[CANCER RESEARCH 55, 1358-1364, March 15, 1995]

Up-Regulation of Vascular Endothelial Growth Factor and Its Receptors invon Hippel-Lindau Disease-associated and Sporadic Hemangioblastomas

S. Wizigmann-Voos,1 G. Breier, W. Risau, and K. H. Plate 1, 2

Majt-Planck-lnstitut fürphysiologische und klinische Forschung, W. G. Kerckhoff-lnslirul, Abteilung Molekulare Zellbio/ogie, Parkstrasse I, 61231 Bad Nauheim. Germany¡S.W-V., G. B., W. R.], and Klinikum der Philipps-Unh-ersitüt, Abteilung Neuropathologie, Baldingerslrasse l, 35043 Marburg, Germany [K. H. P.l

ABSTRACT

Capillary hemangioblastoma is the most frequent manifestation of theautosomal dominantly inherited von Hippel-Lindau (VHL) disease but

also presents as a nonfamilial, sporadic vascular tumor. Hemangioblastomas are characterized by a dense network of capillaries in association withcysts. To investigate the mechanisms underlying neovascularization andcyst formation, we analyzed eight VHL disease-associated and five spo

radic hemangioblastomas. Histologically, both tumor types showed a similar phenotype. The capillaries expressed the endothelial cell markers vonWillebrand factor and CD31 antigen. We investigated the expression ofvascular endothelial growth factor (VEGF), an endothelial cell-specific

mitogen which is also known to induce vascular permeability in vivo, andits high affinity tyrosine kinase receptors.//'-/ and r\l>K. Northern blot andin situ hybridization analysis revealed significant up-regulation of VEGFand VEGF receptor expression in VHL disease-associated and sporadic

hemangioblastomas compared to normal brain and tumor stromal cells assites of abundant VEGF transcription. Endothelial cells did not expressdetectable amounts of VEGF mRNA but coexpressed flt-1 and KDR. Byimmunohistochemistry, VEGF protein was detectable in the tumor inter-

stitium and was found to be concentrated around capillaries. Performingreverse transcription-PCR, we demonstrated that VEGF121 and VEGF165

were the splice variants predominantly expressed, whereas mRNA encoding VEGF189 was present at smaller amounts. Our findings suggest that,in VHL disease-associated and sporadic hemangioblastomas, VEGFI2I

and VEGFj65 are secreted by stromal cells and interact with the corresponding VEGF receptors expressed on tumor endothelial cells. Thisparaci me mechanism may mediate neovascularization and cyst formationin capillary hemangioblastomas.

INTRODUCTION

VHL3 disease is an autosomal dominantly inherited disorder that

predisposes afflicted persons to a variety of lesions in different organs.The major manifestations of VHL disease are hemangioblastomas ofthe CNS, renal cysts, renal cell carcinomas, pheochromocytomas,pancreatic cysts, and epididymal cystadenomas (1). Genetic linkageanalysis mapped the VHL disease gene to chromosome 3p25-p26 (2,

3). Frequent loss of heterozygosity for chromosome 3p in tumorsderived from patients with VHL disease suggests that the VHL geneacts as a tumor suppressor gene (2, 4). Recently, the VHL gene hasbeen identified by positional cloning and has been shown to bemutated in the germline of VHL disease family members as well as infamilial and sporadic renal cell carcinoma (5, 6).

The most frequent tumor type that forms in VHL disease is thecapillary hemangioblastoma (7). Hemangioblastomas occur in theretina and cerebellum and to a lower extent in the area postrema and

Received 9/21/94; accepted 1/18/95.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 Present address: Klinikum der Albert-Ludwigs-Universitäl, Neurozentrum,

Breisacherstrasse 5, 79106 Freiburg, Germany.~To whom requests for reprints should be addressed.3 The abbreviations used are: VHL, von Hippei-Lindau; CNS, central nervous

system; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor; flt,/mi-like tyrosine kinase; KDR, kinase insert domain-containing receptor; RT-PCR,reverse transcription-PCR; bp, base pairs; kb, kilobase(s); GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

the spinal cord (1). Besides VHL disease-associated hemangioblasto

mas, sporadic, nonfamilial hemangioblastomas occur in the CNS.Histologically, familial and sporadic hemangioblastomas consist of adense network of capillaries. By electron microscopy, three cell typesare usually distinguished: (a) endothelial cells and (b) pericytes,which form the microvasculature; and (c) stromal cells, which areclustered between the capillaries (8, 9). Thus far, the stromal cellshave no known counterpart among normal cells, and their histogenesisis unclear.

In addition to the development of vascular tumors in the CNS andformation of well-vascularized tumors, such as renal cell carcinoma

and pheochromocytoma, frequent cyst formation, which may be dueto increased vascular permeability, is characteristic for VHL disease.Recently, VEGF, an endothelial cell-specific mitogen, which induces

angiogenesis and vascular permeability in vivo, has been described(10-12). Four isoforms of VEGF are known, which arise by alterna

tive mRNA splicing. The two smaller forms (VEGF121 and VEGF165)are secreted proteins, whereas VEGF189 and VEGF206 are cell-asso

ciated isoforms (13, 14). Additionally, VEGF has been shown to bindwith high affinity to the cognate tyrosine kinase receptors VEGFR-1(flt-1) (15) and VEGFR-2 (KDR/flk-1; Refs. 16 and 17).

We considered VEGF as a candidate regulator of neovascularization and cyst formation in capillary hemangioblastomas. Therefore,we investigated the expression of VEGF and its two receptorsVEGFR-1 (flt-1) and VEGFR-2 (KDR) in VHL-associated and spo

radic cerebellar hemangioblastomas. In addition, we examined thedistribution of VEGF protein by immunohistochemistry and compared the relative abundance of the different VEGF mRNA isoformsin tumor specimens and normal brain tissue by RT-PCR.

MATERIALS AND METHODS

Specimens. Surgically removed human specimens (eight capillary hemangioblastomas from five patients with VHL disease and five solitary capillaryhemangioblastomas) and two specimens of normal brain tissue were routinelyformalin fixed and paraffin embedded or frozen directly and stored at -70°C.

RNA Extraction and Northern Analysis. Total cytoplasmic RNA wasisolated using the guanidinium thiocyanate method (18). Aliquots of 12.5 figRNA were electrophoresed in a 0.8% agarose gel containing 0.66 M formaldehyde in 1X MOPS buffer [20 mM 3-(/V-morpholino)propanesulfonic acid, 5

mM sodium acetate, and 1 mM EDTA (pH 7.0)] and transferred to nylonmembrane (Hybond N; Amersham) in 20X SSC (IX SSC = 150 mM NaCl-15mM sodium citrate). RNA was cross-linked to the membrane with UV light(0.5 J/cm2) and hybridized overnight in 50% formamide, 5X SSC, 5X Den-hardt's (0.1% Ficoll, 0.1% polyvinylpyrollidone, and 0.1% BSA), 0.5% SDS,and 50 ng/ml tRNA at 42°Cwith 1-3 X IO6 cpm/ml of [32P]dCTP-labeled

cDNA probes (random primed labeling kit; Boehringer Mannheim). Thefollowing cDNA templates were used for random priming: a 517-bp cDNAencoding human VEGF (19); a 1080-bp Bglll/Sall cDNA fragment of thehumanar-/ gene (corresponding to nucleotides 3233-4313; Refs. 20 and 21);and a 1350-bp BamHI fragment of human KDR (corresponding to nucleotides370-1720; Refs. 16 and 22). Filters were washed in 2X SSC at roomtemperature, in 2X SSC with 0.5% SDS at 42°C, and finally with 0.3 XSSC-0.5% SDS at 42°Cand exposed with intensifying screens at -70°C.

RT-PCR Analysis. For reverse transcription, 4 /j.g of total RNA were usedin a 20-/J.1 reaction volume containing 25 (xMhexamer random primer (Boeh

ringer Mannheim), 17 units human placenta! RNase inhibitor (Pharmacia),

1358

on June 12, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

VEQF AND VEGF RECEPTORS IN CAPILLARY HEMANGIOBLASTOMAS

10 HIMDTT, 0.5 HIMdNTP, 200 units Moloney murine leukemia virus reversetranscriptase (GIBCO-BRL), and buffer supplied by the manufacturer(GIBCO-BRL). After first-strand synthesis, a denaturation step (5 min at 95°C)

was performed. One % of the cDNA was subjected to 30 rounds of amplification using a PCR reagent kit (Perkin-Elmer Cetus). Cycles were 30 s at 94°C,1 min at 55°C, and 1 min at 72°C in the Gene Amp PCR System 9600

(Perkin-Elmer Cetus). At the end, an additional extension step for 2 min at72°Cwas performed. The following synthetic oligonucleotide primers wereused for amplification: VEGF (5' oligonucleotide) 5'-d(TGGATCCAT-GAACTTTCTGCTGTC) and (3' oligonucleotide) 5'-d(TCACCGCCTTG-GCTTGTCACAT); GAPDH (5' oligonucleotide) 5'-d(CGATGCTGGCGCT-GAGTAC) and (3' oligonucleotide) 5'-d(CGTTCAGCTCAGGGATGACC;

Ref. 23). As positive control, a full-length cDNA fragment of VEGF165 was

used as a template for amplification; as negative control the DNA template wasomitted in the reaction. The amplification products were separated on 1.5%agarose gels and visualized by ethidium bromide staining.

Imrnunohistochemistry. Sections of paraffin-embedded tissues (5-fimthick) or frozen sections (10-jj.m thick) were dried on TESPA (3-aminopro-pyltrimethoxy-silane)-coated slides. Paraffin-embedded tissue sections were

dewaxed in xylene, rehydrated, and washed in PBS. Slides were incubated in1% H2O2/methanol for 20 min, washed in PBS, and incubated for 5 min atroom temperature with 0.05% Proteinase K (Boehringer-Mannheim) in PBS.

Frozen sections were washed in PBS, and blocking of endogenous peroxidasewas performed with 0.1% H2O2/methanol for 15 min. Paraffin and frozensections were then washed with PBS and incubated in 20% normal goat serum(Dianova) in PBS for 20 min. Sections were then incubated with the primaryantibody for l h at room temperature, washed with PBS, incubated with abiotinylated goat anti-mouse IgG (1:200; Dianova) for l h at room temperature, and finally incubated with a peroxidase-streptavidin complex (Vector)according to the manufacturer's instructions. Immunoreactivity was visualized

with 3,3-diaminobenzidine (Sigma Chemical Co.) dissolved at 0.6 mg/ml in 50HIM Tris-HCl (pH 7.5) and 0.03% H202. Slides were counterstained with

Toluidine Blue, dehydrated, cleared in xylene, and mounted in Entellan(Merck). Primary antibodies used were a monoclonal antibody against humanCD31 (dilution 1:40; Dako), a polyclonal antibody raised against human vonWillebrand factor (1:300; Behring), and a polyclonal antiserum directedagainst human recombinant VEGF (dilution 1:500; a gift from N. Ferrara,Genentech, South San Francisco, CA).

In Situ Hybridization. Single-stranded antisense and sense RNA probes

were generated by in vitro transcription of linearized plasmid templates containing cDNA clones of human VEGF, human flt-1, KDR, and human vonWillebrand factor, respectively, using 100 ^.Ci [35S]UTP (Amersham) and T3

or T7 RNA polymerases (Stratagene). Limited alkaline hydrolysis of probeswas performed with NaHCO3 according to Cox et al. (24) to generate probesof 500-nucleotide average length. Sections of formalin-fixed, paraffin-embed

ded tissues (5-/J.IT1thick) were dewaxed in xylene and rehydrated. The sectionswere incubated for 30 min in 2X SSC at 70°C,digested with Pronase (40-80

/ig/ml), refixed in 4% paraformaldehyde, and acetylated with acetic anhydride0.25% in 0.1 M triethanolamine (pH 8.0). Hybridizations were performed in ahybridization solution containing 50% formamide, 0.3 M NaCl, 10 mM Tris-HCl (pH 7.0), 10 min sodium phosphate (pH 7.0), 5 mM EDTA, 2X Denhardt's

solution (0.04% Ficoll, 0.04% polyvinylpyrollidone, and 0.04% BSA), 10 mMß-mercaptoethanol, 50 ju,g/ml salmon sperm DNA, l mg/ml tRNA, 10 mMDTT, 10% dextran sulfate, and 5 X IO4 cpm/fil 35S-labeled RNA probe at45°Covernight. Slides were then washed in washing buffer [50% formamide,

0.3 M NaCl, 10 mM Tris-HCl (pH 7.0), 10 mM sodium phosphate (pH 7.0), 5mM EDTA, and 10 mM ß-mercaptoethanol] at 45°C,digested with RNase A

[20 Mg/ml in 0.5 M NaCl, 10 mM Tris-HCl (pH 7.5), and 1 mM EDTA] for 30min at 37°Cand washed again with washing buffer for 10-12 h at 45°C.The

sections were dehydrated, coated with Kodak NTB-2 emulsion, and exposedfor 10-21 days at 4°C.Slides were developed and stained with Toluidine Blue.

RESULTS

We analyzed 13 surgically removed human hemangioblastomasfrom 10 patients. Eight tumors were derived from patients with theclinical diagnosis for VHL disease, and five tumors were classified assporadic hemangioblastomas. All specimens were analyzed by

immunohistochemistry for the expression of CD31 antigen (Ref. 25;Fig. la) and von Willebrand factor (data not shown), since theseproteins are known to be highly expressed in endothelial cells. His-

tologically, familial and sporadic hemangioblastomas could not bedistinguished. Both tumor types showed the typical dense network ofblood-filled capillaries in association with stromal cells and cystic

areas. A distinct boundary between highly vascularized tumor andnormal brain tissue could be observed (Fig. la).

To investigate whether overexpression of the endothelial cell-spe

cific mitogen VEGF underlies the proliferation of endothelial cellsobserved in capillary hemangioblastoma, we performed Northern blotanalysis. Total RNA isolated from a hemangioblastoma which wasderived from a patient with VHL disease and from normal humanbrain tissue was analyzed. Highly increased amounts of VEGF mRNAwith transcript lengths of about 4.0 kb were present in capillaryhemangioblastoma tissue, whereas in normal brain tissue, no VEGFtranscripts could be detected by Northern analysis (Fig. 2). Thecognate VEGF receptors, VEGFR-1 (flt-l) and VEGFR-2 (KDR),

were coexpressed in capillary hemangioblastoma, but no signal couldbe detected in normal brain tissue (Fig. 2). The corresponding transcript lengths of approximately 7.7 kb for flt-1 and 7.0 kb for KDR,

respectively, are in agreement with earlier reports (20, 26).We then performed in situ hybridization to localize the VEGF-

producing cells in capillary hemangioblastomas. To test the suitabilityof the surgically obtained material for in situ hybridization, the tissueswere analyzed for expression of von Willebrand factor. Since wefound by immunohistochemistry that von Willebrand factor proteinwas highly expressed in endothelial cells of the tumors, we used thevon Willebrand factor mRNA expression pattern as an indicator forRNA degradation in the tissue specimens (data not shown).

By in situ hybridization, high levels of VEGF mRNA expressioncould be detected in all 13 capillary hemangioblastomas examined.The transcripts were evenly distributed throughout the tumor tissue,and the expression pattern was restricted to highly vascularized areas.Expression of VEGF was barely detectable in the adjacent normalcerebellar cortex, and no VEGF transcripts were detectable in meningea! blood vessels (Fig. 1, b and c). High magnification in Fig. 3ashows that the VEGF transcripts were located in stromal cells clustered between the capillaries. No VEGF expression was observed inendothelial cells. The specificity of the signal was confirmed bycontrol hybridization with a sense RNA probe which showed nospecific labeling (Fig. 3b).

VEGF protein distribution was analyzed by immunostaining offrozen sections of four representative familial and sporadic cases ofcapillary hemangioblastomas using a polyclonal antiserum directedagainst human recombinant VEGF. Immunoreactivity was strongestin the microvasculature of capillary hemangioblastomas. The anti-

serum stained tumor cells and the interstitium to a lesser extent (Fig.3c). No immunoreactivity was detectable in the tumors when theprimary antibody was omitted.

To identify the mRNA species coding for the different VEGFisoforms in capillary hemangioblastomas, we performed RT-PCR. We

analyzed RNA isolated from two human hemangioblastomas, a human glioblastoma (known to express high amounts of VEGF; Ref. 21)and normal human brain. The oligo(dT)-primed cDNAs were amplified using oligonucleotide primers derived from the 5'- and 3'-ends of

the protein coding region of the human VEGF gene, which are sharedby all VEGF mRNA species. In all tissues analyzed, amplificationproducts of 452, 584, and 656 bp corresponding to VEGF121,VEGF165, and VEGF189 were found (Fig. 4). This was also true fornormal human brain, where only faint bands of VEGF12, andVEGF189 were visible. However, amplification products with 707 bpcorresponding to VEGF206 were not detectable. This result was

1359

on June 12, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

VEGF AND VEGF RECEPTORS IN CAPILLARY HEMANGIOBLASTOMAS

Fig. 1. VEGF mRNA is highly expressed in human capillary heman-

gioblastoma but is barely detectable in normal brain tissue in situ, a,immunostaining for human CD31, a cell adhesion molecule expressed byendothelial cells, showing abundant microvasculature characteristic forcapillary hemangioblastoma. b, in situ hybridization with antisense 35S-

labeled RNA probe specific for human VEGF, counterstained withToluidine blue. VEGF is highly expressed in the tumor tissue but isbarely detectable in the adjacent normal brain tissue, c, dark fieldillumination of (b). Arrowheads, boundary between tumor (lower half)and adjacent normal brain tissue (upper half). MV, meningea! vessels;CC, cerebellar cortex. Bars, 50 ¿¿m.Exposure time (b and c) 11 days.

1360

on June 12, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

VEOF AND VEOF RECEPTORS IN CAPILLARY HEMANGIOBLASTOMAS

VEGF flt-1 KDR

12 12 12kb

9.5 —7.5 —

4.4 —

28S —

Fig. 2. Expression of VEGF and ils receptors VEGFR-1 (/>

VEGF AND VEGF RECEPTORS IN CAPILLARY HEMANGIOBLASTOMAS

123456

412 — — GAPDH

Fig. 4. Identification of VEGF isoforms expressed in human capillary hemangioblas-tomas by RT-PCR. cDNAs analyzed: no DNA template (Lane /), human capillaryhemangioblastoma (Lane 2), human capillary hemangioblastoma (Lane 3), human normalbrain (Lane 4), 1 pg of VEGFift5 cDNA (Lane 5), and human glioblastoma (Lane 6).Expected VEGF amplification products of 452, 584, and 656 bp correspond to VEGFisoforms VEGF12|, VEGFlfi5, and VEGF|Hg, respectively. Lower panel shows a single412-bp band amplified with primers specific for GAPDH with the same cDNAs under

identical conditions.

permeability (28). In human and rat glioblastomas, we suggestedVEGF as the main regulator of tumor-induced angiogenesis (21,

29). We showed by in situ hybridization that VEGF is produced bymalignant glioma cells and may act via a paracrine mechanism ontumor endothelial cells, which express VEGF receptors. Recently,up-regulation of VEGF and its receptors has also been reported in

other tumor types such as human kidney and bladder carcinomas(30), indicating that VEGF may be a tumor angiogenesis factor invarious tumors.

Hemangioblastoma, the most frequent manifestation of VHL disease, also presents as a nonfamilial, sporadic form. Both sporadic andVHL disease-associated hemangioblastomas are blood vessel tumors

characterized by abundant endothelial cell proliferation and cyst formation. We hypothesized that overexpression of VEGF may underlyendothelial cell proliferation and increased vascular permeability inhemangioblastomas. Therefore, we investigated the expression ofVEGF and its receptors in 13 specimens of VHL disease-associated

and sporadic hemangioblastomas. Histologically, familial and sporadic hemangioblastomas showed a similar phenotype. Tumors werecharacterized by abundant capillaries which expressed von Wille-

brand factor mRNA and protein and the cell adhesion molecule CD31(Fig. la). Intratumoral cyst formation was frequent, and no obviousdifference was observed between VHL-associated and sporadic he

mangioblastomas. In addition, no difference regarding the spatialdistribution and the expression level of VEGF could be observed byin situ hybridization. In contrast to normal brain tissue, where littleVEGF expression could be observed, abundant amounts of VEGFtranscripts were present in tumor stromal cells (Fig. 1 and 3), whichis consistent with previous reports (31, 32). We could not detectVEGF transcripts in the tumor endothelium, thus excluding anautocrine control of endothelial cell proliferation.

According to Knudson's tumor suppressor theory (33), hemangio

blastoma formation in patients suffering from VHL disease impliesgermline transmission of one mutated alÃ-eleof the VHL gene andinactivation of the balancing wild-type alÃ-eleby a secondary somatic

mutational event. The model further predicts that sporadic tumorswould arise in the same cell type after somatic inactivation of bothcopies of the gene responsible for the hereditary cancer. Comparingthe age incidence curves of familial and sporadic hemangioblastoma,the VHL gene behaves as a typical tumor suppressor gene (34). Lossof the wild-type VHL alÃ-elefrom chromosome 3p was detected in

different tumors from VHL patients, including spinal and cerebellarhemangioblastomas (4), and somatic mutations of the VHL gene insporadic hemangioblastomas of the CNS have also been reported (35).The familial and sporadic cases of capillary hemangioblastoma in thisstudy have been classified by familial history and clinical examinationof predisposed organs. (Genetic analysis for VHL gene mutations is inprogress). Little is known about the function of the VHL gene productsince the partial nucleotide and amino acid sequences showed noapparent homology to known sequences (5), but our data suggest thatinactivation of the VHL tumor suppressor gene directly or indirectlyinduces VEGF transcription in stromal cells of cerebellar hemangioblastomas. Another example for the regulation of angiogenesis byproteins which are under control of a tumor suppressor gene has beendescribed recently. In two reports, it has been demonstrated thatendogenous angiogenesis inhibitors are under control of the tumorsuppressor gene p53 (36, 37).

One known mechanism of VEGF up-regulation is by hypoxia.

Increased VEGF mRNA levels have been observed in cultured celllines grown under anoxic conditions in vitro and in palisading cells invivo, which are located adjacent to necrotic areas in glioblastomas (21,29, 38). In hemangioblastoma, however, hypoxia is unlikely to be amajor mechanism of VEGF up-regulation, since this tumor is very

well vascularized, and necroses do not occur.The majority of lesions in VHL patients are cystic. Beside renal and

pancreatic tumors, cysts occur in the same organs. Hemangioblastomas of the CNS have been reported to be cystic in 75% of the cases(39). The mechanism which underlies cyst formation is unclear, but itis assumed that increased vascular permeability leads to extravasationof serum, which then accumulates in the interstitium. VEGF inducesmicrovascular permeability (28) and is, therefore, a possible candidatefor mediating cyst formation. In the human, four different VEGFisoforms, VEGF121, VEGF,65, VEGFlfw, and VEGF2()6, respectively,have been identified which arise by alternative splicing of mRNA(13). VEGF12j and VEGF165 are secreted proteins, whereas VEGF189and VEGF2()6 remain mostly cell associated (13, 14). VEGF165 is themost abundant isoform in all human tissues except placenta, whereVEGF121 is predominant (40). In contrast to the cellular localization,little is known about the biological function of the four isoforms. Weperformed RT-PCR to identify the mRNA species coding for the

different VEGF isoforms in cerebellar hemangioblastomas, humanglioblastoma, and normal brain. We observed that the three smallerforms of VEGF mRNA are present in all tissues. VEGF165 was the

Table 1 mRNA expression of VEGF and its receptors, VEGFR-1 (flt-1) and VEGFR-2(KDR), in VHL disease-associated and sporadic capillary hemangioblastoma and in

normal brain in situ

Case123456789101112131415DiagnosisFamilialFamilialFam

liaiFamliaiFamliaiFamliaiFamliaiFamHalSporadicSporadicSporadicSporadicSporadicNormalNormalAge"/sex

VEGF flt-1KDR33/M

++++* ++++30/F*++++ ++++31/F*++++ ++++31/F*++++ ++++27/M

++++ ++++21/Mr++23/Mc++29/F

++32/M

++42/M++41/F++28/M++28/M

+++

++++++++

ND++

+ND++++++

++++•f+++33/F

+ ++60/M+ + +

" Age at surgery.

Specimens derived from the same patient.' Specimens derived from the same patient.

+, weak expression; ++, moderate expression;dant expression; ND, not determined.

-++, strong expression; ++++, abun-

1362

on June 12, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

VEGF AND VEGF RECEPTORS IN CAPILLARY HEMANGIOBLASTOMAS

Fig. 5. VEGF receptors, VEGFR-1 (flt-l) and VEGFR-2 (KDR). arc highly expressed in the endothelial cells of human capillary hemangioblastoma in situ. Serial sections of acapillary hemangiohlastoma hybridized with 35S-labeled antisense RNA probes specific for VEGFR-1 (a) and VEGFR-2 (r), counterstained with Toluidine Blue. VEGF receptors arecoexpressed in endothelial cells of the same capillary vessels outlined by arrows. L, capillary lumen; V, larger vessel, b and d, dark-field illuminations of (a) and (

VEGF AND VEOF RECEPTORS IN CAPILLARY HEMANGIOBLASTOMAS

regulation may bring insights into whether a similar approach is usefulfor hemangioblastoma treatment.

In summary, our findings of up-regulation of VEGF in stromalcells and of the corresponding VEGF receptors in tumor endothe-lial cells suggest that VEGF may act as a regulator of neovascu-larization and cyst formation in VHL disease-associated and sporadic hemangioblastomas. It is at present unclear whetherinactivation of the VHL disease gene is involved in VEGF and/orVEGF-receptor up-regulation.

ACKNOWLEDGMENTS

We thank H. D. Mennel (Klinikum der Philipps-Universität, Marburg,

Germany) and H. R. Eggert (Städtische Kliniken, Kassel, Germany) for providing tumor specimens; H. Weich (Gesellschaft fürBiotechnologischeForschung, Braunschweig, Germany) for providing human VEGF cDNA;B. Terman (Lederle Laboratories, New York, NY) for providing KDR cDNA;and E. Keshet (Hebrew University, Jerusalem, Israel) for providing vonWillebrand factor cDNA. We are also grateful to N. Ferrara, (Genentech, Inc.,South San Francisco, CA) for the gift of VEGF antiserum and to M. Simon(Georg-August Universität, Göttingen, Germany) for helpful discussions.

REFERENCES

1. Rüssel,D. S., and Rubinstein, L. J. Pathology of Tumours of the Nervous System.London: Edward Arnold, 1989:

2. Seizinger, B. R., Rouleau, G. A., Ozelius, L. J., el al. Von Hippel-Lindau disease

maps to the region of chromosome 3 associated with renal cell carcinoma. Nature(Lond.), 332: 268-269, 1988.

3. Seizinger, B. R., Smith, D. I.. Filling-Katz, M. R., el al. Genetic flanking markersrefine diagnostic criteria and provide insights into the genetics of von Hippel Lindaudisease. Proc. Nati. Acad. Sci. USA, 88: 2864-2868, 1991.

4. Tory, K., Brauch, H., Linehan, M., Barba, D.. Oldfield, E., Filling-Katz, M., Seizinger, B., Nakamura, Y., White, R., Marshall, F. F., Lerman, M. I., and Zbar, B.Specific genetic change in tumors associated with von Hippel-Lindau disease. J. Nati.Cancer Insl., 81: 1097-1101, 1989.

5. Latif, F., Tory, K., Gnarra, J., et al. Identification of the von Hippel-Lindau diseasetumor suppressor gene. Science (Washington DC), 260: 1317-1320, 1993.

6. Gnarra, J. R., Tory, K., Weng, Y., el al. Mutations of the VHL tumour suppressorgene in renal carcinoma. Nat. Genet., 7: 85-89, 1994.

7. Lindau, A. Studien überKleinhirncysten. Bau, Pathogenese und Beziehung zurAngiomatosis retinae. Acta Pathol. Microbiol. Scand. Suppl., /: 1926.

8. Spence, A. M., and Rubinstein, L. J. Cerebellar capillary hemangioblastoma: itshistogenesis studied by organ culture and electron microscopy. Cancer (Phila.), 35:326-341, 1975.

9. Chaudhry, A. P., Montes. M., and Cohn, G. A. Ultrastructure of cerebellar hemangioblastoma. Cancer (Phila.), 42: 1834-1850, 1978.

10. Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V., and Ferrara, N. Vascularendothelial growth factor is a secreted angiogenic mitogen. Science (WashingtonDC), 246: 1306-1309, 1989.

11. Keck, P. J., Hauser, S. D., Krivi, G., Sanzo, K., Warren, T., Feder, J., and Connolly,D. T. Vascular permeability factor, an endothelial cell mitogen related to PDGF.Science (Washington DC), 246: 1309-1312, 1989.

12. Connolly, D. T., Heuvelman, D. M., Nelson, R., Olander, J. V., Eppley, B. L.,Delfino, J. J., Siege], N. R., Leimgruber, R. M., and Feder, J. Tumor vascularpermeability factor stimulates endothelial cell growth and angiogenesis. J. Clin.Invest., 84: 1470-1478, 1989.

13. Houck, K. A., Ferrara, N., Winer, J., Cachianes, G., Li, B., and Leung, D. Thevascular endothelial growth factor family: identification of a fourth molecular speciesand characterization of alternative splicing of RNA. Mol. Endocrinol., 5: 1806-1814,1991.

14. Breier, G., Albrech!, U., Sterrer, S., and Risau, W. Expression of vascular endothelialgrowth factor during embryonic angiogenesis and endothelial cell differentiation.Development (Camb.), 114: 521-532, 1992.

15. DeVries, C., Escobedo, J. A., Ueno, H., Houck, K., Ferrara, N., and Williams, L. T.The ym.v-like tyrosine kinase, a receptor for vascular endothelial growth factor.Science (Washington DC), 253: 989-991, 1992.

16. Terman, B. I., Dougher-Vermazen, M., Carrion, M. E., Dimitrov, D., Armellino,D. C., Gospodarowicz, D., and Bohlen, P. Identification of the KDR tyrosine kinaseas a receptor for vascular endothelial cell growth factor. Biochem. Biophys. Res.Commun., 187: 1579-1586, 1992.

17. Millauer, B., Wizigmann-Voos, S., Schnürch,H., Martinez, R., Mailer, N. P. H.,Risau, W., and Ullrich, A. High affinity VEGF binding and developmental expressionsuggest Flk-1 as a major regulator of vasculogenesis and angiogenesis. Cell, 72:

835-846, 1993.18. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by acid

guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162:156-159, 1987.

19. Weindel, K., Marme, D., and Weich, H. A. AIDS-associated Kaposi's sarcoma cells

in culture express vascular endothelial growth factor. Biochem. Biophys. Res.Commun., 183: 1167-1174, 1992.

20. Shibuya, M., Yamaguchi, S., Yamane, A., Ikeda, T., Tojo, A., Matsushime, H., andSato, M. Nucleotide sequence and expression of a novel human receptor-type tyrosinekinase gene (flt) closely related to the/mi family. Oncogene, 5: 519-524, 1990.

21. Plate, K. H., Breier, G., Weich, H. A., and Risau, W. Vascular endothelial growthfactor is a potential tumor angiogenesis factor in human gliomas in vivo. Nature(Lond.), 359: 845-847, 1992.

22. Plate, K. H., Breier, G., Weich, H. A., Mennel, H. D., and Risau, W. Vascularendothelial growth factor and glioma angiogenesis: coordinate induction of VEGF-receptors, distribution of VEGF protein and possible in vivo regulatory mechanisms.Int. J. Cancer, 59: 520-529, 1994.

23. Tokunaga, K., Nakamura, Y., Sakata, K., Fujimori, K., Ohkubo, M., Sawada, K., andSakiyama, S. Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenasegene in human lung cancers. Cancer Res., 47: 5616-5619, 1987.

24. Cox, K. H., DeLeon, D. V., Angerer, L. M., and Angerer, R. C. Detection of mRNAsin sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev.Biol., 101: 485-502, 1984.

25. Parums, D. V., Cordeil, J. L., Micklem, K., Heryet, A. R., Gatter, K. C., and Mason,D. Y. JC70: a new monoclonal antibody that detects vascular endothelium associatedantigen on routinely processed tissue sections. J. Clin. Pathol., 43: 752-757, 1990.

26. Terman, B. I., Carrion, M. E., Kovacs, E., Rasmussen, B. A., Eddy, R. L., and Shows,T. B. Identification of a new endothelial cell growth factor receptor tyrosine kinase.Oncogene, 6: 1677-1683, 1991.

27. Vaisman, N., Gospodarowicz, D., and Neufeld, G. Characterization of the receptorsfor vascular endothelial growth factor. J. Biol. Chem., 265: 19461-19466, 1990.

28. Senger, D. R., Connolly, D. T., Van de Water, L, Feder, J., and Dvorak, H. F.Purification and NH2-terminal amino acid sequence of guinea pig tumor-secretedvascular permeability factor. Cancer Res., 50: 1774-1778, 1990.

29. Plate, K. H., Breier, G., Millauer, B., Ullrich, A., and Risau, W. Up- regulation ofvascular endothelial growth factor and its cognate receptors in a rat glioma model oftumor angiogenesis. Cancer Res., 53: 5822-5827, 1993.

30. Brown, L. F., Berse, B., Jackman, R. W., Tognazzi, K., Manseau, E. J., Dvorak, H. F.,and Senger, D. R. Increased expression of vascular permeability factor (vascularendothelial growth factor) and its receptors in kidney and bladder carcinomas. Am.J. Pathol., ¡43:1255-1262, 1993.

31. Berkman, R. A., Merrill, M. J., Reinhold, W. C., Monacci, W. T., Saxena, A., Clark,W. C., Robertson, J. T., Ali, I. U., and Oldfield, E. H. Expression of the vascularpermeability factor/vascular endothelial growth factor gene in central nervous systemneoplasms. J. Clin. Invest., 91: 153-159, 1993.

32. Morii, K., Tanaka, R., Washiyama, K., Kumanishi, T., and Kuwano, R. Expression ofvascular endothelial growth factor in capillary hemangioblastoma. Biochem. Biophys.Res. Commun., 194: 749-755, 1993.

33. Knudson, A. G. Hereditary cancer, oncogenes, and antioncogenes. Cancer Res., 45:1437-1443, 1985.

34. Mäher.E. R., Yates, J. R., and Ferguson-Smith, M. A. Statistical analysis of the twostage mutation model in von Hippel-Lindau disease, and in sporadic cerebellarhemangioblastoma and renal cell carcinoma. J. Med. Genet., 27: 311-314, 1990.

35. Kanno, H., Kondo, K., Ito, S., Yamamoto, I., Fujii, S., Torigoe, S., Sakai, N., Hosaka,M., Shuin. T., and Yao, M. Somatic mutations of the von Hippel-Lindau tumorsuppressor gene in sporadic central nervous system hemangioblastomas. Cancer Res.,54: 4845-4847, 1994.

36. Dameron, K. M., Volpert, O. V., Tainsky, M. A., and Bouck, N. Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1. Science (WashingtonDC), 265: 1582-1584, 1994.

37. Van Meir, E. G., Polverini, P. J., Chazin, V. R., Su Huang, H-J., de Tribolet, N., andCavenee, W. K. Release of an inhibitor of angiogenesis upon induction of wild typep53 expression in glioblastoma cells. Nat. Genet., 8: 171-176, 1994.

38. Shweiki, D., Itin, A., Soffer, D., and Keshet, E. Vascular endothelial growth factorinduced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature (Lond.),359: 843-845, 1992.

39. Neumann, H. P. H., Eggert, H. R., Scheremet, R., Schumacher, M., Mohadjer, M.,Wakhloo, A. K., Volk, B., Hettmannsperger, U., Riegler, P., Schollmeyer, P., andWiestler, O. Central nervous system lesions in von Hippel-Lindau syndrome.J. Neurol. Neurosurg. Psychiatry, 55: 898-901, 1992.

40. Ferrara, N., Houck, K., Jakeman, L, and Leung, D. W. Molecular and biologicalproperties of the vascular endothelial growth factor family of proteins. Endocr. Rev.,13: 18-32, 1992.

41. Robertson, P. L., Du Bois, M., Bowman, P. D., and Goldstein, G. W. Angiogenesisin developing rat brain: an in vivo and in vitro study. Brain Res., 555: 219-223,1985.

42. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and Ferrara, N.Inhibition of vascular endothelial growth factor-induced angiogenesis suppressestumor growth in vivo. Nature (Lond.), 362: 841-844, 1993.

43. Millauer, B., Shawver, L. K., Plate, K. H., Risau, W., and Ullrich, A. Glioblastomagrowth inhibited in vivo by a dominant-negative Flk-1 mutant. Nature (Lond.), 367:576-579, 1994.

1364

on June 12, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

1995;55:1358-1364. Cancer Res S. Wizigmann-Voos, G. Breier, W. Risau, et al. Sporadic HemangioblastomasReceptors in von Hippel-Lindau Disease-associated and Up-Regulation of Vascular Endothelial Growth Factor and Its

Updated version

http://cancerres.aacrjournals.org/content/55/6/1358

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

.pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/55/6/1358To request permission to re-use all or part of this article, use this link

on June 12, 2021. © 1995 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/content/55/6/1358http://cancerres.aacrjournals.org/cgi/alertsmailto:pubs@aacr.orghttp://cancerres.aacrjournals.org/content/55/6/1358http://cancerres.aacrjournals.org/