www.wjpr.net Vol 5, Issue 5, 2016.
1
Aziz et al. World Journal of Pharmaceutical Research
GENETIC ELEMENTS RESPONSIBLE FOR EXTREME DRUG
RESISTANCE (XDR) IN KLEBSIELLA PNUMONIAE VAR PNUMONIAE
ISOLATED FROM CLINICAL SAMPLES OF IRAQI PATIENTS
Rawa Abdul Redha Aziz1*
and Sawsan Sajid Al-Jubori2
1Dept. of Biology, Collage of Science, Kufa University, Najaf, Iraq.
2Dept. of Biology, Collage of Science, Al-Mustansiriyah University, Baghdad, Iraq.
ABSTRACT
Twenty four isolates primarily diagnosed as Klebsiella pneumoniae
were isolated from different samples from patients submitted to
Baghdad hospitals\Iraq. Bacterial diagnosis was performed using
complementary Vitek system. A house keeping gene(primers were
designed for the 16s and 23s rRNA region) was used for genotypic
diagnosis with amplified size 639bp.The results of antimicrobial
susceptibility testing (disc diffusion method) revealed that most
isolates displayed extremely high drug resistance (XDR) patterns. The
highest resistance percentage was towards Ampicillin (95.83%)
followed by Ceftazidime (87.50%) compared with other used antibiotic
groups. Results also reveal that 16\24 (66.67%) isolates were resistant
to Colistin sulphate, while only 2\24 (8.33%) isolates were resistant to Tigecycline. The MIC
test for polymyxin B revealed that 22/24 (91.67%) isolates were resistant to ˃32µg/ml of this
antibiotics. The results of modified Hodge test and rapid ESβLs production test revealed
positivity of 100%(24/24) and 58.33% (14/24), respectively. About genotypic screening test
for antibiotic resistance genes, the results revealed that the highest percentage were towards
aminoglycoside modifying enzyme group type aac(6)-Ib followed by aac(3)-I (100% and
75%, respectively) as compared with other genes in the same group. For efflux pump gene
about 88% of the isolates were harbored mexX gene and only 29% harbored mexY. Also
16.67% of the isolates harbor the metalo β-lactamase gene blaIMP-1 while none of the
isolates were positive to blaVIM gene. The ESBLs genes bla SHV, bla AMP-C, and bla CMY
revealed 58.33%, zero%, and 33.33% among K. pneumonia local isolates tested in this study.
The highest percentage was towards rmtF (66.67%) followed by rmtB (54.17%) as compared
World Journal of Pharmaceutical Research SJIF Impact Factor 6.805
Volume 5, Issue 5, 01-23. Research Article ISSN 2277– 7105
*Corresponding Author
Dr. Rawa Abdul Redha
Aziz
Dept. of Biology, Collage of
Science, Kufa University,
Najaf, Iraq.
Article Received on
26 Feb 2016,
Revised on 15 March 2016,
Accepted on 08 April 2016
DOI: 10.20959/wjpr20165-6020
www.wjpr.net Vol 5, Issue 5, 2016.
2
Aziz et al. World Journal of Pharmaceutical Research
with other gene in the methylation group. Some of the isolates encode the quinolones
resistance genes ParC2 and GyrA (54.17% and 75%, respectively). For oxacillinace genes
(OXA58, OXA51, OXA24, and OXA23), only OXA 23 was detected (8.33%) among K.
pneumonia isolates. As a conclusion, most isolates harbor more than one resistant
mechanisms which might considered a sign for emergency pan drug resistant not only XDR
pattern.
KEYWORDS: XDR Klebsiella pneumonia, ESBLs, Hodege test, Different resistance
mechanism.
1. INTRODUCTION
K. pneumonia is opportunistic pathogen can be carried asymptomatically in the intestinal trac,
skin, nose and throat of healthy individuals but can also cause a range of infections in
hospitalized patients, most commonly pneumonia, wound, soft tissue, or urinary tract
infections.[1]
Increasing reports of infections due to multidrug resistance (MDR) and
extremely drug resistance XDR fermentative Enterobacteriaceae such as Klebsiella spp.
might become the worst health problems and issues.[1,2]
It is pointed out that MDR pathogens
could be resistant towards 3-5 antibiotic classes such as antipseudomonal cephalosporins,
antipseudomonal carbapenems, β-lactam–β-lactamase inhibitor, fluoroquinolones, and
aminoglycosides, while XDR pathogens are susceptibility to only 2 or less antibiotic
classes.[3]
However, PDR (pan drug resistance) pathogens have no options for treatment as
they diminished susceptibility to all classes.[3]
MDR Klebsiella pneumonia remains
susceptible only to more agents such as the polymyxins, and it convert to PDR if they resist
this antibiotic.[3]
Usually Klebsiella pneumonia has the ability to resist wide range of
antibiotics via different mechanisms including production of Extended spectrum β-
lactamases (ESBLs)and carbapenemases, production of aminoglycoside-modifying enzymes,
over expression of efflux pumps, reduction in porin channels, and target-site alteration
including changing in penicillin binding proteins and topoisomerases.[4]
K. pneumoniae is
resistant to penicillins extended-spectrum β-lactamase, and expanded-spectrum
cephalosporins through the production of β-lactamases that are encoded mainly by the bla
SHV, bla TEM, and amp C genes. β-lactams such as imipenem and meropenem, which are
highly resistant to hydrolysis by TEM, SHV, and AmpC β -lactamases remain effective
antibiotic options.[4]
Klebsiella pneumonia contain many plasmids that differ in numbers and
molecular weight, carrying different types of genes including those encoding extended-
www.wjpr.net Vol 5, Issue 5, 2016.
3
Aziz et al. World Journal of Pharmaceutical Research
spectrum β-lactamases (ESBLs), AmpC β-lactamases, inhibitor resistant TEM β-lactamases
and metallo β-lactamase enzymes. These enzymes confer resistance to various antimicrobial
agents including the third and fourth generation cephalosporins, cephamycins, monobactam
βlactamase, β-lactamase/inhibitor combinations and carbapenems.[5]
Due to the dearth of
antimicrobial effect with novel mechanisms of action, very few options remain to treat the
infections caused by XDR pathogens.[6]
Klebsiella pneumonia has emerged as a common
cause of serious epidemic and nosocomial infections in hospitals, resulting in high morbidity
and mortality.[3,6]
ESBL-producing K. pneumoniae is resistance to other antibiotics, including
fluoroquinolones, aminoglycosides, trimethoprim, and sulfamethoxazoles.[7]
It is also
reported that clinical outcome in bacteraemic infections caused by ESBL-producing K.
pneumoniae appears to be worse than that of patients with non-ESBL-producing isolates.[8]
This prevalence of ESBLs has limited the available therapeutic options and necessitated the
increased use of carbapenems against Klebsiella pneumoniae infections. In response to use of
carbapenems, carbapenem resistance has been emerged.[9]
Modified Hodge test (MHT) has
been widely used as primary screening test for carbapenemase activity.[10]
In our study, we
focus on the detection of Iraqi extensively drug-resistant (XDR) among the isolates and
studying their resistance pattern towards different antimicrobial groups by PCR.
2. MATERIAL AND METHODS
2.1. Collection and diagnosis of Bacterial isolates Twenty four isolates of Klebsiella were
obtained from patients admitted to several teaching hospitals in Baghdad during a period
between March 2015 to September 2015. They were collected from the midstream urine from
patients with urinary tract infections (5 isolates),from bacteraemia (7 isolates), wound swabs
from Burn unit (4 isolates), 2 isolates were collected form sputum , ear, and pus (for each ),
finally 1 isolate collected from both of wounds infections and stool. Isolates were re-
diagnosed by Vitek 2 compact automated system (Biomeriux, USA), and the probability was
99% Klebsiella pneumonia ssp pneumonia.
2.2 Genotyping detection for isolates Specific primers were designed for the 16srRNA and
23s rRNA region (housekeeping gene, amplified size was 639 bp) using Geneious Software/
primer 3. The sequence for the forward primer was 3′ TGTACACACCGCCCGTC-5′ and for
the reverse was R-3′GGTACTTAGATGTTTCAGTTC-5′. Total DNA was extracted using
Genomic DNA Extraction Kit (Wizards, Promega, USA) following manufacture’s protocol
and was used as a template for the PCR process. The mixture of PCR composed from 12.5 of
www.wjpr.net Vol 5, Issue 5, 2016.
4
Aziz et al. World Journal of Pharmaceutical Research
GoTaq®Green Master Mix (2x), 5 µl template DNA, 1.5 µl primers (for each) final
concentration 0.6pmol/µl and nuclease free water up to 25 µl (4.5 µl). PCR products were
stored at -20 ºC, then nucleotides sequence was carried out at NICEM Company, USA.
Results of sequencing were analyzed using genious soft ware 7.01R compareid with the
NCBI standered strain.
2.3. Antimicrobial sensitivity tests: Resistance tested for the isolates towards thirty types of
different antibiotics including β- Lactams, aminoglycoside, tetracyclines and quinolones
groups besides other groups. Susceptibility was determined based on the interpretative
criteria recommended by the Clinical and Laboratory Standards Institute (CLSI).[11]
The
antibiotics were: from β- Lactams, Ampicillin (25mcg), Piperacillin(100µg), Cefixime (5µg),
Cefazolin(30µg), Cephalothin(30µg), Cefotaxime(30µg), Ceftriaxone(30µg),
Ceftazidime(30µg), Cefepime(30µg), Amoxicillin/clavulanic acid (20/10µg), Ticarcillin-
clavulanic acid(75/10µg), Aztreonam(30µg), Imipenem(10µg), Meropenem (10µg) and
Doripenem(10µg). In the Aminoglycoside group: Kanamycin(30 µg), Gentamycin (10µg),
Tobramycin(10µg), Netilmicin(30µg) and Amikacin(10µg). The quinolones group include
Naldixic acid(30µg), Levofloxacin(5µg), Gatifloxacin(5µg), Ofloxacin(5µg). Other
antibiotics include sulpha group: Trimethoprim (5µg) and Trimethoprime-
Sulphamethoxazole (1.25/23.75µg), and Tetracyclines: Tetracycline(30µg) and
Doxycycline(30µg). Tigecycline(15µg) and colistin sulphate(25µg) were also tested.[12, 13]
Polymyxin B was also used to achieve the minimum inhibitory concentration (break point
2µg/ml).[14]
E. coli HB101 used as the negative control strain .Phylogenic analysis for
antibiotic susceptibility pattern was done using Tamura –Nei genetic destine model and
UPGMA tree build method in order to analyze antibiogram similarity.
2.4: Indirect three dimensional agar diffusion method to detect ESBLs The detection of
ESBLs production was performed using modified indirect three dimensional method in which
Muller Hinton Agar (MHA) plates were seeded with a lawn of a standard strain E.coliHB101
adjusted to MacFarland (0.5) standard. A slit was performed inside the MHA plate using a
sharp scalpel emerged with the test isolate. The following discs were placed 2mm away
towards the performed line. They were amoxicillin/clavulanic acid(20/10µg), ceftazidime(30
µg), ceftriaxone(30 µg), and cefexime(5µg). The plate was incubated at 37ºC for16-18 hours.
The distortion of inhibition zone around the antibiotic indicates ESBLs production.[15]
www.wjpr.net Vol 5, Issue 5, 2016.
5
Aziz et al. World Journal of Pharmaceutical Research
2.5: Modified Hodge test (MHT) Modified Hodge test (MHT) was performed according
to[10]
for detection of carbapenemase production. Briefly, 5 ml of brain heart infusion broth
culture for Escherichia coli HB101 equal to 0.5 McFarled was prepared then 100μl from.
1:10 dilution was streaked as lawn on to a Mueller Hinton agar plate. Imipenem susceptibility
disk(10μg/disc) was placed in the center of the test area. The test isolate was streaked in a
straight line from the edge of the disk to the edge of the plate. The plate was incubated
overnight at 37º C for 24 hours. After 24 hours, MHT positive test (carbapenemase producer)
showed a clover leaf-like indentation of the Escherichia coli 25922 growing along the test
organism growth streak within the disk diffusion zone. MHT negative test represent by
normal growth for the standard strain or without the formation of clover leaf-like shape.
2.6: Detection of antibiotic resistant genes using PCR amplification technique All the
twenty four isolates were subjected to molecular screening study using PCR amplification
technique to detect XDR profile. Different primers (table 2) were used. PCR mixture was
composed from 5μl template DNA which was extracted using Genomic DNA Extraction Kit
(Wizards, Promega, USA), 12.5μl of GoTaq®Green Master Mix, 1.5μl from forward and
reverse primers (final concentration 0.6pmol\ μl).The volume was completed to 25μl with
nuclease free water. PCR was run under the following conditions: primary denaturation step
95°Cfor 5 min; 30 -40 repeated cycles (according to gene listed in table 2)of 94°C for 30sec ,
43- 62 °C annealing temperature (table-2) for 60 sec and 72°C for 1 min then final extension
step at 72 °C for 6 min. PCR products were electrophoresed in 1% agarose gel and visualized
under UV ligh.[16]
www.wjpr.net Vol 5, Issue 5, 2016.
6
Aziz et al. World Journal of Pharmaceutical Research
Table 2: Primers used for detection antibiotic resistant genes.
Ref. Tm Size product Sequences (5'_3')
R
Sequences (5'_3')
F Primer
This study 59 639 R-GGTACTTAGATGTTTCAGTTC F-TGTACACACCGCCCGTC 16s RNA& 23s RNA
Lianes et.al.,[17]
62 326 R- GAT CTG CTC GAC GCG GGT
CAG CG
F- TGA AGG CGG CCC TGG ACA TCA
GC mexX
Xavier et.al.,[18]
59 250 R-AGCGGGATCGACCAGCTTTC F- CCGCTACAACGGCTATCCCT MexY
Xavier et.al.,[18]
43 227 R- GGCATACGGGAAGAAGT F-AGCCCGCATGGATTTGA aac(3)-I
Ndegwa et.al.,[19]
56 482 R- CTC GAA TGC CTG GCG TGT TT F- TTG CGA TGC TCT ATG AGT GGC
TA aac(6)-Ib-
Ndegwa et.al.,[19]
57 364 RGGAACAAGACCCGTTCAATTCAA
TTCATCAAGTTT
FGACGACGACAAGGATATGGAATTG
CCCAATATTATT ant(4’)IIb-
Haldorsen et.al.,[20]
55 800 R-CAC GCG GGG AAA CGC GAG AA F-TAT CTC GGC GGC GGT CGA GT aph(3′)VI
Vaziri et.al.,[21]
59 200 R-TTCAGTTCCGTTTCCCAGCGG F-AAGATCCACTATCGCCAGCAG blaSHV
Vaziri et.al.,[21]
58 1150 R-GTTGGGGTAGTTGCGATTGG F-ATGCAACAACGACAATCCATC blaAmpC
Oliveira et.al.,[22]
50 1014 R-TGGAACGAAGGCTACGTA F-GACAGCCTCTTTCTCCACA blaCMY
Ramazanzadeh et. al.,[23]
55 500 R-AACCAGTTTTGCCTTACCAT F-CTACGCCAGCAGAGTCTTTG IMP-1
Mendes et.al.,[24]
57 382 R-AATGCGCAGCACCAGGATAG F-GTTTGGTCGCATATCGCAAC VIM
Haldorsen et.al.,[20]
58 635 R-TTG CTT CCA TGC CCT TGC C F-CTA GCG TCC ATC CTT TCC TC RmtA
Doi et.al.,[25]
59 584 R-CTC AAA CTC GGC GGG CAA GC F-CCC AAA CAG ACC GTA GAG GC RmtB
Mendes et.al.,[24]
53 711 R-ATC CCA ACA TCT CTC CCA CT F-CGA AGA AGT AAC AGC CAA AG RmtC
Tijet at.al., [26]
52 500 R-CGATGCGACGATCCATTC F-TCAAAAAGGAAAAGGACGTG RmtD
Lee et.al.,[27]
51 453 R-GGCAGGAGCTTCATCAGAA F-GCGATACAGAAAACCGAAGG RmtF
Morovat et.al., [28]
53 353 R5'-GGATTGCACTTCATCTTGG-3' F 5'-TAATGCTTTGATCGGCCTTG-3' OXA 51
Morovat et.al., [28]
53 599 R 5'-CCCCTTGCGCTCTACATAC-3 F 5'-AAGTATTGGGGCTTGTGCTG-3 OXA58
Morovat et.al., [28]
53 501 R 5'-ATTTCTGACCGCATTTCCAT-3 F 5'-GATCGGATTGGAGAACCAGA-3 OXA23
Morovat et.al., [28]
53 246 R 5'-AGTTGAGCGAAAAGGGGATT-3 F 5'-GGTTAGTTGGCCCCCTTAAA-3' OXA24
This study 57 886 R-TTCCGGGAACTCGGTTAACG F-GGCATTTATTCGTCACCGCC gyr A1
This study 57.1 314 R-TGATTTCACCTGAGGACGGC F-GTTACCGTATGCGAGCGGTA Par C2
www.wjpr.net Vol 5, Issue 5, 2016.
7
Aziz et al. World Journal of Pharmaceutical Research
3. RESULTS AND DISCUSSION
Klebsiella pneumoniae is a leading cause of hospital-acquired (HA) infections and serious
community-acquired (CA) infections ,including pyogenic liver abscess, pneumonia, and
meningitis.[3]
In the current study , all the 24 isolates were diagnosed depending on a
housekeeping gene 16S rRNA gene and 23SrRNA and gave a positive result (figure 1) .The
amplified DNA segment (figure 2) as compareid with the standered strain Klebsiella
pneumoniae subsp.pneumoniae KPNIH29: CP009863 (NCBI) was exactely 639 bp start
from 18,101 bp to 17,467 bp in the genomic map and passing throug 3 important
housekeeping genes (red area) the 16s rRNA, tRNA-Glu and 23s rRNA. Pariwise identity
was 91% which represent the percentage of residues that are identical in the alignment. Some
differences were recognized between the local isolate and the recorded NCBI strain as clear
with gaps in the upper green identity line. The reason of choosing 16S rRNA gene to identify
Klebsiella pneumonia isolates in this study is that the widespread use of this gene sequence
for bacterial identification and taxonomy of many non cultured bacteria, and the fact that it is
an essential part of the description of a novel organism.[28]
Figure(1): Agarose gel electrophoresis (1% agarose, 5 V/cm for 90min) for 16SrRNA
gene of Klebsiella pneumonia isolates .lane M : 100bp DNA ladder, lanes 1,2,3,4,5,6, and
7 are positive results with 639bp amplicon of Klebsiella pneumonia blood 1,2, 3, 4, 5, 6,7.
Lanes ,10 ,11 and 12 are positive results with 639bp amplicon of Klebsiella pneumonia
Urine 1, 2, and 3; lane 8 and 9 show negative results.
www.wjpr.net Vol 5, Issue 5, 2016.
8
Aziz et al. World Journal of Pharmaceutical Research
Figure 2: The housekeeping genes used for diagnosis localKlebsiella isolates.
Antibiotics are widely used in clinical settings whether for treating simple cases or life-
threatening infections caused by microorganisms. Now a days, many antibiotic resistant
gram negative bacteria come up and have made global concern such as Klebsiella
pneumonia.[29]
The broad use of antibiotics had created a strong selective pressure, which
consistently had resulted in the survival and spread of resistance that has evolved with the
increased number, volume and diversity of antimicrobial applications. Among the 24 isolates,
rate of resistance (figure3)for penicillin group the rates were 95.83% for ampicillin, 79.17%
for piperacillin, 58.33% for ticarcillin-clavulante, 70.83% for amoxicillin/clavulanic acid.
While for cephalosporins ,the percentage of resistance were 87.50% for ceftazidime, 83.33%
for cefotaxime, 79.17% for ceftriaxone, 79.17% for cefepime, 75.00% for cefazolin, 66.60%
for cephalothin, 58.33% for cefixime. As for Monobactam the rat was 62.50% for aztreonam.
Resistance towards aminoglycoside group were38%, 20.83%, 4.17% and 29.17% for
kanamycin, gentamycin, amikacin, and tobramycin, respectively, but none of the isolates
were able to resist netilmicin. Tetracyclines was also tested and the results revealed that
62.50% of the isolates showed resistance for tetracycline and the rate decreased to 58.33%
for doxycycline. In addition, flouroquinolones sensitivity test showed that 20.83% of the
isolates resisted each of gatifloxacin, florofloxacin, and levofloxacin, while nalidixic acid
resistance was 66.67%. Finaly rate of resistance toward thrimethoprim and trimethoprime-
sulfamethoxazole were 70.83% and 70.80%, respectively. Similar work was done by Radha
et.al where antibiotic sensitivity test of 25 K. pneumoniae isolates ranged between
intermediate and resistant according to the National committee for clinical laboratory
standard (NCCLS).[29]
Moreover, the results of the current study revealed that there was no
www.wjpr.net Vol 5, Issue 5, 2016.
9
Aziz et al. World Journal of Pharmaceutical Research
resistant isolates towards netlimicin, meropenem, and doripenem, however, 29.17% of
Klebsiella pneumoniae isolates were resistant to imipenem.It has been revealed that, ESBL
producers showed resistance pattern towards imipenem due to the production of
carbapenemase, so these bacteria cannot be eliminated by carbapenems that are the usual
drug of choice against them.[30]
It is reported that 62 (50%) K. pneumonia isolates resistant
to imipenem.[31]
It is important to reveal that 16(66.67%) K. pneumonia isolates (K. pne.b4,
b5, b6, b7, U2, U3, U4, U5, S2, W1, ES2, Bu1, Bu2, Bu3, Bu4, and P1) were resistant to
colistin sulphate, while only two(8.33%) isolates (K. pneumonia b5 and W1) were resistant
to a tigecycline. It was pointed out that tigecycline, a broad-spectrum glycylcycline, is
tigecycline is considered as therapeutic option for MDR gram positive and gram negative
bacteria, and it was found to be effective against Klebsiella infections.[31]
However, Rhee
found that their local Klebsiella pneumoniae collected from patients with diabetes mellitus
and chronic renal failure on He modialysis in South Korea displayed intermediate pattern to
tigecyline, so he concluded that the isolates could be defined as XDR.[32]
Galani et. al.
showed that colistin sulphate was less active against Klebsiella pneumonia tested in their
study[13]
although colistin sulphate (polymyxin E) has been considered an effective
therapeutic option for such XDR pathogen.[33]
Finally, minimum inhibitory concentration
test(MIC) of Polymyxin revealed that 91.67% (22/24) isolates were resistant at 32µg/ml
(break point ≥2µg/ml), leading to conclude that K. pneumoniae isolates are PDR pathogens.
This conclusion is supported in literature, for example Falagas and his team found that the
mortality rate was 41.7% among hospitalized patients at a tertiary-care center when tested 23
Klebsiella pneumoniae isolates. They conclude that PDR gram-negative bacterial infections
are associated with considerable mortality, although not as high as expected given the fact
that the isolates were resistant to all tested antibiotics, including polymyxins.[14]
It was clear
that each isolate showed its ability to resist more than one antibiotic group. As illustrated in
figure(4) each isolates of K. pne. B5, ES2, and Bu2were able to resist 23-24 antibiotics
related to different groups followed by K. pne. W1andP1 that were resistant to 21 antibiotics
as compared with other local isolates tested.
www.wjpr.net Vol 5, Issue 5, 2016.
10
Aziz et al. World Journal of Pharmaceutical Research
Figure 3: the percentage of different antibiotic groups against Klebsiella pneumonia.
Tetracycline (T), Meropenem (MEM), Cefepime (FEP), piperacillin (PRL), Aztreonam
(ATM), Amikacin (AK), Ticarcillin +Clavulanic acid (TIM), Trimethoprim I, Levofloxacin
(LEV), Naldixic acid (NA), Imipenem (IPM), Gentamicin (CN), Cephalothin(KF),
Ceftazidime (CAZ), Ampicillin (AP), Kanamycin (K), Gatifloxacin (GAT), Cefazolin (CZ),
Cefixime(CFM), Tobramycin(TOB), Ofloxacin (OFX), Trimethoprim +Sluphomethoxazole
(SXT), Doripenem (DOR), Doxycycline (DXT), Cefotaxime (CTX), Ceftriaxone (CRO),
Amoxicillin+Clavulanic acid (AMC), netilmicin (NET).
Figure 4: illustrate number of resisted antibiotics related to different by K. pneumonia
www.wjpr.net Vol 5, Issue 5, 2016.
11
Aziz et al. World Journal of Pharmaceutical Research
Figure 5, dendrogram illustrating phylogenic analysis of Antibiotic sensitivity test toward 30
different antibiotics using Global alignment \Tamura-Nei (UPGMA) in Geneious software .
The tree was with 47 nodes and 24 Tips. The data is separated into 2 groups (A and B). The
phylogenic tree of the current study reflects a high diversity between isolates. It is clear that
cluster A2 shows K.pne U4 having different antibiogram pattern compared with other
isolates in the same group. Similarities in antibiogram pattern on the other hand were
appeared in cluster B1b2, precisely K. pne. B5 and K. pne. Bu2since they did not have
differences and the coefficient was (0). Also, similar phenotypic pattern was noticed between
K.pneb1 and b3(B1a cluster) making them segregated within the same clone (red color). The
isolate K.pne .p2 at (0.259) bosses the most differ pattern hence it segregate alone as with the
stander strain.
Figure 5: The phylogenic tree for antibiogram phenotype(47 nodes and 24 Tips) for
local K. pneumonia isolates tested.
Modified Hodge test were performed since this test has been widely used fo rscreening of
carbapenemase activity.[34]
As it is known that carbapenemases (KPC) are β-lactamase
enzymes that inactivate the carbapenems (ertapenem, imipenem andmeropenem), and these
are responsible for many epidemicsin Greece, India, and USA, especially when
carbapenemase producers spread in patients with identical risk factors (patients receiving
broad-spectrum anti-biotherapy, patients in intensive care units, immune compromised
patients, transplant patients, surgical patients.[35]
Therefore, early identification of
carbapenemase producers in clinical infections is mandatory to prevent development of those
www.wjpr.net Vol 5, Issue 5, 2016.
12
Aziz et al. World Journal of Pharmaceutical Research
hospital-based outbreaks.[36]
All the isolates gave a positive result (100%). Figure( 6 )shows
some of the positive tested isolates presented in leaf –shape.
Figure 6: positive results of Modified Hodage test for Klebsiella pneumonia. Isolates no.
1,3,5,13, and 20 showed positive results (leaf shape), while no 16 showed negative
results.
Moreover, it is revealed that K. pneumoniaeis identified to be the mostcommon entero
bacterial species for spreading ESBL genes in health care facilities during the past 30
years.[36, 37]
Resistance to fluoroquinolones, co-trimoxazole, and trimethoprim is frequently
observed among ESBLs producers.[6]
Therefore, results of screening for extended spectrum β-
lactmases via the modified indirect method in this study showed14 isolates (58.33%) were
positive in that 11 isolates (45.83%) were resistant to Amoxicillin/clavulanic acid, 9 (37.5%)
isolates were resistant to Ceftriaxone, 8 (33.33%) to Ceftazidime, 4 (16.67%) were resistant
to Cefixime. Similar work has been done by Dhara et. al., however, their results demonstrated
81.48%ESBLs prevalence among (54 isolates) and the susceptibility pattern of ESBL positive
isolates showed all 2nd
generation cephalosporins, 3rd
generation cephalosporins
andaztreonam were resistant.[38]
Also it has been reported that 148 (61%) of K. pneumoniae
isolates from different areas in Iran were ESBLs producing.[39]
It has been reported that the increasing clinical incidence of antibiotic-resistant bacteriais a
major global health care issue. It has been grounded on data that characterization ofantibiotic
resistance determinants at the genomic level plays a critical role in understanding, and
potentially controlling, the spread of MDR or XDR pathogens. Of particular concern is the
spread of resistant Klebsiella pneumoniae which can harbor both extended-spectrum β-
www.wjpr.net Vol 5, Issue 5, 2016.
13
Aziz et al. World Journal of Pharmaceutical Research
lactamases (ESBL)and carbapenemases capable of hydrolyzing newer carbapenem drugs.
Frequently associated with ESBL-producing K. pneumonia isresistance to other antibiotics,
including fluoroquinolones, aminoglycosides, trimethoprim, and sulfamethoxazoles.[40, 30]
Therefore, many genes related to different antibiotic resistance mechanisms were tested.
Figure 7 represents 1:aac(6)-Ib, 2:aac(3)-I, 3: ant(4’)IIb-, and 4:aph(3′)VI, genes related to
aminoglycoside modifying enzymes.5:mexX and 6:mexY, the efflux pump genes. 7: blaIMP-
1 represent MBL gene 8: multiplex oxacillinase genes (OXA 58, OXA 51, OXA 24, and
OXA23). 9: 16s ribosomal methylation enzymes such as rmtA, 10: rmtD, 11: rmtF,
12:multiplex of rmtB and the ESBLs encoding gene bla SHV. 13: bla CMY. Finally,
14:ParC2 and 15: GyrA1, quinolone resistance genes.
1 2
3 4
5 6
www.wjpr.net Vol 5, Issue 5, 2016.
14
Aziz et al. World Journal of Pharmaceutical Research
7 8
9 10
11 12
13 14
www.wjpr.net Vol 5, Issue 5, 2016.
15
Aziz et al. World Journal of Pharmaceutical Research
15
Figure 7: Agarose gel electrophoreses(1% agarose, 50 V/cm for 90 min) for some
amplified virulence genes: 1) aac(6)-Ib (482 bp), 2) acc(3)-I (227bp), 3)
ant(4’)IIb(364bp), 4) aph(3)-VI (800bp), 5) MexX (326bp), 6) MexY (250bp), 7) bla IMP-1
(500bp), 8)multiplex OXA (58, 51, 24, and 23) (599, 353, 246, and 501bp), 9)rmtA(635bp),
10) rmtD (500 bp), 10) rmtF (453bp), 12)multiplex rmtB (584 bp) and bla SHV (200bp),
13)blaCMY (1014bp), 14)Par C2 (314bp), and 15) Gyr A1 (886 bp).
Results revealed that all the isolates harbored more than one resistant gene .The most
dominant gene among aminoglycoside modifying enzymes tested was aac(6)-Ib(100%),
followed by aac(3)-I(75%), ant(4’)Iib- (45.83%) and the amikacin resistance geneaph(3)-VI
also called (aphA6 ) (8.33%) (figure 8). It has been known that aminoglycoside are
important options for the treatment of infection caused by carbapenem- resistant K.
pneumonia strains. The inactivation by enzymatic modification is the most prevalent
mechanisms of resistance specially class aph(3)-VI and ant(4’)Iib- confer high- level
resistance towards amikacinand are infrequently encountered. Althoughaac (6)Ib is common
among Enterobacteriaceae, the clinical relevance is largely unknown.[41]
Aac(6)-Ib, the most
prevalent aminoglycoside modifying enzyme that confers resistance to tobramycin,
kanamycin, and amikacin was first identified in K. 15arboring isolates in 1986.[42]
Bremmer
reported that 20(70%), aac(6)Ib positive K. pneumonia isolates were resistant to amikacin,
however, majority showed regrowth supporting the idea that aac(6)-Ib confer intermediated
amikacin resistant.[41]
The percentage of Efflux pump genes were 88% and 29.17% for mexX and mexY,
respectively (figure 8). mexX and mexY (RND; resistance-nodulation-division) are located on
operon within genomic chromosome of Klebsiella pneumonia.[43]
There are increasing
evidence that the role of efflux pumps in antibiotic resistance in bacteria is significant.[43]
Despite high- level resistance may not occur as a result of MDR efflux pumps alone, the
www.wjpr.net Vol 5, Issue 5, 2016.
16
Aziz et al. World Journal of Pharmaceutical Research
association of over- expression of these genes amongst highly resistant clinical isolates
cannot be ignored.[44]
The percentages of resistance for16s ribosomal methylation enzymes were rmtA (20.83%),
rmtB (54.17%), rmtC (zero%), rmtD(33.3%), and rmtF (66.67%) (figure 8). Those enzymes
confer high level resistance to most clinically useful aminoglycosides by inhibiting their
access to the site of action.[45]
As can be seen here, the most dominant gene among local
isolates was rmtF that confers high-level resistance to most clinically relevant
aminoglycosides. This resistance determinant appears to be spreading quickly among
enterobacteria associated with other emerging resistance mechanisms, including NDM-1
carbapenemase.[27]
Morover, rmtB has been detected in various species belonging to the
family Enterobacteriaceae, including K. pneumonia, however, only 0.3% presence of rmtB
among K. pneumonia isolates in Taiwan screened by amikacin and confirmed by PCR.
Detection of this resistance mechanism may pose a challenge in clinical laboratories.[24]
The multiplex oxacillinase genes (OXA 58, OXA 51, OXA 24, and OXA23) showed positive
results for only OXA 23 (8.33%) (figure 7). It is reported that OXA-23 confers high-level
carbapenem resistance.[45]
The emergence of carbapenem-resistant K. pneumoniae strains will
have a serious impact on remaining therapeutic options. β-Lactamase producing strains are
clinically significant, as they are difficult to treat.[46]
Moreover, different types of ESBLs and MBLs arethe major enzymes that are increasing in
pathogenic microorganisms worldwide.[30]
The rate of MBL genes in this study was 16.67%
for blaIMP-1 and zero % for blaVIM (figure 7). Also the results showed ESBLs encoding
genes bla AMP-C for which no positive results (0.00%), however, bla SHV and bla CMY
showed positivity (58.33% and 33.33%, respectively). Ulyashova et. al., revealed in their
work that K. pneumonia isolates did not expressed blaVIM.[47]
It has been revealed by
Hammond et al.,that 13/21 clinical isolates tested in their study expressed bla SHV which is
prevalent in gram- negative bacteria, and it can hydrolyze penicillin and cephalosporines but
not extended spectrum antibiotics oxyimino cephalosporine and monobactams.[47]
Reports of
broad spectrum β-lactamase types such as SHV, mediated by plasmids, have proliferated with
the increased identification of K. pneumonia strains and with the use of cephalosporin
during recent years.[48]
Acquired MBL genes are located on integron that reside on mobile
genetic elements such as plasmids or transposons, thus, enabling widespread
dissemination.[45]
According to research done in Mexican hospital, 31 strains of Klebsiella
www.wjpr.net Vol 5, Issue 5, 2016.
17
Aziz et al. World Journal of Pharmaceutical Research
pneumonia isolated from septicemic pediatric pataints could harbor bla SHV gene and
considered as MDR.[48]
Some of these multidrug- resistant isolates produce extended-
spectrum β- lactamases (ESBLs) that are able to hydrolyze expanded- spectrum
cephalosporins (e.g., ceftriaxone, cefotaxime, and ceftazidime), aztreonam, and related
oxyimino-β- lactams. The substitution of one or more amino acids in bla SHV gene has
altered the configuration of the active site.[48]
ParC2 andGyrA1 (quinolone resistance genes) exhibited54.17% and 75% , respectively, and
this is the first time in Iraq to document the existence of quinolons resistant genes among
Iraqi Klebsiella isolates. Flouroquinolones have been frequently prescribed as empirical
therapy against most hospital and community infections due to increased appearance of
multiple drug resistant gram-negative pathogens and to the disease severity. In countries with
extensive clinical use of quinolones, fluoroquinolone resistance has been a problem in
clinical medicine for its limiting of available agents in the treatment of many types of
infection.[49]
Klebsiella pneumonia isolates showed mutation in either gyrA or ParC or both
genes in different codons resulting in resistance towards quinolones, and these multiple
alterations of gyrA and parC have been associated with ciprofloxacin resistance.[50]
It has
been shown that 77 of 120 test strain K. pneumonia harbor gyrA and par C genes and could
then resist quinolones.[51]
Twenty-two K. pneumonia isolates in other study were resistant to
gatifloxacin, trovafloxacin, moxifloxacin, levofloxacin, and ciprofloxacin, whereas only 7
were clinafloxacin resistant. This resistant mechanism related to alteration in gyrA and par C
genes, too.[52]
Results obtained in this study support data in literature which revealed that K. pneumonia
clinical isolates have been shown to manifest all three broad mechanisms of drug resistance
in gram-negative bacteria, which are the acquisition of novel antibiotic catalytic genes,
mutations of antibiotic targets and membrane proteins, and differential expression of specific
genes such as those for efflux pumps which mediate drug effects.[40]
In this study, K.
pneumonia Sputum 2 and Stool 1 isolates noticed to have 13 genes each out of the 22
antibiotic resistant genes tested compared with other isolates that have range of 3-12 genes
(Figure 9).
In conclusion, antibiotic resistance among various species of bacteria is a global public health
problem.Molecular analysis has been performed to quantify the hypothesis of these isolates
being extremely drug resistant(XDR); therefore, it could be concluded from the results
www.wjpr.net Vol 5, Issue 5, 2016.
18
Aziz et al. World Journal of Pharmaceutical Research
explained above that most of the 24 K. pneumonia local Iraqi isolates covered not only
extremely drug resistance (XDR) pattern but also being pan drug resistant (PDR) pathogens.
A sign of emergency of un treatable isolates
Figure 8: Prevalence and percentage of Antibiotics resistance genes within K.
pneumonia local Iraqi isolates.
Figure 9: The number of resisted genes within twenty four Klebsiella pneumonia isolates
REFERENCES
1. Aboulmagd and Alsultan 2014. Synergic bactericidal activity of novel antibiotic
combinations against extreme drug resistant Pseudomonas aeruginosa and Acinetobacter
baumannii. African Journal of Microbiology Research., 2014; 8(9): 856-861.
2. Huang et. Al. Characterization of Plasmids in Multi-Drug Resistant Enterobacteriaceae
Isolated during prospective Surveillance of a newly opened hospital in Iraq. PloS ONE.,
2012; 7(7): e40360.
www.wjpr.net Vol 5, Issue 5, 2016.
19
Aziz et al. World Journal of Pharmaceutical Research
3. Holt K. E., Wertheim H., Zadokse N.R., Bakerg S.,Whitehouse C.A. Danced D., Jenney
A., Connor T.R., Hsum L. Y., Severin J.,Brisse S., Caob H.,WilkschJ.Gorrie C. Schultz
M.B., Edwards D.J.,Nguyenq K.V., Nguyen T.V.,Daoq T.T., Mensink M. Minh V.L. Nhu
N.T.K.,Schultsz C., Kuntaman K., Newton P.N., Moore C.E., Strugnell R.A. and
Thomson N.R. Genomic analysis of diversity, population structure,virulence, and
antimicrobial resistance in Klebsiella 19arboring , an urgent threat to public health.
PNAS. P., 2015; E3574–E3581.
4. Kurupati P., Wei Tan K., KumarasingheG., and Poh C. Inhibition of gene expression and
growth by antisense peptide nucleic acids in the multiresistant β- lactamase producing
Klebsiella pneumonia. Antimicrobial Agents and Chemotherapy., 2007; 51(3): 805–811.
5. Kumar, V.; Sun, P.; Vamathevan, J.; Li, Y.; Ingraham, K.; Palmer, L.; Huang, J.; and
Brown, J. R. Comparative Genomics of Klebsiella 19arboring Strains with Different
Antibiotic Resistance Profiles. Antimicrobial Agents and Chemotherapy., 2011; 55(9):
4267–4276.
6. Akbar et. Al. Isolation and Identification of Multi-Drug Resistant Strains of Non- Lactose
Fermenting bacteria from Clinical Isolates. Open Journal of Microbiology., 2014; 4:
115-123.
7. Chmelnitsky I., ShklyarM.,Hermesh O.,Navon-Venezia S., Edgar R. and Carmeli Y.
Unique genes identified in the epidemic extremely drug-resistant KPC-producing
Klebsiella 19arboring sequence type 258. J Antimicrob Chemother., 2013; 68: 74–83.
8. Giske C. G., Monnet D. L., Cars O.,3 and Carmeli Y. Clinical and Economic Impact of
Common Multidrug-ResistantGram-Negative Bacilli. ANTIMICROBIAL AGENTS
AND CHEMOTHERAPY., 2008; 52(3): 813–821.
9. Radhaet al., 2012. Evaluation of bacterial isolated from clinical sample for multidrug
resistance. J. Microbiol. Biotech. Res., 2012; 2(1): 138-146.
10. Bonnin R. A., Naas T., Poire L., Nordmann P. Phenotypic, Biochemical, and Molecular
Techniques for Detection of Metallo-_-Lactamase NDM in Acinetobacter baumannii.
Journal of Clinical Microbiology., 2012; 50(4): 1419–1421.
11. CLSI. Performance standards for antimicrobial susceptibility testing; Twenty-Third
informational supplement., 2013; 33(1): M100-S23.
12. Pasteran F., Lucero C., Rapoport M., Guerriero L., Barreiro I.,Albornoz E., Veliz O,
Corso A.. Tigecycline and intravenous fosfomycin zone breakpoints equivalent to
theEUCAST MIC criteria for Enterobacteriaceae. J Infect Dev Ctries, 2012; 6(5):
452-456.
www.wjpr.net Vol 5, Issue 5, 2016.
20
Aziz et al. World Journal of Pharmaceutical Research
13. Galani I, Kontopidou F, Souli M, Rekatsina PD, Koratzanis E, Deliolanis J, Giamarellou
H. Colistin susceptibility testing by Etest and disk diffusion methods. Int J Antimicrob
Agents., 2008; 31(5): 434-9.
14. Falagas M. E., Rafailidis P. I., Matthaiou D. K., Virtzili S., Nikita D., Michalopoulos A.
Pandrug-resistant Klebsiella 20arboring, Pseudomonas aeruginosa and Acinetobacter
baumannii infections: Characteristics and outcome in a series of 28 patients. International
Journal of Antimicrobial Agent., 2008; 32(5): 450–454.
15. Al-jubori, S.S. Genetic and molecular study on β-lactamases enzyme produced by local
isolates of Gram negative bacteria. Ph. D. dissertation. College of Science, Al-
Mustansiriya University. Iraq., 1997.
16. Sambrook, J. & Russell, D.W. Molecular Cloning: ALaboratory Manual Cold Spring
Harbor. New York, USA, ColdSpring Harbor Laboratory Press., 2001.
17. Lianes, C.; Hocquet, D.; Vogne, C.; Benali-Baitich, D.; Neuwirth, C.; and Plesiat, P.
Clinical strains of Pseudomonas aeruginosaover producing MexAB-OprM and MexXY
efflux pumps simultaneously. Antimicrob. Agents Chemother., 2004; 48: 1797–1802.
18. Xavier, D.E.; Renata, C. P.; Raquel, G.; Lorena, C.C.F. and Ana, C. G. Efflux pumps
expression and its association with porin down – regulation and β- lactamase production
among pseudomonas aeruginosa causing bloodstream infections in Brazil. BMC
microbiology., 2010; 10: 217.
19. Ndegwa, D. W.; Budambula, N.L.M.; Kariuki, G. and Kiiru, J. N. Aminoglycoside
modifying enzymes detected in strains of Escherichia, Klebsiella, Pseudomonas and
Acinetobacterimplicated in invasive infections in Nairobi, Kenya. Centre for
Microbiology. Kenya Medical Research Institute. Nairobi. Kenya., 2012.
20. Haldorsen, B. C. Aminoglycoside resistance in clinical Gram-negative isolates from
Norway. M. Sc. thesis in medical biology. Norway. University of Tromso., 2011.
21. Vaziri, F.; Peerayeh, S.N.; Nejad, Q.B. and Farhadian, A. (2011). The prevalence of
aminoglycoside modifying enzyme genes (aac (69)-I, aac (69)-II, ant (20)-I, aph (39)-VI)
in Pseudomonas aeruginosa. Clinics Science., 2011; 66(9): 1519-1522.
22. Oliveira, F.A.; Paludo, K.S.; Arend, L.N.; Farah, V.S.; Pedrosa, F.O.; Souza, E.M.;Surek.
M.; Picheth, G. and Fadel-Picheth, C. M. T. Virulence characteristics and antimicrobial
susceptibility of uropathogenicEscherichia coli strains. Genetics and Molecular
Research., 2011; 10(4): 4114-4125.
23. Ramazanzadeh, R. Etiologic agent and extended spectrum beta- Lactamases production
urinary tract infect on in sanandaj. Iran. Eastern Journal of medician., 2010; 15: 57-62.
www.wjpr.net Vol 5, Issue 5, 2016.
21
Aziz et al. World Journal of Pharmaceutical Research
24. Mendes RE, Kiyota KA, Monteiro J. Rapid detection and identificationofmetallo-b-
lactamase-encoding genes by multiplex real-time PCR assayand melt curve analysis. J
Clin Microbiol., 2007; 45: 544–7.
25. Doi, Y. and Arakawa, Y. 16S ribosomal RNA methylation: emerging resistance
mechanisms against aminoglycosides. J. Clin. Infect. Dis. 2007; 45: 88-94.
26. Tijet, N.; Andres, P.; Chung, C.; Lucero, C.; WHONET –Argentina Group; Low, D.E.;
Galas, M.; Corso, A.; Petroni, A. and Melano, R.G. rmtD2, a New Allele of a 16S
rRNAMethylase Gene, Has Been Present in Enterobacteriaceae Isolates from Argentina
for more than a Decade. J. Antimicrob. Agents Chemother. 2011; 2(55): 904-909.
27. Lee, H.; Yong, D.; Yum, J.H.; Roh, K.H.; Lee, K.; Yamane, K.; Arakawa, Y. and Chong,
Y. Dissemination of 16S rRNAmethylase-mediated highly amikacin resistant isolates of
KlebsiellapneumoniaeandAcinetobacterbaumannii in Korea. J. Diagnos. Microbiol.
Infect. Dis., 2006; 53: 305-312.
28. Morovat, T.;Bahram, F; Mohammad, E; Setareh, S., and Mehdi, F. M. Distribution of
different carbapenem resistant clones of Acinetobacter baumannii in Tehran Hospitals.
New Microbiologica., 2009; 32: 265-271.
29. ClarridgeJ. E. Impact of 16S rRNA Gene Sequence Analysis for Identification ofBacteria
on Clinical Microbiology and Infectious Disease. CLINICAL MICROBIOLOGY
REVIEWS., 2004; 17(4): 840–862.
30. Radha K., Uma R., Ramanathan G., and Thangapandian V. Journal of Microbiology and
Biotechnology Research. Journal of Microbiology and Biotechnology Research., 2012;
2(1): 138-146.
31. Bartual S.G., Seifert H.,Hippler C., Luzon M. Development of a Multilocus Sequence
Typing Scheme forCharacterization of Clinical Isolates of Acinetobacter- baumannii.
JOURNAL OF CLINICAL MICROBIOLOGY., 2005; 43(9): 4382-4390.
32. Rhee J.Y., Park Y. K., Shin J.Y., Choi J. Y., Lee M. Y., Peck K. R., Song J., and Ko K.
S. KPC-Producing Extreme Drug-Resistant Klebsiella pneumoniaeIsolatefrom a Patient
with Diabetes Mellitus and Chronic Renal Failure on Hemodialysis in South Korea.
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, May 2010; 54(5): 2278–2279.
33. Brink A., Feldman C., Richards G., Moolman J., Senekal M.
Emergenceofextensivedrugresistance (XDR) among Gramnegativebacilliin South Africa
loomsnearer. SAMJ., 2008; 98(8): 585-592.
34. Nordmann, P.; Naas, T.; and Poirel L. Global Spread of Carbapenemase producing
Enterobacteriaceae. Emerging Infectious Diseases., 2011; 17(10): 1791-1798.
www.wjpr.net Vol 5, Issue 5, 2016.
22
Aziz et al. World Journal of Pharmaceutical Research
35. Bonnin, R. A.; Naas, T.; Poirel, L., and Nordmann P. Phenotypic, Biochemical, and
Molecular Techniques for Detection ofMetallo-β-Lactamase NDM in Acinetobacter
baumannii. Journal of Clinical Microbiology., 2012; 1419–1421.
36. Nordmann, P.; Naas, T.; and Poirel L. Global Spread of Carbapenemase producing
Enterobacteriaceae. Emerging Infectious Diseases. 2011; 17(10): 1791-1798.
37. Ensor VM, Shahid M, Evans JT and Hawkey PM. Occurrence, prevalence andgenetic
environment of CTX-M β-lactamases in Enterobacteriaceae from Indianhospitals. J
AntimicrobChemother., 2006; 58: 1260-3.
38. Dhara M., Disha P., Sachin P., Manisha J., Seema B., Vegad M. Comparison of various
methods for the detection of extended spectrum beta lactamase in Klebsiella pneumonia
isolated from neonatal intensive care unit, Ahmadabad. NATIONAL JOURNAL OF
MEDICAL RESEARCH., 2012; 2(3): 348.
39. Poorabbas B., Mardaneh J., Rezaei Z., Kalani M., Pouladfar G.,Alami M. H., Soltani J.,
Shamsi-Zadeh A., Abdoli-OskooiS, Saffar M. J., Alborzi A. Nosocomial Infections:
Multicenter surveillance of antimicrobialresistance profile of Staphylococcus aureus and
Gram negative rodsisolated from blood and other sterile body fluids in Iran. Iranian
Journal of Microbiology., 2015; 7(3): P127-135.
40. Kumar, V.; Sun, P.; Vamathevan, J.; Li, Y.; Ingraham, K.; Palmer, L.; Huang, J.; and
Brown, J. R. Comparative Genomics of Klebsiella 22arboring Strains with Different
Antibiotic Resistance Profiles. Antimicrobial Agents and Chemotherapy., 2011; 55(9):
4267–4276.
41. Bremmer D. N., Clancy C.J., Press E.G., Almaghrabi R., Chen L., Doi Y., Nquyen M.H.,
and Shields R.K. KPC- Producing Klebsiella pneumonia strains that harbor aac(6’)-Ib
exhibit intermediate resistance to amikacin.Antimicrobial Agents and Chemotherapy.,
2014; 58(12): 7597-7600.
42. Kim Y., Jang J., Kim H., Kim H., Lee K., Park K.S., Lee H., and Kim Y. Identification of
strain 22arboring both aac(6’)-Ib and aac(6’)-IB-cr variant simultaneously in Escherichia
coli and Klebsiella pneumonia. BMB reports., 2011; 44(4): 262-266.
43. Poole K. Efflux-mediated antimicrobial resistance. Journal of Antimicrobial
Chemotherapy., 2005; 56: 20-51.
44. Webber M. A. and Piddock L. J. V. The importance of efflux pumps in bacterial
antibiotic resistance. Journal of Antimicrobial Chemotherapy., 2003; 51: 9-11.
45. Adams-Haduch J.M, Paterson D.L., Sidjabat H.E., Pasculle A.W., Potoski B.A., Muto
C.A., Harrison L.H., and Doi Y. Genetic Basis of Multidrug Resistance in Acinetobacter
www.wjpr.net Vol 5, Issue 5, 2016.
23
Aziz et al. World Journal of Pharmaceutical Research
baumanniiClinical Isolates at a Tertiary Medical Center in Pennsylvani. IMICROBIAL
AGENTS AND CHEMOTHERAPY., 2008; 52(11): 3837–3843.
46. Ulyashova М. М., KhalilovaYu. I., RubtsovaМ. Yu., Edelstein М. V. , AlexandrovaI. А.,
Egorov А. М. Oligonucleotide Microarray for theIdentification of Carbapenemase
Genesof Molecular Classes A, B, and D.ACTA NATURAE, 2010; 2 №3(6): 101-109.
47. Hammond D. S., Schooneveldt j. m., Nimmo G. R., Huygens F.,andGiffard P. M. bla
SHV genes in Klebiella pneumonia: Different allele distributions are associated with
different promoterswithin individual isolates.Antimicrobial Agents and Chemotherapy.,
2005; 49(1): 256-263.
48. Silva J., Gatica R., Aguilar C., Becerra Z., Garza-Ramos U., Velazquez M., Miranda G.,
Leanos B., Solorzano F., and Echaniz G. Outbreak of infection with extended-spectrum
β-lactamase- producing Klebsiellapneumonia in aMexican hospital. Journal of clinical
microbiology., 2001; 39(9): 3193-3196.
49. Minarini L. A.R. and Darini A. L. Mutations in the quinolone resistance- determining
regions of gyrA and ParC in Enterobacteraceae isolates from Brazil. Brazilian Journal of
Microbiology., 2012; 1517-8382. P. 1309-1314.
50. Al- Marzooq F., Yusof M.Y.M., and Tay S. T. Molecular analysis of ciprofloxacin
resistance mechanisms in Malaysian ESBLs- Producing Klebsiella pneumonia isolates
and development of mismatch ampliflication mutation assays (MAMA) for rapid
detection of GyrA and Par Cmutations. BioMed Research International., 2014; 1: 1-10.
51. Brisse S. and Verhoef J. Phylogenetic diversity of Klebsiella pneumonia and
Klebsiellaoxytoca clinical isolates revealed by randomly amplified polymorphic DNA,
gyrA and Par C genes sequencing and automated ribotyping. International Journal of
Systemic and Evolutionary Microbiology., 2001; 51: 915-924.
52. Brisse S., Milatovic D., Fluit A.C., Verhoef J., Martin N., Scheuring S., Koherer K., and
Schmitz F. Comparative in vitro activities of ciprofloxacin, clinafloxacin, gatifloxacin,
levofloxacin, moxifloxacin, and trovafloxacin against Klebsiella pneumonia,
Klebsiellaoxytoca, Enterobacter cloacae, and Enterobacter aerogenes clinical isolates with
alterations in GyrAandPar C proteins. Antimicrobial Agents and Chemotherapy., 1999;
43(8): 2051-2055.