FROM GENOMES TO RESOURCE

COMPETITORSUsing genome sequence data to predict

resource competition within the zebrafish gut microbiota

Alexandra Weston, University of OregonMentor: Zac StephensKaren Guillemin, PI

You are not just a bunch of Human Cells!

EcosystemMicrobiota

Gut Microbiota: disease states

altered gut microbiota

composition

Micah Lidberg

Gut Community Assembly Intestines sterile

before birth What factors affect

community assembly? Microbial traits

○ Motility○ Adhesion

Host interactions○ Host immune response

Microbial Competition○ Locale in gut○ Resources

Micah Lidberg

My Question

Can we use genome data to predict microbial competition within the gut?Resource Competition

My specific hypothesis blah blah blah

My strategy for testin gthe hypothesis Gather predictions from models of other

fiolks Create in vivo conditions to compare in

silico anaylisis with in vivo measurrents Ask whether in silico reflect in vivo If yes .. If no …

in silico Predictions

enzyme reactants products

Metabolic Model

Sequenced Genome

CTTCCTTTATGGTGAACTTTATCGTGGACGATCTTGAGCAAGCCCTACTTCAAGTCACGCAGGGTGGC

in silico Predictions

Seed Set

thiamine-phosphatefructose-1-phosphateSulfuric acidL-ValineArsenite2-Acyl-sn-glycero-3-phosphoglycerolAcetoacetic acidPotassiumGlucose

non-seedseed

thiamine-phosphatefructose-1-phosphateSulfuric acidL-ValineArsenite2-Acyl-sn-glycero-3-phosphoglycerolAcetoacetic acidPotassiumGlucose

Imidazole acetaldehydeGlucoseSulfuric acidL-ValineL-myo-Inositol 1-phosphateN-5-phosphoribosyl-anthranilateAmmoniumButyryl-CoA

in silico Predictions

Program compares seed sets of two microbes

thiamine-phosphatefructose-1-phosphateSulfuric acidL-ValineArsenite2-Acyl-sn-glycero-3-phosphoglycerolAcetoacetic acidPotassiumGlucose

Imidazole acetaldehydeGlucoseSulfuric acidL-ValineL-myo-Inositol 1-phosphateN-5-phosphoribosyl-anthranilateAmmoniumButyryl-CoA

Seed Overlap:Number of

compounds that exist in both seed sets

PredictionHigh seed

overlapMore

competition

The Zebrafish as a Model Organism

In Vivo Testing

• Guillemin lab: collection of commensal zebrafish gut microbes

• 66 strains• 21 genomes

• germ-free zebrafish

Experiment overview

In Vivo Testing

Dissect guts and plate out to determine the colonization by each strain

Germ-free

Bacterial strains

Microbacterium, ZOR0019

Kocuria, ZOR0020

Ensifer, ZNC0028

Bosea, ZNC0032

Bosea, ZNC0037

Chitinibacter, ZOR0017

Variovorax, ZNC0006

Delftia, ZNC0008

Exiquobacterium, ZWU0009

Carnobacterium, ZWU0011

Aeromonas, ZOR0001

Aeromonas, ZOR0002

Pseudomonas, ZWU0006

Vibrio, ZWU0020

Shewanella, ZOR0012

Acinetobacter, ZOR0008

Plesiomonas, ZOR0011

Enterobacter/Lecleria, ZOR0014

Comamonas, ZNC0007

Choosing Competitions

Seed Set Analysis

Monoassociations

19 Strains

11 Strains

Competitions (Seed overlap)

12 X 1912 X 812 X WU6

12 X11 12 X 14 14 X 19 12 X WU20 12 X 1 12 X 2

135-184 185-230 230-278

11 X 2 14 X 8 14 X 1 14 X 2 1 X 2 WU20 X1

Expected Outcomes Analysis: Competitive Index (CI)

9/1 = 9(competition)

5/5 = 1(no competition)

High Competitive Exclusion

Low Competitive Exclusion

Competitive Index per Competition

Results

135-184 185-230 230-278

Two Models of Competitive Exclusion

Highly stereotyped

Highly Variable

Analysis: Competitive Index (CI)

CI =(9/1)=9

CI= (1/9) = 0.11

Analysis: Power CI

|log(CI)|

Allows us to normalize the two different scenarios

Power CI=|log(9/1)| =

0.95

Power CI= |log(1/9)| =

0.95

Normalize to monoassociation ability

ms1= mean CFU/gut in mono-colonization for strain 1

ms2= mean CFU/gut in mono-colonization for strain 1

Power Competitive Index vs. Seed Overlap

Results

Conclusion

Is this a good method for predicting in vivo competition?A great deal of fish-to-fish variationNot the best r2

It’s a start, but it doesn’t tell the whole story of community assembly.

Future Directions

Another possibility: bacteria inhabit discrete locales with different environments

Acknowledgements Guillemin Lab

Karen Guillemin Zac Stephens Jennifer Hampton Annah Rolig Chris Wreden Erika Mittge Rose Sockol

Bohannan Lab Adam Burns Robert Steury

Elhanan Borenstein (UW)

SPUR Peter O’Day

Funding NICHD R25 Summer

Research Program (NIH-1R25HD070817)

Karen’s NIH grant

Questions?