Enzymatic amplification of oligonucleotides in paper substrates

Abootaleb Sedighi and Ulrich. J. Krull*

Department of Chemical and Physical Sciences, University of Toronto Mississauga,

3359 Mississauga Road, Mississauga, Ontario, Canada, L5L 1C6

Corresponding author: ulrich.krull@utoronto.ca

Abstract

Several solution-based methods have recently been adapted for use in paper

substrates for enzymatic amplification to increase the number of copies of DNA

sequences. There is limited information available about the impact of a paper

matrix on DNA amplification by enzymatic processes, and about how to optimize

conditions to maximize yields. The work reported herein provides insights about

the impact of physicochemical properties of a paper matrix, using nuclease-

assisted amplification by exonuclease III and nicking endonuclease Nt.Bbv, and

a quantum dot (QD) - based Forster Resonance Energy Transfer (FRET) assay

to monitor the extent of amplification. The influence of several properties of paper

on amplification efficiency and kinetics were investigated, such as surface

adsorption of reactants, and pore size. Additional factors that impact amplification

processes such as target length and the packing density of oligonucleotide

probes on the nanoparticle surfaces were also studied. The work provides

1

guidance for development of more efficient enzymatic target-recycling DNA

amplification methods in paper substrates.

1. Introduction

Paper-based analytical devices (PAD) have recently emerged as promising

platforms for diagnostics in resource-limited settings, and nucleic acid-based

bioassays are integral to some of these systems [1–3]. The attractiveness of

paper as a substrate for bioassays includes: (1) availability of various porosities

and pore sizes, thicknesses and wicking rates at low cost [4,5], (2) cellulosic

paper is hydrophilic and has relatively weak non-specific binding [2], (3)

patterning strategies, e.g. wax printing, are facile and low cost [4,6], (4) strategies

for surface modification for biomolecule immobilization are well-established, and

(5) fluidics in paper is based on capillary action and transport of solution may

operate independently of external pumps.

Paper-based devices have attracted considerable attention for development of

low-cost assays of nucleic acids as screening technologies at point-of-care

(POC) settings [7–15]. A variety of paper devices with integrated readout

systems including colorimetric [8,9], fluorescence [10,11]. electrochemical [10,11]

and chemiluminescence [13] have been proposed for the detection of nucleic

acids. However, the detection limit achieved by these devices (pM-nM) [14] are

well above the levels encountered in biological samples (aM-fM) [16]. Therefore,

an off-chip amplification step is usually required to increase the number of target

molecules to a detectable level prior to implementation of the assay [14,15]. Such

2

an amplification step complicates a protocol and renders the bioassay less

attractive for POC diagnostics. Several reports have recently attempted to

address the issue by integrating various nucleic acid amplification techniques into

paper substrates [17,18,18–23]. These amplification methods, conducted in

paper substrates with different properties, proved to be highly efficient with limit

of detection achieving a single copy of target nucleic acid [24].

In contrast, several studies have reported contradictory results, indicating

inhibition of enzymatic amplification on different paper matrices [20,25,26]. For

instance, Rohrman et al. reported that the product yield of recombinase

polymerase amplification (RPA) was reduced when done in a Whatman

chromatography paper (CHR) in comparison with the amplification done in bulk

solution, while amplification using a glass fiber (GF) substrate produced a

quantity of product comparable to that obtained from bulk solution reactions [25].

The authors hypothesized that this disparity was due to the larger pore sizes of

GF substrates. Linnes et al. investigated different DNA amplification methods

using different substrates that included CHR, GF, nitrocellulose (NC) and

polyethersulfone (PES). They reported that polymerase chain reaction (PCR)

was completely inhibited in all substrates, while loop-mediated isothermal

amplification (LAMP) and thermophilic helicase-dependent amplification (tHDA)

was most successful in PES substrates [26]. The authors suggested that the

PES substrate has the least surface binding affinity for nucleic acids and

enzymes [26]. In contrast, a recent study by Liu et al. reported a 3-fold

enhancement of rolling circle amplification (RCA) using NC membranes in

3

comparison with the solution phase reaction [17]. This RCA experiment involved

DNA hybridization to a surface-immobilized oligonucleotide, and the

enhancement was attributed to the higher localized concentration of the

immobilized DNA strands [17]. An overview of similar reports about amplification

in paper substrates indicates a paucity of information about the impact of

chemical and physical properties of the paper matrix on the efficiency of

enzymatic DNA amplification reactions.

In this report, the work is intended to provide direction for optimal design of

oligonucleotide amplification by enzymatic target-recycling processes on/in

paper substrates by determining the potential for impact of different factors that

can influence the reactions within the matrix. It is clear that the extent of impact

for different types of enzymes may vary between different paper matrices. This

study offers some insights about general physicochemical properties of paper

substrates, such as the significance of: adsorption of enzymes/nucleic acids;

paper pore sizes; and spatial localization of reaction. The spatial location will be

referred to as the reaction “phase”, with the “solution-phase” being reaction in the

pores of the paper matrix, and “surface-phase” being reactions using reagents

that were deliberately immobilized onto the physical surfaces of the fibers of the

paper matrix. The experimental work considers the effectiveness of enzymatic

target recycling using exonuclease III and nicking endonuclease Nt.Bbv, which

have recently garnered attention as amplification methods that may be suitable

for POC settings [27]. Although, the use of these nucleases for DNA amplification

4

in paper substrates has not been reported, their simple reaction schemes

facilitate the interpretation of the results. A Forster Resonance Energy Transfer

(FRET) – based assay using semiconductor quantum dots (QDs) as the donor

served to monitor the extent of product production by the amplification process.

This fluorescence detection strategy was previously demonstrated to provide for

sensitive and specific biorecognition in paper substrates [28,29].

2. Materials and Methods

2.1. Materials

All oligonucleotides were provided by Integrated DNA Technologies (Coralville,

IA, USA), and are identified in Table 1. Exonuclease III (EXO), nicking

endonuclease Nt.BbvCI (Bbv) and 10X CutSmart buffer were from New England

Biolabs (Ipswich, MA, USA) and used without further purification. Tide

Quencher™ 3-maleimide was from AAT Bioquest, (Sunnyvale, CA, USA).

Diethylaminoethyl (DEAE)-functionalized magnetic beads (MB, 1 μm) were from

Bioclone Inc. (San Diego, CA). Green-emitting CdSe/ZnS core/shell quantum

dots (PL at 518 nm) were from Cytodiagnostics (Burlington, ON, Canada).

Hexahistidine-maleimide peptide sequences were from Canpeptide Inc.

(Montreal, QC, Canada). Illustra NAP-5 size exclusion chromatography columns

were from GE Life Sciences (Quebec, Canada). Amicon Ultra-0.5 centrifugal

filters were from Fisher Scientific (Ontario, Canada). Whatman® cellulose

chromatography papers (Grade 1, CHR-1, 200 × 200 mm), Whatman® cellulose

filter papers grade 1 (Circular, 150 mm diameter), grade 3 (Circular, 55 mm

5

diameter) and grade 5 (Circular, 55 mm diameter), Whatman® glass microfiber

Grade A (GF/A, Circular 24 mm diameter), sodium tetraborate, L-glutathione

(GSH, reduced, ≥98%), DTT, tetramethylammonium hydroxide solution (TMAH,

25% w/w in methanol), sodium (meta)periodate (NaIO4, ≥ 99%), sodium

cyanoborohydride (NaCNBH3, 95%), 1-(3-aminopropyl)imidazole (API, 98%), 4-

(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, ≥ 99.5%), albumin

from bovine serum (BSA, ≥ 98%) and Salmon Sperm DNA were from Sigma

Aldrich (Oakville, ON, Canada). All buffer solutions were prepared using a water

purification system (Milli-Q, 18 MΩ cm−1), and were autoclaved prior to use. The

buffer solutions included 100 mM tris-borate buffer (TB, pH 7.4), 50 mM borate

buffer (BB, pH 7.4), and phosphate buffer (PB, pH 7.4).

Table 1: The oligonucleotide sequences

Name Sequence

MB 5'- /SH/-CTGAGCACAGTCCTCAGCGAAA -/Cy3/-3'

TGT-1 5'- (T)5 TTTCGCTGAGGACTGTGCT (T)5 -3'TGT-2 5'-(T)6 AGCAGCTGAGGACTGTGCTCAG (T)2 -3'TGT-3 5'- (T)21 TTTCGCTGAGGACTGTGCT (T)20 -3'TGT-4 5'- (T)36 TTTCGCTGAGGACTGTGCT (T)35 -3'

(TGT – target)

2.2. Preparation of molecular beacon probes (MB)

Two molecular beacon probes were used in this study. A 22-mer oligonucleotide

that was modified with Cy3 dye at the 3’-end and a thiol group at the 5’-end, was

used to prepare the MB probes. The thiol group was first reduced via 500× DTT

in 1x PBS (10 mM phosphate, 137 mM NaCl, 2.7 mM KCl, pH 7.4) for 2 h. The

unreacted DTT was then removed by ethyl acetate extraction (4 times). To

6

prepare MB-TQ conjugates, 20 equivalents of Tide Quencher 3-maleimide was

added to MB oligonucleotides in PBS and the solution was shaken overnight. To

prepare MB-QD probes, the MB oligonucleotide was first functionalized with a

hexahistidine tag (H6) by incubating it with 5 molar equivalents of a maleimide

functionalized peptide (Maleimide-G(Aib)GHHHHHH, for 24 h. Unreacted TQ-3

and peptide was removed by running the sample through two consecutive NAP-5

desalting columns.

Immobilization of H6-oligonucleotides was performed using a solid-phase

immobilization method that we have recently developed [30]. To obtain different

packing densities of H6-MB on QD surfaces, various equivalents of

oligonucleotides to QDs (3-40 eq) were added to the positively charged magnetic

beads that were dispersed in TBS buffer (tris-borate 100 mM, NaCl 20 mM) at pH

7.4. To remove the unreacted oligonucleotides, the concentration of NaCl was

increased to 350 mM. This process removed >95% of the unreacted

oligonucleotides (See Figure S1). The DNA/QD values were determined by

independent quantification of QDs and MBs, as previously described [30].

2.3. Modification of the paper substrates

The papers were prepared using a method previously developed in our group

[8,11]. Paper substrates were patterned with wax using a Xerox ColorQube

8570DN solid ink printer. Each rectangular paper sheet was 60 mm by 26 mm in

dimension and was printed to contain an array of 8 by 4 of circular reaction zones

of 3 mm diameter (See Figure S2). Printing on smaller circular filter papers was

7

achieved after adhering the papers to regular printing paper using double-sided

tape. The wax printed papers were subsequently heated in an oven at 120 C for

2.5 min. Nitrocellulose substrates were prepared by nitrating the CHR-1 paper.

The papers were soaked in a solution (1:1 by volume) of concentrated sulfuric

acid (98%) and nitric acid (73%) for 30 min, and then neutralized using sodium

bicarbonate and rinsed extensively with deionized water.

For solution-phase amplifications, the reaction zones on the paper were used

without further chemical modifications. In contrast, the surface-phase

amplification made use of functionalized paper. The reaction zones were

modified to conjugate imidazole groups to the paper for immobilization of QD-MB

probes. Imidazole surface modification was conducted in two steps. First, the

cellulose was modified to contain aldehyde groups by two consecutive additions

of 5 μL of aqueous solutions of NaIO4 (50 mM) and LiCl (700 mM), with heating of

the paper at 50 C for 30 min, followed by rinsing with deionized water and drying

at 50 C in an oven. Next, the papers were functionalized with imidazole groups

by spotting 5 μL of a solution containing API at 200 mM and NaCNBH 3 at 300

mM, in HEPES buffer pH 8. The reactions were allowed to proceed at room

temperature for 1 h. The papers were then rinsed with borate buffer 50 mM pH

9.2 and stored in a desiccator for later use.

2.4. Bulk solution amplification

The reactions in the bulk solution were done using 1 U/μL of EXO or 0.2 U/μL of

Bbv enzymes in 50 μL of CutSmart buffer (50 mM potassium acetate, 20mM tris-

8

acetate, 10 mM magnesium acetate, 100 μg/ml BSA, pH 7.9) for 60 min at

different temperatures in the range of 23-37 C. EXO amplifications were done

using 200 nM of MB-QD (or MB-TQ) and various concentrations of TGT-1 target.

Bbv amplifications were done using 600 nM MB-QD (or MB-TQ) and various

concentrations of TGT-2 target. Photoluminescence (PL) spectra were collected

using a QuantaMaster Photon Technology International spectrofluorimeter

(London, ON, Canada).

For amplification involving MB-TQ, the fluorescence measurements were done

using an excitation wavelength of 540 nm and an emission range of 550-700 nm.

The amplification (%) from TQ-MB probes was calculated based on the

enhancement of Cy3 emission signal upon cleavage of the quencher (TQ) by the

enzyme using equation 1:

Amplification (% )MB−TQ=( ∑λ=570λ=550

PL(λ))ET−( ∑λ=570λ=550

PL(λ))N( ∑λ=570λ=550

PL( λ))N×100(1)

where the wavelength range of 550 to 570 nm corresponds to the region of

significant Cy3 PL. The subscript ET denotes a measurement made in the

presence of enzyme and target, while N denotes a measurement made in the

absence of both the enzyme and the target.

9

For amplifications involving MB-QD, the fluorescence measurements were done

using an excitation wavelength of 405 nm and an emission range of 480-640 nm.

The amplification (%) for MB-QD probes was calculated based on the

enhancement of QD emission signal over the Cy3 emission signal upon cleavage

of Cy3 by the enzyme using equation 2:

Amplification(%)MB−QD=

( ∑λ=530

λ=510

PL(λ)

∑λ=570

λ=550

PL(λ))ET−( ∑λ=530λ=510

PL ( λ )

∑λ=570

λ=550

PL ( λ ) )N( ∑λ=530

λ=510

PL ( λ )

∑λ=570

λ=550

PL ( λ ) )N×100(2)

where the wavelength range of 510 to 530 nm corresponds to the region of

significant gQD PL.

2.5. Paper-based amplification

Amplifications on paper substrates were done in solution-phase and surface-

phase formats. In the solution-phase format, 1-5 uL of amplification mixture

containing 1.6 U/μL of EXO, 1X CutSmart buffer, 200 nM of QD-MB was spotted

on each paper zone and the reaction then proceeded for 60 min. For surface-

phase amplification, MB-QDs were first immobilized on paper by adding 3 μL of

MB-QD solution (200 nM) in BB pH 9.2 to each reaction zone. The reactions

were allowed to continue until complete, which was determined to be a period of

10

30 min. The paper was then washed in borate buffer and dried in a desiccator.

Thereafter, 1-5 uL of amplification mixture containing 3 U/μL of EXO, 1X

CutSmart buffer, and various concentrations of TGT-1 oligonucleotides was

spotted on each paper zone, with reaction times of 60 min. To prevent

evaporation of the amplification solution, the paper was enclosed in a humid

chamber (See Figure S2).

The extent of amplification that occurred in the paper substrates was determined

from the PL spectra and the intensities of fluorescence from digital images. The

PL spectra were acquired using a Nikon Eclipse L150 epifluorescence

microscope (Nikon, Mississauga, ON) and the amplification was calculated using

equation (1). Digital color images from paper substrates were acquired using an

iPhone 4S (Apple, Cupertino, CA, U.S.A.). For collection of reproducible digital

images, paper substrates were illuminated at a distance of 10 cm with an

ultraviolet (UV) lamp (UVGL-58, LW/ SW, 6W The Science Company, Denver,

CO, U.S.A.) operated at the long wavelength (365 nm) setting. The digital images

were split into corresponding R-G-B color channels using ImageJ software and

the amplification was quantified by ratiometric analysis of each spot using

equation 3:

Amplification (%)=( IGI R )ET−( IGIR )N

( IGIR )N×100(3)

where IG and IR are the mean PL intensity of green channel (G) and red channel

(R) for a given spot, respectively. The subscript ET denotes a measurement

11

made in the presence of enzyme and target, while N denotes a measurement

made in the absence of both the enzyme and the target.

Kinetic assays. Kinetic experiments in solution-phase and surface-phase format

were done using 1 μL of amplification solution in reaction zone of the paper

substrates. The fluorescence spectrum of each zone was acquired using the

Nikon microscope every 5 min for 60 minutes, and signal intensity was used to

determine the extent of amplification (%). The characteristic rate constants of

amplification (k’) were obtained by fitting to a first-order kinetic model using

equation 4:

AA0

=e−k' t(4)

where A and A0 are the amplification signal at each point of time and the final

amplification signal, respectively, and t represents time in minutes.

3. Results and discussion

The mechanism of nuclease-assisted amplification is based on the target

recycling that is achieved by three sequential events, including: (1) target strand

hybridization to an oligonucleotide probe; (2) probe cleavage by a nuclease that

acts on dsDNA, resulting in development of a fluorescence response; and (3)

target strand release upon cleavage of the probe, providing for a further cycle of

binding of the target strand with oligonucleotide probe. In this work, a molecular

beacon oligonucleotide was used as the probe strand (Table 1). When hybridized

12

to the target strand TGT-1, the 3’-end of the MB was blunt, which resulted in the

cleavage of the probe by the enzyme exonuclease III (EXO). The loop region of

the MB probe contained a recognition sequence for the nicking endonuclease

Nt.Bbv (Bbv), which caused the cleavage of the probe upon binding to the target

strand TGT-2.

According to the supplier, the optimum temperature for both nucleases is 37 °C.

This work investigated the efficiency of the nucleases across a temperature

range of 23-37 °C (Figure S3). The results show ~20% and ~40% reduction in

amplification efficiencies of EXO and Bbv, respectively, at room temperature (23

°C) in comparison with the optimum temperature of 37 °C. Operation at room

temperature better fits the potential applications of paper-based amplification for

screening technologies at the POC settings, and subsequent amplification

experiments were done at room temperature.

3.1. Nanoparticles and FRET for detection

Two different designs of FRET - based assay were used to monitor the quantity

of products from the amplification reactions (Figure 1). In format 1, Cy3 and Tide

Quencher 3, attached to two ends of a MB probe (MB-TQ), were used as the

FRET pair (Figure 1(a)). The enhancement of Cy3 PL upon cleavage of the MB-

TQ probe by the enzyme was monitored as an indication of target amplification.

In format 2, QDs with green fluorescence and Cy3 were used as the FRET donor

and acceptor, respectively (Figure 1(b)). The release of Cy3 molecules from the

nanoparticle surfaces by the action of nuclease resulted in an increase in the

13

ratio of the maximum QD PL at 520 nm over the maximum Cy3 PL at 560 nm.

The amplification (%) resulting from formats 1 and 2 were calculated according to

Equations 1 & 2, respectively. Figure 2(a) shows the emission spectra and the

corresponding calibration curve obtained from EXO-assisted amplification using

MB-TQ probe at various concentrations of the target strand (TGT-1). Upon

addition of EXO, even in the absence of the target strands, there is an increase

in signal by a factor of 1.4 that is attributed to the residual exonuclease activity on

the unbound molecular beacon. A smaller residual activity was observed in Bbv-

assisted amplification, leading to a ~40% increase in signal (Figure S4). This

increase in signal in the control experiment was expected and has been

previously reported [31].

Figures 2(c) and 2(d) show the emission spectra and the corresponding

calibration curve, respectively, obtained using format 2 in which the MB-QDs

serve as the probes. It was observed that the residual exonuclease activity in the

presence of only the MB-QDs (i.e. at target concentration of 0 pM) caused about

20% enhancement in the signal associated with amplification. This result

indicated a 7-fold reduction in the residual exonuclease activity at QD surfaces

as compared to that in the bulk solution (i.e. as represented by the signal

enhancement of MB-QD and MB-TQ probes, respectively, in absence of target

strands). This lower exonuclease activity is attributed to improved limit-of-

detection (LOD) achieved using MB-QD in comparison to that using the MB-TQ

probe (4 pM vs. 45 pM, respectively).

14

Figure 1. Schematic of FRET-based monitoring of nuclease-assisted

amplification using (a) MB-TQ and (b) MB-QD probes.

The lower residual activity of EXO at a nanoparticle surface has been previously

ascribed to issues of steric hindrance, as well as the local salt concentration

being enhanced at the nanoparticle surface due to the dense packing of the

charged oligonucleotides [32,33]. Figure 3 shows the percent amplification

obtained using EXO and Bbv enzymes when the MB packing density on QDs

varied between a MB-to-QD ratio of 2.4 and 12.6. The amplification obtained

using EXO at MB-to-QD values of ≥7.4 was largely suppressed, while the

inhibition of Bbv enzyme occurred at a lower packing density (MB/QD of ≥5.5).

As an indication of local salt concentration at the NP surfaces, the Zeta potential

was determined for NPs coated at different packing densities (Figure 3). The

trend of Zeta potentials was toward more negative values with increasing packing

density. An enhancement of local ionic strength at densely packed NP surfaces

is expected, which may cause salt-induced enzyme inhibition [34]. The inhibition

of Bbv enzyme at lower packing densities compared to that of EXO may be due

15

to the larger steric hindrance encountered by the former enzyme, which is a large

protein with two subunits, each being of equal size to EXO [34,35]. Moreover,

Rush et al. reported that the activity of endonucleases were affected by steric

hindrance at highly packed NP surfaces to a larger extent than exonuclease III

[33].

Figure 2. EXO-assisted DNA amplification in the bulk phase. (a) and (b) show the

emission spectra and the corresponding calibration curves, respectively,

obtained using MB-TQ as the probe, (c) and (d) show the FRET spectra and the

corresponding calibration curves when MB-QD was used as the probe. Error

bars show the standard deviations of 3 replicates.

16

0 2 4 6 8 10 1205

101520253035404550

-32

-30

-28

-26

-24

-22

-20EXO IIINt.BbvCIZeta Potential

DNA/Nanoparticle

Am

plifi

catio

n %

Zeta

pot

entia

l (m

V)

Figure 3. Nuclease-assisted amplification at nanoparticle surfaces coated with

various packing densities of immobilized oligonucleotides. Error bars show the

standard deviations of 3 replicates.

3.2. Amplification in paper

A paper-based platform was used with reaction zones of 3 mm diameter being

confined via wax patterning of CHR-1 paper (Figure 4). The reactions in such

zones may occur in: bulk solution where excess liquid does not penetrate the

paper matrix (Setting 1 (S1) in Figure 4); in the solution-phase within the pores of

the paper matrix (S2); and on the surfaces of the fibers that confine the pores

(S3). CHR-1 substrates have a thickness of 0.18 mm and a porosity of 68% [36],

thus a paper zone contains 0.9 μL of void volume in its porous structure. When a

reaction mixture of ≤0.9 μL is spotted on the paper, the capillary action draws all

the solution into the paper matrix and the reactions occur entirely within the

paper matrix. Using larger reaction volumes results in a portion of the reaction

17

taking place in the bulk solution above the paper substrate. Reaction in the liquid

trapped in pores likely dominates within papers that offer weak surface

interactions with the enzyme/DNA, such as glass [23], CHR [25] and PES [26], or

when non-specific binding on fiber surfaces is ameliorated by implementation of

a blocking agent. The surface-phase reactions may become significant when

DNA probes are immobilized [17], or if there is high non-specific affinity for

adsorption of proteins and DNA, such as occurs when using FTA card [19] and

nitrocellulose papers [26]. Understanding the enzymatic reactions in these

different settings is significant to the design of paper-based amplification

methods.

Figure 4. Schematic showing different environmental settings for reactions in

paper substrates. S1, S2 and S3 represent the reactions in bulk phase above the

paper matrix, in the solution contained in pores, and on the surfaces of the fibers

of the paper, respectively.

18

A comparison of the extent of amplification from the various permutations is

shown in Figure 5. For reactions within pores, the reaction mixture (consisting of

QD-MB probe, the target and the enzyme) was added to unmodified CHR-1

substrates in the absence of any blocking agent. These substrates provided a

cellulosic structure with a low affinity for QDs (see Figure S5 where washing

removed QD-MBs from unmodified CHR-1), that allowed reactions to occur

primarily within the solution trapped in pores [37]. For surface reactions, the QD-

MB probes were added to imidazole-modified CHR-1 substrates prior to the

amplification step. The strong affinity of imidazole for QDs resulted in the

immobilization of QD-MBs on the cellulosic surface, forcing the reactions to occur

at a surface. Note that following the immobilization of QD-MB probes on the

imidazole-modified paper, the paper was washed to remove excess reagents and

to ensure that no free QD-MB remained for amplification by solution-phase

reaction.

To examine the potential contributions to amplification provided by reactions in

bulk solution, the reaction volumes were either 1 μL to fill all pores in a reaction

zone (similar to the 0.9 μL void volume of a reaction zone), or 5 μL (5 times

excess of the void volume, leaving substantial volume of reaction solution as a

bead above the surface of the paper). The amplification by the EXO- and Bbv

methods showed similar trends for the various permutations of reaction volume.

However, the Bbv method generally exhibited lower amplification, which was

consistent with the results obtained from reactions in bulk solution (Figure 3). An

amplification of 51% and 38% was obtained from the EXO and Bbv methods

19

using the 5 μL volumes of reaction solution, respectively, consistent with the

magnitude and the trend obtained for these enzyme reactions done in bulk

solution without any paper matrix (55% and 32% amplification, using 100 pM of

target strands (Fig 2), respectively). When the reactions were forced to occur

within the pores of the paper matrix (i.e. using 1 μL of reaction mixture and

unmodified CHR-1), the amplification was reduced to 28% and 21% for the EXO

and Bbv methods, respectively.

In comparison with the bulk solution reactions, the amplification associated with

the use of immobilized nanoparticles resulted in lower amplification that did not

vary significantly with different reaction volumes of 5 and 1 uL (~20% and 8% for

EXO and Bbv methods, respectively). The overall trend of amplification efficiency

(bulk phase > pore phase > surface phase) indicates an inhibitory effect on

amplification by confining the reactions within a paper matrix. Two primary

considerations that might explain the apparent inhibition of amplification in paper

are: (1) enzyme inactivation, and (2) reduced efficiency of target recycling.

A higher enzyme concentration can offset the apparent reduction of enzyme

activity in paper compared to bulk solution. As Figure 5(d) shows, the EXO-

assisted amplification signal within the liquids in pores reaches a plateau at an

enzyme concentration of 3.2 U/μL, which is 3-fold higher than the corresponding

value in the bulk solution.

20

Figure 5. Amplification in paper. (a) and (b) show optical images obtained from

paper-based amplification reactions on an unmodified CHR-1 paper and a CHR-

1 paper with immobilized MB-QD on the surface, respectively. N denotes the

paper spots where amplification buffer was added and ET denotes the spots

where amplification mixture (containing enzymes and target strands) were

added. (c) The histogram shows the amplification (%) obtained from images (a)

and (b). (d) shows amplification signals in bulk solution and in the liquid in pores

at different concentrations of EXO. All experiments were done using 200 nM of

QD-MB and 100 pM of target strands. Error bars show the standard deviations of

4 replicates.

21

3.3. The significance of surface chemistry

To further investigate the interactions of paper surfaces with the enzyme/DNA

and the impact of these interactions on enzymatic amplifications, a comparison

was done of the amplification obtained from different substrates including CHR-1,

GF/A, NC, DE-81. CHR-1 and GF/A are known to interact poorly with proteins

and oligonucleotides [37,38]. NC interacts strongly with proteins and weakly with

single-stranded oligonucleotides primarily by hydrophobic interactions [39]. DE-

81 is a cationic membrane that interacts strongly with oligonucleotides, as well as

with proteins containing any negatively-charged domains [40]. Some insight

about the impact of surface adsorption was derived by observing the effect of

blocking the surface with common agents such as BSA and salmon sperm DNA

(SSD). BSA is a globular protein that adsorbs to surfaces through various types

of interactions including hydrophobic, Van der Waals and ionic interactions [40],

while SSD is a DNA agent sheared to an average size of ≤2,000 bp and is

commonly used to prevent non-specific adsorption of nucleic acids. Figure 6(a)

and 6(b) show the amplification obtained from EXO and Bbv amplification

methods, respectively, using the various substrates and blocking agents. Without

a blocking agent, the relative magnitude of amplification is CHR-1>GF/A≥DE-

81>NC, which is consistent with the anticipated surface activity of the substrates.

The blocked substrates provided greater amplification, with the exception that the

Bbv method in DE-81 was more effective than GF/A. The amplification on NC

substrate was completely inhibited, while only partial inhibition was observed

22

using the DE-81 substrate. These observations are consistent with hydrophobic

interactions being more significant than electrostatic interactions.

Blocking the surfaces with BSA resulted in substantial enhancement of

amplification from all substrates for both the EXO and Bbv methods. The

effective blocking of the hydrophobic surface of NC by BSA suggests a

substantial role of hydrophobic interactions in enzyme inhibition. It is likely that

the negatively charged BSA molecules (isoelectric point of 5.4) also blocked the

cationic sites on DE-81 substrates that were responsible for the enhancement of

the amplification signal. In contrast, the SSD was only effective at blocking the

cationic sites on DE-81 substrate. On the basis of these results, it appears that

adsorption of the enzymes has a stronger inhibitory effect on the amplification

than the adsorption of oligonucleotides. Successful DNA amplification on the

substrates that are known to have a high affinity with nucleic acids such as the

FTA card and Whatman 903 paper [19,20] was consistent with the finding that

surface interactions of oligonucleotides did not significantly inhibit amplification.

23

Figure 6: Relative amplification by EXO (a) and Bbv (b) methods using different

substrates, with all reactions taking place in the liquids in pores. (c) and (d) show

the kinetic curves of amplification by the EXO method in paper substrates with

different pore sizes. The experiments were done in (c) liquids in pores, and (d) on

the imidazole-modified cellulose surface. All experiments were done using 200

nM of QD-MB and 100 pM of target strands. Error bars show the standard

deviations of 4 replicates.

3.4 The effect of pore sizes

A variety of paper substrates with different pore sizes are commercially available

and have previously been reported for DNA amplification [18,25,26,41]. It is

24

expected that the kinetics, as well as the efficiency of enzymatic reactions within

paper pores, will be affected by the size of the pores. The initial mass transfer of

reactants to the paper pores takes place via capillary action at a fast rate

(seconds). The subsequent processes that lead to the amplification (i.e. DNA

hybridization between target and probe, enzymatic cleavage of the probe and the

target release and recycling) are dependent on diffusion. Diffusion-based mass

transfer in unstirred solution is a slow process, and inter-pore transfers of

amplification components will be evenly more limited. Thus, it can be envisioned

as a first approximation that the amplification processes remain limited on

average within a single pore. This makes pore size a critical factor that affects

the extent of enzymatic amplification. The effect of the pore size on the kinetics

and efficiency of enzymatic amplification in paper substrates of similar chemical

structure was investigated. Figures 6(c) and 6(d) show the kinetic curves of

amplification reactions done in solution-phase and surface-phase for paper

substrates with pore sizes of 2.5, 6, 11, 100 μm diameter [42]. Table 1 shows the

characteristic rate constants calculated by fitting the curves to a first-order kinetic

model (see experimental section and Figures S6 and Figure S7). The rate of the

amplification for solution-phase reactions decreased proportionally with the pore

size, from 6.6 (± 0.6) × 10-2 min-1 for CHR-1 substrate (pore diameter of 100 μm)

to 4.5 (± 0.3) × 10-2 min-1 for FP-5 substrate (pore diameter of 2.5 μm). The rates

of the surface-phase amplifications exhibited an opposite trend, and increased

from 2.3 (± 0.3) × 10-2 min-1 to 6.4 (± 0.5) × 10-2 min-1 for substrates with pore

diameters of 100 μm and 2.5 μm, respectively. The latter trend is consistent with

25

the higher surface-to-volume ratio (SA/V) in smaller pores (Table 2). For

amplification where the MB-probes are immobilized on the pore surfaces, a

higher SA/V denotes a higher number of probe molecules available to the

enzyme/target strands, which is reflected in the increased rate of amplification.

An anomaly is that the FP-5 substrates (2.5 μm) reach a final amplification signal

of 26%, which is distinctly lower than the signals obtained from the other paper

substrates with larger pore sizes. This observation is consistent with our

calculation that the average target/pore ratio in 2.5 μm pores at the target

concentration of 100 pM is equal to ~0.5, and the data suggests that a significant

fraction of the pores receive no target strands. Given the large range of pore

sizes studied here, we speculate from these results that the amplification rate

and efficiency, at the range of pore diameters studied (>1 μm, commonly used

for fabrication of paper devices), are only moderately dependent on the pore

size.

Table 2: Kinetic rate constants of EXO-assisted amplifications in paper

substrates with different pore sizes.

Substrate Pore diameter (μm) a SA/V μm-1 b k’p /10-2 min-1 b k’s /10-2 min-1

CHR-1 100 0.06 c 6.6 ± 0.5c 2.3 ± 0.3FP-1 11 0.5 5.3 ± 0.2 2.9 ± 0.5FP-3 6 1 5.0 ± 0.2 3.8 ± 0.5FP-5 2.5 2.4 4.5 ± 0.3 6.4 ± 0.3

a SA/V represents the surface to volume ratios of the paper poresb k’p and k’s reperesent the characteristic rate constants obtained from curve fittings of solution-phase and surface-phase amplifications, respectively.c The errors reported are standard errors obtained from curve fitting.

26

3.5 The effect of oligonucleotide target length

Target recycling in nuclease-assisted amplification requires the target strand,

after enzymatic cleavage of a probe strand, to diffuse to the next probe and

undergo DNA hybridization. The rates of diffusion and hybridization processes

depend on the target length. Table 3 shows k’p and k’s values obtained from

amplification by the EXO method using target oligonucleotides of 30, 60 and 90-

mer length. The rate of both solution-phase and surface-phase amplifications

decreased as target length increased. However, the extent of reduction was

significantly greater for the surface-phase reactions. While k’p values decreased

by 17% and 30% when the 30-mer target was replaced with the 60-mer and 90-

mer strands, respectively, the corresponding k’s values decreased by 3-fold and

8-fold, respectively. The strong dependence of the surface-phase k’s values on

the target length suggests that diffusion across or within the boundary layer at

the pore surface plays an important role in the overall rate of amplification on

paper.

Table 3: Kinetic rate constants of amplification by the EXO method in CHR-1

paper substrates for target oligonucleotides of different lengths.

27

Target length a k’p /10-2 min-1 a k’s /10-2 min-1

30-mer b 6.6 ± 0.5c 2.3 ± 0.360-mer 5.5 ± 0.3 0.8 ± 0.190-mer 4.6 ± 0.3 0.3 ± 0.03

a k’p and k’s reperesent the characteristic rate constants obtained from curve fittings of solution-phase and surface-phase amplifications, respectively.b The errors reported are standard errors obtained from curve fitting.

4. Conclusions

This work has evaluated the significance of several factors that influence the

efficiency of nuclease-assisted DNA amplifications done in paper matrices. The

data suggests that interactions of enzymes with the paper matrix can lead to an

inhibition of the amplification in comparison to that observed to take place in bulk

solution. Thus, such interactions should be suppressed by using inert substrates

or by implementation of a protein blocking agent such as BSA. Similar levels of

sensitivity to adsorption of oligonucleotides to paper were not evident. Kinetic

studies showed that amplification rates are affected by pore size, and that

solution-phase and surface-phase amplification have opposing trends in relation

to pore size. A reduction of the amplification rate with increase in the

oligonucleotide target length was anticipated, but is significantly greater for

surface-phase as compared to the solution-phase amplifications, denoting the

significance of boundary diffusion in the amplification process. The information

reported in this work is particularly applicable to enzymatic target-recycling

amplification methods in various paper substrates, but also provides insights that

might be relevant to other enzymatic amplification methods in paper.

Acknowledgements

28

We are grateful to the Natural Sciences and Engineering Research Council of

Canada for financial support of this work (Grants STPGP 479222-15; RGPIN-

2014-04121).

References

[1] A. Nilghaz, L. Guan, W. Tan, W. Shen, Advances of paper-based

microfluidics for diagnostics - the original motivation and current status,

ACS Sensors 1 (2016) 1382-1393.

[2] A.W. Martinez, S.T. Phillips, G.M. Whitesides, E. Carrilho, Diagnostics for

the developing world: Microfluidic paper-based analytical devices, Anal.

Chem. 82 (2010) 3–10.

[3] Y. Yang, E. Noviana, M.P. Nguyen, B.J. Geiss, D.S. Dandy, C.S. Henry,

Paper-based microfluidic devices: emerging themes and applications, Anal.

Chem. 89 (2017) 71-91.

[4] E. Carrilho, A.W. Martinez, G.M. Whitesides, Understanding wax printing: a

simple micropatterning process for paper-based microfluidics, Anal. Chem.

81 (2009) 7091–7095.

[5] A.M. López-Marzo, A. Merkoçi, Paper-based sensors and assays: a

success of the engineering design and the convergence of knowledge

29

areas, Lab Chip 16 (2016) 3150-3176.

[6] A.W. Martinez, S.T. Phillips, M.J. Butte, G.M. Whitesides, Patterned paper

as a platform for inexpensive, low-volume, portable bioassays, Angew.

Chemie - Int. Ed. 46 (2007) 1318–1320.

[7] Y. Du, S. Dong, Nucleic acid biosensors: recent advances and

perspectives, Anal. Chem. 89 (2017) 189–215.

[8] M.O. Noor, U.J. Krull, Camera-based ratiometric fluorescence transduction

of nucleic acid hybridization with reagentless signal amplification on a

paper-based platform using immobilized quantum dots as donors, Anal.

Chem. 86 (2014) 10331–10339.

[9] H. Li, X. Fang, H. Cao, J. Kong, Paper-based fluorescence resonance

energy transfer assay for directly detecting nucleic acids and proteins,

Biosens. Bioelectron. 80 (2016) 79–83.

[10] S. Doughan, U. Uddayasankar, U.J. Krull, A paper-based resonance

energy transfer nucleic acid hybridization assay using upconversion

nanoparticles as donors and quantum dots as acceptors, Anal. Chim. Acta

878 (2015) 1-8.

[11] M.O. Noor, U.J. Krull, Paper-based solid-phase multiplexed nucleic acid

hybridization assay with tunable dynamic range using immobilized

quantum dots as donors in fluorescence resonance energy transfer, Anal.

Chem. 85 (2013) 7502-7511.

[12] X. Li, K. Scida, R.M. Crooks, Detection of Hepatitis B virus DNA with a

paper electrochemical sensor, Anal. Chem. 87 (2015) 9009–9015.

30

[13] F. Liu, C. Zhang, A novel paper-based microfluidic enhanced

chemiluminescence biosensor for facile, reliable and highly-sensitive gene

detection of Listeria monocytogenes, Sensors Actuators, B Chem. 209

(2015) 399–406.

[14] K. Yamada, H. Shibata, K. Suzuki, D. Citterio, Toward practical application

of paper-based microfluidics for medical diagnostics: state-of-the-art and

challenges, Lab Chip 17 (2017) 1206–1249.

[15] M. Safavieh, V. Kaul, S. Khetani, A. Singh, K. Dhingra, M.K.

Kanakasabapathy, M.S. Draz, A. Memic, D.R. Kuritzkes, H. Shafiee, Paper

microchip with a graphene-modified silver nano-composite electrode for

electrical sensing of microbial pathogens, Nanoscale 9 (2017) 1852-1861.

[16] S.O. Kelley, What are clinically relevant levels of cellular and biomolecular

analytes?, ACS Sensors 2 (2016) 193-197.

[17] M. Liu, C,Y. Hui, Q. Zhang, J. Gu, B. Kannan, S. Jahanshahi-Anbuhi,

C.D.M. Filipe, J.D. Brennan, Y. Li, Target-induced and equipment-free

DNA amplification with a simple paper device, Angew. Chemie - Int. Ed. 55

(2016) 2709–2713.

[18] J.R. Choi, J. Hu, R. Tang, Y. Gong, S. Feng, H. Ren, T. Wen, X.J. Li,

W.A.B. Wan Abas, B. Pingguan-Murphy, F. Xu, An integrated paper-based

sample-to-answer biosensor for nucleic acid testing at the point of care,

Lab Chip 16 (2016) 611–621.

[19] J.T. Connelly, J.P. Rolland, G.M. Whitesides, "Paper Machine" for

molecular diagnostics, Anal. Chem. 87 (2015) 7595–7601.

31

[20] W. Gan, B. Zhuang, P. Zhang, J. Han, C. Li, P. Liu, A filter paper-based

microdevice for low-cost, rapid, and automated DNA extraction and

amplification from diverse sample types, Lab Chip 14 (2014) 3719-3728.

[21] L. Lafleur, J.D. Bishop, E.K. Heiniger, R.P. Gallagher, M.D. Wheeler, P.C.

Kauffman, X. Zhang, E. Kline, J. Buser, S. Ramachandran, S. Byrnes, N.

Vermeulen, N. Scarr, Y. Belousov, W. Mahoney, B.J. Toley, P.D. Ladd, B.

Lutz, P. Yager, A rapid, instrument-free, sample-to-result nucleic acid

amplification test, Lab Chip 16 (2016) 3777–3787.

[22] M. Dou, D.C. Dominguez, X. Li, J. Sanchez, G. Scott, A versatile

PDMS/paper hybrid microfluidic platform for sensitive infectious disease

diagnosis, Anal. Chem. 86 (2014) 7978–7986.

[23] R. Tang, H. Yang, Y. Gong, M. You, Z. Liu, J.R. Choi, T. Wen, Z. Qu, Q.

Mei, F. Xu, A fully disposable and integrated paper-based device for

nucleic acid extraction, amplification and detection, Lab Chip 17 (2017)

1270–1279.

[24] G. Da Cunha Santos, N. Liu, M.S. Tsao, S. Kamel-Reid, K. Chin, W.R.

Geddie, Detection of EGFR and KRAS mutations in fine-needle aspirates

stored on whatman FTA cards: is this the tool for biobanking cytological

samples in the molecular era?, Cancer Cytopathol. 118 (2010) 450–456.

[25] B.A. Rohrman, R.R. Richards-Kortum, A paper and plastic device for

performing recombinase polymerase amplification of HIV DNA, Lab Chip

12 (2012) 3082-3088.

[26] J.C. Linnes, N.M. Rodriguez, L. Liu, C.M. Klapperich, Polyethersulfone

32

improves isothermal nucleic acid amplification compared to current paper-

based diagnostics, Biomed. Microdevices 18 (2016) 1–12.

[27] Y.V. Gerasimova, D.M. Kolpashchikov, Enzyme-assisted target recycling

(EATR) for nucleic acid detection, Chem Soc Rev 43 (2014) 6405–6438.

[28] M.O. Noor, D. Hrovat, M. Moazami-Goudarzi, G.S. Espie, U.J. Krull,

Ratiometric fluorescence transduction by hybridization after isothermal

amplification for determination of zeptomole quantities of oligonucleotide

biomarkers with a paper-based platform and camera-based detection,

Anal. Chim. Acta 885 (2015) 156-165.

[29] M.O. Noor, A. Shahmuradyan, U.J. Krull, Paper-based solid-phase nucleic

acid hybridization assay using immobilized quantum dots as donors in

fluorescence resonance energy transfer, Anal. Chem. 85 (2013) 1860-

1867.

[30] A. Sedighi, U.J. Krull, Rapid immobilization of oligonucleotides at high

density on semiconductor quantum dots and gold nanoparticles, Langmuir

32 (2016) 13500–13509.

[31] X. Zuo, F. Xia, Y. Xiao, K.W. Plaxco, Sensitive and selective amplified

fluorescence DNA detection based on exonuclease III-aided target

recycling, J. Am. Chem. Soc. 132 (2010) 1816–1818.

[32] D.A. Giljohann, D.S. Seferos, A.E. Prigodich, P.C. Patel, C.A. Mirkin, Gene

regulation with polyvalent siRNA-nanoparticle conjugates, J. Am. Chem.

Soc. 131 (2009) 2072–2073.

[33] A.M. Rush, M.P. Thompson, E.T. Tatro, N.C. Gianneschi, Nuclease-

33

resistant DNA via high-density packing in polymeric micellar nanoparticle

coronas, ACS Nano 7 (2013) 1379–1387.

[34] D.F. Heiter, K.D. Lunnen, G.G. Wilson, Site-specific DNA-nicking mutants

of the heterodimeric restriction endonuclease R.BbvCI, J. Mol. Biol. 348

(2005) 631–640.

[35] C.D. Mol, C.F. Kuo, M.M. Thayer, R.P. Cunningham, J.A. Tainer, Structure

and function of the multifunctional DNA-repair enzyme exonuclease III,

Nature 374 (1995) 381–386.

[36] M.N. Costa, B. Veigas, J.M. Jacob, D.S. Santos, J. Gomes, P.V. Baptista,

R. Martins, J. Inácio, E. Fortunato, A low cost, safe, disposable, rapid and

self-sustainable paper-based platform for diagnostic testing: lab-on-paper,

Nanotechnology 25 (2014) 094006.

[37] A. Yu, J. Shang, F. Cheng, B.A. Paik, J.M. Kaplan, R.B. Andrade, D.M.

Ratner, Biofunctional paper via the covalent modification of cellulose,

Langmuir 28 (2012) 11265-11273.

[38] C. Eckerskorn, W. Mewes, H. Goretzki, F. Lottspeich, A new siliconized‐

glass fiber as support for protein‐chemical analysis of electroblotted

proteins, Eur. J. Biochem. 176 (1988) 509-519.

[39] C.J. Van Oss, R.J. Good, M.K. Chaudhury, Mechanism of DNA (southern)

and protein (western) blotting on cellulose nitrate and other membranes, J.

Chromatograph. A 391 (1987) 53–65.

[40] H.T.M. Phan, S. Bartelt-Hunt, K.B. Rodenhausen, M. Schubert, J.C. Bartz,

Investigation of bovine serum albumin (BSA) attachment onto self-

34

assembled monolayers (SAMs) using combinatorial quartz crystal

microbalance with dissipation (QCM-D) and spectroscopic ellipsometry

(SE), PLoS One 10 (2015) 0141282.

[41] N.M. Rodriguez, W.S. Wong, L. Liu, R. Dewar, C.M. Klapperich, A fully

integrated paperfluidic molecular diagnostic chip for the extraction,

amplification, and detection of nucleic acids from clinical samples, Lab

Chip 16 (2016) 753–763.

[42] S.C. Fernandes, J.A. Walz, D.J. Wilson, J.C. Brooks, C.R. Mace, Beyond

wicking: expanding the role of patterned paper as the foundation for an

analytical platform, Anal. Chem. 89 (2017) 5654-5664.

35

Figure Captions:

Figure 1. Schematic of FRET-based monitoring of nuclease-assisted

amplification using (a) MB-TQ and (b) MB-QD probes.

Figure 2. EXO-assisted DNA amplification in the bulk phase. (a) and (b) show the

emission spectra and the corresponding calibration curves, respectively,

obtained using MB-TQ as the probe, (c) and (d) show the FRET spectra and the

corresponding calibration curves when MB-QD was used as the probe. Error

bars show the standard deviations of 3 replicates.

Figure 3. Nuclease-assisted amplification at nanoparticle surfaces coated with

various packing densities of immobilized oligonucleotides. Error bars show the

standard deviations of 3 replicates.

Figure 4. Schematic showing different environmental settings for reactions in

paper substrates. S1, S2 and S3 represent the reactions in bulk phase above the

paper matrix, in the solution contained in pores, and on the surfaces of the fibers

of the paper, respectively.

Figure 5. Amplification in paper. (a) and (b) show optical images obtained from

paper-based amplification reactions on an unmodified CHR-1 paper and a CHR-

1 paper with immobilized MB-QD on the surface, respectively. N denotes the

36

paper spots where amplification buffer was added and ET denotes the spots

where amplification mixture (containing enzymes and target strands) were

added. (c) The histogram shows the amplification (%) obtained from images (a)

and (b). (d) shows amplification signals in bulk solution and in the liquid in pores

at different concentrations of EXO. All experiments were done using 200 nM of

QD-MB and 100 pM of target strands. Error bars show the standard deviations of

4 replicates.

Figure 6: Relative amplification by EXO (a) and Bbv (b) methods using different

substrates, with all reactions taking place in the liquids in pores. (c) and (d) show

the kinetic curves of amplification by the EXO method in paper substrates with

different pore sizes. The experiments were done in (c) liquids in pores, and (d) on

the imidazole-modified cellulose surface. All experiments were done using 200

nM of QD-MB and 100 pM of target strands. Error bars show the standard

deviations of 4 replicates.

37