+ All Categories
Home > Health & Medicine > Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of...

Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of...

Date post: 11-May-2015
Category:
Upload: agnieszka-lichanska
View: 120 times
Download: 3 times
Share this document with a friend
Description:
Talk presented at the BioConference Live in 2010.
Popular Tags:
28
TessArae, LLC, Proprietary Information Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens. Agnieszka M. Lichanska, Clark Tibbetts, and Matthew C. Lorence TessArae, LLC, Potomac Falls, Virginia, USA
Transcript
Page 1: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of

Multiple Respiratory Pathogens.

Agnieszka M. Lichanska, Clark Tibbetts, and Matthew C. Lorence

TessArae, LLC, Potomac Falls, Virginia, USA

Page 2: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Overview

  Re-sequencing technology vs. traditional diagnostic techniques   How does re-sequencing work?   How are the techniques different?

  Identification of new pathogens - an example: novel H1N1 flu

  Additional examples of use of RPM-Flu 3.1 assay   Summary

Page 3: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Shift in Microbial Diagnostics

TessArray™ !

TessArae Inc. TessArray RPM-Flu v3.1 Respiratory Pathogen

Panel P/N: 520-191

Phenotypic detection and identification

Genotypic detection and identification

Mainly single result per test Multiple results per one test Multiple signatures per pathogen

Detection and confirmation

Page 4: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

RPM Strategy

GTATGGTAGTTGGGATAATTAGCTTGATGTCATACCATCAACCCTATTAATCGAACTACA

GTATGGTAGTTGAGATAATTAGCTTGTATGGTAGTTGCGATAATTAGCTTGTATGGTAGTTGGGATAATTAGCTTGTATGGTAGTTGTGATAATTAGCTT

CATACCATCAACACTATTAATCGAACATACCATCAACCCTATTAATCGAACATACCATCAACGCTATTAATCGAACATACCATCAACTCTATTAATCGAA

Probes to interrogate center position of first complementary target strand

Probes to interrogate center position of second complementary target strand

Target

25-base window of 8 transducers Hemagglutinin A/Goose/Guangdong/1/96/H5N1

Page 5: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

RPM Strategy

GTATGGTAGTTGGGATAATTAGCTTGATGTCATACCATCAACCCTATTAATCGAACTACA

GTATGGTAGTTGGAATAATTAGCTTGGTATGGTAGTTGGCATAATTAGCTTGGTATGGTAGTTGGGATAATTAGCTTGGTATGGTAGTTGGTATAATTAGCTTG

CATACCATCAACCATATTAATCGAACCATACCATCAACCCTATTAATCGAACCATACCATCAACCGTATTAATCGAACCATACCATCAACCTTATTAATCGAAC

Hemagglutinin A/Goose/Guangdong/1/96/H5N1

Page 6: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

RPM Strategy

GTATGGTAGTTGGGATAATTAGCTTGATGTCATACCATCAACCCTATTAATCGAACTACA

GTATGGTAGTTGGGATAATTAGCTTGAGTATGGTAGTTGGGCTAATTAGCTTGAGTATGGTAGTTGGGGTAATTAGCTTGAGTATGGTAGTTGGGTTAATTAGCTTGA

CATACCATCAACCCAATTAATCGAACTCATACCATCAACCCCATTAATCGAACTCATACCATCAACCCGATTAATCGAACTCATACCATCAACCCTATTAATCGAACT

Hemagglutinin A/Goose/Guangdong/1/96/H5N1

Page 7: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

TessArray® RPM-Flu 3.1

TessArray™ !

TessArae, LLC TessArray RPM-Flu v3.1

Respiratory Pathogen Panel P/N: 520-191

Coronavirus (229E) Coronavirus (OC43) Coronavirus (NL63) Coronavirus (SARS Urbani) Cytomegalovirus (HHV-5) Enteroviruses: •  Coxsackievirus (5 types) •  Echovirus (8 types) •  Rhinovirus (27 types) Measles Virus Metapneumovirus (types A, B) Parainfluenza 1 Parainfluenza 2 Parainfluenza 3 Parainfluenza 4a Parainfluenza 4b RSV A RSV B Rubella Virus

Bordatella pertussis Corynebacterium diphtheriae Chlamydia psittaci Chlamydia trachomatis Chlamydophila pneumoniae Haemophilus influenzae Klebsiella pneumoniae Legionella pneumophila Moraxella catarrhalis Mycobacterium kansasii Mycobacterium tuberculosis Mycoplasma pneumoniae Neisseria meningitidis Pseudomonas aeruginosa Staphylococcus aureus Streptococcus agalactiae Streptococcus pneumoniae Streptococcus pyogenes Variola major Bacillus anthracis Francisella tularensis Yersinia pestis

Influenza A HA1 Influenza A HA2 Influenza A HA3 Influenza A HA4 Influenza A HA5 Influenza A HA6 Influenza A HA7 Influenza A HA8 Influenza A HA9 Influenza A HA10 Influenza A HA11 Influenza A HA12 Influenza A HA13 Influenza A HA14 Influenza A HA15 Influenza A HA16

Influenza A NA1 Influenza A NA2 Influenza A NA3 Influenza A NA4 Influenza A NA5 Influenza A NA6 Influenza A NA7 Influenza A NA8 Influenza A NA9 Influenza A Mtx Influenza A NS Influenza A PB2 Influenza B HA1 Influenza B HA2 Influenza B NA1

Influenza B Mtx

Adenovirus B Adenovirus C Adenovirus D Adenovirus E

Simultaneous differential diagnosis of influenza-like illness 30 different types of viral and bacterial respiratory pathogens 938,032 oligonucleotide probes 117,254 nucleotides of targeted pathogen gene sequences per assay

Page 8: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

How the RPM Assay Works?

 Control Template Live Influenza Vaccine (FluMist® 2004-2005)

  Trivalent mixture of different influenza virus A/HN and B subtypes   A/Canterbury/20/1999 (H1N1)   A/Wyoming/3/2003 (H3N2)   B/Jilin/20/2003   Hemagglutinin and Neuraminidase Genes from these Vaccine Strains

 Engineered by Reassortment with Cold-Adapted Master Strains   A/Ann Arbor/6/1960 (H2N2)   B/Ann Arbor/1/1966   Matrix and Other Viral Genes from Master Strains

Page 9: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Chip Background

Segment

Tile A G T C

C A G

T

Translation Key:

TGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGA!Influenza A Virus segment 4 hemagglutinin (HA1)

Page 10: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

>EV70UTR:NRL_KB_FluVaccine_082206 Start=12 End=707!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnncnannnnnngnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnng!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnncnnngnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnngnnnnntnnnnnnnnnnnnnnnncncnnnnnnnnnncnnnnnnnnnnnnnnnnnt!nnnnnnnnnnntnngancnnnnngnnnnnnnnnnccnnnngnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnncnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnn!>FLUAHA1:NRL_KB_FluVaccine_082206 Start=12 End=1487!agaagaatgtgacagngncncactctgtcaacctacttgaggacagtcacaatggaaaactatgtctactaaaaggaata!gccccncnnnnnntgggtaattgcagcgttgccggatggatcttaggaaacccagaatgcgaattactgatttccaagga!atcatggtcctacattgtagaaacaccaaatcctgagaatggaacatgttacccagggtatttcgccgactatgaggaac!tgagggagcaattgagttcagtatcttcatttgagagattcgaaatattccccaaagaaagctcatggcccaaccacacc!gtaaccggagtatcagcatcatgcncccnnnnngggaaaagcagtttttacagaaatttgctatggcngncnnnnnngaa!tggnnnnnnnccaaacctgagcaagtcctatgtaaacaacaaagagaaagaagtccttgtactatgggcnntncntcacc!cgcctaacanagggaaccaaagggccctctatcatacagaaaatgcttatgtctctgtagtgtcttcacattatagcaga!agattcaccccagaaatagccaaaagacccaaagtaagagatcaggaaggaagaatcaactactactggactctgcngga!acctggggatacaataatatttgaggcaaatggaaatctaatagcgccatggtatgcttttgcactgagtagaggctttg!gatcaggaatcatcacctcaaatgcaccaatggatgaatgtgatgcgaagtgtcaaacacctcagggagctataaacagc!agtcttcctttccagaatgtacacccagtcacaataggagagtgtccaaagtatgtcaggagtgcaaaatnaaggatggn!tacaggactaaggaacatcccntccattcaatccagaggtttgtttggagccattgccggtttcattgaagnnnngtgga!ctggaatggtagatgggtggtatggttatcatcatcagaatgagcaaggatcnggnnnnnnnncagatcaaaaaagtnca!caaaatgccattaacgggattacaaacaaggtgannnnnnnnnnnnagaaaatgaacactcaattcacngcngtgggcaa!agaattcaacaaattggaaagaaggatggaaaacttaaataaaaaagttgatgatgggtttctagacatttggannnnnn!nnncagaattgttggttctacTGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGAatctgtatgagaaa!gtaaaaagccaattaaagaataatgccaaagaaataggaaacgggtgttttgaattctatcacaagtgtaacaatgaatg!catggagagtgtgaaaaatggaacttatgactatccaaaatattccgaagaatcaaagttaaacagggagaaaattgatg!gagtgaaattggaatcaatgggagtctatcagattc!>FLUAHA10:NRL_KB_FluVaccine_082206 Start=12 End=787!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnngnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnngnnnnncnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnnnnnnnnnnnnnnnnnannnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnn!nnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nnnnnnncaggaangagnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn!nggnnnnnntnnnangnaggnnggnngnnnnnnnnnnnnnnnnnnncnnnnnnnnn…

Enterovirus 70 UTR Negative

Type A Flu - HA1 Positive

Type A Flu - HA10 Negative

Page 11: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

How to Identify a Novel Pathogen?

Page 12: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

RPM Detection of Novel Strains

CATACCATCAACCCTATTAATCGAACTACAGCGTATGGTAGTTGGGATAATTAGCTTGATGTCG

TGGTAGTTGGGAAAATTAGCTTGATTGGTAGTTGGGACAATTAGCTTGATTGGTAGTTGGGAGAATTAGCTTGATTGGTAGTTGGGATAATTAGCTTGAT

ACCATCAACCCTATTAATCGAACTAACCATCAACCCTCTTAATCGAACTAACCATCAACCCTGTTAATCGAACTAACCATCAACCCTTTTAATCGAACTA

CATACCATCAACCCTGTTAATCGAACTACAGCGTATGGTAGTTGGGACAATTAGCTTGATGTCG

TGGTAGTTGGGAAAATTAGCTTGATTGGTAGTTGGGACAATTAGCTTGATTGGTAGTTGGGAGAATTAGCTTGATTGGTAGTTGGGATAATTAGCTTGAT

ACCATCAACCCTATTAATCGAACTAACCATCAACCCTCTTAATCGAACTAACCATCAACCCTGTTAATCGAACTAACCATCAACCCTTTTAATCGAACTA

Forward strand sequence variant detection

Reverse strand sequence variant detection

target

Old Strain New Strain

Page 13: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Detection of Novel Strains

Page 14: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Novel H1N1 Influenza Detection

Page 15: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Detecting Seasonal Strains of Influenza

RPM-Detector Tiles for Seasonal A/H1N1 and Seasonal A/H3N2 Influenza Viruse s Vir u s Target Gen e Detector Tile Sequence/Strai n Leng t h Prob e s

A/H1 N 1 Hemagglutinin(A/HA1 ) A/New Caledonia/20/1999(H1N1) 1500 bp 12,000 A/H1 N 1 Neuraminidase(A/NA1) A/New Caledonia/20/1999(H1N1) 1200 bp 9,600 A/H1 N 1 Matrix(A/H1N1-M ) A/Canterbury/100/2000(H1N1) 850 bp 6,800

A/H3 N 2 Hemagglutinin(A/HA3 ) A/Canterbury /125/2005(H3N2) 1500 bp 12,000 A/H3 N 2 Neuraminidase(A/NA2) A/Canterbury /125/2005(H3N2) 1200 bp 9,600 A/H3 N 2 Matrix(A/H3N2-M ) A/Canterbury /125/2005(H3N2) 850 bp 6,800

Page 16: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

A Sentinel Case

April 2009:   Patient presents at Washington, DC hospital   Recently returned from vacation in Mexico   Convalescing from recent flu-like illness   Anxious about reports of novel influenza outbreak

TessArray Outcomes:

01 May 2009 - Best Matches L20309, X90504 H influenzae outer membrane protein P5 A/duck/Guanxi/2004(H5N1); A/chicken/Yogjakarta/2004(H5N1)

Very unusual result suggested patient had been infected by an avian influenza virus Database updated following week, new sequence records from Mexico outbreak isolates 05 May 2009 - Best Matches L20309, X90504 H influenzae outer membrane protein P5 A/California/07/2009(H1N1); A/Texas/04/2009(H1N1)

Perfect Match to New CDC Strain! From a Test Designed in 2006 With No Prior Knowledge of New Strain

Page 17: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

T S R A - A ML_CNMC_01_050109 (“RPM-Flu Sentinel Case”) Best Matches from VSRD Archive

Updated November 2008 Best Matches from VSRD Archive

Updated May 2009

A/chicken/Indonesia/7/2003(H5N1) A/chicken/Puebla/231-5284/98(H5N2) A/chicken/Puebla/231-5284/98 (H5N2)

A/chicken/Yogjakarta/BBVet-IX/2004(H5N1) A/duck/Guangxi/1436/2006(H5N1) A/duck/Guangxi/351/2004(H5N1) A/duck/Guangxi/3548/2005(H5N1) A/duck/Guangxi/380/2004(H5N1) A/duck/Guangxi/4016/2005(H5N1)

A/hooded vulture/Burkina Faso/2/2006(H5N1) A/mallard/Alberta/111/99(H4N6) A/mallard/Alberta/111/99(H4N6)

A/mallard/Maryland/1235/2006(H3N6) A/mallard/Maryland/1235/2006(H3N6) A/quail/Tasikmalaya/BPPV4/2004(H5N1)

A/swine/Hong Kong/1197/02(H3N2) A/swine/Hong Kong/1197/02(H3N2) A/swine/Iowa/930/01(H1N2)

A/swine/Virginia/670/1987(H1N1) A/swine/Virginia/671/1987(H1N1)

A/swine/British Columbia/28103/2005(H3N2)

A/California/04/2009(H1N1) A/California/05/2009(H1N1) A/California/06/2009(H1N1) A/California/07/2009(H1N1) A/California/08/2009(H1N1) A/California/09/2009(H1N1) A/California/10/2009(H1N1) A/California/14/2009(H1N1) A/Canada-ON/RV1527/2009(H1N1) A/New York/06/2009(H1N1) A/New York/10/2009(H1N1) A/New York/11/2009(H1N1) A/New York/15/2009(H1N1) A/New York/18/2009(H1N1) A/New York/19/2009(H1N1) A/New York/20/2009(H1N1) A/New York/22/2009(H1N1) A/Ohio/07/2009(H1N1)

A/Texas/04/2009(H1N1) A/Texas/05/2009(H1N1)

RPM detection and identification works for strains and variants that share at least 80% sequence similarity to array detector tiles

The RPM-Flu 3.1 designed for A/H5N1 in 2006 is capable to sensitively detect and differentiate the Novel A/H1N1 SOIV from Seasonal A/H1N1 and Seasonal A/H3N2 subtypes without modification

190/215 = 88%

Page 18: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Avian A/H5N1 matrix gene resequencing detector tile sequence (top sequence)

2009 Novel H1N1 (A/Pensacola/INS107/2009(H1N1)) strain (middle sequence)

Sequence from a high titer stock of a 2009 Novel H1N1 outbreak strain strain, A/NHRC-California/BRD_40116(H1N1) (bottom sequence)

Legend: “x” = Mismatch “|” = Match

Page 19: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Seasonal H1N1 Seasonal H3N2 Novel H1N1

LoD (95%) TCID50/ml

TessArray RPM-Flu   Novel A/H1N1 1,740   Seasonal A/H1N1 102   Seasonal A/H3N2 224

CDC rRT-PCR (JBAIDS)   Novel A/H1N1 5,000   Seasonal A/H1N1 10   Seasonal A/H3N2 100

Analytical Sensitivity with Cultured Influenza Virus

Page 20: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Analytical Sensitivity Cultured Influenza Virus

Controls Seasonal A/H1N1

Seasonal A/H3N2

2009 Novel A/H1N1 SOIV

Endpoint LoD Titration

Seasonal A/H1N1 38/38 (100%) 0/41 (0%) 0/41 (0%)

Seasonal A/H3N2 0/58 (0%) 44/44 (100%) 0/58 (0%)

2009 Novel A/H1N1(SOIV) 0/55 (0%) 0/55 (0%) 44/44 (100%)

Positive Clinical Specimens

Seasonal A/H1N1 13/13 (100%) 0/13 (0%) 0/13 (0%)

Seasonal A/H3N2 0/31 (0%) 31/31 (100%) 0/31 (0%)

2009 Novel A/H1N1(SOIV) 0/8 (0%) 0/8 (0%) 8/8 (100%)

Negative Controls

Avian A/H5N1-positive 0/16 (0%) 0/16 (0%) 0/16 (0%)

Other High Load Pathogens 0/24 (0%) 0/24 (0%) 0/24 (0%)

Water Blanks 0/14 (0%) 0/14 (0%) 0/14 (0%)

Clinical Negative by PCR 0/501 (0%) 0/501 (0%) 0/501 (0%)

Page 21: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Detecting Emergent Strains

A/New Caledonia/20/1999(H1N1) Hemagglutinin A/New Caledonia/20/1999(H1N1) Neuraminidase A/Canterbury/100/2000(H1N1) Matrix A/Canterbury/125/2005 (H3N2) Hemagglutinin A/Canterbury/125/2005 (H3N2) Neuraminidase A/Canterbury/125/2005 (H3N2) Matrix

2004-5 FluMist  A/New Caledonia/20/1999(H1N1)  A/New Caledonia/20/1999(H1N1)  A/Ann Arbor/6/1960(H2N2)  A/Wyoming/03/2003 (H3N2)  A/Wyoming/03/2003 (H3N2)  A/Ann Arbor/6/1960(H2N2)

2009-10 FluMist A/South Dakota/6/2007(H1N1) A/South Dakota/6/2007(H1N1) A/Ann Arbor/6/1960(H2N2) A/Uruguay/716/2007 (H3N2) A/Uruguay/716/2007 (H3N2) A/Ann Arbor/6/1960(H2N2)

What’s on the Device:

What it Told Us:

TessArray™ !

TessArae, LLC TessArray RPM-Flu v3.1

Respiratory Pathogen Panel P/N: 520-191

2006-7 FluZone A/New Caledonia/20/1999(H1N1) A/New Caledonia/20/1999(H1N1) A/Puerto Rico/8/1934(H1N1) A/Wisconsin/67/2005 (H3N2) A/Wisconsin/67/2005 (H3N2) A/Puerto Rico/8/1934(H1N1)

2009-10 FluVirin A/South Dakota/6/2007(H1N1) A/South Dakota/6/2007(H1N1) A/Puerto Rico/8/1934(H1N1) A/Uruguay/716/2007 (H3N2) A/Uruguay/716/2007 (H3N2) A/Puerto Rico/8/1934(H1N1)

When Confronted With Different Strains the Array Still Tells Us What Is Present Based on the Sequences of the Organisms

Page 22: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Match SEPRL Reference Strain

H1N1 A/Turkey/Kansas/4880/80

H2N8 A/Herring Gull/DE/677/88

H3N2 A/turkey/MN/366767/2005

H4N6 A/Blue Winged Teal/LA/240B/88

H7N2 A/quail/PA/20304/98

H8N4 A/turkey/CO/169118-13/02

H10N7 A/quail/NJ/25254-22/95

H11N3 A/chicken/NJ/4645/96

H12N5 A/duck/LA/188D/87

H13N6 A/gull/MD/1824/78

AMPV, No AI Avian Metapneumovirus (Colorado Strain)

H5N3 A/duck/Singapore/F119/97

H7N3 A/chicken/Chile(F0)/176822/02

No AI Avian Paramyxovirus I (NDV, RPM-TEI assay)

H5N2 A/chicken/Mex/26654-1374/94

H7N1 A/turkey/Italy/4580/99

H7N3 A/chicken/Pakistan/1369-CR2/95

H7N7 A/chicken/Victoria/85

H14N5 A/mallard/Gurjev/263/82

H15N9 A/Shearwater/W. Australia/2576/79

Sample RPM Assay

1 H1N1

2 H2N8

3 H3N2

4 H4N6

6 H7N2

7 H8N4

9 H10N7

10 H11N3

11 H12N5

12 H13N6

13 AMPV, No AI

14 H5N3

15 H7N3

16 No AI

17 H5N2

18 H7N1

19 H7N3

20 H7N7

21 H14N5

22 H15N9

Specimens from USDA ARS SEPRL reference archive (20 Mar 08) Avian Influenza Subtypes: Differential Diagnostics

Page 23: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Reconciliation of Inter-Platform Results Discrepancies by de novo DNA Sequencing of Viral Genes from Original Specimens

Sample ID

CDC-Certified H5 (Asian) PCR

Ibis-T5000 ESI-MS

HA RSLT (P1) Serology

TessArray® RPM-Flu v3.1

Gold Standard DNA Sequencing

2006900845 H5 H5N1 H5 H5N1 not tested

2006906089 H5 H5N1 H5 H5N1 not tested

2006900590 H5 H5N1 H5 H5N1 not tested

2006902838 H5 H5N1 H5 H5N1 not tested

2006902764 not tested H5N1 H5 H5N1 H5N1

2006905588 Flu UNKNOWN H7 H7N7 H7N7

2004909864 not tested H9N2 UNKNOWN H7N7 H7

2005912823 Flu H7N7 UNKNOWN H10N7 H10N7

2005912908 not tested H7N7 H10 H10N7 H10N7

2004900600 Flu H7N7 H10 H10N7 H10N7

2004900845 H5 H5N1 H10 H10N7 or H10N5 H10N7

2004900688 not tested H7N7 H11 H11N? H11

2005912306 Flu NEW UNKNOWN H13N6 or H13N8 H13

= Conflict with de novo sequencing results

Avian Influenza Subtypes: Differential Diagnostics

= Results concordant with de novo sequencing

Lin et al PLOS 2009

Page 24: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Longitudinal Data Analysis

CT_Sick_050509 Rhinovirus

CT_Sick_042010 Parainfluenza Virus

CT_Healthy_Control_080508 CT_Sick_Day4_080603 Metapneumovirus

But not the novel A/H1N1!

Page 25: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

MLST-like Epidemiological Analysis: Genomic diversity of Haemophilus influenzae from 50 Different Patients at MCRD San Diego

Page 26: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

MLST-Like Epidemiological Analysis: Clonal genomic uniformity of Adenovirus Type 4 in Same 50 Patients at MCRD San Diego

Page 27: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Summary

  Real-time Epidemic/Pandemic Surveillance in Human and Animal Populations

  Simultaneous Detection and Definitive Identification of Multiple Pathogens   Characterization of Difficult Cases

  Superior to Benchmark Platform Sensitivity and Specificity   Limits of Detection ~ 102 Genome Equivalents/specimen

  Zero False Positive Detection Events   Immediate Identification of Known and Unknown Strains and Variants

  Surveillance of Shift and Drift in Populations   Same Day Results

  RPM Sequence-based Detector Array   Six Sigma Data Quality   Basecall Error Rate ≥ 10-6

Page 28: Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.

TessArae, LLC, Proprietary Information

Acknowledgements

Naval Health Research Center/Naval Respiratory Disease Laboratory, San Diego, CA

David Metzgar Chris Myers Christian Hansen CDR Kevin Russell Jason Brown Larivhie Dela Cruz CDR Dennis Faix Miguel Osuna David Ortiz

TessArae, LLC - Potomac Falls, VA Clark Tibbetts Brian Weslowski Leah Morris Matthew Lorence Lisa Borsuk Klaus Schafer

Naval Research Laboratory/Center for Bio/Molecular Science and Engineering - Washington, DC

Joel Schnur Anthony Malanoski Nina Long David Stenger Baochuan Lin Carolyn Kidd Zheng Wang Dzung Thach Kate Blaney


Recommended