

vergemakkelijken, ofwel dat al deze factoren samenwerken bij het ubiquitineren van

Pex13p om het eiwit te markeren voor proteasomale afbraak. Bovendien geven deze

waarnemingen aan dat cytosolische UPS-factoren de turnover van PMP's kunnen

reguleren en dus mogelijk invloed kunnen hebben op de peroxisoomfunctie. Dit geeft op

Samenvatting

198

zijn beurt aan dat de afbraak van PMP's, zoals die van ER- en mitochondriale

membraaneiwitten, wordt gereguleerd op het niveau van de algemene cellulaire

eiwitafbraak processen. Tenslotte tonen onze gegevens ook aan dat de functie van

Cdc48p niet vereist is voor afbraak van Pex13p. Aangezien Cdc48p betrokken is bij de

afbraak van ER- en mitochondriale membraaneiwitten, laat deze waarneming zien dat de

afbraak van PMP's anders is dan die van andere membraaneiwitten van organellen, en

laat zien vast dat er verschillende mechanismen bestaan om deze afbraakprocessen

mogelijk te maken. Een mogelijkheid is dat de AAA-ATPasen Pex1p en Pex6p, die

betrokken zijn bij de extractie van ubiquitinated Pex5p van het peroxisomale membraan,

zich richten op ge-ubiquitineerd Pex13p naar het proteasoom. Het membraangebonden

AAA-ATPase Msp1p, waarvan werd gerapporteerd dat het staart verankerde eiwitten uit

het peroxisomale membraan extraheert voor afbraak, kan echter ook worden gezien als

een interessante kandidaat voor verder onderzoek. Ten slotte geven recente rapporten

aan dat het proteasoom kan worden gerekruteerd naar membranen om de afbraak van

membraaneiwitten mogelijk te maken. Misschien bestuurt een dergelijk mechanisme

ook de degradatie van Pex13p. Het is duidelijk dat verder werk nodig is om te

onderzoeken hoe ubiquitinated Pex13p wordt uit het peroxisomale membraan wordt

gehaald.

De peroxisoomfunctie is extreem divers en hangt af van soort, celtype en

groeicondities. Om een volledig begrip van de functie (s) van peroxisomen in een

bepaalde cel onder een gegeven aandoening te hebben, is een volledig overzicht van de

eiwitten in deze peroxisomen van vitaal belang. Op massaspectrometrie gebaseerde

proteomics methoden zijn van onschatbare waarde gebleken bij het bestuderen van het

peroxisomale proteoom en hebben verschillende nieuwe inzichten in de

peroxisoomfunctie verschaft. In Hoofdstuk vijf hebben we de bevindingen samengevat

van verschillende massaspectrometrie-gebaseerde proteomics studies van organellen in

gist en filamenteuze schimmels en hebben we de nieuwe inzichten in de peroxisomale

functie uit de studies geschetst.

PMP's zijn betrokken bij alle peroxisomale functies en zijn daarom van vitaal

belang voor het cel metabolisme. De verdere studie van PMP-afbraak zal ons begrip van

hoe PMP-homeostase in stand wordt gehouden en hoe deze invloed heeft op de

peroxisoomfunctie aanzienlijk verbeteren. In dit proefschrift hebben we de afbraak van

de PMP Pex13p in gist onderzocht en naar de bijdragen gekeken van de ubiquitinatie

machinerie van het peroxisomaal membraan, en andere componenten van de UPS. Het

feit dat Pex13p degradatie ondergaat in twee verschillende organismen, blijkbaar via

soortgelijke mechanismen, suggereert sterk dat het vermogen om Pex13p af te breken

Samenvatting

199

zowel een algemeen kenmerk van peroxisomen is, als ook dat het belangrijk is voor de

functie van Pex13p in het importproces van matrixeiwitten. Als we nog een stap verder

gaan, en aannemen dat degradatie van Pex13p ook in zoogdiercellen voorkomt, kunnen

we ons afvragen hoe degradatie van Pex13p kan bijdragen aan de gezondheid van de

mens en of defecten in de afbraak van Pex13p mogelijk menselijke ziekten kunnen

veroorzaken. Omdat de afbraak van Pex13p in beide organismen de peroxisomale

ubiquitinatie-machinerie vereist, gekoppeld aan eerdere rapporten die een rol laten zien

voor componenten van deze machine in de ubiquitinering en afbraak van extra PMP,

vermoeden we bovendien dat de peroxisomale ubiquitinatie-machinerie in feite een

algemeen ubiquitinatie-platform op het peroxisomale membraan is dat op meerdere

substraten is gericht. Toekomstige studies die gericht zijn op het identificeren van extra

substraten van deze machinerie zullen waardevolle nieuwe inzichten verschaffen in de

rol van de machinerie in de peroxisomale functie.

200

Acknowledgments

201

Acknowledgments

Time fleeting, I have witnessed the blossom of trees on campus for five times. Dozens

of people have come to and gone away from the lab in the past few years. I can still

sense the warmth and scent of those memories as if they were happening yesterday. For

a long time, I could not help think that if one day I was no more and then opened eyes to

see this place, the lab, campus and city, and I would perceive myself as entering the

heaven.

My parents do not understand our project, simply not their major, but they supported

me through PhD program with a strong faith and unflinching determination. I would not

be here at the first place without my parents, the source of my life and power.

My first peroxisome meeting OEPM started one week after I joined the lab since Sep,

1st in 2014. Jannet, the Secretary of Molecular Cell Biology and Cell Biochemistry, has

helped me since then with all the paperwork, from the expenses of conferences to my

application of visa. Being skillful, she helped me with patience, politeness and

friendliness, otherwise I would be lost in those files and the plan of project might even

be affected.

The first time I joined lunch with people from the lab, I met several cheerful faces.

Adam and Sanjeev were productive and outgoing, setting a standard for the following

students. Terry was the first Chinese student in the lab. The first day I came to the lab, I

saw him doing Western, putting those bottles as weight onto the lid during the

transferration. Interesting, Western is also the most important assay I have been doing it

for almost four hundred times during my PhD program. Maybe I can consider this as an

inheritage in a way. Ann and Arman were smart and passionate about socializing, always

trying to glue people together with outside lunch at the diner in Bernoulliborgh, or

Christmas party, or summer borrel or drink on the lawn. Natasha, Justyna and Ritika,

like elder sisters, always ready to answer my odds and ends questions frankly. Srishti is

a member of Chris’s group, and she has won several prizes for the best poster in

conferences. The S. cerevisiae work in this thesis was originated from part of her

research, and she helped me a lot with strains and tFT knowledge. I am so glad to have

this team player as colleague in the lab. It was my luck to supervise Joana and Inge for

several months, their intelligence and diligence added colors to the project. For

numerous master and bachelor students, they have contributed and inspired us, bringing

us lively faces and laughter. I still remembered when we sat outside by a big wooden

table for lunch in summer, lively and pleasant.

The first time I joined the seminar, I noticed four men sitting at the back row, Arjen,

Acknowledgments

202

Rinse, Kevin and my boss, Chris. I have learned quite a lot from them. Rinse was the

green finger for computers and electron microscopy. Also focused in EM, Kevin was

clever and smelled like grapes. His beard looked like a young version of Santa. Arjen

was friendly, and taught me how to process fluorescence images concisely. When I

walked behind them in Vienna for OEPM in 2016, they seemed like Mr. Bear and Mr.

Giraffe, only in a cute and friendly way. Further thanks to Arjan for keeping the lab

running, and he is important for the group. More thanks to the people from both groups

Molecular Cell Biology and Cell Biochemistry.

My stay here was definitely colorful and warm with these people, but one person far

outshined, Chris. I am still grateful that I was enrolled under his supervision. The first

time I came to the office, he welcomed me with a firm handshake. I still remembered he

showed how to perform Western, PCR and digestion, patient and meticulous. Unlike

others I met in the past who might just threw a protocol to me, Chris showed me each

step carefully and patiently. This made an good and correct opening to my PhD program,

set the right path for the future years. He prepared the computer for me to provide

convenience for my work, printed publications for me to learn background information,

showed me around the instruments and freezers so that I can get familiar with the

chemicals, enzymes and strains. He taught me how to use the database and the protocols,

how to search gene and protein information, and how to design the plasmid construction.

Furthermore, he taught me how to use Photoshop and illustrator to process images, and

how to make plasmid map with CloneManager. He did not just tell which buttons to

click, but carefully taught me about the rationale, the theory and the mechanism, down

to each detail with drawing graphs and figures. I kept each piece of these valuable notes

in my lab journal. He told me that education is not just restricted in college, but lifetime,

and we should not only know “what”, but also actively pursuing the “how” and “why”

with critical thinking.

He is my boss, and a gentleman. Unlike other people I met in the past who maltreated

students, he treated me as a civilized person and talked to me with equal status, respect

and humanity. He talks to me in a man-to-man manner, not a boss to a subordinate, or a

tyrant to a slave, or an elder to a kid, but a man to a man, affable and approachable. If he

needs me to help him with taking out a plate from the incubator, he always gently asked

whether I had time or not, rather than just gave a command. When I helped him with

something, however small it was, he always thanked me. He treated us students equally

with no discrimination or bias, which I really appreciate very much. The way he talks is

sincere and inspiring. He always guided and enlightened me with series of

thought-provoking questions to lead me through and let me realize the key point and

Acknowledgments

203

find the answer. Many a case, I have realized his precise insight and foresight when the

experiment was at a cross. He could always point a direction which later proved to be

correct. That talent and wisdom impressed me, and made me think that the Great Britain

is the original source of modern intelligence.

His enormous effort and serious thought in education is rare and precious. I would

love to revisit the scenes when he showed me how to write a paragraph, how to analyze

an image from the data and how to prepare a poster. He helped me to apply for a talk in

the conference, and helped me with the rehearsal till I could tell a story with our data.

He is always ready to help me. He offered comments and helped me with changes to the

poster and manuscript. He spent a lot of time to refine my chapters in the thesis. If I

could sail through the defense with flying colors, that is all because I have lived in the

sunshine radiated from him. He is our group leader, and he indeed leads us through the

PhD program with his care, wisdom and big hands.

In my last year of PhD program, we suffered from change of wind. Two saints Engel

and Bert opened arms in the mediation and intervention and separated the frenzied tidal

surges to two sides and pointed us a path to overcome obstacles. Two giants Peter and

Marteen stepped forward to offer us help, and guided us with solid contributions. Their

noble morality and seasoned experiences gave us shelter to prevent the attack of huge

waves. Chris has protected us ducklings in the storm and across the war fire with all of

his strengths. We are safe and warm under his wings. Like a flying golden eagle, he

carried us flying over the mountains and across the seas. Working with him and under

his supervision, he is more than a boss, more of a mentor, a friend, a relative, a role

model of father. He is the spiritual leader and morning star we trust and believe in.

Shedding tears, I am gravely sorry for the sacrifice he made only to protect us during

that. Now, we are all well protected, but the eagle has to fly away to another place. We

could never possibly express all of our gratitude, and we will miss you. I would

personally rather to interpret this as a pause rather than an end, hope one day the PMAD

project could be continued, and he can get what he deserves and so much more.

Time flies, and people leave. This made me feel painful and emotional. The past few

years I spent here was not only a period of time, but an organic part of my life, an

essential part of my body. The missing of anyone is a loss to myself. Those faces, those

laughter and those happy moments would keep me accompanied when I am lonely, keep

me warm when I am cold in the future.

I wish I could preserve those memories in a safe and beautiful place in my heart. One

day in the morning, in my dream, I walked towards Linnaeusborgh in sunshine with

magpie flying above, and I would be able to go back to the lab where Arjen waved at me,

Acknowledgments

204

Ritika was making master mix for PCR, Ann was shifting cultures to new medium by

the flame. The radio was on, playing cheerful melody. I checked the Western corner and

solutions I prepared one day before to make sure everything required for Western was in

order. There would be new ideas about projects written on the white board and new

paintings of Chris’s children pasted on the wall. I would walk towards the office and

smell Chris’s scent, and hear the sound of a silver spoon stirring in a porcelain mug,

knowing my boss would have been working by the computer. Then I came to the office

with a slight bow, saying:

“Morning!”

“Morning, Chen!”