+ All Categories
Home > Documents > WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and...

WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and...

Date post: 12-Jan-2016
Category:
Upload: violet-burns
View: 215 times
Download: 0 times
Share this document with a friend
Popular Tags:
153
WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology
Transcript
Page 1: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

WELCOME!

Take any seat!We will have assigned seats tomorrow.

Mr. Baker Rm. 107E

toAnatomy and

Physiology

Page 2: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

any student with schedule issues can see a counselor in room 193

• Schedule issues are:1. I have a hole in my schedule2. I am scheduled in a course I have already taken

and passed3. I failed the pre-requisite course

• Schedule issues are not: 1. I don't want this class anymore.2. I don't want to be in this teacher's class.

Page 3: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Classroom Mechanics

Page 4: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Randomizers• Paperwork Flow• Assignment types• Syllabus• Letters Home• Dissections

Page 5: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

TARDY POLICY

Page 6: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Your butt is in your seat by the time the bell finishes ringing.

What is considered on-time?

http://workoutsforhome.com/wp-content/uploads/2012/02/thumbs_up_large.png

Page 7: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Please take a moment to locate your Butt and Your Seat

http://www.totallygeeze.com/2012/04/glutesignoring-them-is-more-than-pain.html http://www.seatingzone.com/products/thumbs/3700BR_thumb_522.jpg

&

Page 8: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

If the bell rings and you are:• Just entering the room.• Walking to your seat.• Near but NOT in your seat.• Sharpening your pencil.• In someone else’s seat.• ANYTHING other than sitting PROPERLY in YOUR seat.

http://blogs.discovery.com/.a/6a00d8341bf67c53ef0147e386287a970b-800wi

What is considered “tardy”?

Page 9: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm-Ups

• Most days we will have them. You will have 3 minutes from the start of class to complete them.

• They will mostly be a review of the material we covered the previous day.

• These will be useful for you to study with.• I will spot check this for a weekly grade.

Page 10: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Intro to Anatomy & Physiology

Page 11: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

What is this class about?

• Write down a description or definition of Anatomy

• Write down a description or definition of Physiology.

• Take about 1 min.

Page 12: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Introduce yourself to a person near by.

• Compare your answers!• Are they similar? Different? Who has a better

description.• Come to an agreement on a final definition for

each.• Take 1 min.

Page 13: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Share!

• What were your descriptions?

Page 14: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

http://www.umm.edu/graphics/images/en/15845.jpg

Anatomy: the study of the structure of body parts and their relationships to one another

Anatomy vs. Physiology

Page 15: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

http://www.pinktentacle.com/images/anatomy_godzilla.jpg

Anatomy vs. Physiology

Anatomy:Naming and describing the shape and location of a structure.

You can talk about the Anatomy of just about anything.

Page 16: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Gross/Macroscopic: Large easily observable structures.– i.e. The heart, Bones

• Microscopic anatomy: Structures requiring a microscope or magnifying device to see– i.e. Tissues, Cells

Topics in Anatomy

Page 17: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Physiology: the functioning of the body’s structural machinery (how the body parts work and sustain life)

Anatomy vs.

Physiology

http://www.uml.edu/SHE/PT/Programs/Exercise-Physiology.aspx

Page 18: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Structure determines what functions can take place!

Anatomy/Physiology are inseparable

Page 19: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Understanding the shape and structure of something can tell you something about how it functions!

Page 20: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

So why are you taking this course?

• Find a new partner and introduce yourself!• Get to know their name.• Why they are taking the course.• What do they plan to do with the information

they get here?

• Take 3 minutes.

Page 21: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Introductions!

Page 22: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Body Outline Sheet.

Page 23: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm-Up 1/21/15

1. What is anatomy?2. What is physiology?3. How much of your grade are tests worth?

Page 24: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 25: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Levels of Structural Organization• Chemical level- Atoms combine to form

molecules such as water, sugar, and protein.

Page 26: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Levels of Structural Organization• Cellular level- Cells, the smallest unit of all

living things.

Page 27: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Levels of Structural Organization• Histological level- Simple organisms can be

single cells. Complex organisms such as humans have tissues. Groups of similar cells that have a common function. 4 Basic types.

Page 28: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Levels of Structural Organization• Organ level- Composed of two or more tissue

types that performs a specific function. Allows for extremely complex processes.

Page 29: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Levels of Structural Organization• Organ system level- Groups of organs that

cooperate to accomplish a common purpose.

Page 30: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Subdivisions based upon the operations of specific organ systems

• Examples:– Renal physiology (urine production and kidney

function) – Neurophysiology (nervous system)– Cardiovascular physiology (operation of heart and

blood vessels)

Topics in Physiology

Page 31: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

System Functions

Page 32: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• provides a protective barrier for the body, contains sensory receptors for pain, touch, temperature!

Integumentary System

Page 33: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• protects major organs, provides levers and support for body movement

• Blood cells formed within bones

Skeletal System

Page 34: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Moves bones and maintains posture!

• PRODUCES HEAT

Muscular System

Page 35: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Processes sensory information and initiates reactions.

Nervous System

Page 36: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• SECRETES HORMONES THAT REGULATE GROWTH, REPRODUCTION, AND METABOLISM

Endocrine System

Page 37: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Transports nutrients, chemical messengers, gases and wastes in blood!

Cardiovascular System

Page 38: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Returns fluid to cardiovascular system, detects, filters, and eliminates disease causing organisms!

Lymphatic System

Page 39: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Adds oxygen to the blood and removes carbon dioxide from blood.

Respiratory System

Page 40: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Breaks down food into units that can be absorbed by the body

Digestive System

Page 41: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Removes wastes, maintains body fluid volume, pH and electrolyte levels.

Urinary/Excretory System

Page 42: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• PRODUCES SEX CELLS AND HORMONES

Reproductive System

Male

Female

Page 43: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Review Chart as Class

Page 44: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

System Failure

• Gave 20 min to complete the chart. About 80% were finished at end.

• Didn’t do system failure discussion. Didn’t have time. Keep a note as a time filler in the future on this unit.

Page 45: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

What would happen if these systems stop working?

• Address each system and discuss the physiological result if the system were to not function.

• Link this to the idea that they all have to work together to keep an individual alive and maintain homeostasis.

Page 46: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Cards

Page 47: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Card sortingHand them a sheet to fill out. Function.

And Organs involvedIdentifying organs (use book)

Review as class

Page 48: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Card Sorting activity working with a partner. Turn around.

Have 5 min.Then review as class.

• This is actually good because the descriptions are not verbatim. So the need to understand the functionality to do this well.

• Then have them Identify the organs associated with each system in their book.

Page 49: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Integumentary• Skeletal • Muscular• Lymphatic• Circulatory• Respiratory

•Nervous•Endocrine•Digestive•Urinary•Reproductive

Page 50: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Schedule• Video is it anatomy or physiology?• Review organs in systems• Homeostasis• Muscleman.• Recap.• If time do card sorting or name game.

Page 51: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm-Up 1/22/15

1. What would happen if your urinary system stopped working?

2. What functions are associated with lymphatic system?

3. What is an organ?

Page 52: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

ANATOMY & PHYSIOLOGY

Page 53: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Maintaining Life

http://marketmatch.blogspot.com/2012/04/6-degrees-of-kevin-bacon.html

Our body requires interdependence of all body cells. No organ works in isolation. All organs work together to promote the well-being of the entire body

Each organ systems make major contributions to specific functional processes…

Page 54: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Homeostasis• Ability to maintain a relatively stable internal

conditions even though the outside world is continuously changes. The word roughly translates to “unchanging”.– Homeo- The same or similar– Stasis = Standing still

Is “unchanging” a good term for life? Why or why not?

Page 55: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Dynamic equilibrium

• Homeostasis is better described as a dynamic equilibrium.

• Internal conditions will change and vary, but always within relatively narrow limits.

• What are some ways your body maintains homeostasis?• How does it do this?• What occurs when your body cannot maintain

homeostasis?

Page 56: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Homeostatic Control Mechanisms

• Communication is key!• Nervous system and endocrine systems are

critical!• Use electrical and blood-borne hormones,

respectively as information carriers.• But all homeostatic control mechanisms have

at least three components.

Page 57: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Receptor: Type of sensor that monitors and responds to changes in the environment, called stimuli, by sending information (input) to the control center.

• Information flowing from the receptor to the control center is known as the afferent pathway.

Homeostatic Control Mechanisms

Page 58: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Homeostatic Control Mechanisms

• Control center determines the level (set point) at which a variable (the factor or event being regulated) is to be maintained.

• Analyses information received and determines response.

Page 59: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Homeostatic Control Mechanisms

• Effector provides the means for the control center’s response (output) to the stimulus.

• Information flowing from control center to the effector is the efferent pathway.

• The results of the response then feedback to influence the stimuli either shutting it off, or speeding it up.

Page 60: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Feedback Mechanisms

• Most homeostatic control mechanism are negative feedback mechanisms. They try to shut off or reduce the intensity of the original stimulus.– Example: A thermostat in your house!– You have a thermostat in your body. In the

hypothalamus. Triggers fevers and sweating.

Page 61: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Feedback Mechanisms

• Positive feedback tries to increase the original disturbance and push the variable farther from the original point. Relatively rare in the body.– Examples: Microphone feedback– Blood clotting, contractions during labor.

Page 62: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• ReceptorControl Center: afferent pathway• Control CenterEffector: efferent pathway

Pathways

Page 63: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Muscleman Case Study

• What is a testable hypothesis?• How do you design an experiment? What are

the parts?

Page 64: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Groups of 2-3• Complete on separate sheet of paper, answer

in complete sentences, ensure that all group member’s names are on the paper.

Page 65: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm-Up 1/26

1. What are the three parts of a feedback loop?2. What is homeostasis? Why is it important?3. What is the difference between positive and

negative feedback loops?

Agenda:Warm-upVideoMuscleman Case study

Page 66: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm Up 1/27/15

1. What is Trenbalone?2. Testicular shrinkage due to Trenbalone

administration is an example of what type of feedback?

3. Testicular shrinkage due to Trenbalone is due to its DIRECT interaction with what structures?

Page 67: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

The Language of Anatomy

Page 68: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

If I told you to drive to the intersection and take a left. Which direction would you go?

Page 69: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• To limit confusion, correct anatomical position is always assumed regardless of the position a person is currently in. This gives us a reference point.

Page 70: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Correct Anatomical Position

• Standing erect, facing directly forward, feet pointed forward and slightly apart, and arms hanging down at the sides with palms facing forward.

• Note: when talking about right/left, you are talking about the patients right or left side, not your own.

Page 71: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Directional Terms• Used to explain exactly where one body structure is

in relation to another. Allows for more effective communication.

Page 72: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Describes the location of one part of the body in relation to another.

Relative Positions

Page 73: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Superior (cranial): Toward the hear end or upper part of a structure or the body; above.

• Inferior (Caudal): Away from the hear end or toward the lower part of a structure or the body; below.

Page 74: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Anterior (ventral): Toward the front of the body; in front of

• Posterior (dorsal): Toward the backside of the body; behind

Page 75: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Medial: toward the midline of the body; on the inner side of

• Lateral: away from the midline of the body; on the outer side of

• Intermediate: Between a more medial and a more lateral structure.

Page 76: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Proximal: closer to the point of attachment to the trunk

• Distal: farther from the point of attachment to the trunk

Page 77: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Superficial: toward or at the body surface

• Deep: away from the body surface; more internal

Page 78: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Masking Tape ActivityAnd Horror Story.

Page 79: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 80: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm-Up 1/28/15

1. Name a structure distal to the knee.2. Name a region inferior to the sural region.3. What is a region medial of the axillary

region?

Page 81: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Body planes and sections - cut into sections along a flat surface called a plane

(also called XS – cross section)

(also called coronal)

Page 82: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Body planes

• Body is 3D

• Can be split into three planes

• Sagittal• Coronal• Transverse

Page 83: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Sagittal Plane

• Plane splitting the body into two parts (left and right)

• Sagittal section is a cut made longitudinally along the body

• If it splits into two equal parts = midsagittal

Page 84: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Coronal Plane

• Plane which splits body into anterior and posterior section

• Ie. Facelift

Page 85: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Transverse Plane• Separates body along

horizontal plane

• Also called a cross section

• Will divide an organism into superior and inferior parts

Page 86: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Body Cavities

Page 87: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

http://en.wikipedia.org/wiki/File:Scheme_body_cavities-en.svg

Cavities

• Opening within body which protects internal organs, and allows transfer of materials/information

• 2 Divisions– Dorsal– Ventral

Page 88: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Dorsal Cavities

• Made up of two smaller cavities

• 1) Cranial Cavity – holds and protects brain

• 2) Spinal Cavity – column which runs through vertebra and protects spinal chord

Page 89: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Ventral Cavities Thoracic Abdominopelvic

Page 90: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Ventral Cavities

1) Thoracic – chest area (holds heart, lungs, and diaphragm)

2) Abdominopelvic – lower torso (holds digestive and reproductive organs)

Page 91: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 92: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Bovine Pleural Cavity Collapsed Lung in Pleural Cavity

Pleural cavity is the space containing the lungs

Pleural cavity

Page 93: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Mediastinum Space in the thoracic cavity between the pleural cavities.Contains the pericardial cavity which contains the heart.

Page 94: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Pericardial Cavity

Page 95: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Abdominopelvic

• Contains:• Abdominal cavity• Pelvic cavity

Page 96: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Imaging Technology Reading And TableReview as class.

What's in the MRIMRI safety.

Page 97: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Short StoryIncorporate the following terms into a story describing your

describing your worst nightmare.Underline the term(s) in the story.

• Superior• Inferior• Anterior• Abdominal Cavity• Dorsal• Pelvic Cavity• Medial• Oral Cavity• Lateral

• Proximal• Distal• Superficial• Deep• Skeletal System• Cardiovascular System

Page 98: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm Up 1/29

1. What body cavity contains the brain?2. What cavity contains the heart?3. In what cavity would you find the intestines?

Unit 1 Test Next Friday.

Page 99: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

What Body Plane are these in?

Page 100: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 101: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• We are composed of matter. Energy is the mover of all matter.

• Energy: the capacity to do work. Can be stored or in action– Kinetic: energy in motion– Potential: stored or inactive energy

Basic Chemistry

Page 102: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Chemical: stored in bonds (ATP)• Electrical: movement of charged particles• Mechanical: moving matter• Radiant/Electromagnetic: travels in waves

Forms of energy

Page 103: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Atomic Structure

•Atoms are made up of 3 subatomic particles:

•Protons: positive charge•Neutrons: neutral charge•Electrons: negative charge

Page 104: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Most atoms combine with other atoms to form a molecule. Molecules can be a combination of the same atoms or different atoms

Combining atoms

Page 105: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Result of atoms sharing electrons.

• Stable and Strong.

Covalent Bonds

Page 106: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Slightly positive charge on Hydrogen bound to other atoms is attracted to negative charge on another atom.

• Relatively weak.• Holds water molecules together.

Hydrogen Bonds

Page 107: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Chemical reactions involve making and breaking bonds between atoms.

• Number of atoms remain the same but appear in new combinations.

Page 108: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Reaction types• Synthesis- When two or more atoms or molecules

combine to forma a larger more complex molecule.– A + B => AB– Bonds formed– Anabolic (constructive)– Requires energy

Page 109: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Reaction types• Decomposition- when a molecule is broken down

into smaller molecules or atoms.– AB => A + B– Bonds broken– Catabolic (destructive)– Energy released

Page 110: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Reaction types• Exchange reaction- involve both synthesis and

decomposition. – AB + C => A + BC– AB + CD => AD + CB– Bonds formed and broken

Page 111: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Webquest

Page 112: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm-Up 1/30

1. What type of bonds are stronger, hydrogen or covalent?

2. Where do humans gain potential chemical energy from?

3. What type of reaction is the most important, catabolic or anabolic?

Page 113: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Found as long carbon chains• 4 main types (called macromolecules)

– Carbohydrates– Lipids– Proteins– Nucleic Acids

Organic Compounds

Page 114: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Macromolecule Types

Monomer Polymer

Page 115: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Sugars and Starches• Made of C, H, O• Generally contain H:O ratio of 2:1, same as

water.• Hydrated Carbon• C6H12O6

Carbohydrates

Page 116: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Types classified according to size:–Monosaccharide–Disaccharide–Polysaccharide

Page 117: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Monosaccharide: one sugar unit• Simple sugar• Composed of 5-7 carbon atoms• Glucose (blood sugar) most important type. Other

sugar types are converted to glucose before the body can use them.– Examples:

• Fructose• Galactose• Ribose• Deoxyribose

Carbohydrates

glucose

Page 118: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Dissacharide: two sugar unit–Example:

• Maltose (glucose + glucose)• Sucrose (glucose + fructose)• Lactose (glucose + galactose)

Carbohydrates

glucoseglucose

Page 119: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Polysaccharide: many sugar units– Example: – Starch (glucose storage in plants)– Glycogen (animal starch in muscles and liver)

Carbohydrates

glucoseglucose

glucoseglucose

glucoseglucose

glucoseglucose

Page 120: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• All lipids are insoluble in water.

• Contain C, H, O• Types:

–Triglycerides–Phospholipids–Steroids

Lipids

Page 121: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Composed of 1 glycerol and 3 fatty acids• Body’s most concentrated source of usable energy.

Triglycerides

H

H-C----O

H-C----O

H-C----O

H

glycerol

O

C-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH3

=

O

C-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH3

=

fatty acidsO

C-CH2-CH2-CH2-CH =CH-CH2 -CH

2 -CH2 -CH

2 -CH3

=

Page 122: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Saturated fatty acids: single bonds; solid at room temperature

• Unsaturated fatty acids: double bonds; liquid at room temperature

Fatty Acids

O

C-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH2-CH3

=

saturated

O

C-CH2-CH2-CH2-CH=CH-CH2 -CH

2-CH2 -CH

2 -CH3

=

unsaturated

Page 123: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Triglycerides• Animal Fat• Tristearin: C57H110O6

Page 124: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm Up 2/3/15

1. What is the difference between a monomer and a polymer?

2. What is the technical term for the monomers of a starch molecule?

3. What is the most important carbohydrate in the human body?

Page 125: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Composed of 1 glycerol and 2 fatty acids.• Has a Phosphate group rather than a 3rd fatty acid.• Makes up the plasma membrane

Phospholipids

Page 126: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Steroids• Flat molecules made of interlocking rings• Most important: Cholesterol• Raw material for human steroids• Examples:

– Vitamin D– Sex hormones– Cortisol– Bile salts

Page 127: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Amino acids (20 different types) bonded together by peptide bonds

Proteins (Polypeptides)

Page 128: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• All amino acids have the same basic structure and vary only in their “R” group.

• Humans have 20 different “R” groups.

Page 129: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Every protein in your body is simply written in the alphabet of Amino acids in the same way

that every written work of the English language, whether it is Shakespeare or baking instructions

are just different arrangements of 26 letters.

Page 130: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Change one letter in a word and a sentence can change its meaning.–Flour => Floor

• Or stop making sense–Flour => Fluur

Page 131: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Proteins are the same.• Change an amino acid and they can

change function, or stop working entirely.

Page 132: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Categories of proteins

• Structural- bind structures together and provide strength in certain body tissues.

• Example:– Collagen- Found in bones, cartilage

and tendons. It is the most abundant protein in the body.

Page 133: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Categories of proteins

• Functional- do things rather than just form structures. Mediate virtually all biological processes.

• Examples:– Antibodies– Hormones– Enzymes

Page 134: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Enzymes• Hydrogen bonds important for maintaining

structure, but are easily broken.• Excess heat and pH can break these bonds.

Page 135: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Enzymes• When three dimensional structures are destroyed

the proteins are said the be denatured and can no longer perform their physiological roles

Page 136: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

A denatured paperclip.

Page 137: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 138: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Enzymes

• Function depends on structure.• Most importantly the active site where they

interact with other molecules. Highly specific.

Page 139: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Enzymes

• Enzymes are as biological catalysts, increasing the rate of a chemical reaction.

• Enzymes not changed during reaction so are reusable.

• Control rate and type of reactions that can occur.• Many enzymes end with –ase suffix.

Page 140: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Highly specific! May only control ONE reaction.

• Nearly all end in –ase. Beginning of word characterizes its function/substrate (Ex. Hydrolase- adds water during a chemical reaction)

Enzymes

Page 141: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Warm Up 2/4

1. What does the term denatured mean with regards to a protein?

2. What type of bonds are critical to a protein’s shape but are easily broken?

3. What is the name of bonds that hold amino acids together?

Page 142: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Two types:– Deoxyribonucleic acid (DNA)-double helix– Ribonucleic acid (RNA)-single

• Nucleic acids are composed of long chains of nucleotides

Nucleic Acids

Page 143: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• Nucleotide Structure:–Phosphate group–Pentose sugar (5-Carbon)–Nitrogenous bases:

• Adenine (A)• Thymine (T) DNA only• Uracil (U) RNA only• Cytosine (C)• Guanine (G)

Nucleic Acids

Page 144: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Nucleotide

OO=P-O O

Phosphate Group

CH2

O

C1C4

C3 C2

5

Sugar(deoxyribose)

NNitrogenous base (A, G, C, or T)

Page 145: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

ATP

Page 146: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 147: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.
Page 148: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Base PairingC-GT-A

P

P

P

O

O

O

1

23

4

5

5

3

3

5

G C

T A

P

P

PO

O

O

1

2 3

4

5

5

3

5

3

Page 149: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

2 step process “Central Dogma”

• Transcription (DNA to RNA)• Translation (RNA to Amino Acid sequence)

Transcription TranslationDNA RNA Protein

Page 150: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

• A gene is a functional segment of DNA that provides the genetic information necessary to build a protein

ATGACCGAGAATTCCACGTCCGCCCCTGCGGCCAAGCCCAAGCGGGCCAAGGCCTCCAAGAAGTCCACAGACCACCCCAAGTATTCAGACATGATCGTGGCTGCTATCCAGGCCGAGAAGAACCGCGCTGGCTCCTCGCGCCAGTCCATTCAGAAGTATATCAAGAGCCACTACAAGGTGGGTGAGAACGCTGACTCGCAGATCAAGTTGTCCATCAAGCGCCTGGTCACCACCGGTGTCCTCAAGCAGACCAAAGGGGTGGGGGCCTCGGGGTCCTTCCGGCTAGCCAAGAGCGACGAGCCCAAGAAGTCAGTGGCCTTCAAGAAGACCAAGAAGGAAATCAAGAAGGTAGCCACGCCAAAGAAGGCATCCAAGCCCAAGAAGGCTGCCTCCAAAGCCCCAACCAAGAAACCCAAAGCCACCCCAGTCAAGAAAGCCAAGAAGAAGCTGGCTGCCACACCCAAGAAAGCCAAAAAACCCAAGACTGTCAAAGCCAAGCCGGTCAAGGCATCCAAGCCCAAAAAGGCCAAACCAGTGAAACCCAAAGCAAAGTCCAGTGCCAAGAGGGCCGGCAAGAAGAAGTGA

One of the shortest human genes. ~585 base pairs. Encodes a Histone protein.

Page 151: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

Human salivary amylase

Page 152: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

A three dimensional structural model of stem bromelain

Page 153: WELCOME! Take any seat! We will have assigned seats tomorrow. Mr. Baker Rm. 107E to Anatomy and Physiology.

END.


Recommended