Welcome to the world of two Arabidopsis genes:

At4g14770 and At3g22760

Presented by:

Matt EmmerHC70AL

Spring 2006

At4g14770 and At3g22760

At4g14770 and At3g22760: Tesmin/TSO1-like CXC Domain

Proteins• TSO1

– involved in cellular expansion and cytokinesis, as well as in the development of ovules and microspores

– Contains two cysteine-rich regions similar to CXC domains involved in chromosome segregation

• Tesmin – a member of the CXC family, and a testis-

specific protein

Structure of At4g14770 Structure of At4g14770 (1(1stst Line) Line)

Gene Size 3452 bp

# of Exons 8

# of Introns 7

Protein Encoded

Tesmin/TSO1-like

CXC Domain

# of Amino Acids

659

T-DNA Location

First Intron

?

Structure of At3g22760 Structure of At3g22760 (2(2ndnd Line) Line)

Gene Size 3076 bp

# of Exons 10

# of Introns 9

Protein Encoded

Tesmin/TSO1-like

CXC Domain

# of Amino Acids

610

T-DNA Location

5’ UTR

Where is At4g14770 Expressed?

Where is At3g22760 Expressed?

Were there Mutants in the 1st Line?

WTMut

9 Homozygous Mutants Identified in First Line

1 Heterozygous Mutant

Expected Size

Wild Type 802 bp

T-DNA 644 bp

4.5 ng/μLPlant 13

1.5 ng/μLPlant 12

4 ng/μLPlant 10

15 ng/μLPlant 4

5 ng/μLPlant 3

ConcentrationPlant

0.5 ng/μLWild Type

2 ng/μLPlant 18

4 ng/μLPlant 16

2 ng/μLPlant 15

ConcentrationPlant

What were the DNA Concentrations?

Were there Mutants in the 2nd Line?

1,624 bpWild Type

1,095 bpT-DNA

Expected Size

Genotyping with separate primers

Seeds and Silique

Embryos

MutantMutant vs.vs. Wild TypeWild Type

Any Difference?

NONO

What’s Upstream of At4g14770?

3237 3237 bpbp

1918 1918 bpbp

1319 1319 bpbp

1918 + 1319 1918 + 1319 = 3237= 3237

Single EcoRI Site in Upstream Region

I-proof Pcr Ecori Digest

Upstream Bioinformatics Upstream Bioinformatics

Primers Eco RI Site

How accurate was the SP6 and T7 Sequencing Data?

• Only a single mismatch in the SP6 sequencing data

Actual Sequence: AAAGTAACGGACATCAGTTTTTTTTTTCTTTTCCCTTTTTTCTCTTTTTTG

What’s Upstream of At3g22760?

2911 2911 bpbp

I-proof Pcr Ecori Digest

Did the T-DNA insert Did the T-DNA insert actually knock out actually knock out

At4g14770?At4g14770?

Did the T-DNA insert Did the T-DNA insert actually knock out actually knock out

At4g14770?At4g14770?

• Two Possibilities:– Intron was spliced out– T-DNA was not spliced

out, resulting in a longer mRNA strand

• Follow up experiment:

ConclusionsConclusions• 1st Line mutants were attained

– No mutant phenotype observed– Evidence to suggest that gene knockout was not

successful

• Limited information obtained for 2nd line– No mutant plants attained– SALK indicates a T-DNA insert is in 5’ UTR, so

gene may not have been knocked out

• Future Experiments– Double/Triple Knock Outs to overcome duplication:

• At4g14770, At3g22760, At3g22780

AcknowledgementsAcknowledgements

The TA’s• Mike Gaviño • Ria Yagnik• Jonathan Russell

The Big Shots• Dr. Bob Goldberg • Dr. Anhthu Bui

• Dr. Xingjun Wang

Big Shots To Be• Tomokazu Kawashima• Brandon Le• Jessica Luke

HC70AL

Jordan, Thi, Jennifer, Brian, Jordan, Jason, Daisy, Bekah, and Heather