+ All Categories
Home > Documents > Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject:...

Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject:...

Date post: 30-Dec-2020
Category:
Upload: others
View: 1 times
Download: 0 times
Share this document with a friend
27
Eric Green, M.D., Ph.D. Director, NHGRI Welcome and Setting a Context
Transcript
Page 1: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Eric Green, M.D., Ph.D. Director, NHGRI

Welcome and Setting a Context

Page 2: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Past Future

Genomics Landscape

Present

Page 3: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Human Genome Project Begins

October, 1990

Human Genome Project

Page 4: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Model Organisms

Multicellular Biology

Unicellular Biology

Human Biology

Mammalian Biology

500 Myr

80 Myr

1,000 Myr

Page 5: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Nature 387:1-105, 1997

First Eukaryotic Genome Sequence

Page 6: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Science 282:1012-2018, 1998

First Animal Genome Sequence

Page 7: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Science 287:2185-2195, 2000

Second Animal Genome Sequence

Page 8: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Draft Human Genome Sequence Published

First Mammalian Genome Sequence

Page 9: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Nature 420:520-562, 2002

Second Mammalian Genome Sequence

Page 10: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Human Genome Project Ends

April, 2003

Page 11: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Myriad Applications of Genomics

Health, Disease, & Medicine

Page 12: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Genomic Medicine

Healthcare tailored to the individual based on genomic information

Page 13: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Base Pairs to Bedside

Helix to Health

Nature

2003

Page 14: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Function of the Human Genome Sequence

Page 15: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

The ENCODE Portfolio: Elucidating Genome Function

Page 16: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project
Page 17: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

TGCCGCGGAACTTTTCGGCTCTCTAAGGCTGTATTTTGATATACGAAAGGCACATTTTCCTTCCCTTTTCAAAATGCACCTTGCAAACGTAACAGGAACCCGACTAGGATCATCGGGAAAAGGAGGAGGAGGAGGAAGGCAGGCTCCGGGGAAGCTGGTGGCAGCGGGTCCTGGGTCTGGCGGACCCTGACGCGAAGGAGGGTCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGCCGGTGGCTTCTTCTGTCCTCCAGCGTTGCCAACTGGACCTAAAGAGAGGCCGCGACTGTCGCCCACCTGCGGGATGGGCCTGGTGCTGGGCGGTAAGGACACGGACCTGGAAGGAGCGCGCGCGAGGGAGGGAGGCTGGGAGTCAGAATCGGGAAAGGGAGGTGCGGGGCGGCGAGGGAGCGAAGGAGGAGAGGAGGAAGGAGCGGGAGGGGTGCTGGCGGGGGTGCGTAGTGGGTGGAGAAAGCCGCTAGAGCAAATTTGGGGCCGGACCAGGCAGCACTCGGCTTTTAACCTGGGCAGTGAAGGCGGGGGAAAGAGCAAAAGGAAGGGGTGGTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGGTGAGAAGGTGGCCAACCGAGCTTCGGAAAGACACGTGCCCACGAAAGAGGAGGGCGTGTGTATGGGTTGGGTTTGGGGTAAAGGAATAAGCAGTTTTTAAAAAGATGCGCTATCATTCATTGTTTTGAAAGAAAATGTGGGTATTGTAGAATAAAACAGAAAGCATTAAGAAGAGATGGAAGAATGAACTGAAGCTGATTGAATAGAGAGCCACATCTACTTGCAACTGAAAAGTTAGAATCTCAAGACTCAAGTACGCTACTATGCACTTGTTTTATTTCATTTTTCTAAGAAACTAAAAATACTTGTTAATAAGTACCTAAGTATGGTTTATTGGTTTTCCCCCTTCATGCCTTGGACACTTGATTGTCTTCTTGGCACATACAGGTGCCATGCCTGCATATAGTAAGTGCTCAGAAAACATTTCTTGACTGAATTCAGCCAACAAAAATTTTGGGGTAGGTAGAAAATATATGCTTAAAGTATTTATTGTTATGAGACTGGATATATCTAGTATTTGTCACAGGTAAATGATTCTTCAAAAATTGAAAGCAAATTTGTTGAAATATTTATTTTGAAAAAAGTTACTTCACAAGCTATAAATTTTAAAAGCCATAGGAATAGATACCGAAGTTATATCCAACTGACATTTA

The Human Genome Sequence

Page 18: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Nature Nature

2003 2011

Page 19: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

New NHGRI Vision for Genomics Published

genome.gov/sp2011

February, 2011

Page 20: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Five Domains of Genomics Research

Page 21: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Alternate Routes Among Domains

Page 22: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Understanding the Structure of

Genomes

Understanding the Biology of

Genomes

Understanding the Biology of

Disease

Advancing the Science of

Medicine

Improving the Effectiveness of Healthcare

1990-2003 Human Genome Project

2004-2010

2011-2020

Beyond 2020

Genomic Accomplishments Across Domains

Page 23: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Sequencing a Human Genome

HGP (1st Sequence) Today

~6-8 years ~2-3 days

~$1B ~$4-8K

Immediate Post-HGP

~3-4 months

~$10-50M

Page 24: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project
Page 25: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Continued Key Role of Model Systems

Page 26: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Caroline Kelly Mike Pazin Leslie Adams Elise Feingold Kurd Ali Jory Barone

Special Thanks!

Page 27: Welcome and Setting a Context - Genome.govWelcome and Opening Remarks Author: Eric Green Subject: Genomics of model organisms and human biology: Insights from the modENCODE Project

Improving human health through genomics research


Recommended