Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA

I

Extraction and Analysis of Antioxidant Capacity

in Rice Bran Extracts from Different Sarawak

Local Rice Varieties

By

Tan Xian Wen

A thesis submitted to the

Faculty of Engineering, Computing and Science,

Swinburne University of Technology Sarawak Campus,

Malaysia

in fulfilment of the requirements for the degree of

Master of Science by Research

2015

II

Abstract

Sarawak is blessed with many different local rice varieties. However, the

nutritional contents and value-added processing possibilities of these local rice

varieties remain underexplored. This research project was conducted to extract

and assess natural antioxidant contents from rice bran of selected Sarawak

local rice varieties. The rice bran extracts (RBE) were then further tested with in

vitro chemical- and cell-based antioxidant assays preliminarily to evaluate their

respective antioxidant capacities in alleviating oxidative injuries. The results

revealed that RBE of different Sarawak local rice varieties contain significant

amount of natural antioxidants. According to the current finding, Bajong LN RBE

has the highest contents of phenolic compounds, flavonoids, and γ-oryzanol

among all the tested samples. It was also discovered that higher average total

phenolic, flavonoids, and tocotrienols contents were detected in RBE of

Sarawak local rice varieties studied as compared to those in certain rice

varieties cultivated elsewhere. In vitro chemical-based antioxidant assays

further revealed the dose-dependent 2,2-diphenyl-1-picrylhydrazyl (DPPH) free-

radical scavenging capabilities of RBE to which the effectiveness differed

among RBE of different local rice varieties. Among all the tested rice varieties,

highest free-radical scavenging activity was detected with Bajong LN RBE and

was significantly higher than that with RBE of commercial rice variety, MR219.

Both Bajong LN and MR219 RBE were selected for in vitro cell-based

antioxidant assay. Here, the H9c2(2-1) cardiomyocyte was used and the cellular

induction effects with selected RBE and H2O2 were studied. Incubation of

H9c2(2-1) with RBE and H2O2 showed dose-dependent cytotoxic effects

respectively. Such observation revealed the potential prooxidant activity of RBE

which consequently reduced cell viability at higher concentration. Cellular

induction with safe dose range of RBE showed significant improvement in

enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and

glutathione peroxidase (GPx) in H9c2(2-1). Co-incubation of H9c2(2-1) with

RBE and H2O2 further revealed the potential of RBE in alleviating H2O2-induced

oxidative injuries as observed through a right shift in IC50 of H2O2. Higher

increment in IC50 of H2O2 was detected with Bajong LN RBE as compared to

MR219 RBE. Besides that, significant up-regulations in enzymatic activity and

III

expression of CAT were also reported from H9c2(2-1) co-incubated with RBE

and H2O2. As a summary, the present result put forward the potential of RBE as

a source of antioxidants for alleviation of oxidative injuries in cardiovascular

diseases (CVD). Additional studies are still required to further investigate the

utilization of RBE as a strategy to combat oxidative stress-induced CVD.

IV

Acknowledgement

I would like to express my sincerest gratitude to my supervisor, Dr.

Hwang Siaw San, for her persistent guidance, advice and support throughout

the progression of my research project as well as the completion of this

dissertation. It is an honourable pleasure to have her as supervisor who show

endless care for my work and diligently responded to my doubts at times of

difficulties of my research. In addition to that, I would like to acknowledge my

co-supervisors Dr. Alan Fong Yean Yip, Dr. Ng Sing Muk and Dr. Irine Henry

Ginjom for their valuable advice and for sharing their knowledge and

experiences on technical related uncertainties in my research.

I would like to sincerely thank Prof. Mrinal Bhave from Swinburne

University of Technology Melbourne for providing technical advices and funding

support to facilitate the research work. I would like to further extend my

gratitude to Prof. Yuen Kah Hay and Dr. Sherlyn Lim Sheau Chin from Universiti

Sains Malaysia (USM), Penang for granting access to their HPLC analytical

laboratory and also providing necessary technical advice, chemicals and

consumables required for the HPLC analysis work of this research. Also, I am

delighted to express my gratitude to Dr. Paul Neilsen from Swinburne University

of Technology, Sarawak Campus, and Prof. Eiji Matsuura, Dr. Kazuko

Kobayashi and Dr. Shen Lian Hua from Okayama University Graduate School

of Medicine, Dentistry and Pharmaceutical Sciences for their assistance in

providing invaluable technical advices on cell culture-related work.

I must express my gratitude to my family, especially my parents and

brother for their continuous support, encouragement and patience for

experiencing the peaks and valleys at times of my research. Also not to forget

the guidance and supports from my fellow lab mates: Jessica Fong, Diana Choo,

Melissa Chang, Yan Huey, Reagan and lab colleagues, Jia Ni, Rafika and Nurul

for keeping my things in perspective.

Last but not least, I would like to thank Faculty of Engineering,

Computing and Science, Swinburne Sarawak and Research Consultancy Office

Swinburne Sarawak for providing the necessities which have allowed me to

V

pursue this research. The expenses for the research work, conferences and

research attachment were supported by Swinburne Sarawak Research Grant

2013 (SSRG Grant 2-5503), Melbourne-Sarawak Research Collaboration

Scheme Grant (MSRCS 2013) and Strategic Research Grant (StraRG 2-5607).

Permission has been granted by Sarawak Biodiversity Centre (SBC), Malaysia

for accession to the collection and research on the selected Sarawak local rice

varieties (Research Agreement No.: SBC-RA-0093-HSS).

VI

Declaration by Candidate

I, Tan Xian Wen, higher degree research student of Masters of Science

by Research, from Faculty of Engineering, Computing and Science, Swinburne

University of Technology Sarawak Campus hereby declare that this dissertation

is original and contains no material which has been accepted for award to the

candidate of any other degree or diploma, except where due reference is made

in the text of the examinable outcome. To the best of candidate’s knowledge,

this thesis contains no material previously published or written by another

person except where due reference is made in the text of the examinable

outcome; and where the work is based on joint research or publications, the

relative contributions of the respective workers or authors has been disclosed.

__________________________ (TAN XIAN WEN)

As the principal coordinating supervisor, I hereby acknowledge and certify that

the above mentioned statements are legitimate to the best of my knowledge.

___________________________

(DR. HWANG SIAW SAN)

VII

Table of Contents

Abstract ....................................................................................................................... II

Acknowledgement ...................................................................................................... IV

Declaration by Candidate ............................................................................................ VI

Conference Presentation ............................................................................................ XI

Conference Awards .................................................................................................... XI

List of Figures and Tables .......................................................................................... XII

Chapter 1: Introduction ................................................................................................ 1

1.1. Research Background ........................................................................................ 1

1.2. Research Aims and Objectives ........................................................................... 5

1.3. Research Contributions and Impact to Society ................................................... 6

Chapter 2: Extraction of Natural Antioxidant from Rice Bran ........................................ 7

2.1 Executive Summary ............................................................................................ 7

2.2 Literature Review ................................................................................................ 8

2.2.1 Rice and Rice Brans .......................................................................... 8

2.2.2 Extraction and Analysis of Antioxidants ........................................... 10

2.2.3 Rice Antioxidants ............................................................................. 15

2.2.3.1 Polyphenols ..................................................................................... 16

2.2.3.1.1 Phenolic Acids in Rice .................................................................. 19

2.2.3.1.2 Flavonoids in Rice ........................................................................ 19

2.2.3.1.3 Anthocyanins in Rice .................................................................... 21

2.2.3.1.4 Heath Benefits of Polyphenols ...................................................... 21

2.2.3.2 Gamma-Oryzanol ............................................................................ 24

2.2.3.2.1 Health benefits of γ-Oryzanol ........................................................ 24

2.2.3.3 Vitamin E ......................................................................................... 27

2.2.3.3.1 Health Benefits of Vitamin E (Tocotrienols) ................................... 28

2.3 Research Aims and Objectives ......................................................................... 31

2.4 Experimental Design......................................................................................... 31

2.4.1 Materials and Chemicals ................................................................. 31

2.4.1.1 Rice Samples .................................................................................. 31

2.4.1.2 Chemicals ....................................................................................... 33

2.4.2 Rice Sample Treatment and Preparation of Rice Bran Sample ....... 34

2.4.3 Methodology .................................................................................... 35

2.4.3.1 Simple Solvent Extraction ................................................................ 35

2.4.3.3 Determination of Total Flavonoid Content ........................................ 36

VIII

2.4.3.4 Determination of Total Anthocyanin Content.................................... 37

2.4.3.5 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content ....... 38

2.4.3.6 Determination of Vitamin E Content ................................................. 39

2.4.3.7 Statistical Analysis ........................................................................... 39

2.4.4 Results and Discussion ................................................................... 40

2.4.4.1 Determination of Total Phenolic Content ......................................... 40

2.4.4.2 Determination of Total Flavonoid Content ........................................ 44

2.4.4.3 Determination of Total Anthocyanin Content.................................... 46

2.4.4.4 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content ....... 48

2.4.4.5 Determination of Vitamin E Content ................................................. 50

2.4.5 Conclusion ...................................................................................... 54

Chapter 3: Bioactivity Studies of Natural Antioxidants Derived from Rice Bran of

Different Sarawak Local Rice Varieties .......................................................................57

3.1 Executive Summary .......................................................................................... 57

3.2 Literature Review .............................................................................................. 58

3.2.1 Reactive Oxygen Species (ROS) and Oxidative Stress ............................. 58

3.2.2 Oxidative Stress Related Disease ............................................................. 60

3.2.2.1 Cardiovascular Diseases ................................................................. 61

3.2.2.1.1 Atherosclerosis ................................................................................ 62

3.2.2.1.2 Myocardial Infarction (MI) and Myocardial Reperfusion Injury .......... 66

3.2.3 Antioxidants .............................................................................................. 69

3.2.3.1 Endogenous antioxidant .................................................................. 70

3.2.3.1.1 Superoxide Dismutase (SOD) ......................................................... 70

3.2.3.1.2 Catalase (CAT) ................................................................................ 71

3.2.3.1.3 Glutathione Peroxidase (GPx) ......................................................... 72

3.2.3.2 Exogenous Antioxidants .................................................................. 73

3.3 Research Aims and Objectives ......................................................................... 75

3.4 Experimental Design......................................................................................... 75

3.4.1 Materials and Chemicals ................................................................. 75

3.4.2 Test Samples .................................................................................. 76

3.4.3 Methodology .................................................................................... 76

3.4.3.1 In Vitro Chemical-Based System ..................................................... 78

3.4.3.1.1 DPPH Free Radical Scavenging Assay ........................................... 78

3.4.3.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay .................... 78

3.4.3.1.3 Statistical Analysis ........................................................................... 79

3.4.3.2 In Vitro Cell Culture-Based System ................................................. 80

IX

3.4.3.2.1 Cell Culture and Growth Curve Study ........................................... 80

3.4.3.2.2 Cell cytotoxicity Assay .................................................................. 81

3.4.3.2.3 Induction of Oxidative Stress ........................................................ 82

3.4.3.2.4 Endogenous Antioxidant Enzyme Activity Studies ........................ 82

3.4.3.2.5 Endogenous Antioxidant Enzyme Gene Expression Studies ........... 83

3.4.3.2.6 Statistical Analysis ........................................................................... 85

3.4.4 Results and Discussions ................................................................. 86

3.4.4.1 In Vitro Chemical-Based System ..................................................... 86

3.4.4.1.1 DPPH Free Radical Scavenging Assay ........................................... 86

3.4.4.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay .................... 93

3.4.4.2 In Vitro Cell Culture-Based System ................................................. 98

3.4.4.2.1 Morphology and Growth of H9c2(2-1) Cardiomyocytes ................. 98

3.4.4.2.2 Cell Cytotoxicity Assay (RBE) ..................................................... 101

3.4.4.2.3 Cell Cytoxicity Assay (Hydrogen Peroxide) ................................. 109

3.4.4.2.4 Cell Viability Assay (Rice Bran Extract + Hydrogen Peroxide) .... 112

3.4.4.2.5 Effects of Different Treatments on Activities and Gene Expression

of Endogenous Cellular Antioxidant Enzymes in H9c2(2-1) Cells ............... 118

(A) Superoxide Dismutase (SOD) ....................................................... 119

(i) Effects of RBE on total SOD enzymatic activity and gene expression

of SOD2 in H9c2(2-1) Cells ........................................................... 119

(ii) Effects of H2O2 on total SOD enzymatic activity and gene expression

of SOD2 in H9c2(2-1) Cells ........................................................... 121

(iii) Effects of H2O2 on total SOD enzymatic activity and gene expression

of SOD2 in H9c2(2-1) cells pre-treated with RBE .......................... 123

(B) Catalase (CAT) .............................................................................. 129

(i) Effects of RBE on total enzymatic activity and gene expression of

CAT in H9c2(2-1) cells .................................................................. 129

(ii) Effects of Hydrogen peroxide (H2O2) on total enzymatic activity and

gene expression of CAT in H9c2(2-1) cells .................................... 131

(iii) Effects of H2O2 on total enzymatic activity and gene expression of

CAT in H9c2(2-1) cells pre-treated with RBE ................................. 133

(C) Glutathione Peroxidase (GPx) ....................................................... 137

(i) Effects of RBE on total GPx enzymatic activity and gene expression

of GPx1 in H9c2(2-1) cells ............................................................. 137

(ii) Effects of Hydrogen peroxide (H2O2) on total GPx enzymatic activity

and gene expression of GPx1 in H9c2(2-1) cells ........................... 139

(iii) Effects of H2O2 on total GPx enzymatic activity and gene expression

of GPx1 in H9c2(2-1) cells pre-treated with RBE ........................... 141

3.4.5 Conclusion .................................................................................... 145

X

Chapter 4: Research Limitations and Future Works .................................................. 149

4.1 Project Limitations .......................................................................................... 149

4.2 Future Works .................................................................................................. 152

Appendices ............................................................................................................... 153

5.1 Graphical representations ............................................................................... 153

5.2 Tabulation of Data .......................................................................................... 166

References ............................................................................................................... 167

XI

Conference Presentation

1. Tan, XW, Fong, AYY, Ng, SM, Ginjom, IR & Hwang, SS 2014,

‘Preliminary screening of γ-oryzanol (γ-ory) content in local rice varieties

of Sarawak’, The 18th Biological Sciences Graduate Congress (BSGC),

University of Malaya (UM), Kuala Lumpur, January 6 – January 8, 2014.

2. Tan, XW, Fong, AYY & Hwang, SS 2014, ‘The studies on antioxidant

activity of Sarawak local rice varieties’, 2nd International Conference on

Advances in Plant Sciences (ICAPS 2014), Kuching, Sarawak ,

Malaysia, November 18 – November 22, 2014.

3. Tan, XW, Bhave, M, Fong, AYY & Hwang, SS 2015, ‘Potential

cytoprotective effects of rice bran extracts against oxidative stress in rat

cardiomyocytes’, The Annual Conference on Life Sciences and

Engineering (ACLSE), Osaka, Japan, August 25 – August 27, 2015.

Conference Awards

1. ‘The Gold Medal Winner for Poster Presentation’, Applied Science and

Biotechnology category, The 18th Biological Sciences Graduate

Congress (BSGC), University of Malaya (UM), Kuala Lumpur,

January 6 – January 8, 2014.

2. ‘Upstream Category Silver Award – Best Poster’, 2nd International

Conference on Advances in Plant Sciences (ICAPS 2014), Kuching,

Sarawak, Malaysia, November 18 – November 22, 2014.

XII

List of Figures and Tables

1. Figures

Figure 2-1: An example of Sarawak local rice varieties, ‘Padi Bario’ (also known as

Bario rice. ................................................................................................... 2

Figure 2-1: Local rice varieties of Sarawak ................................................................... 8

Figure 2-2: Chemical structure of phenol functional group. ......................................... 16

Figure 2-3: Basic structural configurations of different flavone and flavonol derivatives

[image source: (Tanaka & Takahashi 2013)] ............................................ 20

Figure 2-4: General pharmacological properties and biological mechanism/molecular

targets of polyphenols ..................................................................................

Figure 2-5: Chemical structure of four major constituents of γ-oryzanol: (A) cycloartenyl

ferulate; (B) campesteryl ferulate; (C) 24-methlenecycloartenyl ferulate; (D)

β-sitosteryl ferulate. .................................................................................. 25


targets of γ-oryzanol .....................................................................................

Figure 2-7: General chemical Structures of (A) tocopherol and (B) tocotrienol. [Image

source: (Wolf 2005)] ................................................................................. 27


targets of tocotrienol ................................................................................. 30

Figure 2-9: Overview of experimental approaches applied for extraction of antioxidants

from rice bran samples and determination of the contents of antioxidants in

the extracts. .............................................................................................. 35

Figure 2-10: HPLC chromatograms of (a) Tocomin50 and (b) RBE of Bajong LN. Delta

T3: δ-tocotrienols; Gamma T3: γ-tocotrienols; Alpha T3: α-tocotrienols;

Tocopherol: mainly α-tocopherol .............................................................. 50

Figure 2-11: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different

RBE were expressed in units of %. The data represented mean ± standard

deviation of three repetitions (n=3). T3 = Tocotrienols; T = Tocopherol. ... 53

Figure 3-1: Graphical representation of atherosclerotic plaque formation [Image

source:(Quillard & Libby 2012a)] .............................................................. 64

Figure 3-2: Developmental stages of atherosclerosis (Quillard & Libby 2012b; Toh et al.

2014) ........................................................................................................ 65

Figure 3-3: Graphical representation of acute myocardial infarction (MI). Normal blood

flow to heart is disrupted at site of arterial blockage and subsequently

damages the heart muscles and tissues. [Image source: (Antipuesto 2014) ]

................................................................................................................. 67

Figure 3-4: Overview of experimental approaches applied for bioactivity studies of

antioxidants from rice bran extracts ..............................................................

Figure 3-5: DPPH free radical scavenging activities of different concentrations of

different crude RBE. The data represented mean ± standard deviation of

three repetitions (n=3). ............................................................................. 89

Figure 3-6: Cell image of healthy H9c2(2-1) cardiomyocytes taken through an inverted

light microscope (Magnification: 200x) ...................................................... 98

XIII

Figure 3-7: Growth curve of H9c2(2-1) cardiomyocytes over 8 days of incubation period.

Each alphabet represents different growth phases of the cells. (a): Log

phase; (b): Exponential phase; (c): Stationary phase; (d): Doubling time

(~2.73 days) ............................................................................................. 99

Figure 3-8: Microscope (40x magnification) images of H9c2(2-1) cardiomyocytes at

different time points (1st to 8th day). ......................................................... 100

Figure 3-9: Cell images of (a) healthy H9c2(2-1) cardiomyocytes (negative control)

and (b) H9c2(2-1) cells induced with lethal dosage of Bajong LN extract

(500 µg/mL). Red oval inset in (b) showed apoptotic H9c2(2-1) cells.

*Magnification: 40x ................................................................................. 101

Figure 3-10: Cell viability curves of H9c2(2-1) cardiomyocytes treated with different

concentrations (6.25µg/mL to 500µg/mL) of (A) Bajong LN and (B) MR219

RBE over 24, 48 and 72 hours of incubation time respectively. Best fit

curves were drawn by using excel for visual purposes. .......................... 103

Figure 3-11: Cell viability curves of H9c2(2-1) cells treated with different concentrations

of hydrogen peroxide (H2O2). The insets showed the inhibition

concentration (IC50) of H2O2 on H9c2(2-1) cells determined via GraphPad

Prism (GraphPad Software, Inc. USA). Best fit curve were drawn using

excel for visual purpose. ......................................................................... 109

Figure 3-12: Effects of H2O2 inductions on cell viabilities of H9c2(2-1) cardiomyocytes

pre-treated with different concentrations of Bajong LN RBE (25µg/mL and

50µg/mL) and MR219 RBE (50µg/mL and 100µg/mL) ............................ 114

Figure 3-13: (A) Total SOD enzymatic activities and (B) gene expression levels of

SOD2 in H9c2(2-1) cells pre-treated with RBE. Data represent mean ±

standard deviation of three repetitions (n=3). ‘*’: significantly different from

negative control at P ≤0.05 and ‘**’: significantly different from negative

control at P ≤0.01. .................................................................................. 120


SOD2 in H9c2(2-1) cells after induction with different concentrations of

H2O2. Data represent mean ± standard deviation of three repetitions (n=3).

‘*’: significantly different from negative control at P ≤ 0.05 and ‘**’:

significantly different from negative control at P≤0.01. ........................... 122


SOD2 in RBE pre-treated H9c2(2-1) cells after induction with 125µM of

H2O2. Data represent mean ± standard deviation of three repetitions (n=3).

‘*’: significantly different from negative control (P ≤0.05); ‘**’: significantly

different from negative control (P ≤0.01) ................................................ 124

Figure 3-16: (A) Total enzymatic activities and (B) gene expression levels of CAT after

treated with RBE. Data represent mean ± standard deviation of three

repetitions (n=3). ‘*’: significantly different from negative control at P ≤0.05

and ‘**’: significantly different from negative control at P ≤0.01. ............. 130

Figure 3-17: (A) Total enzymatic activities and (B) gene expression levels of CAT after

induction with different concentrations of H2O2. Data represent mean ±

standard deviation of three repetitions (n=3). ‘*’: significantly different from

negative control at P ≤0.05 and ‘**’: significantly different from negative

control at P ≤0.01. .................................................................................. 132

XIV

Figure 3-18: (A) Total enzymatic activities and (B) gene expression levels of CAT in

RBE pre-treated H9c2(2-1) cells after induction with 125µM of H2O2. Data

represent mean ± standard deviation of three repetitions (n=3). ‘*’:

significantly different from negative control (P≤ 0.05); ‘**’: significantly


Figure 3-19: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1

after treated with RBE. Data represent mean ± standard deviation of three

repetitions (n=3). ‘*’: significantly different from negative control at P ≤0.05

and ‘**’: significantly different from negative control at P ≤0.01. ............. 138

Figure 3-20: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1

after induction with different concentrations of H2O2. Data represent mean

± standard deviation of three repetitions (n=3). ‘*’: significantly different

from negative control at P ≤ 0.05 and ‘**’: significantly different from

negative control at P ≤0.01. ................................................................... 140

Figure 3-21: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx

in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H2O2.

Data represent mean ± standard deviation of three repetitions (n=3). ‘*’:

significantly different from negative control (P ≤ 0.05); ‘**’: significantly


Figure 5-1: Total phenolic content of different RBE were expressed in unit of mg GAE/g

dried extracts. Vertical bars and errors bars represent the mean ± standard

deviation of 3 experimental repetitions (n=3). Similar letters on each bar

represent significant differences at P ≤ 0.05 (Tukey’s Test). GAE = Gallic

Acid Equivalent. ...................................................................................... 153

Figure 5-2: Total flavonoid content of different RBE were expressed in unit of mg QE/g

dried extracts. Vertical bars and errors bars represent the mean ± standard

deviation of 3 experimental repetitions (n=3). Different letters on each bar

represent significant differences at P ≤ 0.05 (Tukey’s Test). QE =

Quercetin Equivalent. ............................................................................. 154

Figure 5-3: Total anthocyanin content of different RBE were expressed in unit of mg

C3G/100g dried extracts. Vertical bars and errors bars represent the mean

± standard deviation of 3 experimental repetitions (n=3). The ‘*’ annotation

represents significant difference at P ≤ 0.05 from RBE of Bajong (Tukey’s

Test). ...................................................................................................... 155

Figure 5-4: Total γ-oryzanol content of different crude rice bran extracts were

expressed in unit of mg/kg dried extracts. Vertical bars and errors bars

represent the mean ± standard deviation of 3 experimental repetitions

(n=3). Different letters on each bar represent significant differences at P ≤

0.05 (Tukey’s Test). ................................................................................ 156

Figure 5-5: Inhibitory concentration (IC50) of different RBE for DPPH free radical

scavenging assay. Tocomin50 was used as the positive control. The data

represent mean ± standard deviation of three repetitions (n=3). Different

letters on each bar represent significant differences at P ≤ 0.05 (Tukey’s

Test). ...................................................................................................... 157

XV

Figure 5-6: The correlation graphs of 1/DPPH (IC50) from RBE with (A) total phenolic

content, (B) total flavonoid content, (C) total anthocyanin content, (D) total

γ-oryzanol content, (E) total vitamin E content, (F) δ-tocotrienol content, (G)

γ-tocotrienol content, (H) α-tocotrienol content, and (I) tocopherol (α-

tocopherol) content. ................................................................................ 159

Figure 5-7: Trolox Equivalent Antioxidant Capacity (TEAC) assay of different RBE.

Trolox was used as the positive control. Antioxidant capacities of different

RBE were expressed in trolox equivalence (nmol/g trolox). The data

represent mean ± standard deviation of three repetitions (n=3). Different

letters on each bar represent significant differences at P ≤ 0.05 (Tukey’s

Test). ...................................................................................................... 160

Figure 5-8: The correlation graphs of TEAC of RBE with (1) total phenolic content, (2)

total flavonoid content, (3) total anthocyanin content, (4) total γ-oryzanol

content, (5) total vitamin E content, (6) δ-tocotrienol content, (7) γ-

tocotrienol content, (8) α-tocotrienol content, and (9) tocopherol (α-

tocopherol) content. ................................................................................ 162


of Bajong LN extracts over 24, 48 and 72 hours of incubation period

respectively. The insets showed the inhibition concentration (IC50) of

Bajong LN RBE on H9c2(2-1) cells determined via GraphPad Prism

(GraphPad Software, Inc. USA). Best fit curves were plotted using excel for

visual purpose. ....................................................................................... 163


of MR219 extracts over 24, 48 and 72 hours of incubation period

respectively. The insets showed the inhibition concentration (IC50) of

MR219 RBE on H9c2(2-1) cells determined via GraphPad Prism

(GraphPad Software, Inc. USA). Best fit curves were plotted using excel for

visual purpose. ....................................................................................... 164

Figure 5-11: IC50 of H2O2 for H9c2(2-1) cells pre-treated with different concentrations of

RBE. Data represent mean ± standard deviation for 3 repetitions (n=3).

IC50 values were determined via GraphPad Prism (GraphPad Software, Inc.

USA).............................................................................................................

2. Tables

Table 2-1: General chemical structures of different sub-groups of polyphenols

(Navindra 2010) .......................................................................................... 17

Table 2-2: Sample images (showing whole rice grain and de-husked rice grain) of

different rice samples. ................................................................................. 32

Table 2-3: Total phenolic contents of RBE. Values expressed represent mean ±

standard deviation of 3 concecutive repetitions (n=3). Different letters within

the same column denote significant difference at P ≤ 0.05 (Tukey’s Test).

GAE = Gallic Acid Equivalent. Graphical representation for the following data

is presented in Figure 5-1 (Appendix Section). ........................................... 40

Table 2-4: Average total phenolic contents in different rice varieties ........................... 42

XVI

Table 2-5: Total flavonoid contents of RBE. Values expressed represent mean ±


the same column denote significant differences at P ≤ 0.05 (Tukey’s Test).

QE = Quercetin Equivalent. Graphical representation for the following data is

presented in Figure 5-2 (Appendix section)................................................. 44

Table 2-6: Total anthocyanin contents of different RBE were expressed in unit of mg

cyanidin-3-glucoside equivalent/100g dried extracts. Results were expressed

in mean ± standard deviation of three consecutive experimental repetitions

(n=3). Graphical representation for the following data is presented in Figure

5-3 (Appendix section). ............................................................................... 46

Table 2-7: Total γ-oryzanol content of RBE. Values expressed represent mean ±


the same column denote significant differences at P ≤ 0.05 (Tukey’s Test).

Graphical representation for the following data is presented in Figure 5-4

(Appendix section). ..................................................................................... 48

Table 2-8: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different RBE

were expressed in units of mg/kg. The data represented mean ± standard

deviation of three repetitions (n=3). Different letters within the same column

denote significant difference at P ≤ 0.05. T3 = tocotrienols; T = tocopherol.

................................................................................................................... 51

Table 3-1: Oligonucleotide primer sequences ............................................................. 84

Table 3-2: qRT-PCR Reaction Cycle Condition (Qiagen 2011) ................................... 85

Table 3-3: Inhibitory concentration (IC50) of different RBE for DPPH free radical

scavenging assay. Values represents mean ± standard deviation of 3

concecutive repetitions (n=3). Different letters within the same column

denote significant differences at P ≤ 0.05 (Tukey’s Test). Graphical

representation for the following data is presented in Figure 5-5 (Appendix

section). ...................................................................................................... 86

Table 3-4: Regression and correlation analyses of 1/DPPH (IC50) with total phenolic,

total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-

tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE.

Correlation graphs for the following data were depicted in Figure 5-6

(Appendix section). ..................................................................................... 92

Table 3-5: Trolox equivalent antioxidant capacity (TEAC) of different RBE. Values

expressed represent mean ± standard deviation of 3 concecutive repetitions

(n=3). Different letters within the same column denote significant differences

at P ≤ 0.05 (Tukey’s Test). Graphical representation of the data was

depicted in Figure 5-7 (Appendix section) ................................................... 94

Table 3-6: Regression and correlation analyses of trolox equivalent antioxidant

capacity (TEAC) of RBE with total phenolic, total flavonoid, total anthocyanin,

total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and

α-tocopherol. Correlation graphs were depicted in Figure 5-8 (Appendix

section) ....................................................................................................... 95

XVII

Table 3-7: Cell viability of H9c2(2-1) after inductions with different concentrations of

Bajong LN RBE for 24, 48 and 72 hours respectively. Data presented were

the mean ± standard deviation of three replicates (n=3). ‘*’ on each column

denotes significant differences at P ≤ 0.05 as compared to negative control.

................................................................................................................. 104

Table 3-8: Inhibitory concentration (IC50) of Bajong LN RBE over 24, 48 and 72 hours

of incubation time. The IC50 values were determined from respective cell

viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data

represents mean ± standard deviation of 3 consecutive repetition (n=3).

Graphical representations of data were depicted in Figure 5-9 (Appendix

section). .................................................................................................... 105


MR219 RBE for 24, 48 and 72 hours respectively. Data presented were the

mean ± standard deviation of three replicates (n=3). ‘*’ on each column

denotes significant differences at P ≤ 0.05 as compared to negative control.

................................................................................................................. 106

Table 3-10: Inhibitory concentration (IC50) of MR219 RBE over 24, 48 and 72 hours of

incubation time. The IC50 values were determined from respective cell

viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data

represents mean ± standard deviation of 3 consecutive repetition (n=3).

Graphical representations of data were depicted in Figure 5-10 (Appendix

section). .................................................................................................... 107


hydrogen peroxide (H2O2). Data presented were the mean ± standard

deviation of three replicates (n=3). ‘*’ on each column denotes significant

differences at P ≤ 0.05 as compared to negative control. ......................... 110

Table 3-12: IC50 of H2O2 on H9c2(2-1) cell. The IC50 value was determined from

respective cell viability curves (Figure 3-11) via GraphPad Prism (GraphPad

Software, Inc. USA). Data represents mean ± standard deviation of 3

consecutive repetition (n=3). ..................................................................... 111


H2O2. Cells were pre-treated with different concentrations of Bajong LN and

MR219 RBE before H2O2-induction. Data represent mean ± standard

deviation of three replicates (n=3). ‘*’ on each column denotes significant

differences at P ≤ 0.05 as compared to negative control (non-treated cells).

................................................................................................................. 113

Table 3-14: Average IC50 of H2O2 for H9c2(2-1) cells. The IC50 value was determined

from respective cell viability curves (Figure 5-11) via GraphPad Prism

(GraphPad Software, Inc. USA). Data represent mean ± standard deviation

of 3 (n=3). ‘*’ denotes significantly different from negative control treated with

media + 1% EtOH at P ≤ 0.05. Graphical representations of data were

depicted in Figure 5-11 (Appendix section) ............................................... 115

Table 5-1: Extraction yields of RBE .......................................................................... 166

1.

1

2. Chapter 1: Introduction

2.1. Research Background

Recent years of extensive research has disclosed the fact that majority

of diseases originated from the dysregulation of multiple genes, as a

consequence of oxidative stress. The origin of oxidative stress has been

strongly correlated with high concentration of free radicals, whereby it occurs

when the balance between the production rates of free radicals and the rates of

their removals are being disturbed (Wang et al. 2011). Primary targets of free

radicals include important biological components such as DNA, lipids, sugars,

proteins and fatty acids (Dröge & Schipper 2007; Esiri 2007; Fleury, Mignotte &

Vayssiere 2002). Under oxidative stress conditions, these essential biological

components will undergo oxidative modifications which disrupt their normal

functions. This consequently triggered the occurrence of chronic diseases such

as cardiovascular diseases, cancers and various degenerative diseases

(Magalhaes et al. 2009).

Endogenous antioxidants are produced by the body as a defensive

mechanism to maintain redox homeostasis within the biological system

(Rodrigo & Gil-Becerra 2014). Although these endogenous antioxidants are

capable of neutralizing free radicals, they remain incomplete in the absence of

exogenous antioxidants. Both components act synergistically to maintain low

levels of free radicals within the biological systems (Bouayed & Bohn 2010;

Pietta 2000). For instance, the rejuvenation of oxidized glutathione (GSSG) to

its reduced form (GSH) requires vitamin E as one of the precursors (Valko et al.

2007). Besides that, vitamin E also detoxifies lipid peroxyl radicals (LOO-)

(Bouayed & Bohn 2010) concomitantly with endogenous antioxidant enzyme,

glutathione peroxidase (GPx) to terminate free radical chain reactions (Lip &

Hall 2007).

2

Exogenous antioxidants often come from dietary sources and can be

categorized under two different types, namely synthetic exogenous antioxidants

and natural exogenous antioxidants. As the safety of synthetic exogenous

antioxidants remains as a major concern, there has been a great attention

centred on natural antioxidants derived from bioactive compounds present

naturally in both fruits and vegetables (Magalhaes et al. 2009).

In Malaysia, Sarawak state is known as the treasure trove for many

different local rice varieties. These include Bario (Figure 2-1), Biris, Bajong,

Rotan, Boria, Udang Halus and other less-known rice varieties. Overall, there

are more than 100 different rice varieties in Sarawak and majority of them are

sold in local markets (Teo 2000). Rice is usually consumed in the form of

polished and refined white grains. Through the rice milling process, rice brans

are often removed as part of the raw rice component. The removal of brans

from the grains has resulted in significant loss of numerous nutritive

components (Borresen & Ryan 2014).

Figure 2-1: An example of Sarawak local rice varieties, ‘Padi Bario’ (also known

as Bario rice.

3

Rice bran extracts derived from various extraction methods have shown

a mixture of antioxidant-rich bioactive compounds. These include anthocyanins,

gamma-oryzanol (γ-oryzanol), phenolic acids and vitamin E (tocopherols and

tocotrienols). It has been proven epidemiologically that consumption of bran

portion of rice significantly reduces the prevalence and occurrence rates of

chronic diseases such as cardiovascular diseases, type 2 diabetes, various

degenerative diseases and cancers (de Munter et al. 2007; Jariwalla 2001;

Most et al. 2005).

Studies on rice bran and health related research have been performed to

evaluate rice bran antioxidants in health and wellness. With more than 100,000

different varieties of rice grown worldwide, it opens up research opportunities to

evaluate specific traits and health significance that come in association with the

brans (Borresen & Ryan 2014). Presently, research on different varieties of rice

is being conducted actively by researchers from different regions of rice-

producing countries. The nutritional compositions of the rice are being assessed

and the dietary supplementation of the rice extract was found to possess

numerous health benefits, generally attributed to the presence of antioxidant

compounds (Hu et al. 2003).

Cardiovascular disease (CVD) still remains as one of the largest leading

cause of global mortality. The World Health Organization (WHO) has estimated

a total number of 17.5 million deaths from CVD in the year 2012, accounted for

one-third of the global mortality (WHO 2015). The total numbers of annual

fatalities are expected to increase to 20 million of death cases by 2020, and

further increase to 24 million by 2030 (WHO 2004). Hence, there is an urgent

need for global attention to alleviate mortality rate of CVD. One of the initiating

causes of CVD was characterized as oxidative modification (Goldstein et al.

1979; Steinberg et al. 1989). Oxidative modification induces a series of signal

transduction cascade events that lead to the progression of CVD. Therefore,

strategies of using antioxidant to attenuate CVD via inhibition of inadvertent

cellular oxidative damage or signalling pathway may have important

implications to both prevention and treatment of CVD (Lönn, Dennis & Stocker

2012).

4

Research on nutraceutical compounds from various agricultural crops

has become one of the emerging fields of study in the recent years. Various

efforts have been devoted to enhance the value of these agricultural crops. A

well-thought-out approach that thoroughly assesses the content and

bioactivities of natural antioxidants present in various Sarawak local rice

varieties is likely to bring social and economic benefits. Hence, it is worthwhile

to carry out further investigation on the bioactivities of antioxidants derived from

rice bran. This would significantly broaden the knowledge base on the

antioxidant protective effects of rice bran extracts (RBE). The outcomes can be

applied to further nutraceuticals research and also for more in-depth study of

plant-based food product development.

The present research was designed to extract and assess the content of

natural antioxidants from RBE of different Sarawak local rice varieties. This

thesis comprises of two different sections. The first section emphasizes on the

extraction of natural antioxidants from rice bran of different Sarawak local rice

varieties via solvent extraction method and followed by the determination of

antioxidants content in the RBE. The second section focuses on the bioactivity

studies of RBE. Two different in vitro systems: (i) in vitro chemical-based

system and (ii) in vitro mammalian cell culture-based system were used to

evaluate the antioxidant activities of RBE. For the in vitro chemical-based

system, 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay

and Trolox Equivalent Antioxidant Capacity (TEAC) assay were both used to

assess the antioxidant capacity of different RBE. As for the in vitro mammalian

cell culture-based system, a neonatal cardiomyocytes (H9c2) derived from

Rattus novergicus was used as the mammalian cell culture model to study the

antioxidant and cardioprotective potential of RBE via inductions of endogenous

cellular antioxidant enzymes. All these sections constitute the main objectives

of this research work.

5

2.2. Research Aims and Objectives

The overall research design embarked on two main aims.

Aim 1 of this work was to extract and assess natural antioxidant contents from

rice bran of selected Sarawak local rice varieties. In order to achieve the aim,

experimental works were designed to fulfil the following objectives:

a. Extraction of natural antioxidant compounds from rice bran of

different Sarawak local rice varieties via solvent extraction

method.

b. Assessment of the contents of antioxidant compounds derived

from RBE of different Sarawak local rice varieties.

c. Quantitative analyses of antioxidant compounds derived from

RBE via UV-Visible Spectrophotometer (UV-Vis) and High

Performance Liquid Chromatography (HPLC).

Aim 2 of this work was to assess the bioactivity of RBE by studying their

antioxidant capacities via in vitro antioxidant assays. In order to achieve the aim,


a. Study of antioxidant activity of RBE based on in vitro chemical-

based systems.

b. Study of antioxidant activity of RBE based on in vitro

mammalian cell culture-based system.

c. Determination of the optimal and safe dosage of RBE that is

appropriate for its maximal antioxidant activity in in vitro

mammalian cell culture-based system.

d. Assessment of RBE on the induction of endogenous cellular

antioxidants in in vitro mammalian cell culture-based system.

6

2.3. Research Contributions and Impact to Society

The outcomes of this research work are expected to:

Promote research on health-improving bioactive compounds derived from

rice bran.

Promote value-added processing possibilities of rice industries in Sarawak,

specifically the management of by-products from rice production,

supporting local industry and using natural biodiversity to its full advantage

Identify Sarawak local rice varieties that have the highest antioxidant

contents.

Promote germplasm expansion (for planting) and breeding of new non-

genetically modified rice varieties that are nutritious in natural antioxidants.

Enhance international knowledge base on the antioxidant properties of

RBE in terms of correlation between the concentration of RBE and other

factors such as induction of endogenous cellular antioxidants and the

effectiveness of their respective antioxidant activity.

Establish supporting data for further investigation in carefully planned

animal model studies and clinical trials.

Ideally, the latter may lead to identification and expansion of local

inexpensive rice varieties as potential nutraceuticals for cardioprotection.

Additionally, it also offers opportunity for development and manufacture of new

plant-based drug and nutraceuticals products. The safe and low post-treatment

side effect of these natural bioactive compounds can be a potential candidate to

replace chemically synthesised drugs used for treatment of cardiovascular

diseases. Such approaches will have high socio-economic impact on the

nation’s populations in conjunction with the efforts to reduce the nation’s

mortality rate caused by cardiovascular diseases annually.

7

2. Chapter 2: Extraction of Natural Antioxidant

from Rice Bran

2.1 Executive Summary

Health concerns over the use of synthetic antioxidants as food additives

in processed food products have led to an increase in research interests

targeting on natural antioxidants. Plant materials such as vegetables, nuts and

fruits are good sources of natural antioxidants. Due to the biological diversity of

these plant materials, each and every one of them contains different types and

amount of antioxidants. Hence, there have been many research works targeting

on qualification, elucidation and quantification of bioactive compounds present

in plant materials. Rice bran, by products of rice milling process, is known for

having high contents of essential proteins, vitamins and various natural

antioxidants. Despite its high nutritional value, it remains underutilized as health

food. In Malaysia, Sarawak is known as the treasure trove for different local rice

varieties. However, the health and nutritional of these local rice varieties remain

underexplored. There is very little fundamental information on the distribution

and quantification of bioactive compounds/natural antioxidants present in these

local rice samples. Hence, the following work was conducted to extract and

thoroughly assess the content of natural antioxidants from rice bran of different

Sarawak local rice varieties.

In this chapter of the thesis, it provides a comprehensive literature review

relevant to the field of study. In addition, summary of experimental approaches

and presentation of results for the first section of the overall research work are

also included in this chapter.

8

2.2 Literature Review

2.2.1 Rice and Rice Brans

Rice is a staple food and remains as the utmost important agricultural

commodities in many Asian countries (Van Hoed et al. 2006). It provides

sources of calories and nourishments for majority of the Asian population’s

nutritional requirement (Schramm et al. 2007). In addition, rice continues to play

a significant role in sustaining global food security systems and establish a

continual capacity to feed the increasing world populations (Swaminathan &

Rao 2008).

Presently, rice is being cultivated in more than 100 countries with an

estimated 475 million tonnes of production capacity annually (Borresen & Ryan

2014). In Malaysia, Sarawak state is known as the treasure trove for many

different varieties of aromatic rice. Some of these include Bario, Biris, Bajong,

Rotan, Boria, Udang Halus and other less-known rice varieties (Figure 2-1).

Overall, there are more than 100 different rice varieties in Sarawak and majority

of them are sold in local markets (Teo 2000).

Figure 2-1: Local rice varieties of Sarawak

9

Rice is primarily consumed in the form of white polished grains (also

known as white rice). Its non-milled rice form, otherwise known as brown rice is

less popular due to its poor texture and undesirable quality after cooking. The

whole rice grain consists of 3 major parts: husk, bran and endosperm. In the

rice milling industries, the milling process typically begins with the dehulling of

rice grains to remove the husk layer. This later reveals the bran layer which

shields the endosperm. Further removal of bran layer yields the endosperm,

commonly known as the white rice which is ready-to-cook (Elaine et al. 2004;

Ha et al. 2006).

The whole rice grain is known for containing rich contents of vitamins,

lipids, minerals, proteins, fibres and numerous antioxidants (Singh &

Chakraverty 2014) which may aid in disease control (Talwinder 2009). Major

composition of these bioactive compounds is found in the bran of rice grain.

However, the removal of bran from rice has resulted in the loss of

approximately 70% of the essential nutrients present in rice (Elaine et al. 2004).

Despite having high content of nutritious components and commercial value,

rice bran remains as an underutilized agricultural by-product. Most of them are

used as animal feed while only a small portion is used in the production of rice

bran oil for human consumption (Sirikul, Moongngarm & Khaengkhan 2009).

Several research works have been focusing on the health attributes of

rice bran in the prevention and treatment of chronic diseases. The outcomes

from the studies revealed positive correlation between the consumption of rice

bran (also inclusive of brown rice) and risk reductions in chronic diseases such

as cardiovascular disease (Ausman, Rong & Nicolosi 2005; Justo et al. 2013;

Wilson et al. 2002), cancers (Bang et al. 2010; Henderson et al. 2012), type 2

diabetes (de Munter et al. 2007), hypertension and hyperlipidaemia (Most et al.

2005).

Through the emerging knowledge of rice bran in health and wellness, its

consumption begins to gain popularity in recent years (Elaine et al. 2004). The

current research trend on rice bran revolves around its innovation in food

system that aims to alleviate issues of malnutrition and chronic diseases. In

addition, emphasis is also put on the genetic, geographic, nutritional diversities

10

of different rice varieties and their associated health attributes (Borresen &

Ryan 2014). Hence, by addressing all these research statements, it will provide

global health prospects for proper and innovative utilization of rice bran in the

management of chronic diseases.

2.2.2 Extraction and Analysis of Antioxidants

The extraction of bioactive compounds from plant materials is the start-

up procedure for preparation of natural nutraceuticals or dietary supplements.

Depending on the nature of the raw materials, natural antioxidants can be

extracted from fresh, frozen, freeze-dried or dried plant samples. These plant

materials are usually pre-treated by milling, grinding or homogenization which

may later be preceded by air-drying or freeze drying for sample preservation

and storage (Dai & Mumper 2010). There are various methods available for the

extraction of antioxidants from plant materials. These methods are categorized

under three different categories, namely physical methods (Moreno et al. 2003),

chemical methods (Romero-Pérez et al. 2000), and enzymatic methods (Meyer

& Meyer 2005).

Among all the extraction methods, solvent extraction (a chemical

extraction method) is the most commonly used extraction methodology to

extract favourable compounds from plant materials. The stand-out points for

such extraction methodology are being easy to perform, efficient and its wide

applicability. Solvents such as methanol, ethanol, acetone, ethyl acetate, and

water are commonly used in the extraction of bioactive compounds from plant

materials (Eloff 1998). Due to the variation in composition of phytochemicals,

selection of suitable solvent to be used for extraction is dependent on the

nature of targeted sample and bioactive compounds (Gupta, Naraniwal &

Kothari 2012). Hence, there is no standardized extraction protocol made

available for extraction of bioactive compounds from plant materials.

11

Polar and short carbon-chain alcohol such as methanol has been used

widely in the extraction of bioactive compounds from rice bran. Targeted

bioactive compounds such as phenolic acids, flavonoids, anthocyanins (Chen et

al. 2012; Gunaratne et al. 2013; Rao et al. 2010), vitamin E: tocotrienols (Chen

& Bergman 2005; Renuka Devi & Arumughan 2007) and, gamma oryzanol (γ-

oryzanol) (Jeng et al. 2012; Miller & Engel 2006) have been successfully

extracted from rice bran by using methanol as the main solvent system.

Depending on the compound of interest, other solvents such as acetone

(Gunaratne et al. 2013), hexane (Xu, Hua & Godber 2001), ethanol , and

isopropanol (Chen & Bergman 2005) have also been used to extract these

antioxidants from rice bran.

Aside from the choice of solvent system, extraction yields of each

different types of bioactive compounds also varies and dependent on other

extraction parameters such as extraction temperature, extraction duration,

solvent concentration, and type of instrument used (Goufo et al. 2014b;

Pellegrini et al. 2006). However, extraction temperature appears to be the major

factor among all. Different bioactive compounds have variable susceptibilities to

thermal degradation (Goufo & Trindade 2014; Stratil, Klejdus & Kubáň 2007).

For instance, high extraction temperature (>70°C) is able to degrade

anthocyanin rapidly (Havlíková & Míková 1985). In addition, rapid degradation

of flavonoids have also been reported at high extraction temperatures beyond

130°C (Rostagno & Prado 2013).

Over the past few years, many different analytical methods have been

developed to quantify and determine the contents of phenolic acids, flavonoids,

anthocyanins, vitamin E: tocotrienols and γ-oryzanol. Most of these methods

utilize instrumentation-based analyses involving the use of equipment such as

UV-Visible spectrophotometer, high performance liquid chromatography (HPLC),

gas chromatography (GC), mass spectrometric (MS) detection, liquid

chromatography-mass spectrometry (LC-MS).

12

Total phenolic content in plant materials is commonly determined via

Folin Ciocalteu’s assay method. The method was initially established by Folin

and Ciocalteu (1927) and was then altered by Singleton and Rossi (1965). It is

a colorimetric assay based on the reduction of Folin Ciocalteu’s reagent, a

yellow phosphomolybdic phosphotungstic acid reagent through the transfer of

electron from phenolic compounds under alkaline condition (Lester et al. 2012;

Singleton & Rossi 1965). Gallic acid, a type of phenolic acid is commonly used

as the reference standard in this assay. The reaction yields blue colour product

which can be analysed spectrophotometrically via UV-Visible

spectrophotometer at 750nm (Vázquez et al. 2015).

The aluminium complexation-based spectrophotometric assay is a

commonly used approach to evaluate the total flavonoid content in plant

materials. The method was initially proposed by Christ and Müller (1960) and

was fine-tuned several times. Typical concentration of 2% to 10% (weight per

volume, w/v) of aluminium chloride (AlCl3) is used in this assay. The

complexation of aluminium chloride can take place in either acidic or alkaline

condition. Upon the addition of aluminium chloride, a yellow complex solution is

formed and it turns red after the addition of sodium hydroxide (NaOH). The

absorbance of the final red product is then evaluated spectrophotometrically at

510 nm (Malta & Liu 2014; Pękal & Pyrzynska 2014). Flavonoid reference

standards such as quercetin, quercitrin, and galangin are commonly used in the

assay.

There are several methods to determine the total anthocyanin contents

of plant samples. Methods such as direct spectrophotometric approach via

HPLC (Sompong et al. 2011) and spectrophotometric pH differential method

(Fuleki & Francis 1968; Giusti & Wrolstad 2001) have been used to determine

total anthocyanin content. Among the two methods, the rapid and simple

spectrophotometric pH differential approach is often used to determine total

anthocyanin content. The method determines total content of monomeric

anthocyanin via changes in absorbance of anthocyanin chromophore at pH 1.0

and pH 4.5 respectively. Under different pH environment, monomeric

anthocyanins exist in different forms by going through a reversible structural

transformation. The coloured oxonium form of monomeric anthocyanin

13

predominates at pH 1.0 while the colourless hemiketal form predominates at pH

4.5. The total anthocyanin content is often expressed as the equivalents of a

commonly found monomeric anthocyanin, cyanidin-3-glucoside (Lee 2005).

Vitamin E isomers can be analysed via high performance liquid

chromatography (HPLC). The separation of different vitamin E isomers can be

performed via both normal-phase HPLC (Kamal-Eldi et al. 2000; Panfili,

Fratianni & Irano 2003) and reverse-phase HPLC (Chen & Bergman 2005;

Grebenstein & Frank 2012). Various combinations of solvents have been used

as the mobile phase of HPLC and detection of the compounds can be done with

either ultraviolet (UV) detector or a fluorescence detector. Due to the high

sensitivity and selectivity of fluorescence detector as compared to UV detector,

it is more commonly used in the analysis of vitamin E isomers (Cunha et al.

2006). Under normal phase HPLC chromatographic method, proper separation

of all 8 different isomers of vitamin E can be performed easily. Contrarily, a

reversed phase HPLC chromatographic method fails to separate β- and γ-

isomers of tocopherol (T) and tocotrienols (T3) (Finocchiaro et al. 2007).

Analysis of γ-oryzanol can be performed via UV-spectrophotometry

(Bucci et al. 2003), normal phase and reversed phased HPLC (Yoshie et al.

2009), and gas chromatography (Miller et al. 2003). Simultaneous analysis of

tocopherols, tocotrienols and γ-oryzanol from rice can be performed via a

modified mobile phase in gradient mode (Chen & Bergman 2005). UV

spectrophotometric analytical approach of γ-oryzanol has reported higher

content of total γ-oryzanol content (by 2-folds) as compared to HPLC approach

(Bucci et al. 2003). Two factors were known for causing the difference: (1) the

use of oil-based solvent system and (2) low concentration of γ-oryzanol in

sample (Bucci et al. 2003). Significant difference in total γ-oryzanol content

between the two analytical approaches was observed with samples suspended

in n-heptane and those with low concentration of γ-oryzanol. This is due to the

fact that UV spectrophotometer tends to pick up non-negligible interference

from the oil-matrix at absorbance wavelength of 315nm and hence causing

inaccuracies in the reported results. Based on the findings of Bucci et al. (2003),

they reported dose-dependent interactions between the concentration of

γ-oryzanol in different rice bran oils and the detection accuracy of γ-oryzanol

14

via UV spectrophotometer. UV spectrophotometer detected relatively higher

total content of γ-oryzanol in samples containing low concentration of solute

than those detected via HPLC (0.82mg/g of γ-oryzanol versus 0.40mg/g of γ-

oryzanol respectively). As of those samples with higher concentrations of γ-

oryzanol, the results of both detection methods were comparable. UV

spectrophotometry detected total amount of 10.9mg/g of γ-oryzanol while HPLC

detected total amount of 9.8mg/g of γ-oryzanol (Bucci et al. 2003).

Depending on the solvent system of the test compound, maximum

absorption wavelength of γ-oryzanol varies between the ranges of 315nm to

327nm. Alcohol-based solvent system (max λ = 327nm) has more accurate

results when γ-oryzanol is detected via UV spectrophotometric approach with

negligible interferences from oil-matrix. For oil-based solvent system (max λ =

315nm), a second derivative analysis can be performed to eliminate the

interferences from oil matrix (Bucci et al. 2003). As for HPLC approaches,

depending on the choice and alteration in the composition of solvent system,

different γ-oryzanol derivatives can be separated. However, quantification of

individual γ-oryzanol components remain as a challenge due to lack of

commercially available pure reference standards (Goufo & Trindade 2014).

15

2.2.3 Rice Antioxidants

Controversies over the safety of synthetic antioxidants in processed

foods and their use as food additives have sparked the concerns of many

health-conscious consumers. Butylated hydroxyanisole (BHA) and butylated

hydroxytoluene (BHT) are the commonly used synthetic antioxidants for

preservation of fatty food (Addis 1986). However, long term exposures to these

synthetic antioxidants have been reported capable of promote tumour formation

and develop carcinogenic effects in organs such as liver, forestomach, and

glandular stomach (Hirose et al. 1998; Ito et al. 1983; Ito, Fukushima & Tsuda

1985; Williams 1986; Williams & Iatropoulos 1996). This has led to an increase

in research interests that target on natural antioxidants (Islam et al. 2014).

Natural antioxidants are defined as phenolic or polyphenolic compounds

derived from plant materials. Fruits, vegetables and nuts are common sources

of natural antioxidants. Although these foods contain significant amount of

natural occurring antioxidants, types and amount of antioxidants present in

these foods differ from one another. Some of these natural antioxidants include

polyphenols, flavonoids, anthocyanins, vitamins, and resveratrol (Tsuda et al.

2002a).

Numerous scientific evidences have shown that frequent dietary intake of

antioxidant-rich food are commonly linked with low incidence of oxidative stress

associated diseases (Tsuda et al. 2002a). Research on natural antioxidants

have shown positive health effects towards cardioprotection, inflammation, anti-

infection, liver protection, anti-diabetic, anti-obesity and neurodegenerative

processes (Aedín, José & Peter 2012; Anne & Barrie 2008; Biasutto, Mattarei &

Zoratti 2012; Cesar & Patricia 2012; Chang et al. 2009; Mireia et al. 2012).

These naturally occurring bioactive constituents provide a defence system to

the body by eliminating free radicals and protect the body against oxidative

injuries. They prevent the initial stage of free radicals formation and hinder the

progression of oxidative chain reaction that may subsequently lead to

production of secondary radical species (Mukhopadhyay 2000).

There have been a lot of research works focusing on the identification

and elucidation of action mechanisms of rice antioxidants. Such research efforts

16

remain on-going and have gained considerable interest since the establishment

of positive correlation between rice consumption and low incidence of

cardiovascular diseases and cancers among Asian populations (Hudson et al.

2000). In the following, general descriptions on some of the different types of

antioxidants present in rice will be highlighted and discussed. These include

phenolic acids, flavonoids and anthocyanins which are collectively categorized

under the group of polyphenols, and other antioxidants such as γ-oryzanol and

vitamin E.

2.2.3.1 Polyphenols

Polyphenols exist abundantly in the diet. They are known as the dietary

antioxidants, accounted for approximately 1g/d of the total dietary intake and

considerably much higher than other classes of phytochemicals. Primary

sources of polyphenols include fruits, vegetables and legumes (Scalbert,

Johnson & Saltmarsh 2005). They are the secondary metabolites produced by

plants to protect themselves against aggression by external factors such as

ultraviolet radiation and pathogens. Aside from protecting the plants, health

effects of polyphenols have come to the attention of food nutrition researchers

with research evidences of their credible effects in prevention and treatment of

oxidative stress associated diseases (Manach et al. 2004).

Figure 2-2: Chemical structure of phenol functional group.

All polyphenols have characteristic phenol functional groups, each

consisting of a hydroxyl group (-OH) attached to an aromatic ring (Figure 2-2).

There are thousands of polyphenols that have been identified to-date. The

17

limitless arrangement of polyphenolic structures have accounted for the

diversity and complexity of different polyphenols. They are differentiated by the

number of phenol group and other structural elements (arrangement of carbon

atoms) that link each and every one of the rings. Despite the vast array of

structural complexity, polyphenols can still be categorized into two main groups:

flavonoid polyphenols and non-flavonoid polyphenols (Navindra 2010). Each

group is further sub-divided into smaller groups. Sub-groups of flavonoid

polyphenols include flavonols, flavones, isoflavones, flavanones, flavanols, and

anthocyanins. As for non-flavonoid polyphenols group of compounds, it consists

of phenolic acids, stilbenoids, and lignans (Navindra 2010). The following

illustrates the general structures of different types of polyphenols (Table 2-1):

Table 2-1: General chemical structures of different sub-groups of

polyphenols (Navindra 2010)

Flavonoid Polyphenols

Flavonol

Flavone

Isoflavone

Flavanone

18

Flavanol

Anthocyanin

Non-Flavonoid Polyphenols

Phenolic Acid

Stilbenoid

Lignans

19

In the following literature reviews, three major sub-groups of polyphenols

present in rice will be briefly discussed. The three major sub-groups of

polyphenols include: phenolic acids, flavonoids and anthocyanins.

2.2.3.1.1 Phenolic Acids in Rice

Phenolic acids have a general structure consisting of a phenolic ring and

a carboxyl functional group (Goufo et al. 2014b) (general chemical structure of

phenolic acid is depicted in Table 2-1). Sinapic acid, gallic acid, ferulic acid, and

p-coumaric acid are some of the common types of phenolic acids (Navindra

2010). Antioxidant properties of phenolic acid are attributed to the presence of

phenolic ring that neutralize unpaired electrons.

The strength of phenolic acid’s antioxidant capacity corresponds to both

number and position of hydroxyl (-OH) group on the phenolic ring (Heuberger et

al. 2010). To date, a total of twelve different types of phenolic acids have been

identified and their respective contents varies among different rice varieties as

well as in different parts of the rice. In general, ferulic acid accounted for the

most abundant type of phenolic acid in the endosperms, whole grains and bran

of the rice (Goufo & Trindade 2014). P-Coumaric acid comes in second and

later followed by other phenolic acids such as sinapic acid and gallic acid

respectively. There are also additional phenolic acids that have been identified

in rice but still need to be further validated (Chen et al. 2012; Fujita et al. 2010;

Vichapong et al. 2010).

2.2.3.1.2 Flavonoids in Rice

Flavonoids have a general chemical structure, consisting of two 6-carbon

aromatic rings and interlinked by carbon chain made of three carbons.

Flavonoids are sub-divided into different groups, namely flavonols, flavanols,

flavanonols, flavones, isoflavones and anthocyanins (Navindra 2010). As an

antioxidant, flavonoids scavenge free radicals by donating electrons to

neutralize and stop the chain reactions caused by radical species. Such

20

activities are credited to the presence of hydroxyl (-OH) groups on the 3’- and

4’- carbon of the three carbons chain (Figure 2-3) (Cho et al. 2013; Kim et al.

2010).

Figure 2-3: Basic structural configurations of different flavone and flavonol

derivatives [image source: (Tanaka & Takahashi 2013)]

To date, there are seven types of flavonoids in rice that have been

reported. These flavonoids include quercetin, myricetin, isorhamnetin, luteolin,

kaempferol, apigenin, and tricin which accounted for the major types of

flavonoids found in rice (Goufo & Trindade 2014).

21

2.2.3.1.3 Anthocyanins in Rice

Anthocyanins are a group of compounds that is categorized under the

flavonoids family. The compounds are the glycosylated and stabilized forms of

anthocyanidins (Yonekura-Sakakibara et al. 2009). Anthocyanins are commonly

found in plant tissues. They are pigmented and soluble in water, and are

responsible for imparting colours to plant materials (Navindra 2010). The free

radical scavenging activities of anthocyanins are generally attributed to the

chemical structure of the compounds. The compound basically exists in the

form of acylglycosides and O-glycosides (in either mono-, di- or tri-

configuration) of anthocyanidins in which the sugar functional group can be

replaced by hydroxycinnamic, aliphatic or hydroxybenzoic acids (Goufo &

Trindade 2014). There are a total of eighteen different types of anthocyanins

that have been identified in rice. Among the eighteen, only four types of

anthocyanins were quantified (Goufo & Trindade 2014), namely peonidin-3-O-

glucosides, cyanidin-3-O-galactoside, cyanidin-3-O-glucoside and cyanidin-3-O-

rutinoside. Among the four types of anthocyanins, both cyanidin-3-O-glucoside

and peonidin-3-O-glucoside predominate and is then followed by both cyanidin-

3-O-rutinoside, and cyanidin-3-O-galactoside (Hou et al. 2013; Shao et al.

2014).

2.2.3.1.4 Heath Benefits of Polyphenols

Health benefits of polyphenols are largely associated with their

prominent antioxidative potency. As antioxidants, polyphenols protect cells from

oxidative injuries by scavenging free radicals or trigger the endogenous defence

systems. The phenolic functional groups of polyphenols are able to disrupt the

oxidative chain reactions in cellular components by accepting free electron and

form stable phenoxyl radicals. Thus, this limits the formation of reactive oxygen

species (Scalbert et al. 2005). In addition to antioxidant properties of

polyphenols, other health protective benefits of polyphenols in prevention of

degenerative diseases such as cardiovascular diseases, neurodegenerative

diseases and cancers have been widely studied and are evidently supported by

positive outcomes in various animals and cell line study models (Scalbert et al.

22

2005). An overview of the health benefits and molecular targets of polyphenols

is depicted in the following figure (Figure 2-4).

23

Anti-diabetic

Prevent uptake of glucose in the gut and peripheral tissues (Matsui et al. 2002)

Regulate transport of glucose from stomach to small intestine (Dembinska-Kiec et al. 2008)

Modulate sirtuin-1 (SIRT1) to improve glucose homeostasis and insulin sensitivity (Milne et al. 2007)

Antioxidant

Increase plasma antioxidant capacity (Pandey & Rizvi 2009)

Absorb pro-oxidative food components (eg. Iron) (Scalbert et al. 2005)

Scavenge free radicals (Pandey & Rizvi 2009)

Reduce oxidative damage (Luqman & Rizvi 2006)

Reduce risk of oxidative stress associated degenerative diseases (Pandey & Rizvi 2010)

Neuro-protection

Polyphenols

Inhibit nuclear factor kappa-β signaling to prevent microglia-dependent β-amyloid toxicity (Markus & Morris 2008)

Scavenge free radical to prevent oxidative damage on brain macromolecules (Pandey & Rizvi 2009)

Reduce risk of Parkinson’s disease (Rossi et al. 2008)

Scavenge neurotoxin, N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and MPTP mediated radicals (Rossi et al. 2008)

Activate MAP kinases for cell survival (Rossi et al. 2008)

Figure 2-4: General pharmacological properties and biological mechanism/molecular targets of polyphenols

Anti-cancer

Cardiovascular Protection

Inhibit oxidation of low density lipoprotein (LDL) cholesterol (Aviram et al. 2000)

Prevent disruption of atherosclerotic plaques (Garcia-Lafuente et al. 2009)

Improve high density lipoprotein (HDL) cholesterol level (Garcia-Lafuente et al. 2009)

Regulates endothelial function that via vasoconstriction and vasodilation (Pirola & Frojdo 2008)

Induce cell cycle arrest and cell apoptosis (Garcia-Lafuente et al. 2009)

Regulate host immunity system (Sharma & Rao 2009)

Inhibit proliferation of cancerous cells (Pandey & Rizvi 2009)

Halt the conversion of pro-carcinogens into their active forms (Pandey & Rizvi 2009)

Quench cancer-causing free radicals (Kamaraj et al. 2007)

24

2.2.3.2 Gamma-Oryzanol

Steryl ferulates (also known as γ-Oryzanol) are mixtures of ferulate

esters with sterols or triterpenes. There are four main components of steryl

ferulates, namely campesteryl ferulates, cycloartenyl ferulates,

24-methylenecycloartenyl ferulates and β-sitosteryl ferulates (Figure 2-5)

(Kozuka et al. 2012). These are the phenolic compounds that can be found in

cereal grains such as rice, corn, wheat, barley and rye (Kiing et al. 2009).

Among all of them, rice has the highest content of steryl ferulates.

γ-Oryzanol was first being isolated from rice bran oil by Kaneko and

Tsuchiya (1954) while other constituents of γ-Oryzanol and its derivatives were

later discovered by Xu and Godber (1999), and Fang, Yu and Badger (2003).

Ever since the discovery of γ-oryzanol, numerous works have been conducted

to thoroughly assess the therapeutic properties of the compound.

2.2.3.2.1 Health benefits of γ-Oryzanol

The antioxidant activity of γ-Oryzanol significantly contributes to overall

health benefits of the compound. It has phenol and ferulic acid functional

groups that are able to quench free radicals. The phenol moiety of the

compound is able to accept free radicals to form stable phenoxyl radicals while

the ferulic acid functional group donates electrons to disrupt the actions of free

radicals (Lemus et al. 2014).

γ-Oryzanol was found to have strong and superoxide dimutase-alike

antioxidant properties as reported from several in vitro systems, animal models

and human subjects’ studies (Gerhardt & Gallo 1998; Hundemer et al. 1991;

Vissers et al. 2000). The compound has been proposed as a natural antioxidant

additive to food, cosmetic and pharmaceutical products (Kim & Godber 2001;

Nanua, McGregor & Godber 2000). In addition to that, γ-Oryzanol has been

reported to possess cholesterol-lowering, anti-inflammatory, anticancer and

anti-diabetic properties as shown in several animal and cell-line models (Islam

et al. 2008; Jin Son et al. 2010; Son et al. 2011). The pharmacological activities

and biology actions of γ-Oryzanol are summarized in Figure 2-6.

25

Figure 2-5: Chemical structure of four major constituents of γ-oryzanol: (A)

cycloartenyl ferulate; (B) campesteryl ferulate; (C) 24-

methlenecycloartenyl ferulate; (D) β-sitosteryl ferulate.

(B)

(C)

(D)

(A)

26

Antioxidant

Anti-cancer

Cardioprotection

Anti-diabetic

γ-Oryzanol

Inhibit tumor mass and growth (Kim

et al. 2012)

Promote cytolytic activity of natural

killer (NK) cells (Kim et al. 2012)

Reduce number of blood vessels in

tumor (Kim et al. 2012)

Reduce expression and release of

pro-angiogenic biomarkers (Kim et

al. 2012)

Inhibit cancer cell proliferation and

alter cancer cell cycle (Henderson

et al. 2012)

Quench organic radicals and prevent

lipid peroxidation (Juliano et al. 2005)

Enhance activities of cellular antioxidant

enzymes in high fat-induced oxidative

stress (Jin Son et al. 2010)

Improve radical scavenging activities of

cellular antioxidant enzyme, glutathione

reductase (Jin Son et al. 2010)

Stimulate pancreatic release of glucose-

stimulate insulin (Kozuka et al. 2013)

Relieve endoplasmic recticulum for

proper regulation of glucose-stimulated

insulin (Kozuka et al. 2013)

Possess hypoglycemic effect (Ghatak &

Panchal 2012)

Regulate pancreatic enzymes involved

in glucose production (Ghatak &

Panchal 2012)

Inhibit lipid peroxidation (Juliano

et al. 2005)

Lower plasma cholesterol and

low density lipoprotein (LDL)

cholesterol level (Seetharamaiah

& Chandrasekhara 1989)

Prevent arterial inflammation by

regulating inflammatory

cytokines and mediators (Islam

et al. 2008)

Increase level of high density

lipoprotein (HDL) cholesterol

(Seetharamaiah &

Chandrasekhara 1989)

Reduce formation of aortic fatty

streak (Rong, Ausman &

Nicolosi 1997)

Figure 2-6: General pharmacological properties and biological mechanism/molecular targets of γ-oryzanol

27

2.2.3.3 Vitamin E

In the human diet, vitamin E is a crucial nutrient and is widely known for

its strong antioxidant properties (Wong & Radhakrishnan 2012). Ever since the

discovery of vitamin E in 1922, many studies have been focusing on the health

and pharmaceutical benefits of the two major forms of vitamin E, namely

tocopherol and tocotrienol (Wolf 2005) (Figure 2-7). All derivatives have a

hydroxyl functional group (-OH) attached to chromanol rings. Each group

consists of four different isomeric forms distinguished by the degree of

substitution of methyl groups (-CH3) in the chromanol head (Liva 2008) and.

The α-isoform consists of three methyl groups, while both of the γ- and β-

isoforms have two methyl groups, and the δ- isoform with only one methyl

group (Vasanthi, Parameswari & Das 2012). The key structural difference

between tocopherol and tocotrienol lies within their carbon side chains.

Tocopherol has a long saturated carbon side-chain (also known as the phytyl

tail) while tocotrienol has a short unsaturated carbon side-chain (the farnesyl tail)

(Drotleff & Ternes 2001).

Figure 2-7: General chemical Structures of (A) tocopherol and (B) tocotrienol.

[Image source: (Wolf 2005)]

R1 R2

Alpha derivative – -CH3 -CH3

Beta derivative – -CH3 -H

Gamma derivative – -H -CH3

Delta derivative – -H -H

(A)

(B)

28

In rice, major portion of the vitamin E content consists of tocotrienols

(Goufo & Trindade 2014). Among the four different derivatives of tocotrienols, γ-

tocotrienol accounted for the highest content to the total tocotrienols content in

rice and later followed the remaining derivatives such as α-tocotrienols, δ-

tocotrienols, and β-tocotrienols (Min, McClung & Chen 2011; Yu et al. 2007). In

addition to the four tocotrienols derivatives, two additional novel tocotrienols

derivatives were isolated from rice bran and they were characterized as

desmethyl tocotrienol and didesmethyl tocotrienol respectively (Qureshi et al.

2000).

2.2.3.3.1 Health Benefits of Vitamin E (Tocotrienols)

Nonetheless, α-tocopherol was once the most widely studied vitamin and

little emphasis was placed on tocotrienols. It was only discovered in the 1980s

and 1990s that tocotrienol is 40 to 60 folds more potent antioxidant than

tocopherol. Besides that, it has cholesterol lowering properties which are absent

in tocopherol (Qureshi et al. 1995; Sen, Khanna & Roy 2006; Tan 2005). Since

then, tocotrienols began to draw attention for studies of their health-related

biological significance. Evidence suggests that biological actions of tocotrienol

are more potent than tocopherol. Such properties are generally attributed to the

short carbon side chain of tocotrienol, which allows the compound to have

better intra- and intercellular mobility between the lipid membranes (Suzuki et

al. 1993; Yoshida, Niki & Noguchi 2003). Contrarily, the long carbon side chain

of tocopherol has a higher tendency of anchorage into the phospholipids

membranes and hence restricts its mobility (Yoshida, Niki & Noguchi 2003). As

such, this could possibly justify the stronger antioxidant properties of

tocotrienols compared to those of tocopherols (Serbinova et al. 1991).

In addition, among the different isomers of tocotrienols, the potency of

biological actions is arranged as follows: δ- > γ- > α- > β- derivatives. This is

attributed to degree of substitution and location of methyl group at the

chromanol ring of each derivatives (Anne & Barrie 2008). It is suggested that

the tocotrienol isoform that has fewer substitutions of the methyl group and

29

absence of methyl group at the C5 position of its chromanol ring has higher

bioactivity. Among the four isomers, only γ- and δ- tocotrienols do not have a

methyl group at the C5 position (Tan 2005).

The pharmacological effect of tocotrienols is widely linked to its strong

antioxidant properties which generally attributed to the presence of redox active

hydroxyl group (-OH) in the chromanol ring (Litwack 2007). It was found to

regulate various anti-oxidizing enzymes to actively scavenge free radicals,

which are among the primary sources for causing various chronic diseases

(Hsieh & Wu 2008; Lee, Mar & Ng 2009; Newaz & Nawal 1999). In addition,

anti-cancer properties of tocotrienols in growth suppression and anti-

proliferation of cancer cells have also been described in recent research

publications. Other pharmacological properties such as anti-cholestrolemic,

anti-hypertensive, anti-diabetic, cardioprotective and neuro-protective have also

been reported from in vitro and in vivo study models (Figure 2-8) (Alexander

2008).

30

Antioxidant Anticholesterol and

Cardioprotection Anti-inflammatory

Neuroprotective and Anti-diabetic

Anti-cancer

Figure 2-8: General pharmacological properties and biological mechanism/molecular targets of tocotrienol

Inhibits the biosynthesis of

cholesterol (Qureshi et al. 1986)

Prevents arterial inflammation

(Aggarwal et al. 2010; Henryk 2008)

Reduces concentration of plasma

cholesterol and low-density

lipoprotein (LDL) cholesterol

(Qureshi et al. 1991)

Activates a range of antioxidant

enzymes (Adam et al. 1996; Hsieh

& Wu 2008; Lee, Mar & Ng 2009;

Newaz & Nawal 1999)

Removes the reactive oxygen

species (ROS) (Renuka Devi &

Arumughan 2007)

Reduces oxidative stresses

(Renuka Devi & Arumughan 2007)

Regulates transcription factors of NF-kappaB (Ahn et al. 2007)

Suppresses inflammatory mediators (Ahmad et al. 2005)

Suppresses COX-2 activity and inducible nitric oxide synthases (Wu & Ng 2010a)

Induces tumour growth suppression

(Agarwal et al. 2004)

Induces cell apoptosis (cell death)

(Kashiwagi et al. 2008)

Regulates various growth factors that are

responsible for tumour formation and

tumour suppression (Agarwal et al. 2004;

Weng-Yew et al. 2009; Wu & Ng 2010b)

Prevents glutamate induced neuronal cell

death (Sen, Khanna & Roy 2004; Sen et

al. 2000)

Attenuates diabetic neuropathy (Kuhad &

Chopra 2009)

Regulates biochemical changes linked to

diabetes (Kuhad & Chopra 2009)

Tocotrienols

Antioxidant

31

2.3 Research Aims and Objectives

The main aim for this part of the research work was to extract natural

antioxidants from rice bran of different Sarawak local rice varieties. In order to

achieve the aforementioned objective, experimental works were designed to

fulfil the following objectives:

a. Extraction of natural antioxidant compounds from rice bran of different

Sarawak local rice varieties via simple solvent extraction method.

b. Assessment of the contents of antioxidant compounds derived from RBE

of different Sarawak local rice varieties.

c. Quantitative analyses of antioxidant compounds derived from RBE via

UV-Visible Spectrophotometer (UV-Vis) and High Performance Liquid

Chromatography (HPLC).

2.4 Experimental Design

2.4.1 Materials and Chemicals

2.4.1.1 Rice Samples

A total of nine different Sarawak local rice samples were used in this

study. The whole rice grain samples were provided by Department of

Agriculture Sarawak, Malaysia, sourced from local rice plantation sites that are

based in Sri Aman and Bario (for ‘Padi Bario’), in Sarawak, Malaysia. The local

names for the nine rice samples are ‘Padi Bubuk’, ‘Padi Bajong’, ‘Padi Bajong

LN’, ‘Padi Wangi Mamut’, ‘Padi Bali’, ‘Padi Bario’, ‘Padi Biris’, ‘Padi Pandan’,

and MR219, which is a commercially grown rice variety. Among all the test

samples, Bajong LN, Bali and Wangi Mamut are pigmented rice. The images of

the rice grains are summarized in the table (Table 2-2) as follow:

32

Table 2-2: Sample images (showing whole rice grain and de-husked rice grain) of

different rice samples.

Sarawak Local Rice Varieties

Local Name:

‘Padi Bubuk’

Local Name:

‘Padi Bajong’

Local Name:

‘Padi Bajong LN’

Local Name:

‘Padi Wangi Mamut’

Local Name:

‘Padi Bali’

Local Name:

‘Padi Bario’

33

Local Name:

‘Padi Biris’

Local Name:

‘Padi Pandan’

Name:

MR219*

*(Commercially cultivated rice grains)

2.4.1.2 Chemicals

Analytical grade methanol (MetOH) (EMSURE®), HPLC grade methanol

(MetOH), hydrochloric acid (HCl) and Folin-Ciocalteu’s reagent were purchased

from Merck (Darmstadt, Germany). Absolute ethanol (EtOH) was purchased

from Fisher Scientific (Malaysia). Glacial acetic acid (CH3COOH) was

purchased from J.T Baker (Thailand). Potassium chloride (KCl) and sodium

acetate (NaOAc) were purchased from R&M (Malaysia). Sodium carbonate

(Na2CO3) and sodium hydroxide (NaOH) were purchased from Unichem

(Malaysia). Sodium nitrite (NaNO2) was purchased from Bendosen (Malaysia).

Aluminium trichloride (AlCl3) was purchased from Acros Organics. Gallic acid

was purchased from NextGene. Quercetin was purchased from Sigma Aldrich.

Tocomin50 (Carotech, Malaysia) standard was a gift in kind given by Prof. Yuen

Kah Hay and Dr. Sherlyn Lim from Universiti Sains Malaysia (USM).

34

2.4.2 Rice Sample Treatment and Preparation of Rice Bran Sample

All immature and diseased whole rice grains were first removed manually

via hand pick from the healthy grains. Then, all the healthy whole rice grains

were pre-dried in forced air drying oven (TFAC-136 Drying Oven, Tuff)

overnight at 70ᵒC to remove moisture and to minimize deterioration in milling

quality of rice grains (Ondier, Siebenmorgen & Mauromoustakos 2012). The

dried whole rice grains were then stored in air tight bags and kept in -22ᵒC

freezer until further use.

For preparation of rice bran sample, rice milling machine (N6.0II, Saint

Donkey) was used to separate the husk layer, bran layer and rice of the whole

grains. The collected brans were immediately filtered through sieves to remove

residual husk layers that were carried over during the milling process. The

filtered brans were then stored in air tight bags and kept in -22ᵒC freezer until

further use. Storing rice bran at cold temperature helps to stabilize the bran

from becoming rancid as a result of oxidation mediated by enzymatic reaction of

lipases (Nagendra Prasad et al. 2011; Randall et al. 1985).

35

2.4.3 Methodology

Figure 2-9 summarises the overview of experimental approaches

applied for extraction and analysis of antioxidants derived from rice bran

samples of different Sarawak local rice varieties.

Figure 2-9: Overview of experimental approaches applied for extraction of

antioxidants from rice bran samples and determination of the

contents of antioxidants in the extracts.

.

2.4.3.1 Simple Solvent Extraction

Extraction of antioxidants from rice brans was carried out at a sample

mass to solvent ratio of 1:10 [weight (g)/volume (mL)], using 3g of rice bran and

30mL of analytical grade methanol. The mixture was stirred continuously on a

stirring hot plate (Stirring Hot Plate HS0707V2, Favorit) for 30 minutes, at room

temperature. After 30 minutes, the RBE were centrifuged (Centrifuge 5702,

Eppendorf) for 10 minutes at 1,000 RPM. The supernatants were collected and

extraction of the residual bran samples were repeated twice more and all the

supernatants were combined.

Extracts with known

concentration in (µg/mL)

RBE

Rice Bran

High Performance

Liquid Chromatography

Extraction with Methanol (MetOH)

Extract

Lyophilization

Reconstituted

Extract

Total Phenolic Content

Total Flavonoid Content

Total Anthocyanin Content

Total γ-Oryzanol Content

Vitamin E (Tocotrienols)

UV-Visible

Spectrophotometry

36

The solvent in the collected extracts were then evaporated using rotary

evaporator at 35°C (RE300, Yamato) and were further concentrated using

vacuum concentrator (7810037, Labconco) until the extracts were fully

lyophilized. The lyophilized extracts were then weighed and kept in -22ᵒC

freezer until further use. For the analysis of rice bran antioxidants, a known

concentration stock solution of crude extract was prepared by dissolving the

lyophilized extract samples in absolute ethanol. The prepared stocks were then

used to prepare a series of diluted samples.

2.4.3.2 Determination of Total Phenolic Content

Total phenolic contents of RBE were determined as per method of

Singleton and Rossi (1965) with slight modification. Briefly, 10µL of RBE were

aliquoted onto a 96-wells plate. Then 40µL of 7.5% (w/v) sodium carbonate

(Na2CO3) was added into each well and later followed by the addition of 50µL of

Folin-Ciocalteu reagent (diluted 10 folds). The solutions were allowed to stand

in the dark and at room temperature for 60 minutes. Then, the absorbance of

the solutions was measured using a microplate reader (Synergy HT, Biotek) at

765nm. Different concentrations of gallic acid (10-100mg/mL) were used to

prepare a standard curve and the total phenolic contents of extracts were

expressed in mg of gallic acid equivalents (GAE) per gram of dried extract.

2.4.3.3 Determination of Total Flavonoid Content

Total flavonoid content of RBE were determined via the aluminium

trichloride method as per method of Jia, Tang and Wu (1999) and Herald,

Gadgil and Tilley (2012) with slight modification. Briefly, 250µL of RBE were

mixed with 1mL of ultra-pure water (Milipore) and 75µL of 5% (w/v) of sodium

nitrite (NaNO2). The mixtures were vortexed (Maxi Mix II, Barnstead

International) thoroughly for 5 minutes. Then, 150µL of 10% (w/v) aluminium

trichloride (AlCl3) was added into all the mixtures respectively and were allowed

to incubate for 6 minutes at room temperature. Later, 500µL of 1M sodium

37

hydroxide (NaOH) and 500µL of ultra-pure water were added into the mixtures.

The mixtures were then centrifuged at 3,000 RPM for 5 minutes to eliminate the

precipitates. Finally, the absorbances of the collected supernatants were

measured via UV-Visible Spectrophotometer (Cary 50 Conc UV-Visible

Spectrophotometer, Varian). Different concentrations of quercetin

(0.008-1.000mg/mL) were used to prepare standard curve and the total

flavonoid contents of RBE were expressed in the unit of mg of quercetin (QE)

equivalents per gram of dried extract.

2.4.3.4 Determination of Total Anthocyanin Content

Total anthocyanin content of RBE were assessed via pH differential

method as per method of Giusti and Wrolstad (2001). Briefly, 25µL of RBE were

mixed with 175µL of 0.024M potassium chloride (KCl) buffer (pH 1.00) onto a

96-wells microplate. The mixtures were left aside for 15 minutes before

absorbance was measured via microplate reader (Synergy HT, Biotek) at

510nm and 700nm respectively. Another 96-wells microplate was set up,

consisting of mixtures of 25µL of RBE and 175µL of 0.025M sodium acetate

(NaOAc) buffer (pH 4.5). The mixtures were also left aside for 15 minutes

incubation at room temperature before their respective absorbances were read

at 510nm and 700nm respectively. The following equations were used to

calculate the total anthocyanin content of RBE:

Equation 1: Absorbance = (A510nm – A700nm)pH 1.0 – (A510nm – A700nm)pH 4.5

Equation 2: Total Anthocyanin Content = 𝐀 𝐱 𝐌𝐖 𝐱 𝐃𝐅 𝐱 𝟏𝟎𝟎𝟎

𝐌𝐀 𝐱 𝟏

*Equation 1 determines the variation in absorbance between two pH buffer

systems.

*Equation 2 determines the total anthocyanin content of sample in the unit of

mg cyanidin-3-glucoside equivalent per mass of sample, in which:

38

A = Difference in Absorbance from Equation 1

MW = Molecular weight of cyanidin-3-glucoside (C3G) (449.2g/mol)

DF = Sample dilution factor

MA = Molar absorptivity (equivalent to 26900)

2.4.3.5 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content

Total γ-oryzanol contents of RBE were determined

spectrophotometrically as per method of Bucci et al. (2003) with slight

modification by using a UV-Visible Spectrophotometer (Cary 50 Conc UV-

Visible Spectrophotometer, Varian). Briefly, the analysis was performed at the

wavelength in the range between 250nm to 800nm. Maximum absorption

spectrum of γ-Oryzanol was determined at 327nm. Different concentrations of

γ-oryzanol reference standards were used to create a standard calibration

curve and the total γ-oryzanol content of RBE were expressed in unit of mg of

γ-oryzanol per kg of sample.

39

2.4.3.6 Determination of Vitamin E Content

Vitamin E contents of RBE were determined via a reversed phase High

Performance Liquid Chromatography (HPLC) system (Agilent 1260 Infinity LC,

Agilent Technologies) coupled with a fluorescence detector (Agilent 1260

Infinity Fluorescence Detector, Agilent Technologies). Briefly, stock RBE of

each rice varieties was diluted 40 times with HPLC grade methanol. All samples

were filtered through 0.45µm PTFE filter prior to sample injection into HPLC. A

solvent system consisting of 100% HPLC grade methanol was delivered to a

4.6 x 250mm, 5µm C-18 column (Zorbax SB-C18, Agilent Technologies).

Separation of vitamin E isomers was performed in isocratic elution mode at a

flow rate of 1.0mL/min and column temperature was kept at 25ᵒC. A sample

injection volume of 25µL was injected into the HPLC and the vitamin E

derivatives were detected at the excitation wavelength of 296nm and emission

wavelength of 330nm. Tocomin50, a mixture of tocotrienols and tocopherol

derived from palm oil was used as reference standard.

2.4.3.7 Statistical Analysis

All results data were presented as mean and standard deviation of three

consecutive experimental repetitions on similar sample. Statistical tool,

GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data

via one-way analysis of variance (ANOVA). The differences among test

samples were determined via Tukey’s multiple comparison test with significance

and confidence level set at P ≤ 0.05.

40

2.4.4 Results and Discussion

2.4.4.1 Determination of Total Phenolic Content

In the following study, total phenolic contents of nine different types of

rice brans from local rice varieties were analysed. The total phenolic contents of

rice brans were determined via a modified Folin Ciocalteu’s assay method. The

total content was expressed in unit of gallic acid equivalent (in mg) per g of

dried extract. As summarized in Table 2-3, only total phenolic contents in RBE

of Bajong, Bajong LN, Bali and Pandan varied significantly (P ≤ 0.05) while no

significant difference was determined between the remaining RBE samples.

Based on the result, the total phenolic contents of all the RBE ranged between

1.34mg GAE/g and 46.80mg GAE/g dried extract.

Table 2-3: Total phenolic contents of RBE. Values expressed represent mean ±

standard deviation of 3 concecutive repetitions (n=3). Different letters

within the same column denote significant difference at

P ≤ 0.05 (Tukey’s Test). GAE = Gallic Acid Equivalent. Graphical

representation for the following data is presented in Figure 5-1

(Appendix Section).

RBE of Different Rice Varieties

Total Polyphenol Content

(mg GAE/g dried extracts)

Bajong LN 46.80 ± 2.80a

Bali 18.66 ± 2.09b

Pandan 10.99 ± 0.17b

Wangi Mamut 5.89 ± 0.64c

Bajong 3.60 ± 0.43cd

MR219 3.59 ± 0.38cde

Bario 2.04 ± 0.35def

Biris 1.73 ± 0.18defg

Bubuk 1.34 ± 0.29deg

41

In the present study, three out of nine samples are pigmented rice

varieties. The three pigmented rice varieties are Bajong LN, Bali and Wangi

Mamut. RBE derived from Bajong LN, Bali and Wangi Mamut generally showed

a higher total phenolic content as compared to non-pigmented varieties. Such

trend is concurrent with reports from several researchers in which pigmented

rice varieties were found to contain more phenolic compounds as compared to

none pigmented rice varieties (Huang & Ng 2012; Mohanlal et al. 2013; Seo et

al. 2013; Yawadioa, Tanimorib & Moritta 2007). Among the three pigmented

rice varieties, RBE of Bajong LN had the highest total phenolic content, and

then followed by Bali and lastly Wangi Mamut. Their respective contents were

significantly different from one another (P ≤ 0.05).

However, in the present work, it was discovered that the RBE of non-

pigmented rice varieties, Pandan showed a higher total phenolic content when

compared Wangi Mamut and the difference was significant (P ≤ 0.05). Based

on the present result, it is more likely that RBE of Pandan contains more

phenolic compounds than RBE of Wangi Mamut. It was suggested that factors

such as variation in plant genetic diversities and growth environment factors

influence the difference in total phenolic contents of the two rice varieties (Britz

et al. 2007; Huang & Ng 2012).

To the best of author’s knowledge, most of the selected Sarawak local

rice varieties in the present study remain underexplored. There is a lack of

reference data to be used for comparison with the presently obtained results.

There was a study on the total phenolic content of MR219 rice variety by

Fasahat et al. (2012). However, direct comparison cannot be performed as their

main focus was not emphasized on the phenolic content in rice bran but on the

polished rice grain (0.32mg GAE/g) instead (Fasahat et al. 2012).

The present study reported average total phenolic contents of 388mg

GAE/100g and 2378mg GAE/100g for non-pigmented (white bran) and

pigmented (purple bran) rice respectively. Table 2-4 summarizes the total

phenolic contents of rice varieties from different locations. As per review of

Goufo and Trindade (2014), the present data were comparable to pooled data

of total phenolic contents detected in more than 50 different types of rice

42

varieties cultivated in different countries (inclusive of China, Taiwan, Brazil,

Thailand, India). They were 294.1mg GAE/100g and 2297.4mg GAE/100g for

non-pigmented and pigmented rice respectively. The average total phenolic

contents for non-pigmented rice bran reported in this study (338mg GAE/100g)

were slightly higher than those reported in Taiwan (196.1mg GAE/100g) (Huang

& Ng 2012) and Iran (256.6mg GAE/100g) (Ghasemzadeh et al. 2015)

respectively. As of the selected pigmented rice bran in this study, the average

total phenolic contents reported was 2378mg GAE/100g which was higher than

those detected in Taiwan (949.0mg GAE/100g) (Huang & Ng 2012) and

Thailand (1091.0mg GAE/100g) (Muntana & Prasong 2010).

Table 2-4: Average total phenolic contents in different rice varieties

n.a – not available

Contrarily, the average total phenolic contents reported in this study were

slightly lower than those detected in commercial rice varieties cultivated in

China (Zhang et al. 2010) and India (Parvathy et al. 2014). The average total

phenolic contents detected in non-pigmented and pigmented rice varieties

cultivated in China and India were 485mg GAE/100g and 3906.5mg GAE/100g,

and 650mg GAE/100g and 3935mg GAE/100g respectively. The differences in

total phenolic contents among different rice varieties cultivated in various parts

Average Total Phenolic Content (mg GAE/100g)

Location of Rice Varieties Non-Pigmented Rice Pigmented Rice

Malaysia (Sarawak) 338.0 2378.0

China, Taiwan, Brazil, Thailand,

India (Pooled Data) (Goufo &

Trindade 2014)

294.1 2297.4

Taiwan (Huang & Ng 2012) 196.1 949.0

China (Zhang et al. 2010) 485.0 3906.5

Thailand (Muntana & Prasong

2010) 940.8 1091.0

Iran (Ghasemzadeh et al. 2015) 256.6 n.a

India (Parvathy et al. 2014) 650.0 3935.0

43

of the world could be due to variations in genetic diversity and environmental

factors (Huang & Ng 2012). The effect of bran colour on the phenolic acid

composition in rice is one of the most significant factors. Strong correlation

between the colour of rice bran and its total phenolic content has been well

documented. It has been reported that black rice varieties generally have the

highest total phenolic content and followed by red, purple and white rice

varieties (Shen et al. 2009; Zhang et al. 2006). In general, rice bran and husk

have the highest phenolic content and then followed by polished rice grain (also

known as ‘white rice’) (Goufo et al. 2014a).

44

2.4.4.2 Determination of Total Flavonoid Content

Total flavonoid contents of different RBE were determined via aluminium

complexation-based spectrophotometric assay. Quercetin (QE), a type of

flavonoid was used as the reference standard for the assay and results were

expressed in mg QE/g dried extract. The flavonoid contents for all test samples

are summarized in Table 2-5. Based on the results, total flavonoid contents in

crude extracts of different rice bran varied significantly (P ≤ 0.05). The

determined total flavonoid contents in crude extracts of different rice brans were

in the range of 1.80 to 16.30mg QE/g dried extracts.

Table 2-5: Total flavonoid contents of RBE. Values expressed represent mean ±


within the same column denote significant differences at P ≤ 0.05

(Tukey’s Test). QE = Quercetin Equivalent. Graphical representation

for the following data is presented in Figure 5-2 (Appendix section).

The highest total flavonoid content was determined from the crude

extract of Bajong LN rice bran (16.30mg QE/g dried extract) while the lowest

total flavonoid content was detected in RBE of Biris (1.80mg QE/g dried extract).



(mg QE/g dried extracts)

Bajong LN 16.30 ± 0.11a

Pandan 10.28 ± 0.09b

Bali 7.97 ± 0.03c

Bajong 5.00 ± 0.05d

Bubuk 3.21 ± 0.07e

Wangi Mamut 3.19 ± 0.03e

MR219 2.30 ± 0.06f

Bario 1.88 ± 0.06g

Biris 1.80 ± 0.01g

45

The total flavonoid content detected in rice varieties selected for this

study in range of 1.80 to 16.30mg QE/g dried extracts. The range was slightly

higher than those reported from rice varieties cultivated in India which was in

the range of 1.68mg QE/g to 8.51mg QE/g (Rao et al. 2010). The present study

reported average total flavonoid contents of 2.72 mg QE/g and 9.15mg QE/g for

non-pigmented and pigmented rice respectively. Similar to the total phenolic

content, total flavonoid content is evidently higher in pigmented rice when

compared to non-pigmented rice (Goufo & Trindade 2014). Based on the

pooled data reviewed by Goufo and Trindade (2014), average total flavonoid

contents detected in non-pigmented and pigmented rice were 4.09mg catechin

equivalent (CE)/g and 11.07mg CE/g respectively. Although different reference

standard was used in the studies reviewed, it still showed the trend of

pigmented rice having higher total flavonoid content as compared to those non-

pigmented rice.

Among the three pigmented rice, RBE of Bajong LN reported the highest

total flavonoid content, then followed by Bali and lastly Wangi Mamut. Their

respective total flavonoid contents were significantly different from one another

(P ≤ 0.05). However, RBE of Pandan reported a significantly higher (P ≤ 0.05)

total flavonoid content as compared Bali extract, and the flavonoid content in

Bajong extract was also significantly higher (P ≤ 0.05) than the latter in Wangi

Mamut extract. Based on the present result, it was deduced that the RBE of

Pandan (non-pigmented rice) contain more flavonoids as compared to both

RBE of Bali and Wangi Mamut (pigmented rice). However, it was suggested

that factors such as variation in plant genetic diversities, growth environment

factors, and extraction method do influence the total flavonoid contents in

different rice varieties (Britz et al. 2007; Huang & Ng 2012).

46

2.4.4.3 Determination of Total Anthocyanin Content

Total anthocyanin contents of different RBE were determined via pH

differential method. The results are depicted in Table 2-6. Cyanidin-3-glucoside,

a type of monomeric anthocyanin was used as reference standard. The data

were all expressed in unit mg cyanidin-3-glucoside equivalent/100g of dried

extract. Based on the results, only the total anthocyanin contents in RBE of Bali

(11.94mg/100g), Bario (12.40mg/100g), and MR219 (11.91mg/100g) were

significantly different from Bajong (10.80mg/100g) at P ≤ 0.05.

Table 2-6: Total anthocyanin contents of different RBE were expressed in unit of

mg cyanidin-3-glucoside equivalent/100g dried extracts. Results were

expressed in mean ± standard deviation of three consecutive

experimental repetitions (n=3). Graphical representation for the

following data is presented in Figure 5-3 (Appendix section).

n.a – not available

*Significantly different from Bajong at P ≤ 0.05 (Tukey’s Test)

The highest total anthocyanin content was determined in the RBE of

Bario (12.40mg cyanidin-3-O-glucoside equivalent /100g) while the lowest total

anthocyanin content was determined in the RBE of Biris (8.84mg cyanidin-3-O-

glucoside equivalent /100g).



(mg cyanidin-3-O-glucoside/100g dried extracts)

Bario 12.40 ± 0.16*

Pandan 12.08 ± 0.2

Bali 11.94 ± n.a*

MR219 11.90 ± 0.06*

Bajong LN 11.66 ± 0.68

Wangi Mamut 10.84 ± 0.55

Bajong 10.80 ± 0.06

Bubuk 9.77 ± 0.51

Biris 8.84 ± 0.88

47

Cyanidin-3-glucoside is the predominant form of anthocyanins present in

rice. Its content accounted for 51-84% of the total anthocyanin content in rice,

particularly on the bran layer of rice (Goufo & Trindade 2014). Most the

literature reported a higher total anthocyanin content in pigmented rice as

compared to non-pigmented rice. The average total anthocyanin contents in

pigmented rice (440mg cyanidin-3-O-glucoside equivalent/ 100g) were

approximately 10 folds much higher than those in non-pigmented rice (4.34mg

cyanidin-3-O-glucoside equivalent/ 100g). Within the group of pigmented rice,

purple rice has the highest total anthocyanin content, then followed by black

rice, red rice, and brown rice respectively (Goufo & Trindade 2014). It has been

revealed that black rice contains mainly anthocyanins (Zhang et al. 2010) while

the red rice are mainly composed of proanthocyanidins (Min, McClung & Chen

2011). As for purple rice, it contains both anthocyanins and proanthocyanidins

(Goufo & Trindade 2014).

The present result did not follow the trend of pigmented rice having

higher total anthocyanin content as compared to the non-pigmented rice

varieties. The total anthocyanin contents of pigmented rice varieties: Bali,

Bajong LN, and Wangi Mamut were 11.94, 11.66 and 10.94mg cyanidin-3-O-

glucoside equivalent/ 100g respectively. These reported values were lower than

some of the non-pigmented rice varieties studied which include Bario (12.40mg

cyanidin-3-O-glucoside equivalent/ 100g), Pandan (12.08mg cyanidin-3-O-

glucoside equivalent/ 100g), and MR219 (11.90mg cyanidin-3-O-glucoside

equivalent/ 100g). Such discrepancies could be due to the degradation of

anthocyanin compounds over the course of sample storage. Various factors

such as pH, temperature, light exposure, compound structure, and storage

concentration are known to alter the stability of anthocyanins (He et al. 2012).

Anthocyanins are generally more stable in acidified media (lower pH) as

compared to the higher pH alkaline media. Different pH will have an effect on

the compound structure of anthocyanins (Bordignon-Luiz et al. 2007; Morais et

al. 2002). Temperature wise, anthocyanins are more stable at lower

temperature (4˚C) and usually stored in powder or concentrated forms. These

factors have been shown to alter the stability and half-life of anthocyanins

(Bordignon-Luiz et al. 2007).

48

2.4.4.4 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content

Total γ-oryzanol content in RBE of different rice varieties were analysed

via a fixed wavelength spectrophotometric method (Bucci et al. 2003).

γ-Oryzanol was used as reference standard to establish a standard curve for

determination of total γ-oryzanol content in all test samples. The total γ-oryzanol

contents of RBE were depicted in Table 2-7. Based on the obtained results,

total γ-oryzanol contents in RBE of different rice varieties were significantly

different (P ≤ 0.05) from one another. The highest total γ-oryzanol was

determined in RBE of Bajong LN (7523.96mg/kg dried extracts) while the lowest

total γ-oryzanol was determined in RBE of Bario (1234.11mg/kg dried extracts).

Table 2-7: Total γ-oryzanol content of RBE. Values expressed represent mean ±


within the same column denote significant differences at P ≤ 0.05

(Tukey’s Test). Graphical representation for the following data is

presented in Figure 5-4 (Appendix section).



(mg/kg dried extracts)

Bajong LN 7523.96 ± 27.16a

Pandan 4092.06 ± 4.76b

Bali 3883.53 ± 5.36c

Bajong 2507.66 ± 14.36d

Bubuk 2095.73 ± 6.02e

Wangi Mamut 1954.93 ± 3.04f

Biris 1612.76 ± 4.69g

MR219 1393.10 ± 8.59h

Bario 1234.11 ± 7.01i

49

In this study, the total γ-oryzanol contents detected in non-pigmented

and pigmented rice were in the range of 1234.11mg/kg to 4092.06mg/kg and

1954.93mg/kg to 7523.96mg/kg respectively. The obtained data were slightly

different from data pooled and summarized by Goufo and Trindade (2014)

which were in the range of 1030-8864mg/kg and 1122-9120mg/kg γ-oryzanol

for non-pigmented and pigmented rice respectively. Aside from that, Min,

McClung and Chen (2011) also reported a different range of total γ-oryzanol

content (3861.93mg/kg to 5911.12mg/kg) detected in different types of rice bran.

γ-Oryzanol is a mixture of ferulate esters with sterols or triterpenes.

There are four main components of steryl ferulates, namely campesteryl

ferulates, cycloartenyl ferulates, 24-methylenecycloartenyl ferulates and β-

sitosteryl ferulates. Among all different types of cereal grains, rice has the

highest content of γ-oryzanol (Kozuka et al. 2012). Variation in plant genotypes

could be one of the factors causing variation in total γ-oryzanol content among

different rice varieties. In addition to that, it has been discovered that

environmental factor, such as growth temperature also influence the total γ-

oryzanol content in rice (Britz et al. 2007). Other than that, the yield of γ-

oryzanol is also highly dependent on the extraction method and solvent used for

the extraction (Chen & Bergman 2005).

The effects of bran colour on the total γ-oryzanol composition of rice

were not apparent. The colour of rice generally does not stipulate the levels of

total γ-oryzanol content as there is no significant correlation between the two

variables (Huang & Ng 2012). However, the distribution of γ-oryzanol in rice

predominantly exists in the bran portion of rice, followed by the whole rice grain,

husk and finally the endosperm (Kozuka et al. 2012). This gives an indication

that γ-oryzanol is mostly concentrated in the pericarp than the endosperm

portion of the rice.

50

2.4.4.5 Determination of Vitamin E Content

Total vitamin E contents of different RBE were determined via high

performance liquid chromatography (HPLC) method. Tocomin50, a tocotrienols

rich fraction derived from palm oil was used as the reference standard for the

analysis. A total of 50% of the content in tocomin50 is constituted of delta (δ-)

tocotrienols (5.30%), gamma (λ-) tocotrienols (20.60%), alpha (α-) tocotrienols

(12.30%) and tocopherol (mainly α-tocopherol: 11.80%) while the remaining

50% of the components are consisting of phytosterols, co-enzyme Q10 and

carotenoids. Figure 2-10 depicts the HPLC chromatograms of Tocomin50

standard [Figure 2-10(a)] and RBE sample [Figure 2-10(b)] respectively.

Figure 2-10: HPLC chromatograms of (a) Tocomin50 and (b) RBE of Bajong LN.

Delta T3: δ-tocotrienols; Gamma T3: γ-tocotrienols; Alpha T3: α-

tocotrienols; Tocopherol: mainly α-tocopherol

(a)

(b)

51

Due to the nature of tocomin50, only δ-T3, γ-T3, α-T3 and tocopherol

(mainly α-tocopherol) were determined in different RBE via HPLC. Contents of

different vitamin E derivatives were expressed in units of mg/kg sample. Based

on the result as shown in Table 2-8, the contents of γ-T3, α-T3 and tocopherol

(mainly α-tocopherol) differed significantly (P ≤ 0.05) among different RBE. The

δ-T3 contents of different RBE were in the range of 3.18 to 15.41mg/kg. As for

γ-T3, they were in the range of 126.89 to 353.53mg/kg; α-T3 was in the range

of 1.46 to 87.12mg/kg; tocopherols (mainly α-T) were in the range of 54.62 to

231.04mg/kg.

Table 2-8: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different

RBE were expressed in units of mg/kg. The data represented mean

± standard deviation of three repetitions (n=3). Different letters within

the same column denote significant difference at P ≤ 0.05. T3 =

tocotrienols; T = tocopherol.

Vitamin E Content (mg/kg)

Rice Varieties δ-T3 γ-T3 α-T3 T

Bajong 9.51±0.24a 154.64±5.64a 36.86±0.41a 122.04±0.52a

Bajong LN 15.41±1.72a 353.53±5.15b 68.02±2.34b 231.04±6.32b

Bali 3.18±0.15b 347.27±4.61b 13.72±1.31c 55.09±1.27c

Bario 9.36±0.23a 282.22±1.96c 11.57±0.06c 61.32±1.47cd

Biris 6.81±0.21c 209.16±1.15d 87.12±32.17d 198.97±7.82e

Bubuk 7.88±0.22a 243.29±0.67e 24.47±0.73e 103.07±0.67f

MR219 6.79±0.20a 307.85±4.40f 1.46±0.042f 54.62±1.58cd

Pandan 6.33±0.08a 126.89± 4.82g 28.19±2.99ae 119.96±3.02g

Wangi Mamut 7.94±0.13a 196.65±1.23h 49.28±1.10g 143.14±3.75h

52

The obtained results varied slightly from the contents of different vitamin

E derivatives detected in rice varieties grown in Taiwan (Huang & Ng 2012).

Higher contents of vitamin E derivatives were detected in Sarawak local rice as

compared to those detected in Taiwan’s rice varieties. The δ-T3 contents of

different Taiwan rice varieties were in the range of 1.34 to 3.53mg/kg. As for γ-

T3, they were in the range of 68.52 to 151.09mg/kg; α-T3 were in the range of

8.44 to 67.01mg/kg; tocopherols (mainly α-T) were in the range of 23.27 to

107.73mg/kg (Huang & Ng 2012). Such variations could have been caused the

differences in plant genotypes, environmental condition, harvesting method and

extraction method. Regardless of the type of rice, γ-T3 appeared to be the

predominant form of vitamin E that is present in the rice bran. The second most

abundant vitamin E derivative in rice bran is tocopherol, then followed by α-T3

and lastly, δ-T3 which only exist in trace amount (Huang & Ng 2012). Moreover,

in addition to the four tocotrienol derivatives, two additional novel tocotrienols

derivatives were isolated from rice bran and they were characterized as

desmethyl tocotrienol and didesmethyl tocotrienol respectively (Qureshi et al.

2000).

As depicted in Figure 2-11, the compositional percentage of different

vitamin E derivatives in different RBE varied from one another. In general, the

content of γ-T3 was the highest among other vitamin E derivatives determined,

accounting for 41.67% - 83.04% of the total vitamin E content. Tocopherol was

the second most abundant vitamin E derivatives determined, accounting for

13.14% - 42.65% of the total vitamin E content. As for δ-T3 and α-T3, both

vitamin E derivatives only existed in trace amount, with content in the ranges of

0.76% - 2.94% and 0.39% - 17.35% of the total vitamin E content determined

respectively.

Based on the present results, there is no significant correlation between

the colour of rice bran and the content of different vitamin E derivatives

(Table 2-8). Similar result trend was also reported by Goufo and Trindade

(2014). It was suggested that plant genotypes and growth environment are

known to be the major factors that contribute to the total contents of vitamin E

derivatives (Goufo & Trindade 2014).

53

Figure 2-11: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in

different RBE were expressed in units of %. The data represented

mean ± standard deviation of three repetitions (n=3). T3 =

Tocotrienols; T = Tocopherol.

0%

20%

40%

60%

80%

100%

Bajong BajongL.N

Bali Bario Biris Bubuk MR219 Pandan WangiMamut

Perc

en

tag

e (

%)

Rice Varieties

Vitamin E Composition Analysis δ-T3

γ-t3

α-t3

T

54

2.4.5 Conclusion

Total contents of phenolic compounds, flavonoids, anthocyanins, γ-

oryzanol and vitamin E (specifically on δ-tocotrienols, α-tocotrienols, γ-

tocotrienols and tocopherol) in different local rice varieties were thoroughly

assessed in this study. The results have demonstrated discrepancies in the

contents of bioactive compounds among different RBE of Sarawak local rice

varieties. By studying the distribution of these bioactive compounds in different

rice sample, it offers useful information for the selection of ideal rice variety as

functional food.

Among all the nine different Sarawak local rice varieties selected for this

part of the study, the RBE of Bajong LN reported the highest contents of

phenolic compounds (46.80mg GAE/g), flavonoids (16.30mg QE/g), and total γ-

oryzanol (7523.96mg/kg) respectively. Based on the obtained result, average

total phenolic contents detected in selected Sarawak local rice varieties were

388mg GAE/100g and 2378mg GAE/100g for non-pigmented and pigmented

rice respectively. The obtained value were slightly higher than the average total

phenolic contents of more than 50 different rice varieties from various locations

in the world (294.1mg GAE/100g and 2297.4mg GAE/100g for non-pigmented

and pigmented rice respectively).

In addition to that, higher total flavonoids contents were also detected in

Sarawak local rice varieties (1.80mg QE/g to 16.30mg QE/g) as compared to

Njavara rice varieties (1.68mg QE/g to 8.51mg QE/g) cultivated in India. Total γ-

oryzanol detected in the selected Sarawak local rice varieties was in the range

of 1234.11mg/kg to 7523.96mg/kg which were comparable to the average

range of total γ-oryzanol (1030mg/kg to 9120mg/kg) detected in various rice

varieties in the world.

As for vitamin E, higher contents of compounds were generally detected

in Sarawak local rice as compared to those detected in Taiwan’s rice varieties.

The δ-T3 contents detected in different Taiwan rice varieties were in the range

of 1.34 to 3.53mg/kg (Sarawak local rice: 3.18 to 15.41mg/kg). As for γ-T3, they

were in the range of 68.52 to 151.09mg/kg (Sarawak local rice: 126.89 to

55

353.53mg/kg); α-T3 were in the range of 8.44 to 67.01mg/kg (Sarawak local

rice: 1.46 to 87.12mg/kg); tocopherols (mainly α-T) were in the range of 23.27

to 107.73mg/kg (Sarawak local rice: 54.62 to 231.04mg/kg). Despite of

discrepancies in vitamin E contents, most rice varieties share the same trend in

their respective vitamin E composition. γ-T3 appeared to be the predominant

form of vitamin E that are present in the rice bran and followed by tocopherol, α-

T3 and lastly, δ-T3 which only exist in trace amount.

Among nine different types of Sarawak local rice varieties studied, three

of them are purple colour pigmented rice varieties (Bajong LN, Bali and Wangi

Mamut) while the others are non-pigmented rice. Based on the obtained results,

pigmented rice varieties generally have higher content of bioactive compounds

when compared to non-pigmented varieties. Such result trend is consistent with

reports from literature. Highest contents of phenolic compounds (46.80mg

GAE/g), flavonoids (16.30 ± 0.11mg QE/g), γ-oryzanol (7523.96 ± 27.16mg/kg),

and vitamin E (15.41 ± 1.72mg/kg δ-tocotrienols; 353.53 ± 5.15mg/kg γ-

tocotrienols; 68.02 ± 2.34mg/kg α-tocotrienols; 231.04 ± 6.32mg/kg tocopherol)

were detected in the RBE of Bajong LN. The contents of bioactive compounds

in Bajong LN were significantly higher than those detected in commercial rice

variety, MR219.

Due to the lack of reference data available for the selected Sarawak local

rice varieties, direct comparison with the presently obtained results cannot be

performed. Discrepancies in contents of bioactive compounds among different

rice varieties could be due to variations in plant genotypes and growth

environment. Both are known to have an effect on the production of bioactive

compounds in plants. These essential compounds are produced by plants for

growth, reproduction, and as part of the defence mechanisms against external

stress factors. Besides that, other factors such as plant growth stage,

harvesting period and method can also contribute to the differences in contents

of bioactive compounds among different rice varieties.

56

In addition, the lack of standardized extraction and analytical methods

might also contribute to variation in the data obtained. Bioactive compounds in

plant material may exist in free form (soluble-free antioxidants) and conjugated

forms (insoluble antioxidants) of glycosides or esters with additional compounds

like sterols, glucosides, flavonoids, fatty acids, proteins, and alcohols. Due to

the use of methanol as the extraction solvent in the present work, most of the

extracted compounds were in the soluble-free forms which generally have low

molecular weight. Contrarily, the high molecular weight insoluble forms of

bioactive compounds tend to trap in food matrix and often present in remains of

organic extraction (Goufo & Trindade 2014). Regardless of the discrepancies in

the contents of bioactive compounds among different RBE, the present result

put forward the potential of rice bran as a good source of essential natural

antioxidants for health and wellness. It is an ideal food source that can be used

in the development of nutraceuticals and functional food ingredients.

57

3. Chapter 3: Bioactivity Studies of Natural

Antioxidants Derived from Rice Bran of Different

Sarawak Local Rice Varieties

3.1 Executive Summary

The existence of reactive oxygen species (ROS) is vital for biological

activities of cells. Low amount of ROS can stimulate cellular physiological

activities. Cells utilized a series of endogenous and exogenous antioxidant

protection systems to regulate and maintain redox homeostasis. However,

when the ROS production escalates and failed to be removed by antioxidants in

the cells, it causes over-accumulation of ROS and eventually leads to oxidative

stress. The presence of oxidative stress has been known to play the central role

in the onset and progression of chronic diseases. Several evidences have

revealed the involvement of oxidative stress in pathogenesis of cardiovascular

diseases (CVD). Oxidative modification of essential biological components

initiates a series of signal transduction cascade that eventually leads to the

progression of CVD. Hence, the rationale of using natural antioxidant to

attenuate the risks of CVD via inhibition of inadvertent cellular oxidative damage

or signalling pathway may have important implications to both prevention and

treatment of CVD.

In the previous chapter (Chapter 2), a preliminary study on the contents

of bioactive compounds in different RBE of Sarawak local rice varieties have

been conducted. The current work focuses on the antioxidant activities of RBE.

Two types of in vitro antioxidant assay systems (in vitro chemical-based and in

vitro cell-based assay systems) have been used to assess the antioxidant

capacity of Sarawak RBE. For the in vitro cell-based antioxidant assay system,

the preliminary study of assessing antioxidant capacity of RBE towards

cardioprotection was conducted by using a cardiac cell culture model.

58

In this chapter of the thesis, it provides a comprehensive literature review

relevant to the field of study. In addition, summary of experimental approaches

and presentation of results for the second section of the overall research work

are also included in this chapter.

3.2 Literature Review

3.2.1 Reactive Oxygen Species (ROS) and Oxidative Stress

The existence of reactive oxygen species (ROS) always has been part of

the physiological cycles of aerobic cells. ROS is referred as a general term for

either free radicals or free radicals generating molecular species (Kunwar &

Priyadarsini 2011). Common source of these reactive radicals include the by-

products both endogenous and exogenous metabolisms of aerobic cells, such

as the superoxide (O2˙-) and nitric oxide (NO˙) radicals while other external

noxious sources such as chemicals, environmental toxins, drugs and radiation

are also contributing to the increment of overall intracellular ROS content

(Helmut 1994).

Under normal cellular condition, cellular processes produce considerable

amount of O2˙- and NO˙ radicals. During mitochondrial respiration and

phagocytosis, cells taken up oxygen and converts it to O2˙- radicals. As for NO˙

radicals, they are the enzymatic product of nitric oxide synthase which acts as

relaxing factor and neurotransmitter for endothelium. Through a series of

complex transformation, these two radicals are converted to stronger radical

species such as the hydroxyl radical (˙OH), peroxyl radicals (ROO˙) and singlet

oxygen (1O2). Certain radical species may further be converted to molecular

radical species such as the peroxynitrite (ONOO-) and hydrogen peroxide (H2O2)

(Kunwar & Priyadarsini 2011). All these reactive radical species are the

sources of ROS in cells.

59

Certain biological functions of cells require low concentration of ROS. In

this case, ROS acts as the stimulant for cellular physiological activities such as

maintaining cellular growth, modulating gene expression, defencing the cell

against infection and acts as secondary messengers for signal transduction

pathways (Droge 2002; Schreck & Baeuerle 1991). However, ROS is relatively

unstable due the possession of one or more unpaired electrons within its own

electron configuration (Aruoma 1998).

At high concentration, ROS are capable of interacting with different

biomolecules in various ways to produce certain types of radicals. For example,

when ROS interacts with crucial biomolecules like DNA, proteins and lipids,

secondary radicals derived from sugar and nitrogenous bases, amino acids and

lipids are produced. Oxidations of protein and DNA by ROS impose structural

changes and fragmentation that disrupt their proper functions, and

consequently result in cell death and mutation. As for cellular membrane,

phospholipids are vulnerable to oxidation by ROS and forms lipid peroxides.

These secondary radicals are capable of causing cascade reactions and affect

the normal physiological functions of cells (Beckman & Ames 1997; Kunwar &

Priyadarsini 2011).

The balance between ROS production rates and the rates of its removal

by various antioxidants is crucial for maintaining intracellular homeostasis of

ROS. In all forms of life, the redox state of cells is mediated by cofactors such

as glutathione (GSH), nicotinamide adenine dinucleotide (NAD), and flavin

adenine dinucleotide (FAD) which are commonly found in cells, tissues and

biological fluids. Cells usually have a more negative redox state under normal

conditions (Kohen & Nyska 2002; Schafer & Buettner 2001). However, when

the ROS production escalates and failed to be removed by antioxidants in the

cells, the redox state of the cells will shift to a less negative state and thereby

increases their oxidation status. Such situation is known as oxidative stress

(Droge 2002).

60

Oxidative stress is known to induce intracellular cell damage and cell

death that affects all critical biomolecules such as DNA, lipids, sugars and

proteins (Dröge & Schipper 2007). For instance, when the level of oxidative

stress in the cell elevates, cellular mitochondrial functions will deteriorate and

cause the depletion of adenosine triphosphate (ATP) (Droge 2002). The

depletion in ATP levels will then triggers cell death via necrosis or apoptosis

(Eguchi, Shimizu & Tsujimoto 1997). Other than ATP levels as the determinant

of cell death, it has been reported that the shifting of cellular redox state from a

more negative to a less negative state also induce apoptosis- or necrosis-

mediated cell death (Schafer & Buettner 2001).

Many different chronic diseases such as atherosclerosis, neurological

diseases, cancer and diabetics have been associated with oxidative stress.

Factors such as molecular targets, mechanism and severity of oxidative stress

define the consequence of oxidative stress injury on cells. In general, the

hallmark of oxidative stress-mediated chronic diseases is widely linked with

involvement of oxidative stress in the signal cascade reaction of inflammation

and the production of chemo-attractants (Aruoma 1998).

3.2.2 Oxidative Stress Related Disease

The progression of chronic diseases such as cardiovascular disease,

neurological disease, pulmonary disease, rheumatoid arthritis, nephropathy,

and ocular disease has been attributed to complex and multifactorial

physiological changes mediated by externally- and internally-driven stimuli

(Pham-Huy, He & Pham-Huy 2008). There have been significant evidences

supporting the involvement of oxidative stress in the progression of these

diseases. Majority of these diseases were originated from the dysregulation of

multiple genes as a consequence of oxidative stress (Aruoma 1998; Wang et al.

2011).

61

Oxidative stress occurs when excess free radicals fail to be removed and

accumulated over time. Excessive accumulation of these free radicals exhibits a

deleterious effect to essential biological components such as DNA, lipids,

sugars, proteins and fatty acids (Dröge & Schipper 2007; Esiri 2007; Fleury,

Mignotte & Vayssiere 2002). Under oxidative stress condition, normal functions

of these essential biological components will undergo progressive oxidative

modifications and consequently disturb their usual functions. The biological

system will attempt to offset and regulate these stresses by initiating their

respective repairing mechanisms. However, if the biological repairing

mechanisms fail to counteract the attacks, oxidative stress will trigger the

occurrence and progression of various chronic diseases through a series of

signal transduction cascade events (Magalhaes et al. 2009).

.

3.2.2.1 Cardiovascular Diseases

Cardiovascular disease (CVD) still remains as one of the largest leading

cause of global mortality. The World Health Organization (WHO) has estimated

a total number of 17.5 million deaths from CVD in the year 2012, accounted for

one-third of the global mortality (WHO 2015). The total numbers of annual

fatalities are expected to increase to 20 million of death cases by 2020, and

further increase to 24 million by 2030 (WHO 2004). In Sarawak, the disease

accounted for the second leading cause of mortality among the local community.

In 2012, there were a total of 26,000 cases reported and the number of cases

continues to upsurge with 24,000 cases reported within the first eight months of

2013 (Ruekeith 2013). There is an urgent need for global attention to alleviate

mortality rate of CVD.

The onset and progression of CVD are known to be multifactorial (Pham-

Huy, He & Pham-Huy 2008). There has been a huge debate over the potential

role of oxidative stress as the primary source for pathogenesis of CVD (Ceriello

2008). Such hypothesis has been supported by evidences (Ceriello 2008;

Chatterjee et al. 2007; Droge 2002) that reveal the involvement of oxidative

stress in several types of CVDs. Coronary artery disease (CAD) is the most

62

common type of CVD that eventually leads to myocardial infarction, a medical

event commonly known as heart attack (Ma et al. 2013). The disease begins

with the narrowing of coronary arteries as a result of atherosclerosis (Forycki

2010). Progressive narrowing of coronary arteries reduces the blood supply to

the heart. If the condition gets worsen, it may cause a blockage in the coronary

artery and completely disrupt the blood flow to heart. In such case, this will

cause extensive damage to heart muscles and tissue whereby the

consequences could be fatal (Chantal et al. 2012).

3.2.2.1.1 Atherosclerosis

Atherosclerosis refers to the hardening of arteries. It is a type of chronic

inflammatory disease (Toh et al. 2014) and it has been known as the primary

cause of CAD (Lönn, Dennis & Stocker 2012). It typically begins prior to

adulthood and progresses slowly. Its slow progression and complicated etiology

limit the detection of early atherogenic events for prevention measures (Lönn,

Dennis & Stocker 2012). Some of the contributors to the development of

atherosclerosis include smoking, unhealthy diet (high fat diet) and the lack of

physical exercises. In addition, medical conditions such as hyperlipidemia, high

blood pressure, and diabetes are also among the risk factors that closely

associate with the development of atherosclerosis (Anand et al. 2008; Toh et al.

2014).

One of the initiating causes of atherosclerosis was characterized as

oxidative modification (Goldstein et al. 1979; Steinberg et al. 1989). Both

oxidative stress and oxidation of low density lipoprotein (LDL) have been

regarded as the key issues in pathogenesis of atherosclerosis (Muid et al.

2013). Excessive reactive oxygen species (ROS) produced from cellular

metabolism add on to the oxidative stress, which in turn promotes various

mechanisms of atherosclerosis, including endothelial dysfunction, migration of

monocytes, LDL peroxidation and proliferation of smooth muscle cells (Berliner

et al. 1995). The latter induce additional events that lead to progression of

atherosclerosis.

63

The progression of atherosclerosis is complicated and multifactorial

throughout different developmental stages. Progression of atherosclerosis was

depicted in Figure 3-1 and the pathogenesis of atherosclerosis was

summarized in Figure 3-2. Briefly, it begins with the entrance of low-density-

lipoproteins (LDLs) into the sub-endothelial region (also known as intima) of the

blood artery (Swirski & Nahrendorf 2013; Toh et al. 2014). Through a series of

biochemical reaction and signal transduction cascade, it progressively leads to

the formation of atherosclerotic plaque and narrowing of blood vessel. Blockage

of blood artery will restrict the blood flow to the heart and consequently increase

the likelihood of ischemia, a condition in which the supplies of oxygen and

nutrients to the heart get disrupted (Lusis 2000). Prolonged condition of

ischemia will induce extensive damage to heart muscles and tissues. Such

event is known myocardial infarction, commonly known as heart attack (Chantal

et al. 2012; Ma et al. 2013; Swirski & Nahrendorf 2013).

64

Figure 3-1: Graphical representation of atherosclerotic plaque formation [Image source:(Quillard & Libby 2012a)]

65

Figure 3-2: Developmental stages of atherosclerosis (Quillard & Libby 2012b;

Toh et al. 2014)

1. Accumulation of low-density-lipoproteins (LDLs) occurs in

intima matrix of the blood vessel. The LDLs undergo oxidation

mediated by ROS produced from metabolic activities of

surrounding cells and promote up-regulation of cell adhesion

molecules to attract circulating monocytes.

2. Monocytes migrate into the intima matrix of blood vessel

and undergo differentiation to form mature macrophages.

Activated macrophages begin to uptake oxidized LDL and

form foam cells (macrophage loaded with lipoproteins).

Foam cells release pro-inflammatory cytokines and initiate

localized inflammatory response and oxidative stress. This

results in the recruitment of more macrophages in the intima

matrix of blood vessel.

3. Foam cells begin to accumulate and form a lipid core (also

known as atherosclerotic plaque) within the intima matrix of

the blood vessel. Smooth muscle cells and collagen matrix

begin to overlie the plaque and form a thin fibrous cap.

Continuous accumulation of foam cells further increase the

size of the plaque and narrow the diameter of the blood

vessel. This begins to restrict the blood flow and potentially

leads to ischemia.

4. Plaque ruptures occur as a result of over-accumulation of

foam cells. It leads to the revelation of pro-thrombic content

which subsequently initiates platelet aggregation and localized

formation of thrombus. Delocalization of thrombus may cause

blockage in the narrowed blood vessel and consequently leads

to the onset of ischemia and myocardial infarction.

Different Stages in Pathogenesis of Atherosclerosis

66

Although the causal role of oxidative stress in pathogenesis of

atherosclerosis has been well documented (Goldstein et al. 1979; Steinberg et

al. 1989), the exact underlying mechanisms for oxidative stress mediated

cardiovascular pathophysiology remain complicated. Various in vivo studies

have revealed ROS contributing to oxidative can be derived from exogenous or

endogenous sources (Singh & Jialal 2006; Stocker & Keaney 2004). Therefore,

a better understanding of the involvement ROS in progression of

atherosclerosis is crucial. This will likely drive future research towards strategies

of using antioxidants to attenuate atherosclerosis via inhibition of inadvertent

cellular oxidative damage or signalling pathway. Ultimately, this may have

important implications to both prevention and treatment of atherosclerosis (Lönn,

Dennis & Stocker 2012).

3.2.2.1.2 Myocardial Infarction (MI) and Myocardial Reperfusion Injury

Myocardial infarction (MI) (Figure 3-3) is the medical terms commonly

referred as an event of a heart attack. It is a type of cardiovascular disease

(CVD) that occur when normal blood flow to heart is obstructed, causing injuries

to the heart muscles and tissues. During such event, cardiac cells experienced

apoptosis or cell death as a result of oxidative stress by ischemia and

reperfusion injuries. Normal heart function begins to deteriorate along with the

extensive cardiac cell apoptosis (Ma et al. 2013).

Common themes for causality of MI are oxidative stress and

inflammation. Both components have been implicated in pathogenesis of MI

and their respective prevalence has strong positive correlation with reactive

oxygen species (ROS) and free radicals. Although the involvement of oxidative

stress and inflammation in progression of cardiac disorders has been evidently

established, a complete picture of the mechanisms involved is still remains

unclear. Through oxidative modification of essential cellular components, ROS

and free radicals are capable of damaging both physical and physiological

properties of cardiac cells or cardiomyocytes. Inflammatory responses triggered

by damaged cells step-in in later stage and subsequently create cycles of

67

chronic damages that are difficult to breakdown. With extensive cardiac cell

death or apoptosis, it ultimately leads to the deterioration of cardiac function (Li

et al. 2013; Ma et al. 2013).

Figure 3-3: Graphical representation of acute myocardial infarction (MI). Normal

blood flow to heart is disrupted at site of arterial blockage and

subsequently damages the heart muscles and tissues. [Image

source: (Antipuesto 2014) ]

Reperfusion of myocardium refers to the condition in which the blood

supply returns to the heart tissue after myocardial ischemia. During the event of

myocardial ischemia, cardiac muscles can endure injuries from the event for up

to 15 minutes, following an immediate myocardial reperfusion before the death

of cardiomyocytes occurs (Verma et al. 2002). However, with the extended

duration and severity of ischemic injuries, the damage to myocardium is

irreversible even after reperfusion and the consequences can be fatal. Such

damage to myocardium is referred as ischemic reperfusion injury (Arslan et al.

2010).

68

At the event of severe reperfusion injury, extensive damages to the

myocardium occur through endothelial injuries and permanent myocytes

apoptosis. Though numerous factors have been known for causing the injuries,

it has been evidently suggested that oxidative stress and ROS play the key

central role in mediating multiple signal transduction mechanisms and signalling

pathways in myocardial reperfusion injury (Hori & Nishida 2009). Substantial

amount of ROS is generated after the event of myocardial reperfusion. The

cellular redox mechanism and enzymes such as nicotinamide adenine

dinucleotide phosphate (NADPH oxidase), mitochrondria and xanthine oxidase

were among the major contributors of ROS (Chen et al. 1998; Wang et al.

1998). Localized accumulation of ROS will eventually leads to the onset of

oxidative stress and cause cell death.

In additional, ROS also mediate signalling pathway that further induce

the expression of inflammatory cytokines such as interleukin-6 (IL-6),

interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) (Irwin et al. 1999).

Overexpression of these inflammatory cytokines can also trigger additional

inflammatory responses that further threaten the survival and death of myocyte

cells (Nian et al. 2004).

Both ROS and inflammatory cytokines are capable of interrupting

mitochondrial energy production and ultimately induce myocyte cell death

(Hausenloy & Yellon 2008). After reperfusion injuries, impairment of intracellular

homeostasis of calcium (Ca2+) ions occurs at cardiomyocytes level. Extensive

production of ROS mediates the overloading of Ca2+ and further enhances the

permeability of cardiomyocytes’ mitochondrial membranes (known as

mitochondrial permeability transition pore, MPT pore) through a series of signal

transduction cascades (Hori & Nishida 2009; Javadov & Karmazyn 2007). The

opening of MPT pore ceases the normal function of mitochondria in ATP

production and halts the energy supports for sustaining the survival of myocyte

cells. Consequently, the cells died of energy depletion (Hausenloy & Yellon

2008).

69

3.2.3 Antioxidants

Cells developed a series of antioxidant protection systems to regulate

and maintain redox homeostasis. The cellular antioxidant protection systems

can be derived from endogenous and exogenous origins (Krishnamurthy &

Wadhwani 2012). These systems work synergistically to maintain the balance

between oxidants and antioxidants within the physiological system. The

prevalence of oxidative stress arises when oxidation-reduction balance in cells

is disrupted. Normal cellular metabolic processes produce small amount of

ROS and free radicals. These radicals are usually scavenged by the cellular

antioxidant defence system which consists of endogenous cellular antioxidant

enzymes such as superoxide dismutase (SOD), catalase (CAT) and glutathione

peroxidase (GPx) (Pham-Huy, He & Pham-Huy 2008). However, in disease

state such as cardiac ischemia and reperfusion injuries, overproduction of ROS

and free radicals substantially deplete the available antioxidants and disrupt the

cellular redox homeostasis. With the elevation of ROS and free radicals status

in cells, it creates oxidative stress environments which promote cell death (Ma

et al. 2013; Noori 2012).

Apart from endogenous cellular antioxidants, natural exogenous

antioxidants are also involved in quenching of ROS and free radicals within the

biological system. These antioxidants are usually derived from food and often

require replenishment via dietary sources. Through years of extensive research

on natural antioxidants, they have been proven to quench free radicals

effectively and improve the antioxidant status of cells and provide protection

against cellular oxidative injuries (Magalhaes et al. 2009). With the fact that

chemistry between oxidants and antioxidants controls various crucial cellular

pathway and metabolism, the simple ‘oxidant-antioxidant imbalance’ theory has

now grown to be incorporated into the progression of various chronic diseases.

Hence, the rationale for strategies of utilizing exogenous natural antioxidants as

therapeutic intervention to attenuate cardiac injury through inhibition of

inadvertent cellular oxidative damage or signalling pathways may have

important implications to both the prevention and treatment of these diseases

(Tsuda et al. 2002b).

70

3.2.3.1 Endogenous antioxidant

Endogenous antioxidants are the antioxidant protection system produced

by the body. They can be sub-categorized into non-enzymatic- and enzymatic

antioxidants (Krishnamurthy & Wadhwani 2012).

Non-enzymatic antioxidants refer to components such as bilirubin,

coenzyme Q10, uric acid, glutathione and cellular redox system, NADPH and

NADH (Krishnamurthy & Wadhwani 2012). Endogenous enzymatic antioxidants

often refers to cellular antioxidant enzymes such as superoxide dismutase

(SOD), catalase (CAT) and glutathione peroxidase (GPx) (Pham-Huy, He &

Pham-Huy 2008). They are the first line of enzyme-based cellular defensive

systems. Each enzyme plays a different role is alleviation of oxidative injury

(Rodrigo et al. 2013). Briefly, SOD involves in the neutralization of superoxide

anions (O2•-) into hydrogen peroxide (H2O2) and oxygen (O2). H2O2 later

becomes the substrate for both CAT and GPX. CAT transforms H2O2 to water

(H2O) and oxygen (O2) molecules while GPx catalyses the reduction of H2O2

and hydroperoxides in the presence of co-substrate, reduced glutathione (GSH)

(Pham-Huy, He & Pham-Huy 2008).

3.2.3.1.1 Superoxide Dismutase (SOD)

To date, four different isoforms of SOD have been identified. Each of

these metalloproteins contains different metal ions: manganese (Mn), Copper-

Zn (Cu/Zn), nickel (Ni) and Iron (Fe) (Meier et al. 1998). Most eukaryotes have

three forms of SOD. They are Mn-SOD, Cu/Zn-SOD, and EC-SOD (known as

extracellular SOD, the secreted form of Cu/Zn-SOD) (Kang & Kang 2013). Mn-

SOD present mostly in mitochrondria while Cu/Zn-SOD occupies areas within

the nucleus, cell cytoplasm, and blood plasma (Krishnamurthy & Wadhwani

2012). Bacteria mostly utilize Fe-SOD or Mn-SOD which localized

predominantly in the mitochondria (Dos Santos et al. 2000). Catalytic reaction

of SOD can be represented in the reaction equation below (Equation 3):

71

Equation 3: 2 O2- + 2 H+

𝐒𝐎𝐃→

H2O2 + O2

The highly reactive superoxide anions (O2•-) are neutralized by SOD to

yield H2O2 and O2. The less reactive H2O2 is further co-ordinately neutralized by

CAT and GPx. The metal ions located at the active site of the enzymes are

responsible for the catalytic conversion of O2•- to H2O2 and O2 through redox

reactions (Meier et al. 1998). Majority of the SODs have affinity towards fluoride

ion (F-) and azide ion (N3-) which are both singly-charged anions. However,

each isoform of SOD has distinctive response towards different anions. It was

noted that F-, N3- and cyanide (CN-) are the competitive inhibitors of Cu/Zn SOD

(Leone et al. 1998; Vance & Miller 1998).

3.2.3.1.2 Catalase (CAT)

CAT enzyme has four porphyrin heme (iron-containing) groups. The

enzyme catalyses the conversion of H2O2 to H2O and O2 in a two-steps reaction

(Equation 4) (Kang & Kang 2013). First step involves the oxidation of heme

group in CAT by a molecule of H2O2. First step of the reaction yields an

oxyferryl heme and a radical of porphyrin cation. Second step of the reaction

involves the reduction of the enzyme back to its ground state and generate one

molecule of H2O and O2 respectively (Krishnamurthy & Wadhwani 2012).

Equation 4: 2 H2O2

𝐂𝐀𝐓→ 2 H2O + O2

ROOH + AH2 H2O + ROH + A

CAT protects intracellular ROS homeostasis by detoxifying H2O2

produced from cellular metabolic activities. The enzyme primarily localized in

peroxisomes of the cells and actively neutralize H2O2 that diffuses into the

peroxisomes (Slater 1984). It is also a highly conserved protein and gets

encoded by a single gene. The presence of CAT is abundant in erythrocytes,

72

kidneys and liver. It has also been reported that its enzymatic activity is the

highest in these components (Kang & Kang 2013; Nishikawa et al. 2002).

3.2.3.1.3 Glutathione Peroxidase (GPx)

GPx is a selenocysteine (Sec)-containing enzyme. The enzyme protects

the cells against low level of oxidative injury by neutralizing H2O2 and organic

hydroperoxides in the presence of its co-substrate, GSH and the cellular

NADPH-NADH redox system. The catalytic reaction involves the oxidation of

GSH to oxidized form of glutathione (GSSG). GSSG is then reduced back to

GSH by glutathione reductase (Equation 5) (Pham-Huy, He & Pham-Huy 2008).

Equation 5: ROOH + 2 GSH

𝐆𝐏𝐱→ ROH + GSSG + H2O

Eight different isoforms of GPx have been detected in mammals. Majority

of the GPx isoforms (GPx1, GPx2, GPx3, GPx4 and GPx6) are selenocysteine-

containing enzymes while the remaining isoforms contain only cysteine at the

active site of the enzymes. Among all the isomeric forms of GPx, only the

functions of GPx1, GPx3 and GPx4 have been characterized to date (Kang &

Kang 2013). Both GPx1 and GPx4 genes encode cytosolic GPx that are mainly

distributed in cytoplasm. GPx1 gene has also involved in encoding

mitochondrial GPx while GPx4 also encodes phospholipid hydroperoxide GPx

that mainly localized in associated membrane. As for GPx3, it encodes

extracellular GPx which is the secreted form of GPx (Esworthy, Ho & Chu 1997;

Imai & Nakagawa 2003; Kang & Kang 2013).

73

3.2.3.2 Exogenous Antioxidants

Exogenous antioxidants are dietary antioxidants that are not produced in

the body. They are usually supplied to the body as food or supplements and

need to be replenish regularly at moderate amount. Examples of exogenous

antioxidants include polyphenols (flavonoids), vitamins (vitamin C and E), beta

carotene, carotenoids, and polyunsaturated fatty acids (omega-3 and omega-6

fatty acids) (Pham-Huy, He & Pham-Huy 2008).

Both vitamin C and E have been widely studied and they are known as

the most important vitamin-based antioxidants in the biological system. Vitamin

C (ascorbic acid) is hydrophilic in nature. Due to its instable and hydrophilic

nature, it is readily excreted from the body and hence it requires constant

replenishment. It is an important ROS scavenger in the extracellular fluids and

essentially required for the biosynthesis of neurotransmitters and collagen (Li &

Schellhorn 2007), Vitamin C has been shown to exhibit antioxidant,

carcinopreventive- and immunomodulatory-properties. Synergistic effect of

vitamin C and E in quenching of free radical has also been reported (Pham-Huy,

He & Pham-Huy 2008). However, overdose (> 2000mg/day) of vitamin C was

found to exhibit the properties of pro-oxidants (Naidu 2003).

Vitamin E is lipophilic in nature. It exists in two major forms: tocopherol

and tocotrienols. Each form is further sub-divided into four different derivatives

(α-, γ-, β-, and δ-isomers) (Wolf 2005). The different isomeric forms of vitamin E

are distinguished by the degree of substitution of methyl groups (-CH3) in the

chromanol head (Liva 2008). The antioxidant activity of vitamin E is largely

attributed to the presence of redox active hydroxyl (-OH) group on its chromanol

ring. It protects fatty acids of the cell membrane from lipid peroxidation (Litwack

2007). Aside from its antioxidant properties, other health attributes of vitamin E

includes, anticancer, anti-cholestrolemic, anti-hypertensive, anti-diabetic,

cardioprotective- and neuroprotective-effects have also been reported from in

vitro and in vivo study models. (Alexander 2008; Hsieh & Wu 2008; Lee, Mar &

Ng 2009; Newaz & Nawal 1999).

74

The research on plant-derived natural antioxidants becomes one of

emerging field of study in the recent years (Islam et al. 2014). These

phytochemicals are natural antioxidants comprise of phenolic or polyphenolic

compounds such as polyphenols, flavonoids, anthocyanins, vitamins, and

resveratrol which are commonly found in fruits, vegetables and nuts (Tsuda et

al. 2002a). It has been revealed that frequent dietary intakes of antioxidant-rich

food are commonly linked with low incidence of oxidative stress associated

diseases. These naturally occurring bioactive constituents provide a defence

system to the body by eliminating free radicals and protect the body against

oxidative injuries (Mukhopadhyay 2000). Research on natural antioxidants have

shown positive health effects towards cardioprotection, inflammation, anti-

infection, liver protection, anti-diabetic, anti-obesity and neurodegenerative

processes (Aedín, José & Peter 2012; Anne & Barrie 2008; Biasutto, Mattarei &

Zoratti 2012; Cesar & Patricia 2012; Chang et al. 2009; Mireia et al. 2012). All

these health benefits are proposed to be attributed to the synergistic antioxidant

protective effects of different phytochemicals present in plant materials (de Kok,

van Breda & Manson 2008).

.

75

3.3 Research Aims and Objectives

The main aim for this part of the research work was to study the

bioactivities of RBE derived from different Sarawak local rice varieties via

selected in vitro antioxidant assays. In order to achieve the aforementioned aim,


a. Study of antioxidant activity of RBE based on in vitro chemical-based

systems.

b. Study of antioxidant activity of RBE based on in vitro mammalian cell

culture-based system.

c. Determination of the optimal and safe dosage of RBE that is

appropriate for its maximal antioxidant activity in in vitro mammalian

cell culture-based system.

d. Assessment of RBE on the induction of endogenous cellular

antioxidants in in vitro mammalian cell culture-based system.

3.4 Experimental Design

Antioxidant activities of RBE were studied based on two different types of

in vitro systems: chemical-based system and cell culture based system.

3.4.1 Materials and Chemicals

In vitro chemical-based systems: 2,2-diphenyl-1-picrylhydrazyl (DPPH)

and trolox standard were purchased from Sigma Aldrich. Absolute ethanol

(EtOH) was purchased from Fisher Scientific (Malaysia). Tocomin50 (Carotech,

Malaysia) standard was a gift in kind given by Prof. Yuen Kah Hay and Dr.

Sherlyn Lim from Universiti Sains Malaysia (USM).

76

In vitro cell culture-based system: H9c2(2-1) Rattus norvegicus rat’s

cardiomyocytes (ATCC® CRL-1446TM) was purchased from ATCC. CellTiter

96® Aqueous Non-Radioactive Cell Proliferation assay kit was purchased from

Promega, Dulbecco’s Modified Eagle Medium (DMEM) and phosphate buffer

saline (PBS) were purchased from Gibco®. Fetal Bovine Serum (FBS),

Penicillin-Streptomycin (10,000 units), 0.25% Trypsin-EDTA, trypan blue, and

dimethyl sulfoxide (DMSO) were purchased from Sigma Aldrich. Hydrogen

peroxide (30% v/v) was purchased from Bendosen (Malaysia). Absolute ethanol

(EtOH) was purchased from Fisher Scientific (Malaysia). AxyPrep multisource

total RNA miniprep kit was purchased from Axygen. QuantiFast SYBR® Green

RT-PCR kit was purchased from Qiagen. Superoxide dismutase assay kit and

catalase assay kit were purchased from Cayman Chemical. Glutathione

peroxidase activity colorimetric assay kit was purchased from Biovision.

3.4.2 Test Samples

Nine different types of RBE prepared in Chapter 2 were all used to

assess their respective antioxidant activities via in vitro chemical-based

systems. Tocomin50 was used as a positive control for comparison. After the

assessment of antioxidant activities of different RBE via in vitro chemical-based

systems, rice bran extract that gave the high antioxidant activity along with rice

bran extract of commercial rice, MR219 were selected to further assess their

respective antioxidant activities via in vitro cell culture-based system.

3.4.3 Methodology

Two In vitro chemical-based systems (DPPH free radical scavenging

assay and Trolox Equivalent Antioxidant Capacity (TEAC) assay) and in vitro

cell culture-based system were used to determine the antioxidant activities of

different RBE. As depicted in Figure 3-4, it showed the schematic

representation of experimental approaches used to determine the antioxidant

activities of RBE.

77

H9c2(2-1) Cardiomyocyte

Cell Viability

Assay Cellular Antioxidant

Activity Assay

Gene Expression Study of Cellular

Antioxidants

Cell viability

assay via:

Microscopic

Observation

Trypan Blue

Exclusion

MTS Assay

Activity Assay

on:

SOD

enzyme

CAT enzyme

GPx enzyme

Figure 3-4: Overview of experimental approaches applied for bioactivity studies of antioxidants from rice bran extracts

Gene expression

assessment via

qPCR on:

SOD enzyme

CAT enzyme

GPx enzyme

In Vitro Cell Culture-Based System

Rice Bran

Extracts

Hydrogen

Peroxide

In Vitro Chemical-Based System

Tocomin50 (Positive Control)

Antioxidant

Capacity Assays

Rice Bran

Extracts

DPPH Free

Radical

Scavenging

Assay

Trolox Equivalent

Antioxidant

Capacity (TEAC)

Assay

Trolox (Positive Control)

78

3.4.3.1 In Vitro Chemical-Based System

3.4.3.1.1 DPPH Free Radical Scavenging Assay

DPPH free radical scavenging assay was performed as per method of

Herald, Gadgil and Tilley (2012) with minor modifications. Briefly, 0.2mM DPPH

free radical solution was prepared in absolute ethanol. Different serially diluted

(2x) concentrations (156.25µg/mL to 5000µg/mL) of RBE and positive control,

Tocomin50 were serially diluted and 50µL of each serially diluted sample were

aliquoted into 96 wells microplate. Absolute ethanol was used as negative

control and reagent blank. A total volume of 50µL of 0.2mM DPPH free radical

solution was then added to each well and the plate was allowed to incubate for

30 minutes and kept away from light. The absorbance was later measured at

517nm via microplate reader (Synergy HT, Biotek). DPPH free radical

scavenging capacity of different RBE was determined via the following equation

(Equation 6):

Equation 6: DPPH free radical scavenging capacity = (𝑨𝟎−𝑨)

𝑨𝟎 x 100 %

*where A0 = absorbance of control sample; A = absorbance of test sample

3.4.3.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay

TEAC assay was performed based on the DPPH-scavenging capacities

of different RBE. The assay method was performed as per method of Pisoschi,

Cheregi and Danet (2009) with minor modifications. Briefly, different

concentrations of trolox were prepared (n=3) to establish a reference standard

curve. A total volume of 50µL of serially diluted (2x) concentrations

(156.25µg/mL to 5000µg/mL) of RBE (n=3) were aliquoted into 96 wells

microplate and was then followed by the addition of 50µL of the prepared DPPH

free radical solution (0.2mM). The plate was later incubated in the dark for 30

minutes before the absorbance was measured at 517nm via microplate reader

(Synergy HT, Biotek). Equation 6 was used to determine the DPPH free radical

79

scavenging capacity of different RBE and results were expressed in unit of nmol

of Trolox equivalent/100 g dry extract.

3.4.3.1.3 Statistical Analysis




via one-way analysis of variance (ANOVA) and Student’s t-test. Statistical

significance and confidence level of data were set at P ≤ 0.05.

80

3.4.3.2 In Vitro Cell Culture-Based System

3.4.3.2.1 Cell Culture and Growth Curve Study

H9c2(2-1) Rattus norvegicus rat’s cardiomyocyte was used as the

mammalian cell culture model for in vitro cell culture-based antioxidant assay.

The cells were cultivated in DMEM media supplemented with 10% fetal bovine

serum (FBS) and 100 units/mL of penicillin-streptomycin (final concentration).

Cells were incubated at 37°C and 5% CO2. Sub-cultivation of cells was

performed when cells achieved 70% - 80% confluence. Cells in passage

number 20-25 were used in all experiments and appropriate concentration of

cells was seeded for different experiments accordingly.

Growth curve study: Growth curve study of H9c2(2-1) cardiomyocytes

was performed as per method of Iloki Assanga et al. (2013) with slight

modifications. Briefly, cells were initially plated on 25cm2 cell culture flask at a

density of 6000 cells (initial cell density). The cells were allowed to incubate for

24 hours at 37℃, 5% CO2. The cells were allowed to incubate over a period of 8

days and cell counting was performed at one day interval using the trypan blue

dye exclusion method on a haemocytometer. Microscope cell images were

taken manually through an inverted microscope system (Nikon Eclipse Ti-S).

The growth curve of the cells was presented in the form of non-linear fitting of

polynomial curve. The doubling time (DT) of H9c2(2-1) cardiomyoctes was

determined via the following equation (Equation 7):

Equation 7: DT= T x 𝒍𝒏 (𝟐)

𝐥𝐧 (𝐗𝐞/𝐗𝐛)

In which:

T - Incubation time (in any units).

Xb - Cell number at the initial of the incubation time.

Xe - Cell number at the end of the incubation time.

81

3.4.3.2.2 Cell cytotoxicity Assay

The cell toxicities of selected RBE and hydrogen peroxide were studied

by using a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-

sulfophenyl)-2H-tetrazolium (MTS)-based assay kit (CellTiter 96® Aqueous

Non-Radioactive Cell Proliferation Assay Kit, Promega). Appropriate

concentrations of cells were plated onto 96 wells microplate and pre-incubated

for 24 hours before the cells were further treated with RBE and hydrogen

peroxide.

A. Cell cytotoxicity study of selected RBE

Different concentrations (6.25µg/mL to 500µg/mL) of selected RBE were

prepared by diluting the prepared stocks in two-fold dilutions with serum-free

DMEM. The range of concentration was prepared to identify the inhibition

concentration (IC50) of RBE. The final concentration of ethanol content in each

sample was kept below 1% (v/v) and ethanol (1% v/v) was used as negative

control in the assay. The treated cells were incubated for 24, 48 and 72 hours

respectively. Cell viability was determined via the MTS assay kit (CellTiter 96®

Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). Briefly, after

the incubation period, media were discarded and cells were washed and

replaced with fresh serum-free DMEM. MTS reagent was then added to each

well and the microplate was incubated for 4 hours before the absorbance was

measured at 490nm through a microplate reader (Synergy HT, Biotek). IC50 of

rice bran extracts were determined from the cell viability curves.

B. Cell cytotoxicity study of hydrogen peroxide (H2O2)

Different concentrations (15.625µM to 1000µM) of H2O2 were prepared

by diluting the prepared stock in two-fold dilutions with PBS buffer. The range of

concentration was prepared to identify the inhibition concentration (IC50) of H2O2.

Standardisation of H2O2 was performed spectrophotometrically by measuring

the absorbance of prepared samples at 240nm and a molar extinction

coefficient of 43.6M-1cm-1 was used to calculate the actual concentration of

82

hydrogen peroxide prepared. PBS buffer was used as negative control in the

assay. H2O2 treated cells were incubated for 24 hours and cell viability was

determined via the MTS assay kit (CellTiter 96® Aqueous Non-Radioactive Cell

Proliferation Assay Kit, Promega). Briefly, after the incubation period, media

were discarded and cells were washed and replaced with fresh serum-free

DMEM. MTS reagent was then added to each well and the microplate was

incubated for 4 hours before the absorbance was measured at 490nm through a

microplate reader (Synergy HT, Biotek). Inhibition (IC50) of hydrogen peroxide

was determined from the cell viability curve.

3.4.3.2.3 Induction of Oxidative Stress

H9c2(2-1) cells were seeded and incubated at 37°C and 5% CO2 for

24 hours before they were treated with RBE. The cells were treated with specific

concentrations of the selected RBE, and were incubated for 24 hours. After 24

hours incubation, growth media were replaced and oxidative stress was induced

by treating the cells with different concentrations (62.5µM to 1000µM) of

hydrogen peroxide. The treated cells were incubated for another 24 hours

before the cell viability was determined via MTS assay kit (CellTiter 96®

Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). MTS reagent

was then added to each well and the microplate was incubated for 4 hours

before the absorbance was measured at 490nm through a microplate reader

(Synergy HT, Biotek).

3.4.3.2.4 Endogenous Antioxidant Enzyme Activity Studies

Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxide

(GPx) were the targeted endogenous antioxidant enzymes in this experiment.

The activities of targeted endogenous antioxidant enzymes were studied by

using commercially available ELISA kits. Samples were prepared as per

protocols stated in the kits’ manual. Briefly, cells were detached by using rubber

83

policeman and collected in ice cold PBS buffer (pH 7.4). Cell lysis was

performed via physical disruption by sonicating the cells in ultrasonic water bath

for 2 minutes. The superoxide dismutase activity was examined via Superoxide

Dismutase Assay kit (Cayman Chemical); catalase activity was examined via

Catalase Assay Kit (Cayman Chemical); glutathione peroxidase activity was

examined via Glutathione Peroxidase Activity Colorimetric Assay Kit (Biovision

Incorporated). The absorbances of reaction mixtures were measured at

respective wavelength defined for each assay kit.

3.4.3.2.5 Endogenous Antioxidant Enzyme Gene Expression Studies

Superoxide dismutase 2 (SOD2), catalase (CAT) and glutathione

peroxide 1 (GPx1) were the targeted endogenous antioxidant enzymes in this

experiment. The effects of RBE and hydrogen peroxide inductions on the gene

expression of targeted endogenous antioxidant enzymes were assessed

through quantitative Real Time Polymerase Chain Reaction (qRT-PCR)

approach.

Cell cultivation: H9c2(2-1) cells were seeded and incubated at 37°C and

5% CO2 on 6-wells plates for 24 hours before they were treated with RBE and

hydrogen peroxide respectively.

Total RNA extraction: Extraction of RNA from H9c2(2-1) cardiomyocytes

was performed through AxyPrep Multisource Total RNA Miniprep kit (Axygen

Biosciences). Prior to RNA extraction, supernatants were discarded and cells

were washed twice with ice cold PBS buffer (pH 7.4). Then, the extraction of

RNA from cells was performed as per method described in the kit protocol.

RNase-free water was used to elute the purified total RNA. RNA samples were

kept on ice when they are in used or stored in -80℃ until further use.

Nucleic acid quantitation and qualification: The concentration and purity

of extracted RNA were assessed spectrophotometrically through a microplate

reader (Synergy HT, Biotek) by using Take3 Micro-Volume Plates. The pre-set

settings for nucleic acid quantitation and qualification were selected, and the

84

absorbances of samples were measured at the wavelengths of 230nm, 260nm,

280nm, and 320nm (background check) respectively. RNase-free water was

used as blank reagent. The absorbance ratios of 260/280 and 260/230 were

used to determine the purity of RNA samples. The acceptable absorbance ratio

for 260/280 as pure RNA is ≥ 2.0 while the acceptable range of absorbance

ratio for 260/230 as pure RNA is between 2.0 to 2.2.

Relative quantitation of gene expression: Gene expression studies of

targeted endogenous cellular antioxidant enzymes were performed through

qRT-PCR approach. A one-step qRT-PCR kit (Quantifast SYBR® Green RT-

PCR kit, Qiagen) was used to quantify the RNA targets. A total 20ng of RNA

sample (final amount per reaction tube = 2ng) was mixed with reagent kits and

oligonucleotide primers sets as per manufacturer’s instructions. The sequences

of oligonucleotide primers used in this experiment are as follow (Table 3-1):

Table 3-1: Oligonucleotide primer sequences

Primer Set Primer Sequence

Superoxide Dismutase 2 (SOD2)

Forward Primer:

5'-GTGTCTGTGGGAGTCCAAGG-3'

Reverse Primer:

5'-TGATTAGAGCAGGCGGCAAT-3'

Catalase (CAT)

Forward Primer:

5'-CGCCTGTGTGAGAACATTGC-3'

Reverse Primer:

5'-TAGTCAGGGTGGACGTCAGT-3'

Glutathione Peroxidase 1 (GPx1)

Forward Primer:

5'- CTCGGTTTCCCGTGCAATCA -3'

Reverse Primer:

5'-ACCGGGTCGGACATACTTGA-3'

Glyceraldehyde 3-phosphate dehydrogenase (GADPH)

Forward Primer:

5’- CAG GGC TGC CTT CTC TTG TG -3’

Reverse Primer:

5’- CTT GCC GTG GGT AGA GTC AT -3’

85

Amplification reactions of RNA targets were performed via Rotor-Gene Q

2plex HRM Platform (Qiagen). Settings for reaction cycles were configured as

per method specified in the kit manual (Table 3-2).

Table 3-2: qRT-PCR Reaction Cycle Condition (Qiagen 2011)

Step Time Temperature

Reverse Transcription 10 minutes 50 ℃

PCR Initial Activation Step 5 minutes 95 ℃

Two-Step Cycling 40 cycles

Denaturation 10 seconds 95 ℃

Annealing/Extension 30 seconds 60 ℃

Melt Curve 90 seconds Ramp from 72 ℃ to 95 ℃

5 seconds 95 ℃

All amplification reactions were normalized to mRNA expression of

housekeeping gene, Glyceraldehyde 3-phosphate dehydrogenase (GADPH) for

Rattus norvegicus. All samples were prepared in triplicates and relative gene

expression levels of RNA targets were normalized to that of negative control

cells.

3.4.3.2.6 Statistical Analysis




via one-way analysis of variance (ANOVA) and Student’s t test. Statistical

significance and confidence level of data were set at P ≤ 0.05.

86

3.4.4 Results and Discussions

3.4.4.1 In Vitro Chemical-Based System

3.4.4.1.1 DPPH Free Radical Scavenging Assay

The DPPH free radical scavenging assay was used to assess the

antioxidant capacities of different RBE. The inhibitory concentrations (IC50) of

RBE represent the concentration of extract required to scavenge the initial

concentration of DPPH free radicals by 50%. The lower the IC50 value of extract,

the stronger the efficacy of extract in DPPH free radical scavenging activity.

Table 3-3: Inhibitory concentration (IC50) of different RBE for DPPH free radical

scavenging assay. Values represents mean ± standard deviation of 3

concecutive repetitions (n=3). Different letters within the same column

denote significant differences at P ≤ 0.05 (Tukey’s Test). Graphical

representation for the following data is presented in Figure 5-5

(Appendix section).

Sample

Inhibitory Concentration (IC50)

for DPPH Free Radical Scavenging Assay

(µg/mL)

Tocomin50 (Positive control) 78.81 ± 1.29a

Bajong LN 188.46 ± 10.95b

Bali 222.63 ± 4.36b

Pandan 749.19 ± 20.61c

Bajong 1063.78 ± 20.08d

Wangi Mamut 1124.07 ± 21.24de

MR219 1130.65 ± 9.14de

Bubuk 1295.25 ± 17.11def

Biris 1534.43 ± 44.97def

Bario 2279.41 ± 25.9g

87

Table 3-3 shows the (IC50) of different RBE for DPPH free radicals

scavenging assay. Based on the obtained data, the IC50 values of different RBE

were significantly different from one another (P ≤ 0.05). The values were in the

range of 188.46µg/mL to 2279.41µg/mL respectively. The RBE of Bajong LN

showed the lowest IC50 value (188.46µg/mL) among all the RBE while the

highest IC50 value was determined in the RBE of Bario (2279.41µg/mL).

DPPH free radical, also known as 2,2-diphenylpicrylhydrazyl assay is one

of the commonly used chemical assays for antioxidant activity (Pyrzynska &

Pekal 2013). DPPH is a stable free radical that lacks of one hydrogen atom. It

can be neutralized via transfer of electron or hydrogen atom and form

corresponding hydrazine, DPPH2. When the DPPH free radical is neutralized to

form DPPH2, the initial colour of the chemical changes from purple to yellow

(Sharma & Bhat 2009). As a result of the nature of the chemical, it is suitable for

antioxidant activity studies. The DPPH free radical scavenging activities of

different concentrations of RBE were depicted in Figure 3-5. Based on the

results, the DPPH free radical scavenging activities of RBE were proportional to

their respective concentrations.

In this experiment, the effects of different concentrations of various RBE

on DPPH free radical scavenging were studied. A significant decrease in DPPH

concentration was determined with higher concentration of RBE used in the

assay. In addition, the DPPH free radical scavenging activities of RBE also

varied among different RBE. Such discrepancies were attributed to the

differences in the contents of bioactive compounds among different RBE. The

efficacies of different RBE in DPPH free radical scavenging were expressed by

identifying the concentration of test sample required to neutralize 50% of the

initial concentration of DPPH, also known as the inhibition concentration (IC50).

A low IC50 value indicates a relatively strong antioxidant activity of the extract

samples and vice versa (Sirikul, Moongngarm & Khaengkhan 2009).

88

1.12

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)

Concentration (x103 µg/mL)

Wangi Mamut

WangiMamut

IC50

1.30

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Bubuk

Bubuk

IC50

2.28

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Bario

Bario

IC50

1.53

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Biris

Biris

IC50

0.19

0%

20%

40%

60%

80%

100%

0 1 2

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Bajong LN

Bajong LN

IC50

0.75

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Pandan

Pandan

IC50

*[Figure continues on to next page]

89

Figure 3-5: DPPH free radical scavenging activities of different concentrations of different crude RBE. The data represented mean ±

standard deviation of three repetitions (n=3).

1.13

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y

(%)


MR219

MR219

IC50

0.22

0%

20%

40%

60%

80%

100%

0 1 2

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Bali

Bali

IC50

1.06

0%

20%

40%

60%

80%

100%

0 2 4

DP

PH

Rad

ical

Scav

en

gin

g

Acti

vit

y (

%)


Bajong

Bajong

IC50

90

The lowest IC50 value was detected from RBE of pigmented rice variety,

Bajong LN (188.46µg/mL). The obtained data was comparable to some of

reports from the literature, IC50 values from 15 different pigmented rice varieties

were in the range of 117µg/mL and 121µg/mL (Goufo & Trindade 2014). Rao et

al. (2010) conducted a similar study on some Indian medicinal rice varieties.

Contrarily, they reported IC50 values in the range of 30.85 to 87.72µg/mL which

is lower than the results obtained in this study. In addition, another study on

defatted rice bran of Thai rice varieties also reported a relatively low range of

IC50 values (9.19 to 19.73µg/mL) (Sirikul, Moongngarm & Khaengkhan 2009).

The relatively low IC50 values reported from both Indian medicinal and

Thai rice varieties indicate stronger antioxidant activities and higher efficacies of

the extracts in DPPH free radical scavenging as compared to the extracts of

Sarawak local rice varieties in the present study. It was suggested that variation

in plant genotypes could be one of the factors causing the difference in IC50

values between the presently obtained data and those reported from the

literature. Other factors such as environmental factor (Britz et al. 2007) and

extraction method (Chen & Bergman 2005) also significantly influence the total

content of natural antioxidants present in the extracts. Therefore, direct

comparison cannot be made unless experimental protocols are standardized

among all samples. Nevertheless, the present data have demonstrated the free

radical scavenging capabilities of RBE derived from different Sarawak rice

varieties. This was observed through successive dose-dependent free radical

scavenging effects of RBE in comparison to negative control.

Regression and correlation analyses of 1/DPPH (IC50) with total phenolic,

total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol,

γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE were represented in

Table 3-4. Strong positive (R ≥ 0.8) and significant (P ≤ 0.05) correlations

were observed in DPPH free radical scavenging activity against total phenolic

content, total flavonoid content, and total γ-oryzanol content respectively. Such

observations suggest the contributions of phenolic compounds, flavonoids, and

γ-oryzanol from RBE in DPPH free radical scavenging; indicating the

significance of phenolic compounds, flavonoids, and γ-oryzanol as the potential

91

sources of natural antioxidants contributing to the efficacy of total antioxidant

activities in RBE.

Among the three, the highest correlation value of 1/DPPH (IC50) was

observed with the total phenolic content in RBE (R = 0.9425), followed by γ-

oryzanol (R = 0.8917) and flavonoids (R = 0.8455) respectively. It was

discovered that sample’s total phenolic and flavonoid contents have more

profound effects on DPPH free radical scavenging (Goufo & Trindade 2014).

Rao et al. (2010) also reported the significant contribution of phenolic

compounds as the potential source of natural antioxidants responsible for the

total antioxidant activities in RBE.

Poor correlations between 1/DPPH (IC50) and vitamin E derivatives

(tocotrienols and tocopherol) were reported, with R values ranged from 0.1919

to 0.7105. The poor correlations were due to the lipophilic nature of vitamin E

derivatives (Cederberg, Siman & Eriksson 2001). DPPH assay was conducted

with aqueous alcohol (absolute ethanol) which is favourable for hydrophilic

antioxidants (Kedare & Singh 2011). In the absence of solubilizing agent,

factors such as solvent properties and nature of targeted compounds have

been shown to hinder the reactions between antioxidants and DPPH radicals

(Yu 2008).

Several reports from literature have highlighted on the radical-

scavenging activity of γ-oryzanol. The compound is known to exhibit higher

activity in DPPH free radical scavenging as compared to different derivatives of

vitamin E (Chotimarkorn & Silalai 2008). As of different derivatives of vitamin E,

correlation analysis between 1/DPPH (IC50) and total vitamin E content in RBE

reported a statistically significant (P ≤ 0.05) R value of 0.7105. Among the

different targeted vitamin E derivatives, the highest R value was observed in γ-

tocotrienol content (R = 0.6534), then followed by δ-tocotrienol (R = 0.3453), α-

tocopherol (R = 0.3380), and α-tocotrienol (R = 0.1919). Such observations

suggest that γ-tocotrienol as the potential vitamin E derivative that contribute

more to the overall antioxidant activity of RBE while the remaining vitamin E

derivatives reported a weak correlation with DPPH free radical scavenging

activity.

92

Table 3-4: Regression and correlation analyses of 1/DPPH (IC50) with total

phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total

vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-

tocopherol from RBE. Correlation graphs for the following data were

depicted in Figure 5-6 (Appendix section).

1/DPPH (IC50)

vs Total

Phenolic

Content

1/DPPH (IC50)

vs Total

Flavonoid

Content

1/DPPH (IC50)

vs Total

Anthocyanin

Content

1/DPPH (IC50)

vs Total γ-

Oryzanol

Content

R value 0.9425 0.8455 -0.5384 0.8917

R2 0.8884 0.7148 0.2899 0.7951

P value 0.001303 0.001183 0.001154 0.05790

Slope 0.0001239 0.0003331 -0.0002505 0.0000008604

1/DPPH (IC50)

vs Total

Vitamin E

Content

1/DPPH (IC50)

vs δ-

Tocotrienol

Content

1/DPPH (IC50)

vs γ-

Tocotrienol

Content

1/DPPH (IC50)

vs α-

Tocotrienol

Content

R value 0.7105 0.3453 0.6534 0.1919

R2 0.5048 0.1192 0.4269 0.0368

P value 0.02381 0.001158 0.006591 0.001431

Slope 0.00001206 0.0002017 0.00001549 0.00001324

1/DPPH (IC50)

vs Tocopherol

(α-Tocopherol)

Content

R value 0.3380

R2 0.1143

P value 0.002796

Slope 0.00001045

Remarks: Number of observations in all experiments was 3 (n=3). Positive

correlation (R value) represents a positive fit while negative R value represents a

negative fit. P value less than 0.05 (P ≤ 0.05) represents statistically significant

between two test variables (paired T-test). The R2 value represents the coefficient of

determination for a fitted regression line.

93

3.4.4.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay

Trolox equivalent antioxidant capacity (TEAC) assay was conducted

based on the DPPH free radical scavenging assay. Trolox (6-hydroxy-2, 5, 7, 8-

tetramethylchroman-2-carboxylic acid), a water soluble analogue of vitamin E

(Sagach et al. 2002) was used as the positive control in this assay. The results

were expressed in trolox equivalent (nmol).

Table 3-5 shows trolox equivalent antioxidant capacities (TEAC) of

different RBE for TEAC assay. High TEAC value of RBE is proportional to its

antioxidant capacity, indicating its efficacy in free radical scavenging.

Based on the obtained data, the TEAC values of different RBE were

significantly different from one another (P ≤ 0.05). The values were in the range

of 12.79nmol/100g to 61.49nmol/100g respectively. The RBE of Bajong LN

showed the highest TEAC value (61.49nmol/100g) among all the RBE while the

lowest TEAC value was determined in the RBE of Bario (12.79nmol/100g).

The DPPH free radical was used as the radical source for TEAC assay.

The neutralization of the radical occurs through electron or hydrogen transfer in

which it causes decolouration of DPPH solution from purple colour to yellow

colour. The antioxidant efficacy of test sample is proportional to the degree of

conversion of DPPH to corresponding hydrazine, DPPH2 which is yellow in

colour (Sharma & Bhat 2009).

In this study, significant discrepancies in TEAC values were observed

among different RBE. Factors such as plant genotypes, environmental factors

(Britz et al. 2007) and extraction method (Chen & Bergman 2005) of bioactive

compounds from samples were known to collectively affect the total content of

natural antioxidants and the total antioxidant activities of the extracts.

94

Table 3-5: Trolox equivalent antioxidant capacity (TEAC) of different RBE. Values

expressed represent mean ± standard deviation of 3 concecutive

repetitions (n=3). Different letters within the same column denote

significant differences at P ≤ 0.05 (Tukey’s Test). Graphical

representation of the data was depicted in Figure 5-7 (Appendix

section)

Sample Trolox Equivalent Antioxidant Capacity

(TEAC) (nmol/100g)

Bajong LN 61.49 ± 1.13a

Bali 35.09 ± 0.46b

Pandan 34.56 ± 0.78b

Bajong 25.81 ± 1.14c

Wangi Mamut 22.97 ± 2.26cd

Bubuk 22.23 ± 0.67cd

Biris 15.02 ± 1.29e

MR219 15.72 ± 0.29ef

Bario 12.79 ± 0.25ef

Table 3-6 shows the regression and correlation analyses of TEAC value

with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total

vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE.

Based on the obtained results, strong positive (R ≥ 0.8) and significant (P ≤

0.05) correlations were observed in TEAC value against total phenolic content,

total flavonoid content, and total γ-oryzanol content respectively. Such

observations suggest the contributions of phenolic compounds, flavonoids, and

γ-oryzanol from RBE as potential sources natural antioxidants that involve in

DPPH free radical scavenging. All these potential sources of natural

antioxidants collectively contributed to the efficacy of total antioxidant activities

in RBE.

95

Table 3-6: Regression and correlation analyses of trolox equivalent antioxidant

capacity (TEAC) of RBE with total phenolic, total flavonoid, total

anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-

tocotrienol, α-tocotrienol, and α-tocopherol. Correlation graphs were

depicted in Figure 5-8 (Appendix section)

TEAC vs Total

Phenolic

Content

TEAC vs Total

Flavonoid

Content

TEAC vs Total

Anthocyanin

Content

TEAC vs Total

γ-Oryzanol

Content

R value 0.9533 0.9789 -0.4910 0.9932

R2 0.9089 0.9582 0.2411 0.9865

P value 0.000004 0.000247 0.047 0.002

Slope 0.9780 3.0103 -1.7836 0.0075

TEAC vs

Total Vitamin

E Content

TEAC vs δ-

Tocotrienol

Content

TEAC vs γ-

Tocotrienol

Content

TEAC vs α-

Tocotrienol

Content

R value 0.6020 0.5275 0.3221 0.2926

R2 0.3624 0.2782 0.1037 0.0856

P value 0.000004 0.003 0.000030 0.39

Slope 0.0797 2.4055 0.0596 0.1575

TEAC vs

Tocopherol (α-

Tocopherol)

Content

R value 0.5177

R2 0.2680

P value 0.0011

Slope 0.1250

Remarks: Number of observations in all experiments was 3 (n=3). Positive

correlation (R value) represents a positive fit while negative R value represents a

negative fit. P value less than 0.05 (P ≤ 0.05) represents statistically significant

between two test variables (paired T-test). The R2 value represents the coefficient

of determination for a fitted regression line.

96

Total γ-oryzanol content in RBE reported the highest correlation value

with TEAC value (R= 0.9932), followed by total flavonoid content (R= 0.9789),

and total phenolic content (R = 0.9533). Goufo and Trindade (2014) reported

the significant effects of phenolic and flavonoid compounds on DPPH free

radical scavenging. Rao et al. (2010) also reported the similar significant

contribution of phenolic compounds as the potential source of natural

antioxidants responsible for the total antioxidant activities in RBE.

All the reports were concurrent with the presently obtained data and

hence indicating the significant contribution of phenolic compounds to the

overall antioxidant activity of RBE. In addition, it was also reported that the

antioxidant efficacy of phenolic compounds outrun those of anthocyanins (Chen

et al. 2012; Min, McClung & Chen 2011) and α-tocopherol (Goffman & Bergman

2004).

As of different derivatives of vitamin E, poor correlations between TEAC

and vitamin E derivatives (tocotrienols and tocopherol) were reported, with R

values ranged from 0.2926 to 0.6020. The poor correlations were due to the

lipophilic nature of vitamin E derivatives (Cederberg, Siman & Eriksson 2001).

TEAC assay was conducted with aqueous alcohol (absolute ethanol) which is

favourable for hydrophilic antioxidants (Kedare & Singh 2011). DPPH was used

as the radical source for TEAC assay. In the absence of solubilizing agent,

factors such as solvent properties and nature of targeted compounds are known

to affect the reactions between antioxidants and the radical source (Yu 2008).

It has been reported that the antioxidant activity of γ-oryzanol in rice is

approximately 10 times stronger than those of vitamin E, particularly α-

tocopherol (Xu, Hua & Godber 2001). The statement is in agreement with the

presently obtained data. The TEAC value showed a stronger correlation value

to γ-oryzanol content (R = 0.9932) in RBE than that of α-tocopherol

(R = 0.5177). When compared to α-tocopherol and the remaining vitamin E

derivatives, the presently obtained data suggest the significant role of γ-

oryzanol as the potential source of natural antioxidant that contribute to the total

antioxidant activity of RBE. The abilities to quench radicals and prevent lipid

peroxidation (Juliano et al. 2005), to enhance endogenous cellular antioxidant

97

enzymes in high fat-induced oxidative stress (Jin Son et al. 2010), and to

improve the radical scavenging activities of glutathione reductase (Jin Son et al.

2010) are among the antioxidant properties of γ-oryzanol reported from the

literature.

98

3.4.4.2 In Vitro Cell Culture-Based System

3.4.4.2.1 Morphology and Growth of H9c2(2-1) Cardiomyocytes

Figure 3-6: Cell image of healthy H9c2(2-1) cardiomyocytes taken through an

inverted light microscope (Magnification: 200x)

Morphological characteristics of healthy H9c2(2-1) cardiomyocytes were

depicted in Figure 3-6. Under normal and healthy condition, H9c2(2-1)

cardiomyocytes have thin and elongated morphologies. In addition, the cells

appeared to be multinucleated (having multiple nuclei in a cell). The cells were

attached cells and grow in monolayer.

Figure 3-7 shows the growth curve of H9c2(2-1) cardiomyocytes over a

growth period of 8 days. Three different stages of growth curve were observed.

The cells were in the lag phase within the first 24 hours of incubation period. As

the cells were still adapting to the new environment in the first 24 hours, cell

division was minimal and thus there was no apparent increment in cell number

(Sigma-Aldrich 2010). At day 2 to day 5, a rapid increment in cell population

was observed; indicating the exponential phase of cell growth. At this growth

99

stage, cells were at their optimal condition and divide at a rapid rate until the

maximum cell number is achieved (Sigma-Aldrich 2010). Beyond day 5, the

cells began to enter the stationary phase in which cell population begin to

confluent. Cell growth was compromised by the depletion of essential nutrient

and built up of toxic wastes. Based on the calculation, the doubling time of

H9c2(2-1) cardiomyocytes was between day 2 to day 3 (~2.73 days).

Figure 3-7: Growth curve of H9c2(2-1) cardiomyocytes over 8 days of incubation

period. Each alphabet represents different growth phases of the cells.

(a): Log phase; (b): Exponential phase; (c): Stationary phase; (d):

Doubling time (~2.73 days)

The growth curve of H9c2(2-1) cardiomyocytes was depicted in

Figure 3-8 shows the microscope (40x magnification) images of H9c2(2-1) cells

over a growth period of 8 days. There was no apparent growth in cell population

in the first 48 hours of incubation period indicating the lag phase of H9c2(2-1)

cell growth. After 48 hours (2 days) of growth period, H9c2(2-1) cells began to

proliferate actively. A significant growth in cell population was observed in

between Day 2 and Day 6. At Day 6, the cell population achieved ~90 %

confluence and achieved 100% confluence at Day 7 and Day 8.

6

60

0 1 2 3 4 5 6 7 8

Cell

Nu

mb

er

(x1

03 C

ell

s/c

m2)

Incubation Period (Day)

Growth Curve of H9c2(2-1)

(a)

(b) (c)

(d)

100

Figure 3-8: Microscope (40x magnification) images of H9c2(2-1) cardiomyocytes at different time points (1st to 8th day).

Day 1

1

Day 2

1

Day 3

1

Day 4

1

Day 5

1

Day 6

1

Day 8

1

Day 7

1

101

3.4.4.2.2 Cell Cytotoxicity Assay (RBE)

Figure 3-9: Cell images of (a) healthy H9c2(2-1) cardiomyocytes (negative

control) and (b) H9c2(2-1) cells induced with lethal dosage of

Bajong LN extract (500 µg/mL). Red oval inset in (b) showed

apoptotic H9c2(2-1) cells. *Magnification: 40x

(a)

(b)

102

Based on the screening outcomes of total antioxidant activities from

different RBE, the highest antioxidant activity in free radical scavenging was

detected in Bajong LN rice bran extract. The Bajong LN extract was then

selected for in vitro cell culture-based system to further assess the antioxidant

capacity of the extract. RBE of commercial rice variety, MR219 was selected for

comparative study.

Figure 3-9 shows the cell images of normal cells of H9c2(2-1)

cardiomyocytes (negative control) and cells that were induced with lethal dose

(500µg/mL) of Bajong LN RBE. In this experiment, it was discovered that 1%

final concentration of ethanol in media did not induce cell death [data not

shown]. Therefore, all concentrations of RBE were adjusted to less than 1%

while negative control cells were treated with 1% final concentration of ethanol

in media. Based on the cell image in Figure 3-9(a), the negative control

H9c2(2-1) cardiomyocytes treated with 1% ethanol were healthy and appeared

to have multiple nuclei, thin and elongated morphologies.

Contrarily, cells treated with 500 µg/mL of Bajong LN RBE showed signs

of cell apoptosis, as shown in Figure 3-9(b). Disintegration of cell membrane

and nucleus were observed in the culture with cellular debris spread across the

surface area of the tissue culture flask. Such observation indicates dosage of

Bajong LN RBE at 500µg/mL is cytotoxic to H9c2(2-1) cells with cell viability

significantly dropped to only 18.58% (P < 0.01).

H9c2(2-1) cardiomyocytes were induced with different concentrations of

RBE to identify their respective safe dose range. Cell toxicities of selected RBE

were examined via 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-

(4-sulfophenyl)-2H-tetrazolium (MTS)-based assay kit. The assay measures the

metabolic rate of mitochondrial activities through conversion of MTS to

formazan by viable cells (Wang, Henning & Heber 2010). Figure 3-10 shows

the cell viability curves of H9c2(2-1) cells treated with different concentrations of

RBE over 24, 48 and 72 hours respectively. Data were presented in terms of

relative cell viability versus log of extract dosage. Based on the results, dose-

dependent cytotoxicity effects were observed in cells treated with RBE of

Bajong LN and MR219 respectively.

103

Figure 3-10: Cell viability curves of H9c2(2-1) cardiomyocytes treated with

different concentrations (6.25µg/mL to 500µg/mL) of (A) Bajong LN

and (B) MR219 RBE over 24, 48 and 72 hours of incubation time

respectively. Best fit curves were drawn by using excel for visual

purposes.

0%

20%

40%

60%

80%

100%

120%

0 1 2 3

Ce

ll V

iab

ilit

y (

%)

Log [Bajong LN], µg/mL

Bajong LN

Bajong LN Day 1

Bajong LN Day 2

Bajong LN Day 3

0%

20%

40%

60%

80%

100%

120%

140%

0 1 2 3

Ce

ll V

iab

ilit

y (

%)

Log [MR219], µg/mL

MR219

MR219 (Day 1)

MR219 (Day 2)

MR219 (Day 3)

(A)

(B)

104

The concentrations of extracts used for the induction were in the range of

6.25µg/mL to 500µg/mL (2-fold). For RBE of Bajong LN, extract concentrations

beyond 75µg/mL induced critical cell death with cell viabilities dropped below 32%

(Table 3-7). Cell viabilities dropped below 20% after 48 hours and 72 hours of

incubation time respectively. Contrarily, viabilities of H9c2(2-1) cells treated with

Bajong LN extract in the concentration ranges of 6.25µg/mL to 50µg/mL were

beyond 70% throughout the 24, 48 and 72 hours of incubation time. Therefore,

it gave an indication that the safe working concentration range of Bajong LN

extract were in the approximate range of 6.25µg/mL to 50µg/mL.

Table 3-7: Cell viability of H9c2(2-1) after inductions with different concentrations

of Bajong LN RBE for 24, 48 and 72 hours respectively. Data presented

were the mean ± standard deviation of three replicates (n=3). ‘*’ on

each column denotes significant differences at P ≤ 0.05 as compared

to negative control.

Bajong LN-Cell Viability (%)

Log

(Dose)

Dose

(µg/mL)

Day 1

(24 hours)

Day 2

(48 hours)

Day 3

(72 hours)

0.80 6.25 83.76 ± 5.18 84.47 ± 1.45* 91.96 ± 2.70*

1.10 12.5 70.33 ± 5.95* 92.55 ± 2.38* 98.93 ± 2.75

1.40 25 74.42 ± 5.79* 87.51 ± 5.77 102.32 ± 7.60

1.70 50 81.19 ± 5.86* 77.23 ± 3.02 95.71 ± 2.75

1.88 75 31.37 ± 4.83* 8.81 ± 0.00* 12.50 ± 1.12*

2.00 100 12.44 ± 0.74* 11.23 ± 0.48* 15.14 ± 1.29*

2.40 250 11.68 ± 1.61* 10.49 ± 0.66* 18.33 ± 1.09*

2.70 500 18.57 ± 0.61* 10.70 ± 0.94* 17.68 ± 0.00*

105

Table 3-8 shows the inhibitory concentration (IC50) of Bajong LN RBE on

H9c2(2-1) cells. The IC50 value referred to the concentration of Bajong LN RBE

that will kill half (50%) of the original population of the cells. Based on the

obtained results, the IC50 values of Bajong LN RBE were in the range of

61.67µg/mL to 63.10µg/mL over 24, 48 and 72 hours of incubation time

respectively.

Table 3-8: Inhibitory concentration (IC50) of Bajong LN RBE over 24, 48 and 72

hours of incubation time. The IC50 values were determined from

respective cell viability curves via GraphPad Prism (GraphPad


consecutive repetition (n=3). Graphical representations of data were


For RBE of MR219, extract concentrations beyond 250 g/mL induced

critical cell death with cell viabilities dropped below 13% (Table 3-9). Cell

viabilities further dropped below 12% with 500µg/mL after 24, 48 and 72 hours

of incubation time respectively. Contrarily, viabilities of H9c2(2-1) cells treated

with MR219 extract in the concentration ranges of 6.25µg/mL to 75µg/mL were

beyond 70% throughout the 24, 48 and 72 hours of incubation time. Therefore,

it gave an indication that the safe working concentration ranges of MR219

extract were in the range of 6.25µg/mL to 75µg/mL.

Bajong LN (IC50) – (µg/mL)

Dose (µg/mL) Log (Dose)

Day 1

(24 hours) 64.57 ± 0.91 1.81 ± 0.01

Day 2

(48 hours) 61.67 ± 0.32 1.79 ± 0.002

Day 3

(72 hours) 63.10 ± 4.99 1.80 ± 0.04

106

Table 3-9: Cell viability of H9c2(2-1) after inductions with different concentrations

of MR219 RBE for 24, 48 and 72 hours respectively. Data presented

were the mean ± standard deviation of three replicates (n=3). ‘*’ on

each column denotes significant differences at P ≤ 0.05 as compared

to negative control.

MR219-Cell Viability (%)

Log

(Dose)

Dose

(µg/mL)

Day 1

(24 hours)

Day 2

(48 hours)

Day 3

(72 hours)

0.80 6.25 108.88 ± 4.76 93.34 ± 8.97 111.70 ± 5.63

1.10 12.5 97.78 ± 1.21 99.48 ± 5.67 119.73 ± 5.63*

1.40 25 102.22 ± 3.44 101.05 ± 1.44 118.93 ± 1.61*

1.70 50 118.93 ± 1.42* 107.03 ± 3.41 122.50 ± 3.65*

1.88 75 84.99 ± 3.68* 76.08 ± 1.27* 86.61 ± 2.64*

2.00 100 52.57 ± 3.21* 65.79 ± 2.38* 75.54 ± 3.21*

2.40 250 8.41 ± 0.61* 8.18 ± 0.55* 12.50 ± 1.12*

2.70 500 10.63 ± 1.13* 6.30 ± 1.09* 11.79 ± 1.86*

107

Table 3-10 shows the inhibitory concentration (IC50) of MR219 RBE on

H9c2(2-1) cells. Based on the obtained results, the IC50 values of MR219 RBE

were in the range of 95.44µg/mL to 111.50µg/mL over 24, 48 and 72 hours of

incubation time respectively.

Table 3-10: Inhibitory concentration (IC50) of MR219 RBE over 24, 48 and 72

hours of incubation time. The IC50 values were determined from

respective cell viability curves via GraphPad Prism (GraphPad


consecutive repetition (n=3). Graphical representations of data were


The present study showed the dose-dependent cytotoxic effects of

Bajong LN and MR219 extracts on H9c2(2-1) cardiomyocytes. In general, cell

viabilities dropped below 20% when high doses (>250µg/mL) of RBE were used

for induction. Contrarily, positive time-dependent induction effects were

observed in cells treated with safe dose range of extracts (Bajong LN: 6.25 to

50µg/mL; MR219: 6.25 to 75µg/mL).

Induction of cells with RBE within the range of safe dosage showed

improvements in cell viabilities with longer incubation period. Possible

deductions for such observation could be due to the potential cell proliferation

induction effects from the extracts or activation cellular protective response that

counteract the stress for adaptation and survival (Fulda et al. 2010). However,

further studies are needed to support the statement.

MR219 (IC50) – (µg/mL)

Dose (µg/mL) Log (Dose)

Day 1

(24 hours) 95.44 ± 1.02 1.98 ± 0.01

Day 2

(48 hours) 111.50 ± 1.07 2.05 ± 0.03

Day 3

(72 hours) 107.20 ± 1.05 2.03 ± 0.02

108

The IC50 of Bajong LN and MR219 extracts on H9c2(2-1) cardiomyocytes

were calculated by using GraphPad Prism (GraphPad Software, Inc. USA).

The present data revealed that the range of IC50 values of Bajong LN and

MR219 RBE differed from one another. To recap, the IC50 values of Bajong LN

and MR219 were in the range of 61.67µg/mL to 63.10µg/mL and 95.44µg/mL to

111.50µg/mL respectively. The discrepancy in IC50 values between the two

RBE could be due to the difference in their respective total antioxidant contents.

According to the results obtained from previous study (Chapter 2), RBE of

Bajong LN has significantly higher contents of antioxidants (total phenolic, total

flavonoid, total γ-oryzanol, and total vitamin E contents) as compared to MR219

extract. Therefore, the extract of Bajong LN may require a lower concentration

to achieve similar antioxidant activities as of the MR219 extract.

Cytoprotective effects of natural antioxidants derived from plant food

have been highlighted in several in vitro cell studies. Cells treated with these

exogenous natural antioxidants were protected from oxidative stress mediated

cell death (Heo et al. 2008; Romier et al. 2008). However, it was discovered that

‘too much’ antioxidants did not further improve the overall antioxidant activity of

the exogenous natural antioxidants in cytoprotection. In this experiment, viability

of H9c2(2-1) cells dropped when high doses of extracts were used and hence

suggesting the dose-dependent cytotoxic effects of the extracts. There have

been several reports on cell cytotoxicity of polyphenols when high doses of the

antioxidants were used. Counter effects can arise from these natural

antioxidants at high doses, in which they act as prooxidants that threaten

survival and viability of cells (Azam et al. 2004; Decker 1997; Watjen et al.

2005). In addition, it was also reported that antioxidant activities of

endogeneous cellular antioxidant enzymes such as superoxide dismutase

(SOD), catalase (CAT), and gluthatione S-transferase can be affected when

cells were induced with high concentrations of exogenous antioxidants

(Robaszkiewicz, Balcerczyk & Bartosz 2007). This could be arising from the

production of radicals by polyphenols through autoxidation and redox cycling

processes (Gaspar et al. 1994; Hodnick et al. 1986; Metodiewa et al. 1999).

109

3.4.4.2.3 Cell Cytoxicity Assay (Hydrogen Peroxide)

H9c2(2-1) cardiomyocytes were induced with different concentrations of

hydrogen peroxide (H2O2) to identify the suitable range of working

concentrations that do not induce cell death. Figure 3-11 shows the cell viability

curve of H9c2(2-1) cells treated with different concentrations of H2O2. Data were

presented in terms of relative cell viability versus log of extract dosage. Based

on the results, a dose-dependent cytotoxicity effect was observed in cells

treated with different concentrations of H2O2. The range of H2O2 concentration

between 15.63µM to 250µM did not decrease the viability of H9c2(2-1) cells.

Therefore, H2O2 in the range of these concentrations were considered as the

safe dose range of H2O2.

Figure 3-11: Cell viability curves of H9c2(2-1) cells treated with different

concentrations of hydrogen peroxide (H2O2). The insets showed the

inhibition concentration (IC50) of H2O2 on H9c2(2-1) cells

determined via GraphPad Prism (GraphPad Software, Inc. USA).

Best fit curve were drawn using excel for visual purpose.

2.76

0%

20%

40%

60%

80%

100%

120%

140%

0 1 2 3

Cell

via

bilit

y (

%)

Log [H2O2], µM

H2O2 Induction

IC50

110

Table 3-11: Cell viability of H9c2(2-1) after inductions with different

concentrations of hydrogen peroxide (H2O2). Data presented were

the mean ± standard deviation of three replicates (n=3). ‘*’ on

each column denotes significant differences at P ≤ 0.05 as

compared to negative control.

Cell viabilities were more than 87% after treatment with H2O2 within the

aforementioned concentration range of H2O2. Contrarily, the cell viability

significantly decreased (Table 3-11) after cells were treated with H2O2 at

concentration beyond 250µM. Cell viability was less than 5% for H9c2(2-1) cells

that were treated with 500µM H2O2. In addition, the inhibitory concentration

(IC50) of H2O2 on H9c2(2-1) cells was detected at 572.10µM (refer to Table

3-12).

Under normal cellular metabolic activities, low concentrations of H2O2 are

produced as the by-product that is relatively harmless and rather beneficial to

most cells. Cells utilize the H2O2 for processes such as oxidative biosynthesis

and host defence. In addition, there are also evidences showing the potential of

H2O2 as signalling messenger in cellular signal transduction pathways (Stone &

Yang 2006). However, over accumulation of H2O2 in cells can be deleterious. It

will lead to the onset of oxidative stress and subsequently induce oxidative

stress mediated diseases over time (Nindl et al. 2004).

H2O2 Induction on H9c2(2-1) Cardiomyocytes

Log (Dose),

µM Dose (µM) Cell Viability (%)

1.19 15.63 119.47 ± 3.39*

1.49 31.25 115.27 ± 5.48*

1.80 62.50 109.29 ± 2.07*

2.10 125.00 101.29 ± 3.57

2.40 250.00 87.56 ± 2.49*

2.70 500.00 47.68 ± 3.34*

3.00 1000.00 3.43 ± 1.00*

111

Table 3-12: IC50 of H2O2 on H9c2(2-1) cell. The IC50 value was determined from

respective cell viability curves (Figure 3-11) via GraphPad Prism

(GraphPad Software, Inc. USA). Data represents mean ± standard

deviation of 3 consecutive repetition (n=3).

Based on the results, H9c2(2-1) cells induced with low concentrations of

H2O2 (15.63µM and 31.25µM) showed proliferative effect. The cell viabilities

were more than 100% in relation to the negative control. Such observation

suggests the potential of low concentration of H2O2 in stimulating cell growth of

H9c2(2-1). Low concentration of H2O2 has been reported capable of stimulating

cell proliferation (Burdon & Rice-Evans 1989). In addition, the present data were

in agreement with the general response trend of proliferating mammalian cells

to H2O2 (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995). It was

reported that low concentration of H2O2 in range of 3 to 15µM has the potential

of inducing growth stimulation while the higher concentration range, 120 to

150µM can cause growth arrest temporarily. Growth arrest may occur

permanently when cells were induced with H2O2 in the concentration range

between 250µM and 400µM while concentration of H2O2 beyond 1000µM will

induce cell necrosis (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies

1995). Therefore, variation in cellular responses towards different

concentrations of H2O2 could be the potential deduction for dose-dependent

cytotoxicity effect of H2O2 on H9c2(2-1) cells. However, further studies are

needed to support the statement.

IC50 of H2O2 on H9c2(2-1) cell

Dose ( µM ) Log (Dose), µM

Hydrogen Peroxide (IC50) – (µM) 572.10 ± 1.23 2.76 ± 0.09

112

3.4.4.2.4 Cell Viability Assay (Rice Bran Extract + Hydrogen Peroxide)

There have been several reports of H2O2-mediated cell cytotoxicity and

apoptosis in H9c2(2-1) cells after gaining exposure to H2O2 (Cheng et al. 2009;

Sheng et al. 2010; Zhang et al. 2011). In this study, the potential of RBE to

alleviate oxidative stress in H9c2(2-1) cells mediated by H2O2 was investigated.

H9c2(2-1) cells were pre-treated with different concentrations of each Bajong

LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) extracts

respectively before they were induced with various concentrations of H2O2.

Negative control cells were pre-treated with media + 1% EtOH before induction

with different concentrations of H2O2. The effects of H2O2-inductions on the cell

viability of H9c2(2-1) cardiomyocytes pre-treated with different RBE were shown

in Table 3-13 and Figure 3-12 (cell viability curves) respectively.

Based on the results, H2O2-induction of H9c2(2-1) cells pre-treated with

different concentrations of RBE revealed their respective dose-dependent

cytoprotective effects. Such observations suggest the potential protective

effects of RBE against H2O2-induced cell cytotoxicity. In general, cells pre-

treated with lower concentrations of RBE (Bajong LN: 25µg/mL; MR219:

50µg/mL) revealed their potential cytoprotective role in alleviating H2O2-induced

cell cytotoxicity. These were observed through right shifts in cell viability curve

of H9c2(2-1) cells pre-treated with the low concentration of both extracts

(Appendix: Figure 5-11).

IC50 values of H2O2 (inhibitory concentration of H2O2 that decreases cell

viability to 50%) have also increased significantly (P ≤ 0.05) for cells that were

pre-treated with the low concentration of extracts (as compared to negative

control cells). As presented in Table 3-14, IC50 values of H2O2 for H9c2(2-1)

cells pre-treated with Bajong LN (25µg/mL) and MR219 (50µg/mL) before H2O2

induction were 645.65µM and 320.63µM respectively as compared to that of

negative control, 316.23µM.

113

Table 3-13: Cell viability of H9c2(2-1) after inductions with different

concentrations of H2O2. Cells were pre-treated with different

concentrations of Bajong LN and MR219 RBE before H2O2-

induction. Data represent mean ± standard deviation of three

replicates (n=3). ‘*’ on each column denotes significant

differences at P ≤ 0.05 as compared to negative control (non-

treated cells).

Cell viability (%)

Log [H2O2],

µM

H2O2

(µM)

Negative

Control

(media + 1%

EtOH)

Bajong LN

(25µg/mL)

Bajong LN

(50µg/mL)

1.80 62.5 92.61± 7.62 116.67 ± 4.83* 62.80 ± 5.55*

2.10 125 65.31 ± 3.75* 99.09 ± 6.12 36.95 ± 2.09*

2.40 250 55.70 ± 1.27* 83.05 ± 1.61* 25.04 ± 3.22*

2.70 500 41.65 ± 2.20* 67.87 ± 1.77* 19.62 ± 2.90*

3.00 1000 3.67 ± 2.52* 9.55 ± 2.48* 2.18 ± 0.32*

Log [H2O2],

µM

H2O2

(µM)

Negative

Control

(media + 1%

EtOH)

MR219

(50µg/mL)

MR219

(100µg/mL)

1.80 62.5 92.61± 7.62 117.30 ± 8.43 76.93 ± 8.30*

2.10 125 65.31 ± 3.75* 105.91 ± 6.24 67.93 ± 2.96*

2.40 250 55.70 ± 1.27* 63.50 ± 0.97* 16.86 ± 2.88*

2.70 500 41.65 ± 2.20* 35.15 ± 3.62* 6.56 ± 4.99*

3.00 1000 3.67 ± 2.52* 4.15 ± 0.32* -12.66 ± 4.56*

114

Figure 3-12: Effects of H2O2 inductions on cell viabilities of H9c2(2-1)

cardiomyocytes pre-treated with different concentrations of Bajong

LN RBE (25µg/mL and 50µg/mL) and MR219 RBE (50µg/mL and

100µg/mL)

115

Table 3-14: Average IC50 of H2O2 for H9c2(2-1) cells. The IC50 value was

determined from respective cell viability curves (Figure 5-11) via

GraphPad Prism (GraphPad Software, Inc. USA). Data represent

mean ± standard deviation of 3 (n=3). ‘*’ denotes significantly

different from negative control treated with media + 1% EtOH at P

≤ 0.05. Graphical representations of data were depicted in Figure

5-11 (Appendix section)

The efficiencies of potential cytoprotective effects of Bajong LN

(25µg/mL) and MR219 (50µg/mL) also differed from one another. Pre-

incubation of H9c2(2-1) cells with Bajong LN (25µg/mL) extract increased the

IC50 of H2O2 by approximately two fold. Contrarily, the efficiency of MR219

(50µg/mL) extract was not on par with that of Bajong LN (25µg/mL) extract, only

a slight increment in IC50 of H2O2 was detected in cells pre-treated with MR219

(50µg/mL) extract (approximately 1.4%). The differences in efficiency of

cytoprotective effects of both extracts could be attributed to the difference in

their respective total antioxidant contents.

The high concentrations of Bajong LN (50µg/mL) and MR219

(100µg/mL) extracts tested in the present study did not result in cytoprotection

of cells towards H2O2-induced cell cytotoxicity. Left shifts in cell viability curves

were observed in H9c2(2-1) cells pre-incubated with higher concentrations of

Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts respectively. These

were followed by a decrease in IC50 values of H2O2 along with the high

Average IC50 of H2O2 – (µM)

H2O2 (µM) Log [H2O2], µM

Negative Control

(media + 1% EtOH) 316.23 ± 1.02 2.50 ± 0.01

RBE H2O2 (µM) Log [H2O2], µM

Bajong LN (25 µg/mL) 645.65 ± 1.10* 2.81 ± 0.04*

Bajong LN (50 µg/mL) 92.90 ± 1.17* 1.97 ± 0.07*

MR219 (50 µg/mL) 320.63 ± 1.14* 2.55 ± 0.06*

MR219 (100 µg/mL) 171.79 ± 1.13* 2.24 ± 0.05*

116

concentrations RBE used. The IC50 values of H2O2 for H9c2(2-1) cells pre-

treated with Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts were

92.90µM and 171.79µM respectively as opposed to that of low concentration of

Bajong LN (25µg/mL) and MR219 (50µg/mL) extracts (645.65µM and 320.63µM

respectively).

High concentrations of Bajong LN and MR219 extracts selected for this

study were near the range of IC50 for both extracts (IC50 of Bajong LN:

52.18µg/mL to 73.09µg/mL; IC50 of MR219: 95.44µg/mL to 111.50µg/mL). It

was deduced that H9c2(2-1) cells could have experienced cytotoxic stress from

high concentrations of crude rice brans and H2O2 respectively. As overdoses of

natural antioxidants have been reported to exhibit prooxidant-like characteristics

that potentially threaten cell survival and viability (Azam et al. 2004; Decker

1997; Watjen et al. 2005), additional cytotoxic stress derived from H2O2 could

have further decrease the viability of H9c2(2-1) after treatment with extract and

and H2O2 respectively.

Pre-treatment of cells with Bajong LN (25µg/mL and 50µg/mL) and

MR219 (50µg/mL and 100µg/mL) extracts did not result in protection of cells

against H2O2-induced cell cytotoxicity at 1000µM of H2O2 (Table 3-13). Viability

of H9c2(2-1) cells significantly decreased to less than 10%. This could be due

to over accumulation of H2O2 in cells which threaten the cell viability. Besides,

induction of cells with high concentration may have induced cell necrosis and

apoptosis (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995).

Various chronic diseases such as cardiovascular diseases, cancer and

diabetics are closely associated with oxidative stress. Factors such as

molecular targets, mechanism and severity of oxidative stress define the

consequence of oxidative stress injury on cells. This may further initiates signal

transduction cascade reactions that lead to the onset and progression of

chronic diseases (Aruoma 1998; Magalhaes et al. 2009). The present

preliminary results have revealed the potential of RBE as a source of natural

antioxidants to alleviate oxidative stress mediated cytotoxicity. Coupled with

further carefully planned investigations, RBE could be considered for further

117

application as nutraceuticals for protection against chronic diseases mediated

by oxidative stress, such as cardiovascular diseases.

118

3.4.4.2.5 Effects of Different Treatments on Activities and Gene Expression

of Endogenous Cellular Antioxidant Enzymes in H9c2(2-1) Cells

Cells develop a series of endogenous cellular antioxidant enzymes as

the first line defensive mechanism for regulation and maintenance of cellular

redox homeostasis (Krishnamurthy & Wadhwani 2012). Superoxide dismutase

(SOD), catalase (CAT) and glutathione peroxidase (GPx) are among the first

line endogenous antioxidant protective mechanisms of cells. These protective

mechanisms work synergistically with exogenous antioxidants to maintain the

balance between oxidants and antioxidants within the physiological systems

(Pham-Huy, He & Pham-Huy 2008).

Oxidative stress has been implicated as one of the multifactorial

etiologies of cardiovascular disease (CVD) (Ceriello 2008; Chatterjee et al.

2007; Droge 2002). Hence, strategies of using antioxidant to attenuate CVD via

inhibition of inadvertent cellular oxidative damage or signalling pathway may

have important implications to both prevention and treatment of CVD (Lönn,

Dennis & Stocker 2012)

Previous studies (Chapter 2) on the antioxidant activities of RBE of

Sarawak local rice varieties have shown their potential antioxidant activities as

free radical scavengers in several in vitro chemical-based antioxidant assays.

Therefore, this part of the study was conducted at preliminary stage to assess

the potential cytoprotective and antioxidant protective effects of these RBE by

using an in vitro cardiomyocyte cell culture model.

The focus of this part of study was centred on the potential induction

effects of RBE on the regulations of endogenous cellular antioxidant enzymes

(SOD, CAT and GPx). The cells were pre-treated with different concentrations

of RBE and hydrogen peroxide (H2O2) respectively. The effects of different

treatments were assessed by studying the respective activities and gene

expression of targeted endogenous cellular antioxidant enzymes in induced

H9c2(2-1) cardiomyocytes.

119

(A) Superoxide Dismutase (SOD)

SOD involves in the neutralization of superoxide anions (O2•-) into

hydrogen peroxide (H2O2) and oxygen (O2). It mainly exist in three different

forms: Cu/Zn-SOD, Mn-SOD and EC-SOD respectively (Meier et al. 1998).

Each of them is distributed in different parts of the cells, Mn-SOD present

mostly in mitochrondria while Cu/Zn-SOD occupies areas within the nucleus,

cell cytoplasm, and blood plasma (Krishnamurthy & Wadhwani 2012). As for

EC-SOD, it is the secreted form of Cu/Zn-SOD distributed in the extracellular

space. Enzymatic activities of SOD were examined by using the commercially

available detection assay kit (Cayman Chemicals). The assay kit measures the

total enzymatic activities of Cu/Zn-SOD, Mn-SOD and Fe-SOD (Cayman

Chemical 2014). The isoenzyme of SOD, SOD2 was the targeted gene for gene

expression study in this part of the project. SOD2 is responsible for encoding

Mn-SOD. They are mostly distributed in cellular mitochondria and protect the

organelles from oxidative damage (Kang & Kang 2013; Kokoszka et al. 2001).

This part of the study aimed to investigate the respective induction effects of

RBE and H2O2 on the enzymatic activities and gene expression of SOD in

H9c2(2-1) cardiomyocytes.

(i) Effects of RBE on total SOD enzymatic activity and gene expression

of SOD2 in H9c2(2-1) Cells

The effects of pre-treating H9c2(2-1) cells with different concentrations of

RBE on their respective enzymatic activities and gene expression levels of SOD

were depicted in Figure 3-13. Based on the results, pre-treatment of H9c2(2-1)

cells with RBE after 24 hours significantly increased the total activities of SOD

[Figure 3-13(A)]. The highest SOD activity was detected in H9c2(2-1) cells pre-

treated with 50µg/mL of Bajong LN extract. The total SOD activity was

increased by 2 folds as compared to negative control while cellular induction

with 25µg/mL of Bajong LN, 50µg/mL and 100µg/mL of MR219 extracts

elevated the total SOD activity by approximately 1.4 times in relation to negative

control.

120


SOD2 in H9c2(2-1) cells pre-treated with RBE. Data represent mean

± standard deviation of three repetitions (n=3). ‘*’: significantly

different from negative control at P ≤0.05 and ‘**’: significantly

different from negative control at P ≤0.01.

121

The induction effects of different concentrations of RBE on the

expression of SOD2 were depicted in Figure 3-13(B). After 24 hours of

incubation with RBE, expression of SOD2 was significantly down regulated by

RBE of Bajong LN (50µg/mL) and MR219 (50µg/mL and 100µg/mL)

respectively. No significant difference in expression of SOD2 was observed

between negative control and 25µg/mL of Bajong LN treated sample. Contrarily

to the lower concentration Bajong LN extract, 50µg/mL of Bajong LN induced a

weak down-regulation in expression of SOD2 by approximately 10% in relation

to negative control. Distinctive down-regulations of SOD2 were observed with

50µg/mL and 100µg/mL of MR219 extracts. Both extracts have down-regulated

the expression of SOD2 by approximately 45%.

(ii) Effects of H2O2 on total SOD enzymatic activity and gene expression

of SOD2 in H9c2(2-1) Cells

In this part of the study, H2O2 was used to induce oxidative injuries to

H9c2(2-1) cardiomocytes. H9c2 cells were treated with three different

concentrations of H2O2 and incubated for 24 hours. The effects of H2O2

inductions on total enzymatic activity of SOD and expression levels of SOD2 in

H9c2(2-1) cells were depicted in Figure 3-14. Based on the results, cellular

induction with different concentrations of H2O2 showed dose-dependent effects

on the enzymatic activities and expression of SOD.

Briefly, incubation of H9c2(2-1) cells with 125µM, 250µM and 500µM

H2O2 have elevated the total SOD activities of H9c2(2-1) cells [Figure 3-14(A)].

Total SOD activities were significantly elevated with increasing dose of H2O2

from 125µM to 250µM. Cellular inductions with 125µM and 250µM of H2O2 were

found to increase total SOD activity by ~19% and ~43% in relation to negative

control respectively. Contrarily, cellular induction with 500µM of H2O2 resulted in

approximately 33% decrement in total SOD activity as compared to that with

250µM of H2O2.

122


SOD2 in H9c2(2-1) cells after induction with different concentrations

of H2O2. Data represent mean ± standard deviation of three

repetitions (n=3). ‘*’: significantly different from negative control at

P≤0.05 and ‘**’: significantly different from negative control at

P≤0.01.

123

The effects of H2O2 induction on the expression levels of SOD2 were

depicted in Figure 3-14(B). A significant up-regulation of SOD2 expression was

observed with 250µM of H2O2; the expression level of SOD2 was up-regulated

by 2 folds (relative to negative control) with 250µM of H2O2. Contrarily, the

expression level of SOD2 was significantly down-regulated by 32% (relative to

negative control) with 500µM of H2O2. There was no significant difference in

expression level of SOD2 between negative control and 125µM of H2O2.

(iii) Effects of H2O2 on total SOD enzymatic activity and gene expression

of SOD2 in H9c2(2-1) cells pre-treated with RBE

In this part of the study, H9c2(2-1) cells were pre-treated with different

concentration of RBE before they were subjected to oxidative injuries with H2O2.

Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL)

extracts were among the different concentrations of RBE selected for the study.

After 24 hours of incubation with RBE, the cells were induced with 125µM H2O2.

The concentration of H2O2 was selected based on the lowest the concentration

that would substantially decrease cell viability to approximately 50% (Figure

3-12 and Table 3-13). The effects of the treatment on total SOD enzymatic

activities and gene expression of SOD2 in H9c2(2-1) cells were depicted in

Figure 3-15.

Post H2O2 induction (with 125µM of H2O2) effects of H9c2(2-1)

cardiomyocytes pre-treated with different concentrations of RBE generally have

resulted in a slight decrease in total SOD activities in relation to negative control

[Figure 3-15(A)]. Only significant increase (approximately 36% in relation to

negative control) in total SOD activities was detected in cells pre-treated with

25µg/mL of Bajong LN extract. Total SOD activities significantly decreased by

~23.3% and ~13.6% in cells pre-treated with 50µg/mL of Bajong LN and

50µg/mL of MR219 extracts respectively. In addition, there was no significant

difference in total SOD activity between negative control and 100µg/mL of

MR219 treated cells.

124


SOD2 in RBE pre-treated H9c2(2-1) cells after induction with 125µM of

H2O2. Data represent mean ± standard deviation of three repetitions

(n=3). ‘*’: significantly different from negative control (P ≤0.05); ‘**’:

significantly different from negative control (P ≤0.01)

125

Down-regulations in expression levels of SOD2 were generally observed

across H9c2(2-1) cells pre-treated with different concentrations of RBE except

for H9c2(2-1) cells pre-treated with 100µg/mL of MR219 extract

[Figure 3-15(B)]. There was no significant difference in SOD2 expression

between negative control and H9c2(2-1) cardiomyocytes pre-treated with

100µg/mL of MR219 extract. Pre-treatment of H9c2(2-1) cells with RBE of

Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL) extract induced

down-regulation in expression of SOD2 by ~38%, ~22%, and ~48% in relation

to negative control respectively [Figure 3-15(B)]. In addition, dose-dependent

interactions of RBE with the expression level of SOD2 were also observed.

Cellular induction with low concentrations (25µg/mL of Bajong LN and 50µg/mL

of MR219) of both RBE has significantly down-regulated the expression of

SOD2 by ~38% to ~48% respectively. However, a weaker down-regulation in

expression of SOD2 was reported with higher concentration of RBE (50µg/mL

of Bajong LN and 100µg/mL of MR219 extracts) as compared to the lower

concentration RBE (25µg/mL of Bajong LN and 50µg/mL of MR219 extracts).

Based on the current findings, induction of H9c2(2-1) cardiomyocytes

with different concentrations of RBE and H2O2 has revealed their respective and

distinctive effects in regulating the total SOD enzymatic activities and gene

expression of SOD2. Inductions of H9c2(2-1) cells with different concentrations

of RBE have significantly increased the total SOD enzymatic activity. Several in

vivo and in vitro studies targeting on the antioxidative effects of RBE have also

reported similar increment in enzyme activity of SOD after induction with RBE

(Ling et al. 2001; Surarit et al. 2015; Wang et al. 2014). This reveals the

potential of RBE in enhancing the enzymatic activity of SOD.

The positive induction effects of RBE on the total SOD activity of

H9c2(2-1) cells could be attributed to its polyphenol contents. Several reports

have described the potential of polyphenols exhibiting prooxidant effects.

Oxidation polyphenols is able to generate significant amount of potentially

cytotoxic prooxidants such as O2•-, H2O2, semiquinones and quinones (Awad et

al. 2001; Lambert & Elias 2010). It was proposed that these prooxidants may

have mildly triggered oxidative stress and subsequently induced the cellular

126

antioxidant defences which ultimately lead to cellular cytoprotection (Fahey &

Kensler 2007; Halliwell 2009)

The present data revealed that the expression of SOD2 gene was

significantly down-regulated after induction of RBE. The effects were relatively

more distinctive with higher concentrations of RBE. The exact mechanisms

involved in the down-regulation of SOD2 gene remains unknown and require

further investigation.

Inductions of H9c2(2-1) cardiomyocytes with different concentrations of

H2O2 have shown dose-dependent interactions with both total SOD enzymatic

activity and the gene expression of SOD2. The present data revealed that

cellular induction with 250µM of H2O2 significantly elevated the total SOD

activity and expression level of SOD2. It was proposed that such observation

could be attributed to the the accumulation of O2•- which subsequently initiate

the protective mechanism of SOD in detoxification of O2•-. Such mechanism is

crucial for maintaining cellular redox homeostasis (Pham-Huy, He & Pham-Huy

2008). However, the underlying mechanism that leads to the accumulation of

O2•- remains unknown. It was deduced that the source of O2

•- could potentially

be deriving from normal cellular metabolic activities.

During normal cell proliferation cycles, mitochondrial oxidative

phosphorylation, the ATP energy production pathway of mitochondrial produces

ROS such as superoxide (O2•-) and hydroxyl (OH•-) radicals and H2O2 (Hoffman

& Brookes 2009; Lee et al. 2011). Positive correlation between mitochondrial

ROS and Mn-SOD has been reported in proliferating cells (Chung et al. 2009;

Lee et al. 2011). In order to maintain the intercellular mitochondrial redox

homeostasis, Mn-SOD localized in mitochondrial matrix are up-regulated to aid

in the detoxification of O2•- to O2 and H2O2 (Zelko, Mariani & Folz 2002). Similar

observation was reported in the present study. The expression of SOD2 was

significantly up-regulated by 2.4 folds in relation to negative control. Such

observation may suggest the activation of Mn-SOD to counteract potential

oxidative injury mediated by exogenous H2O2.

In contrast to the induction effect with 250µM of H2O2, cellular induction

with 500µM of H2O2 weakly up-regulated the total SOD activity in H9c2(2-1)

127

cells by approximately 8.6% while the expression of SOD2 was significantly

down-regulated. As the expression of SOD2 directly correlate to the levels of

Mn-SOD (Drane et al. 2001), the present observation on down-regulation of

SOD2 expression with 500µM of H2O2 could suggest the decrease in Mn-SOD

level. In the condition of absence or little existence of Mn-SOD, both cytosolic

Cu/Zn-SOD and EC-SOD could have involved in the detoxification of

superoxide ions in the cells (Papa et al. 2014). Previous study on viability of

H9c2(2-1) cells with different concentrations of H2O2 (Figure 3-11) have

revealed a significant drop in cell viability to approximately 48% after 24 hours

of treatment with 500µM H2O2.

It was presumed that 500µM H2O2 could have induced substantial

oxidative injuries to H9c2(2-1) cardiomyocytes and consequently led to

mitochondrial dysfunction. Both Mn-SOD and Cu/Zn-SOD are involving in the

detoxification of O2•- that leads to intracellular accumulation of H2O2 and O2

(Meier et al. 1998). It was discovered that SOD (Mn-SOD and Cu/Zn-SOD) and

high concentration of H2O2 synergistically induced the degradation of nitric

oxide (NO) and concomitantly increased the formation of ONOO- (McBride,

Borutaite & Brown 1999). Intracellular accumulation of these ONOO- has been

associated with pathologies of various oxidative stress-related chronic diseases.

These radicals are capable of inducing mitochondrial cytotoxicity by inhibition of

mitochondrial electron transport chain (McBride, Borutaite & Brown 1999; Radi

et al. 1994). This consequently leads to ATP depletion which threatens cell

survival and normal functions of mitochondria (Lieberthal, Menza & Levine

1998).

Based on the present result, the H2O2-induction of RBE pre-treated

H9c2(2-1) cells generally did not result in any significant improvement over the

total SOD enzymatic activity and expression levels of SOD2. Interestingly, only

H9c2(2-1) cells that was pre-treated with 25µg/mL of Bajong LN RBE resulted

in significant improvement of total SOD activity by 33% (relative to negative

control) after being induced with 125µM of H2O2 for 24 hours (Figure 3-15).

Contrarily, tthe total SOD activity of H9c2(2-1) cells pre-treated with 25µg/mL of

Bajong LN RBE only (Figure 3-13) reported a significant increment of total SOD

128

activity by 44% in relation to negative control. This translates into a difference of

11% in the total SOD activity of H9c2(2-1) cells pre-treated with 25µg/mL of

Bajong LN RBE, before and after H2O2-induction . The mechanisms involved in

relation to the present observations await further investigation. It was

speculated that the decrease in total SOD activity of RBE (25µg/mL of Bajong

LN) pre-treated H9c2(2-1) after being induced with 125µM of H2O2 could be

linked to the oxidation of SOD enzyme mediated by H2O2 (Jewett et al. 1999).

Polyphenols are capable of exerting characteristics of prooxidants.

Through oxidation process, the oxidized polyphenols can generate prooxidants

such as O2•-, H2O2, semiquinones and quinones (Awad et al. 2001; Lambert &

Elias 2010). Accumulation of these endogenous H2O2 along with those

introduced exogenously could have initiated the inactivation of SOD enzyme.

Jewett et al. (1999) has highlighted the potential of H2O2 in mediating oxidation

of Cu/Zn-SOD. The loss of copper ion, fragmentation of active-site peptides and

the production of 2-oxo-histidine were among the characteristics of oxidized

Cu/Zn-SOD which consequently leads to the enzyme inactivation (Jewett et al.

1999).

129

(B) Catalase (CAT)

CAT enzyme involves in the catalytic conversion of H2O2 to H2O and O2

in a two-steps reaction (Kang & Kang 2013). It actively involves in detoxification

of H2O2 produced from the enzymatic reaction of SOD and cellular metabolic

activities (Pham-Huy, He & Pham-Huy 2008). The enzyme maintains

intracellular ROS homeostasis by neutralizing the toxic effects of H2O2

produced from cellular metabolic activities. The enzyme primarily localized in

peroxisomes of the cells and actively neutralize H2O2 that diffuses into the

peroxisomes (Slater 1984). It is also a highly conserved protein and is encoded

by a single gene (Kang & Kang 2013; Nishikawa et al. 2002).

(i) Effects of RBE on total enzymatic activity and gene expression of

CAT in H9c2(2-1) cells

The effects of inducing H9c2(2-1) cells with different concentrations of

RBE on their respective enzymatic activity and gene expression of CAT were

depicted in Figure 3-16. Based on the results, cellular induction with Bajong LN

(50µg/mL) and MR219 (50µg/mL and 100µg/mL) RBE have elevated cellular

CAT activity respectively while no significant improvement in CAT activity was

observed with 25µg/mL of Bajong LN [Figure 3-16(A)].

Among the two different concentrations of extracts selected in this study,

higher concentrations of extracts were found to induce higher cellular CAT

activities as compared to the lower extract concentrations. Briefly, cellular CAT

activity had increased by ~39% and ~103% in relation to negative control with

50µg/mL of Bajong LN extract and 100µg/mL of MR219 extract respectively. As

for the 50µg/mL of MR219 extract, it weakly elevated the cellular CAT activity

by ~16%. In additional, significantly higher CAT activities were also observed in

MR219 extracts when compared to Bajong LN extracts.

130

Figure 3-16: (A) Total enzymatic activities and (B) gene expression levels of CAT

after treated with RBE. Data represent mean ± standard deviation of

three repetitions (n=3). ‘*’: significantly different from negative

control at P ≤0.05 and ‘**’: significantly different from negative

control at P ≤0.01.

131

Figure 3-16(B) showed the effects of cellular induction with different

concentrations of RBE on the expression levels of cellular CAT. Based on the

result, the expression levels of CAT were significantly up-regulated with all the

concentrations of extracts tested. The increments were in the range of ~18% to

~40%. In addition, it was discovered that Bajong LN extracts expressed higher

levels of CAT (relative to negative control) as compared to MR219 extracts.

There was no significant difference in expression of CAT between the two

different concentrations of each extract selected for this part of the study.

(ii) Effects of Hydrogen peroxide (H2O2) on total enzymatic activity and

gene expression of CAT in H9c2(2-1) cells

Effects of H2O2 inductions on the enzymatic activity and expression

levels of CAT in H9c2(2-1) cells were depicted in Figure 3-17. H9c2(2-1) cells

were incubated with three different concentrations of H2O2 for 24 hours. The

present results revealed that cellular induction with 250µM of H2O2 significantly

increased the CAT activity by ~20%. Contrarily to the induction effect with

250µM of H2O2, no significant difference in CAT activity was reported with

125µM and 500µM of H2O2 respectively [Figure 3-17(A)]. Induction of H9c2(2-1)

cardiomyocytes with different concentrations of H2O2 significantly elevated the

expression levels of CAT [Figure 3-17(B)]. The up-regulation of CAT

expression was in the range of ~80% to ~380% in comparison to negative

control. Among the three different concentrations of H2O2 studied (125µM,

250µM and 500µM), the highest up-regulation in expression level of CAT was

with 250µM H2O2 (4.8 folds over negative control) then followed 125µM H2O2

(3.2 folds over negative control), and with 500µM H2O2 (1.8 folds over negative

control).

132


after induction with different concentrations of H2O2. Data represent

mean ± standard deviation of three repetitions (n=3). ‘*’:

significantly different from negative control at P ≤0.05 and ‘**’:

significantly different from negative control at P ≤0.01.

133

(iii) Effects of H2O2 on total enzymatic activity and gene expression of

CAT in H9c2(2-1) cells pre-treated with RBE

H9c2(2-1) cells were pre-treated with different concentration of RBE:

Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) for

24 hours before they were induced with oxidative injuries with 125µM of H2O2.

Figure 3-18 showed the effects of the treatment on enzymatic activities and

gene expression of CAT. Briefly, CAT activities of cells pre-treated with RBE

were significantly increased after being induced with 125µM of H2O2

[Figure 3-18(A)]. The changes in increment of CAT activities were in the range

of 3 to 8 folds as compared to negative control. Sample group pre-treated with

100µg/mL of MR219 extract reported the highest fold change (~8 folds) in CAT

activity when compared to control group, then followed by 50µg/mL of MR219

extract (~5 folds); 25µg/mL of Bajong LN extract (~4.5 folds) and 50µg/mL of

Bajong LN extract (~3.3 folds).

Figure 3-18(B) depicted the gene expression of CAT after pre-treatment

with different concentrations of RBE and followed by induction with 125µM of

H2O2. Based on the results, both 25µg/mL Bajong LN extract and MR219

(50µg/mL) extract significantly up-regulated the expression levels of CAT by 13%

and 33% respectively in relation to negative control. A slight down-regulation in

expression of CAT (~7%) was observed with cells pre-treated with 25µg/mL of

Bajong LN extract. No significant difference in expression of CAT was reported

between negative control and 100µg/mL of MR219 treated cells.

Based on the current research findings, induction of H9c2(2-1)

cardiomyocytes with different concentrations of RBE and H2O2 has revealed

their respective and distinctive effects in regulating the total enzymatic activities

and gene expression levels of CAT. Briefly, CAT activities of H9c2(2-1) cells

pre-treated with different concentrations of RBE were significantly improved in

relation to negative control. Similar observations have also been reported in

several in vitro and in vivo study models in which CAT activities of the study

models were significantly improved by the induction of RBE (Lee et al. 2014;

Surarit et al. 2015; Wang et al. 2014). All these evidences would suggest

134

potential of RBE as mediators for increasing cellular CAT activity and thereby

improve the total antioxidant status of induced cells.

Positive induction effects of RBE in elevating the activity of CAT were

further evidently supported by up-regulation in gene expression of CAT. It is

presumed that the positive induction effects of RBE on both enzymatic activity

and gene expression CAT were generally attributed to the contents of

polyphenols in those extracts. Polyphenols are capable of exerting

characteristics of prooxidants. Through oxidation process, the oxidized

polyphenols can generate prooxidants such as O2•-, H2O2, semiquinones and

quinones (Awad et al. 2001; Lambert & Elias 2010). Accumulation of these

prooxidants would trigger oxidative stress that ultimately leads to activation of

cellular antioxidant protective- and cytoprotective-mechanisms (Fahey &

Kensler 2007; Halliwell 2009).

Hydrogen peroxide (H2O2) is known as one of the inducers of oxidative

stress. It can easily be converted to reactive hydroxyl radicals and are able to

migrate freely between cells and tissues (Jiang et al. 2014). CAT actively

involved in the detoxification of H2O2 produced from the enzymatic reaction of

SOD and cellular metabolic activities (Pham-Huy, He & Pham-Huy 2008). It

catalyses the conversion of H2O2 to H2O and O2 in a two-steps reaction (Kang &

Kang 2013). CAT naturally has high Michaelis constants (Km) for H2O2, hence it

is capable of neutralizing high concentration of H2O2 (Kohen & Nyska 2002).

In the presence of different concentrations of exogenous H2O2,

activities and gene expression of CAT in H9c2(2-1) cardiomyocytes induced

with different concentrations of H2O2 were significantly up-regulated in a dose-

dependent manner. An increase in activity and expression levels of CAT was

reported with 125µM and 250µM of H2O2 respectively and followed by a

decrease in activity and gene expression CAT when cells were induced with

500µM H2O2.

135


in RBE pre-treated H9c2(2-1) cells after induction with 125µM of


(n=3). ‘*’: significantly different from negative control (P≤0.05); ‘**’:


136

Previous study on viability of H9c2(2-1) cells with different

concentrations of H2O2 (Figure 3-11) have revealed a significant drop in cell

viability to approximately 48% after 24 hours of treatment with 500µM H2O2. It

was presumed that 500µM H2O2 could have induced substantial oxidative

injuries to H9c2(2-1) cardiomyocytes and consequently resulting in progressive

cell death. During such event, normal functions of cellular biological systems

could have been disrupted (Trachootham et al. 2008).

The present data revealed that pre-treating H9c2(2-1) cells with RBE

before H2O2 induction (with 125µM H2O2) resulted in significant improvement on

the enzymatic activity of CAT. Based on such observation, it was proposed that

RBE could have protected H9c2(2-1) cells from oxidative injuries mediated by

H2O2 via up-regulation of CAT activity.

137

(C) Glutathione Peroxidase (GPx)

GPx is a selenocysteine (Sec)-containing enzyme. The enzyme involves

in the catalytic conversion of H2O2 to H2O and organic hydroperoxides to their

respective alcohols (Rodrigo et al. 2013). The enzyme is sensitive to low levels

of oxidative injuries and capable of neutralizing low levels of H2O2 (Kohen &

Nyska 2002), GPx decomposes H2O2 and organic hydroperoxides by utilizing

its co-substrate, glutathione (GSH) and NADPH-NADH redox system (Pham-

Huy, He & Pham-Huy 2008).

Selenocysteine-containing GPx has 5 different isoforms: GPx1, GPx2,

GPx3, GPx4 and GPx6. Each isoform has different structural form and is

localized in different part of the physiological system (Kang & Kang 2013) . Both

GPx1 and GPx4 genes encode cytosolic GPx that are mainly distributed in

cytoplasm. GPx1 gene has also involved in encoding mitochondrial GPx while

GPx4 also encodes phospholipid hydroperoxide GPx that mainly localized in

associated membrane (Esworthy, Ho & Chu 1997; Imai & Nakagawa 2003;

Kang & Kang 2013).

(i) Effects of RBE on total GPx enzymatic activity and gene expression

of GPx1 in H9c2(2-1) cells

The effects of pre-treating H9c2(2-1) cells with different concentrations of

RBE : Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL)

on their respective total GPx enzymatic activities and expression of GPX1 were

depicted in Figure 3-19. Cellular induction with different concentrations of RBE

significantly elevated the total GPx activities in H9c2(2-1) cells by 1.3 to 1.5

folds in comparison to that of negative control [Figure 3-19(A)]. However, GPx

activity was weekly elevated with 100µg/mL of MR219 extract. In addition,

among the two different RBE, no significant difference was observed between

the two in their respective induction effects on GPx activities.

138

Figure 3-19: (A) Total GPx enzymatic activities and (B) gene expression levels of

GPx1 after treated with RBE. Data represent mean ± standard

deviation of three repetitions (n=3). ‘*’: significantly different from

negative control at P ≤ 0.05 and ‘**’: significantly different from

negative control at P ≤0.01.

139

Figure 3-19 (B) depicted the effects of cellular induction with different

concentrations of RBE on the expression of targeted GPx gene, GPx1. GPx1

gene was selected for this part of the study as the gene is responsible for

encoding cytosolic and mitochrondrial GPx (Esworthy, Ho & Chu 1997). Based

on the results, cellular induction with different concentrations of RBE showed a

dose-dependent effect in the regulation of GPx1 gene. A significant up-

regulation in GPx1 gene (by 1.4 folds) was observed with 25µg/mL of Bajong

LN extract. Contrarily, significant down-regulations in the expression of GPx1

gene were reported with 50µg/mL of Bajong LN, 50µg/mL and 100µg/mL of

MR219 extracts respectively. The expression of GPx1 was down-regulated by

0.4 to 0.6 folds.

(ii) Effects of Hydrogen peroxide (H2O2) on total GPx enzymatic activity

and gene expression of GPx1 in H9c2(2-1) cells

Effects of H2O2 inductions on the enzymatic activity and expression

levels of GPx in H9c2(2-1) cells were depicted in Figure 3-20. H9c2(2-1) cells

were incubated with three different concentrations of H2O2 for 24 hours. The

present results revealed that cellular induction with 125µM and 250µM of H2O2

significantly increased the GPx activities by ~34% and ~20% (relative to

negative control) respectively. No significant difference in GPx activity was

reported with 500µM of H2O2 [Figure 3-20(A)].

Induction of H9c2(2-1) cardiomyocytes with 125µM and 250µM of H2O2

significantly elevated the expression levels of GPx by 1.3 and 1.2 folds

respectively [Figure 3-20(B)]. Among the three different concentrations of H2O2

studied (125µM and 250µM), the highest up-regulation in expression level of

GPx1 was with 125µM of H2O2 (1.3 folds over negative control) and then

followed 250µM of H2O2 (1.2 folds over negative control). As for the effect of

induction with 500µM of H2O2, the expression of GPx1 was significantly down-

regulated by 37% as compared to negative control.

140


GPx1 after induction with different concentrations of H2O2. Data

represent mean ± standard deviation of three repetitions (n=3). ‘*’:

significantly different from negative control at P ≤0.05 and ‘**’:

significantly different from negative control at P ≤0.01.

141

(iii) Effects of H2O2 on total GPx enzymatic activity and gene expression

of GPx1 in H9c2(2-1) cells pre-treated with RBE

Different concentration of RBE: Bajong LN (25µg/mL and 50µg/mL) and

MR219 (50µg/mL and 100µg/mL) were used to induce H9c2(2-1)

cardiomyocytes for 24 hours before 125µM of H2O2 was introduced to the cells

to induce oxidative injuries. The effects of pre-treating cells with different

concentrations of RBE on their respective enzymatic activities and gene

expression levels of GPx were depicted in Figure 3-21.

H9c2(2-1) cells that have been pre-treated with 50µg/mL Bajong LN,

50µg/mL and 100µg/mL of MR219 extracts showed significant decrement in

total GPx activities after induction with 125µM of H2O2 [Figure 3-21(A)]. Total

GPx activities were decreased by ~27% to ~53% as compared to negative

control. There was no significant difference in total GPx activity between

negative control and 25µg/mL of Bajong LN pre-treated cells. In addition, the

total GPx activity also showed dose-dependent interaction. The present data

showed that GPx activity significantly decreased with increasing concentration

of RBE.

Figure 3-21(B) showed the post H2O2 induction effects of H9c2(2-1)

cells pre-treated with different concentration of RBE on their respective

expression of GPx1. Based on the results, GPx1 expression showed dose-

dependent interaction. The expressions of GPx1 were weakly up-regulated with

both 25µg/mL of Bajong LN (7% increment)) and 50µg/mL of MR219 (10%

increment) extracts. Contrarily, GPx1 expressions were down-regulated when

the cells were induced with higher concentrations of RBE. However, the down-

regulation effects were relatively weak. The expression of GPx1 was down-

regulated by ~14% with 25µg/mL of Bajong LN extract. There was no significant

difference in expression of GPx1 between negative control and 100µg/mL of

MR219 extracts.

142


GPx in RBE pre-treated H9c2(2-1) cells after induction with 125µM of


(n=3). ‘*’: significantly different from negative control (P ≤0.05); ‘**’:


143

The present data showed that the induction of H9c2(2-1) cardiomyocytes

with different concentrations of RBE and H2O2 has revealed their respective and

distinctive effects in regulating the total enzymatic activities and gene

expression levels of GPx. The activity of GPx was significantly improved

through inductions with different concentration of RBE. Such observation

suggested the potential of RBE as prospective enhancer for enzymatic activity

of GPx. Similar positive induction effects of RBE have also been reported in

several in vitro and in vivo study models (Noaman et al. 2008; Wang et al.

2014). As mentioned previously, the positive induction effects of RBE could be

attributed to the content of polyphenols in the extracts. Oxidation of polyphenols

can lead to production of cytotoxic prooxidants such as O2•-, H2O2,

semiquinones and quinones (Awad et al. 2001; Lambert & Elias 2010). These

prooxidants could trigger mild oxidative stress which further induced the

expression of cellular antioxidant and cytoprotective-mechanisms.

Similar to CAT, GPx also involve in the catalytic conversion of H2O2 to

H2O, in addition to its ability of neutralizing organic hydroperoxides to their

respective alcohols (Rodrigo et al. 2013). In this part of the study, GPx1 was

selected as the molecular target for gene expression study. The gene is

responsible for encoding mitochondrial and cytosolic GPx (Esworthy, Ho & Chu

1997; Imai & Nakagawa 2003; Kang & Kang 2013). Based on the present result,

only the expression of GPx1 was significantly up-regulated by 25µg/mL Bajong

LN extract. Cellular inductions with the remaining RBE have resulted in

significant down-regulation of GPx1 expressions. However, the exact

mechanisms involved in the down-regulation of GPx1 gene by RBE remain

unknown and require further investigation.

Dose-dependent interactions of H2O2 with the activity and gene

expression of GPx were reported in the present study. A gradual decrease in

activity and gene expression of GPx was observed along with increasing

concentration of H2O2. Unlike CAT, GPx has higher affinity for H2O2 when the

substrate is present in low concentration (lower Km as compared to CAT)

(Makino et al. 1994; Sheffield & Hilfer 2012). Hence, higher GPx activity was

reported from low concentration of H2O2 (125µM) to which the activity

progressively decreases along with increasing concentrations of H2O2.

144

The present data revealed that pre-treating H9c2(2-1) cells with RBE

before H2O2 induction (with 125µM H2O2) did not result in any significant

improvement on the enzymatic activity of GPx. Cellular GPx activities were

generally significantly lower than that of negative control. In additional, the

present data also revealed a dose-dependent interaction of RBE on the activity

of GPX. Cellular induction with higher concentrations of RBE resulted in lower

GPx activity as compared to the lower concentrations of RBE.

Contrarily to the trend of cellular GPx activity, Expression of GPx1 was

significantly up-regulated with low concentrations of Bajong LN and MR219

extracts. Despite of the significant up-regulations, the positive induction effects

on the expression of GPx1 by low concentrations of both extracts were rather

weak. The gene expression of GPx1 was weakly down-regulated by 50µg/mL

Bajong LN extract while no significant difference in expression of GPx1

between negative control and cells that were pre-treated with 100µg/mL MR219

extract. Based on the current observation, it was proposed that the GPx could

have been mainly involved in catalytic conversion of low concentration of H2O2.

GPx naturally has low Km and hence it has high affinity towards low

concentration of H2O2 (Sheffield & Hilfer 2012).

Since both CAT and GPx are actively involved in the detoxification of

H2O2, it was presumed that CAT could have predominantly involved in the

disposal of H2O2. The present data revealed that cellular CAT activities of

H9c2(2-1) cells that have been pre-treated with RBE were significantly higher

than that of negative control. However, such result trend was not observed in

GPx activities of H9c2(2-1) cells. A kinetic study on the H2O2 detoxification role

of both erythrocytes-derived CAT and GPx has revealed that CAT

predominantly catalyses the disposal of H2O2. The results showed that CAT

catalysed the disposal of H2O2 at a rate that was significantly higher than that of

GPx. Simultaneous detoxification of H2O2 by CAT and GPx has revealed that

the disposal of H2O2 by GPx only occurred at a rate of 17% in relation to the

concurrent activity of CAT (Gaetani et al. 1996).

145

3.4.5 Conclusion

In the present study, the antioxidant activities of different Sarawak RBE

have been studied via in vitro chemical-based and in vitro cell-based antioxidant

assay systems. The results have demonstrated the potential of RBE as sources

of naturally-derived antioxidants.

In vitro chemical-based antioxidant assays have revealed the free-radical

scavenging capabilities of different RBE. Dose-dependent interactions of RBE

with their respective free radical scavenging activities were reported in this

study. Although the free radical scavenging activities of RBE were lower than

positive controls: tocomin50 and trolox, RBE of different Sarawak rice varieties

still possess substantial efficacies in free radical scavenging activities. This

indicated the potential of RBE as natural sources of antioxidants for free radical

scavenging activities.

The inhibitory concentrations (IC50) of different RBE for DPPH free

radicals scavenging assay were in the range between 188.46µg/mL and

2279.41µg/mL. Among the different RBE studied, Bajong LN exhibited the

highest efficacy in DPPH free radical scavenging. The extract had the lowest

IC50 value required to scavenge 50% of the initial concentration of DPPH as

compared to RBE of other rice varieties.

Regression and correlation analyses of 1/DPPH (IC50) with total phenolic,

total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol,

γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE have been conducted to

study the correlation between the antioxidant activities of RBE and their

respective contents of bioactive compounds. Strong positive (R ≥ 0.8) and

significant (P ≤ 0.05) correlations were observed in DPPH free radical

scavenging activity against total phenolic content in RBE (R = 0.9425), total γ-

oryzanol content (R = 0.8917), and total flavonoid contents (R = 0.8455)

respectively.

The free radical scavenging activities of RBE were compared to positive

control, trolox in Trolox Equivalent Antioxidant Capacity (TEAC) assay. The

TEAC values of different RBE were in the range of 12.79nmol/100g to

61.49nmol/100g respectively. Similar to the result trend in DPPH assay, highest

146

TEAC value (61.49nmol/100g) was detected in Bajong LN RBE. In addition,

strong positive (R ≥ 0.8) and significant (P ≤ 0.05) correlations were also

observed in TEAC value against total phenolic content (R = 0.9533), total

flavonoid content (R = 0.9789), and total γ-oryzanol content (R = 0.9932)

respectively.

Both DPPH and TEAC assays showed similar trend in regression and

correlation analysis between different contents of bioactive compounds in RBE

and their respective free radical scavenging activities. Hence, the present data

revealed the potential contributions of these groups of bioactive compounds to

the efficacy of total antioxidant activities in RBE. The present observations were

also concurrent with several reports from literature highlighting on the significant

contributions of phenolic compounds and flavonoids to the total antioxidant

activities of RBE.

Based on the screening of total antioxidant activities from different RBE,

the highest antioxidant activity in free radical scavenging was detected in

Bajong LN rice bran extract. Hence the extract was selected for in vitro cell

culture-based system to further assess the antioxidant capacity of the extract.

RBE of commercial rice variety, MR219 was selected for comparative study.

H9c2(2-1) cardiomyoytes were used as the cell culture study model for this part

of the study. The cells were induced with different concentrations of RBE and

hydrogen peroxide (H2O2) to assess the potential cytoprotection and antioxidant

protective effects of RBE against oxidative injuries mediated by H2O2.

The induction of cells with different concentrations of RBE showed dose-

dependent interactions on the viabilities of H9c2 cells. Both Bajong LN and

MR219 extracts differed distinctively in their respective safe dose ranges and

lethal concentrations (IC50). Bajong LN extract generally has a lower safe dose

range and lethal concentration as compared to MR219 extracts. The

discrepancy in safe dose range and lethal concentration between the two RBE

could be due to the difference in their respective total antioxidant contents. RBE

of Bajong LN was found to have significantly higher contents of antioxidants

(total phenolic, total flavonoid, total γ-oryzanol, and total vitamin E contents) as

compared to MR219 extract. There have been several reports highlighting on

147

the correlation between cell cytotoxicity and high doses of antioxidant. It was

proposed that high dose of antioxidants; particularly polyphenols can exhibit

characteristics of prooxidants that threaten survival and viability of cells.

Induction of H9c2(2-1) cardiomyocytes with H2O2 also revealed a dose-

dependent interaction. Low concentrations of H2O2 generally did not decrease

the viability of H9c2(2-1) cells but induced proliferation in H9c2 cells. However,

viability of H9c2(2-1) gradually decreased when higher concentrations of H2O2

beyond 125µM were used. Pre-treatment of H9c2(2-1) cells with 25µg/mL

Bajong LN and 50µg/mL MR219 before induction with different concentrations

of H2O2 have revealed the potential of RBE in alleviating H2O2 mediated

cytotoxicity. Pre-incubation of H9c2(2-1) cells with Bajong LN (25 µg/mL)

extract increased the IC50 of H2O2 by approximately two fold in relation to

negative control. Contrarily, the efficiency of 50µg/mL MR219 extract was not

on par with that of 25µg/mL Bajong LN extract, only a slight increment in IC50 of

H2O2 was detected in cells pre-treated with 50µg/mL MR219 extract

(approximately 1.4% in relation to negative control).

The preliminary study on the induction effects of RBE on endogenous

cellular antioxidant enzymes has revealed the potential of RBE as mediators for

improving the enzymatic activities of SOD, CAT and GPx in H9c2(2-1) cells.

Cellular induction with RBE significantly improved the enzymatic activities of

SOD, CAT and GPx in H9c2(2-1) cells. H2O2-induction of H9c2(2-1) cells

pre-treated with RBE further revealed significant up-regulation in enzymatic

activity and expression level of CAT. Through this preliminary study, it has

demonstrated the potential antioxidant protective effects of RBE in alleviating

H2O2-mediated oxidative injuries via up-regulation in enzymatic activities and

expression levels of CAT.

As a summary, the antioxidant capacities of different RBE of Sarawak

have been assessed via two different types of in vitro antioxidant assays: in

vitro chemical-based antioxidant assay and in vitro mammalian cell culture-

based antioxidant assay. Preliminary outcomes from these assays have shown

the potential of RBE as free radical scavengers and protect H9c2(2-1)

cardiomyocytes from oxidative injuries mediated by H2O2 via regulation of

148

endogenous antioxidant enzymes. Regardless of the discrepancies in

antioxidant activities of different RBE, the present findings revealed the

potential of RBE as an exogenous source of antioxidants for improving the total

antioxidant status in physiological systems and provide protection against

oxidative stress. Hence, strategies of using RBE to attenuate CVD via inhibition

of inadvertent cellular oxidative damage or signaling pathway may have

important implications to both prevention and treatment of CVD.

149

4. Chapter 4: Research Limitations and Future

Work

4.1 Project Limitations

The overall research design were intended to achieve two main

objectives, which are to (1) extract and assess natural antioxidant contents from

rice bran of selected Sarawak local rice varieties; (2) assess the bioactivity of

RBE by studying their antioxidant capacities via in vitro antioxidant assays. The

objectives of the research have been achieved. Throughout the study some

limitations have been recognized due to time and resource constraints. The

following provides an overview of the known limitations for the present work.

Objective 1: Extraction of natural antioxidants from rice bran

Standardization of sample collection

Rice varieties selected for the present work were collected by officers

from Agriculture Department of Sarawak at different time point

throughout the study. As rice samples were pre-harvested by farmers,

the author has limitations over the controls of time and methods of

harvesting the samples and also the mode of sample storage to

maintain the freshness of samples.

Detailed compositional analysis of rice bran antioxidants

The total contents of phenolics, flavonoids, anthocyanins, and γ-

oryzanol compounds in RBE were studied via assay methods that

estimate the total contents of the aforementioned bioactive compounds.

Due to the diversity of compounds and the lacking of available reference

standards, detailed compositional analyses of each group of compounds

were limited. Hence qualitative and quantitative analyses of specific

compounds were restricted.

150

Standardization of extraction methods

Due to the nature of different compounds, different extraction methods

are required for different compound to fully isolate them from plant

materials. The present work utilized only methanol as the solvent

system for extraction. The lack of optimization in extraction method

could affect the final extraction yield of the compounds.

Objective 2: Bioactivity studies of natural antioxidants derived from rice

bran of Sarawak local rice varieties

Radical Source for In Vitro Chemical-Based Antioxidant Assays

DPPH free radical source was used in the present study to assess the

antioxidant capacities of RBE in in vitro chemical-based antioxidant

assays. Although significant antioxidant activities of RBE towards DPPH

were reported in the present work, the potential effectiveness of

antioxidant activities of RBE towards alternative electron- or radical-

based sources still remains unknown.

Accumulation of Intracellular Reactive Oxygen Species (ROS)

The accumulation of intracellular ROS in H9c2(2-1) cardiomyocytes was

not investigated in the present work. Hence, differences in the amount

of accumulated intracellular ROS before and after induction with

different treatments were unable to be determined.

Molecular and Integrative Cell Signaling Factors of Cells

Present work was a preliminary study that only focused on the potential

of RBE in mediating the cell viability, activities and expression levels of

endogenous antioxidant enzymes in H9c2(2-1) cells. It is still remains

unknown that how will RBE affect the signal transductions involved in

the regulation of cell viability, proliferation, senescence, apoptotic- and

necrotic-pathways.

151

Activities and gene expression studies of SOD and GPx

Both SOD and GPx have different isomeric forms. Each isomer has

different functions and is distributed in different location or region in the

cells. Present work only focused on the total enzymatic activities of both

endogenous antioxidant enzymes and the expression levels of their

respective single isomeric form (SOD2 and GPx1). Hence, it remains

unknown of how RBE treatments regulate the enzymatic activities and

expression levels of different SOD and GPx isomers.

152

4.2 Future Work

In order to address the limitations from the present research, some of the

potential areas that can be considered to further pursue the present objectives

are as follow:

Objective 1: Extraction of natural antioxidants from rice bran

Effects of different extraction parameters such as solvent system,

temperature, and extraction duration on the extraction yield of natural

antioxidants derived from RBE.

Detailed study on the compositions and structural elucidations of natural

antioxidants present in RBE.

Studies on proteins and fatty acids contents in RBE.

Isolation and purification of compound of interest for further research

and application.

Objective 2: Bioactivity studies of natural antioxidants derived from rice

bran of Sarawak local rice varieties

Bioactivity studies of RBE via alternative electron- or radical-associated

antioxidant assays.

Assessment on the contents of intracellular reactive oxygen species

(ROS) before and after induction with RBE.

Molecular and integrative cell signaling study of cells induced with RBE.

Detailed study on activities and gene expressions of alternative isomers

of SOD and GPx.

Bioactivity studies of RBE using animal models.

153

5. Appendices

5.1 Graphical representation

5.1.1 Total Phenolic Content of RBE of Different Sarawak Local Rice

Varieties

Figure 5-1: Total phenolic content of different RBE were expressed in unit of mg

GAE/g dried extracts. Vertical bars and errors bars represent the

mean ± standard deviation of 3 experimental repetitions (n=3). Similar

letters on each bar represent significant differences at P ≤ 0.05

(Tukey’s Test). GAE = Gallic Acid Equivalent.

a

b

b

c cd cde

def defg deg

0

10

20

30

40

50

60

BajongLN

Bali Pandan WangiMamut

Bajong MR219 Bario Biris Bubuk

mg

GA

E/g

dri

ed

ex

trac

t

RBE

Total Phenolic Content

Bajong LN

Bali

Pandan

Wangi Mamut

Bajong

MR219

Bario

Biris

Bubuk

154

5.1.2 Total Flavonoid Content of RBE of Different Sarawak Local Rice

Varieties

Figure 5-2: Total flavonoid content of different RBE were expressed in unit of mg

QE/g dried extracts. Vertical bars and errors bars represent the mean

± standard deviation of 3 experimental repetitions (n=3). Different

letters on each bar represent significant differences at P ≤ 0.05

(Tukey’s Test). QE = Quercetin Equivalent.

a

b

c

d

e e

f g g

0

2

4

6

8

10

12

14

16

18

BajongLN

Pandan Bali Bajong Bubuk WangiMamut

MR219 Bario Biris

mg

QE/

g d

ried

ext

ract

RBE


Bajong LN

Pandan

Bali

Bajong

Bubuk

Wangi Mamut

MR219

Bario

Biris

155

5.1.3 Total Anthocyanin Content of RBE of Different Sarawak Local Rice

Varieties

Figure 5-3: Total anthocyanin content of different RBE were expressed in unit of

mg C3G/100g dried extracts. Vertical bars and errors bars represent

the mean ± standard deviation of 3 experimental repetitions (n=3).

The ‘*’ annotation represents significant difference at P ≤ 0.05 from

RBE of Bajong (Tukey’s Test).

* * *

0

4

8

12

16

Bario Pandan Bali MR219 BajongLN

WangiMamut

Bajong Bubuk Biris

mg

C3

G e

qu

iva

len

t/1

00

g s

am

ple

RBE


Bario Pandan

Bali MR219

Bajong LN Wangi Mamut

Bajong Bubuk

Biris

156

5.1.4 Total γ-Oryzanol Content of RBE of Different Sarawak Local Rice

Varieties

Figure 5-4: Total γ-oryzanol content of different crude rice bran extracts were

expressed in unit of mg/kg dried extracts. Vertical bars and errors

bars represent the mean ± standard deviation of 3 experimental

repetitions (n=3). Different letters on each bar represent significant

differences at P ≤ 0.05 (Tukey’s Test).

a

b c

d

e f

g h

i

0

1

2

3

4

5

6

7

8

BajongLN

Pandan Bali Bajong Bubuk WangiMamut

Biris MR219 Bario

x1

03 m

g/k

g

RBE


Bajong LN

Pandan

Bali

Bajong

Bubuk

Wangi Mamut

Biris

MR219

Bario

157

5.1.5 IC50 of RBE of Different Sarawak Local Rice Varieties for DPPH Free

Radical Scavenging Assay

Figure 5-5: Inhibitory concentration (IC50) of different RBE for DPPH free radical

scavenging assay. Tocomin50 was used as the positive control. The

data represent mean ± standard deviation of three repetitions (n=3).

Different letters on each bar represent significant differences at P ≤

0.05 (Tukey’s Test).

a b

b

c

d de de

def

def

g

0.0

0.5

1.0

1.5

2.0

2.5

Tocomin50 Bajong LN Bali Pandan Bajong WangiMamut

MR219 Bubuk Biris Bario

IC50 (

x1

03 µ

g/m

L)

RBE

DPPH Free Radical Assay

Tocomin50 Bajong LN Bali

Pandan Bajong Wangi Mamut

158

5.1.6 Correlation Graphs of 1/DPPH (IC50) from RBE with The Content of Different Groups of Bioactive Compounds

y = 0.0001x + 0.0005 R² = 0.8884

0

0.002

0.004

0.006

0.008

0 10 20 30 40 50

1/D

PP

H (

IC50)

Total Phenolic Content (mg GAE/g)

(A) DPPH vs Total Phenolic Content

y = 0.0003x - 0.0001 R² = 0.7148

0

0.002

0.004

0.006

0.008

0 6 12 181/D

PP

H (

IC50)

Total Flavonoid Content (mg QE/g)

(B) DPPH vs Total Flavonoid Content

y = -0.0003x + 0.0052 R² = 0.2899

0

0.002

0.004

0.006

0.008

0 10 20

1/D

PP

H (

IC50)

Total Anthocyanin Content (mg C3G/100g)

(C) DPPH vs Total Anthocyanin Content

y = (9x10-7)x - 0.0007 R² = 0.7951

0

0.002

0.004

0.006

0.008

0 2 4 6 8

1/D

PP

H (

IC50)

Total γ-Oryzanol Content (x103 mg/kg)

(D) DPPH vs γ-Oryzanol

y = (1x10-5)x - 0.0032 R² = 0.5048

0

0.002

0.004

0.006

0.008

0 200 400 600

1/D

PP

H (

IC50)

Total Vitamin E Content (mg/kg)

(E) DPPH vs Vitamin E

y = 0.0002x + 0.0002 R² = 0.1192

0

0.002

0.004

0.006

0.008

0 5 10 15 20

1/D

PP

H (

IC50)

Total δ-Tocotrienol Content (mg/kg)

(F) DPPH vs δ-Tocotrienol

*[Figure continue on to next page]

159

Figure 5-6: The correlation graphs of 1/DPPH (IC50) from RBE with (A) total phenolic content, (B) total flavonoid content, (C) total

anthocyanin content, (D) total γ-oryzanol content, (E) total vitamin E content, (F) δ-tocotrienol content, (G) γ-tocotrienol

content, (H) α-tocotrienol content, and (I) tocopherol (α-tocopherol) content.

y = (2x10-5)x - 0.002 R² = 0.4269

0

0.002

0.004

0.006

0.008

0 200 400

1/D

PP

H (

IC50)

Total γ-Tocotrienol Content (mg/kg)

(G) DPPH vs γ-Tocotrienol

y = (1x10-5)x + 0.0013 R² = 0.0368

0

0.002

0.004

0.006

0.008

0 20 40 60 80 100

1/D

PP

H (

IC50)

Total α-Tocotrienol Content (mg/kg)

(H) DPPH vs α-Tocotrienols

y = (1x10-5) x + 0.0005 R² = 0.1143

0

0.002

0.004

0.006

0.008

0 100 200 300

1/D

PP

H (

IC50)

Total Tocopherol (α-Tocopherol) Content (mg/kg)

(I) DPPH vs Tocopherol (α-Tocopherol)

160

5.1.7 Trolox Equivalent Antioxidant Capacity (TEAC) Assay of Different

RBE.

Figure 5-7: Trolox Equivalent Antioxidant Capacity (TEAC) assay of different

RBE. Trolox was used as the positive control. Antioxidant capacities

of different RBE were expressed in trolox equivalence (nmol/g

trolox). The data represent mean ± standard deviation of three

repetitions (n=3). Different letters on each bar represent significant

differences at P ≤ 0.05 (Tukey’s Test).

a

b b

c

cd cd

e ef ef

0

10

20

30

40

50

60

70

BajongLN

Bali Pandan Bajong WangiMamut

Bubuk MR219 Biris Bario

Tro

lox

Eq

uiv

ale

nt

(nm

ol/ 1

00

g)

RBE

TEAC Bajong LN

Bali

Pandan

Bajong

Wangi Mamut

Bubuk

MR219

Biris

Bario

161

5.1.8 Trolox Equivalent Antioxidant Capacity (TEAC) Assay of RBE from Different Sarawak Local Rice Varieties.

y = 0.978x + 17.014 R² = 0.9089

0

20

40

60

80

0 10 20 30 40 50

TE

AC

(n

mo

l/100g

)

Total Phenolic Content (mg GAE/g)

(1) TEAC vs Total Phenolic Content

y = 3.0103x + 9.9305 R² = 0.9582

0

20

40

60

80

0 5 10 15 20T

EA

C (

nm

ol/100g

) Total Flavonoid Content (mg QE/g)

(2) TEAC vs Total Flavonoid Content

y = -1.7836x + 51.548 R² = 0.2411

0

20

40

60

80

0 10 20 30

TE

AC

(n

mo

l/100g

)

Total Anthocyanin Content (mg C3G/100g)

(3) TEAC vs Total Anthocyanin Content

y = 0.0075x + 5.4386 R² = 0.9865

0

20

40

60

80

0 2 4 6 8

TE

AC

(n

mo

l/100g

)

Total γ-Oryzanol Content (x103 mg/kg)

(4) TEAC vs γ-Oryzanol Content

y = 0.0797x - 5.5265 R² = 0.3624

0

20

40

60

80

0 200 400 600 800

TE

AC

(n

mo

l/100g

)

Total Vitamin E Content (mg/kg)

(5) TEAC vs Total Vitamin E Content

y = 2.4055x + 7.7305 R² = 0.2782

0

20

40

60

80

0 5 10 15 20

TE

AC

(n

mo

l/100g

)

Total δ-Tocotrienol Content (mg/kg)

(6) TEAC vs δ-Tocotrienol Content

*[Figure continue on to next page]

162

Figure 5-8: The correlation graphs of TEAC of RBE with (1) total phenolic content, (2) total flavonoid content, (3) total anthocyanin

content, (4) total γ-oryzanol content, (5) total vitamin E content, (6) δ-tocotrienol content, (7) γ-tocotrienol content, (8) α-

tocotrienol content, and (9) tocopherol (α-tocopherol) content.

y = 0.0596x + 12.588 R² = 0.1037

0

20

40

60

80

0 100 200 300 400

TE

AC

(n

mo

l/100g

)

Total γ-Tocotrienol Content (mg/kg)

(7) TEAC vs γ-Tocotrienol Content

y = 0.1575x + 21.685 R² = 0.0856

0

20

40

60

80

0 20 40 60 80 100

TE

AC

(n

mo

l/100g

) Total α-Tocotrienol Content (mg/kg)

(8) TEAC vs α-Tocotrienol Content

y = 0.125x + 12.173 R² = 0.268

0

20

40

60

80

0 100 200 300

TE

AC

(n

mo

l/100g

)

Total Tocopherol (α-Tocopherol) Content (mg/kg)

(9) TEAC vs Tocopherol (α-Tocopherol) Content

163

5.1.9 Dose- and Time-Dependent Interactions of Bajong LN RBE on the

cell viability of H9c2(2-1) cells.


concentrations of Bajong LN extracts over 24, 48 and 72 hours of

incubation period respectively. The insets showed the inhibition

concentration (IC50) of Bajong LN RBE on H9c2(2-1) cells

determined via GraphPad Prism (GraphPad Software, Inc. USA).

Best fit curves were plotted using excel for visual purpose.

1.81

0%

20%

40%

60%

80%

100%

120%

0 1 2 3

Cell

Via

bilit

y (

%)


Bajong LN (Day 1)

Bajong LN Day 1

IC50

1.79

0%

20%

40%

60%

80%

100%

120%

0 1 2 3

Cell

Via

bilit

y (

%)


Bajong LN (Day 2)

Bajong LN Day 2

IC50

1.80

0%

20%

40%

60%

80%

100%

120%

0 1 2 3

Cell

Via

bilit

y (

%)


Bajong LN (Day 3)

Bajong LN (Day 3)

IC50

164

5.1.10 Dose- and Time-Dependent Interactions of MR219 RBE on the cell

viability of H9c2(2-1) cells.


concentrations of MR219 extracts over 24, 48 and 72 hours of

incubation period respectively. The insets showed the inhibition

concentration (IC50) of MR219 RBE on H9c2(2-1) cells determined

via GraphPad Prism (GraphPad Software, Inc. USA). Best fit

curves were plotted using excel for visual purpose.

1.98

0%

20%

40%

60%

80%

100%

120%

140%

0 1 2 3

Cell

Via

bilit

y (

%)

Log [MR219], µg/mL

MR219 (Day 1)

MR219 (Day 1)

IC50

2.05

0%

20%

40%

60%

80%

100%

120%

0 1 2 3

Cell

Via

bilit

y (

%)

Log [MR219], µg/mL

MR219 (Day 2)

MR219 (Day 2)

IC50

2.03

0%

20%

40%

60%

80%

100%

120%

140%

0 1 2 3

Cell

Via

bilit

y (

%)

Log [MR219], µg/mL

MR219 (Day 3)

MR219 (Day 3)

IC50

165

5.1.11 Dose-Dependent Interactions of H2O2 on the cell viability of H9c2(2-1) cells pre-treated with different concentrations

of Bajong LN RBE and MR219 RBE.

Figure 5-11: IC50 of H2O2 for H9c2(2-1) cells pre-treated with different concentrations of RBE. Data represent mean ± standard

deviation for 3 repetitions (n=3). IC50 values were determined via GraphPad Prism (GraphPad Software, Inc. USA).

166

5.2 Tabulation of Data

Table 5-1: Extraction yields of RBE

Extraction Yield

Rice

Varieties

Mass of

Starting

Material

(g Dry Weight)

Volume

of Solvent,

MetOH

(mL)

Mass of Extract

(g Dry Weight)

mg/g

Dry Weight

% mg/g Dry

Weight

mg/100g

Dry Weight

Bajong LN 3.0459 30 0.0531 0.0174 1.74 1.74

Bali 3.0171 30 0.102 0.0338 3.38 3.38

Biris 3.0412 30 0.1378 0.0453 4.53 4.53

Bubuk 3.0539 30 0.0991 0.0325 3.25 3.25

Bario 3.0172 30 0.1218 0.0404 4.04 4.04

Wangi Mamut 3.073 30 0.1034 0.0336 3.36 3.36

MR 219 3.0309 30 0.1195 0.0394 3.94 3.94

Bajong 3.0757 30 0.0988 0.0321 3.21 3.21

Pandan 3.0573 30 0.0711 0.0233 2.33 2.33

167

6. References

Adam, A, Marzuki, A, Ngah, WZ & Top, GM 1996, 'Nitrofurantoin-induced hepatic and pulmonary biochemical changes in mice fed different vitamin E doses', Pharmacol Toxicol, vol. 79, no. 6, Dec, pp. 334-9.

Addis, PB 1986, 'Occurrence of lipid oxidation products in foods', Food Chem Toxicol, vol. 24, no. 10-11, Oct-Nov, pp. 1021-30.

Aedín, C, José, P & Peter, H 2012, 'Bioavailability of Isoflavones in Humans', in Flavonoids and Related Compounds, CRC Press.

Agarwal, MK, Agarwal, ML, Athar, M & Gupta, S 2004, 'Tocotrienol-Rich Fraction of Palm Oil Activates p53, Modulates Bax/Bcl2 Ratio and Induces Apoptosis Independent of Cell Cycle Association', Cell Cycle, vol. 3, no. 2, pp. 200-199.

Aggarwal, BB, Sundaram, C, Prasad, S & Kannappan, R 2010, 'Tocotrienols, the vitamin E of the 21st century: its potential against cancer and other chronic diseases', Biochem Pharmacol, vol. 80, no. 11, Dec 1, pp. 1613-31.

Ahmad, NS, Khalid, BA, Luke, DA & Ima Nirwana, S 2005, 'Tocotrienol offers better protection than tocopherol from free radical-induced damage of rat bone', Clin Exp Pharmacol Physiol, vol. 32, no. 9, Sep, pp. 761-70.

Ahn, KS, Sethi, G, Krishnan, K & Aggarwal, BB 2007, 'Gamma-tocotrienol inhibits nuclear factor-kappaB signaling pathway through inhibition of receptor-interacting protein and TAK1 leading to suppression of antiapoptotic gene products and potentiation of apoptosis', J Biol Chem, vol. 282, no. 1, Jan 5, pp. 809-20.

Alexander, GS 2008, 'Tocotrienols', in Tocotrienols, CRC Press, pp. 3-12.

Anand, SS, Islam, S, Rosengren, A, Franzosi, MG, Steyn, K, Yusufali, AH, Keltai, M, Diaz, R, Rangarajan, S & Yusuf, S 2008, Risk factors for myocardial infarction in women and men: insights from the INTERHEART study.

Anne, MM & Barrie, T 2008, 'Tocotrienols in Cardiometabolic Diseases', in Tocotrienols, CRC Press, pp. 257-273.

Antipuesto, DJ 2014, Nursing Crib.

Arslan, F, Keogh, B, McGuirk, P & Parker, AE 2010, 'TLR2 and TLR4 in Ischemia Reperfusion Injury', Mediators of Inflammation, vol. 2010, p. 8.

Aruoma, O 1998, 'Free radicals, oxidative stress, and antioxidants in human health and disease', Journal of the American Oil Chemists' Society, vol. 75, no. 2, 1998/02/01, pp. 199-212.

168

Ausman, LM, Rong, N & Nicolosi, RJ 2005, 'Hypocholesterolemic effect of physically refined rice bran oil: Studies of cholesterol metabolism and early atherosclerosis in hypercholesterolemic hamsters', The Journal of Nutritional Biochemistry, vol. 16, no. 9, 9//, pp. 521-529.

Aviram, M, Dornfeld, L, Rosenblat, M, Volkova, N, Kaplan, M, Coleman, R, Hayek, T, Presser, D & Fuhrman, B 2000, 'Pomegranate juice consumption reduces oxidative stress, atherogenic modifications to LDL, and platelet aggregation: studies in humans and in atherosclerotic apolipoprotein E-deficient mice', Am J Clin Nutr, vol. 71, no. 5, May, pp. 1062-76.

Awad, HM, Boersma, MG, Boeren, S, van Bladeren, PJ, Vervoort, J & Rietjens, IM 2001, 'Structure-activity study on the quinone/quinone methide chemistry of flavonoids', Chem Res Toxicol, vol. 14, no. 4, Apr, pp. 398-408.

Azam, S, Hadi, N, Khan, NU & Hadi, SM 2004, 'Prooxidant property of green tea polyphenols epicatechin and epigallocatechin-3-gallate: implications for anticancer properties', Toxicol In Vitro, vol. 18, no. 5, Oct, pp. 555-61.

Babich, H, Zuckerbraun, HL, Wurzburger, BJ, Rubin, YL, Borenfreund, E & Blau, L 1996, 'Benzoyl peroxide cytotoxicity evaluated in vitro with the human keratinocyte cell line, RHEK-1', Toxicology, vol. 106, no. 1–3, 1/8/, pp. 187-196.

Bang, MH, Van Riep, T, Thinh, NT, Song le, H, Dung, TT, Van Truong, L, Van Don, L, Ky, TD, Pan, D, Shaheen, M & Ghoneum, M 2010, 'Arabinoxylan rice bran (MGN-3) enhances the effects of interventional therapies for the treatment of hepatocellular carcinoma: a three-year randomized clinical trial', Anticancer Res, vol. 30, no. 12, Dec, pp. 5145-51.

Beckman, KB & Ames, BN 1997, 'Oxidative Decay of DNA', Journal of Biological Chemistry, vol. 272, no. 32, August 8, 1997, pp. 19633-19636.

Berliner, JA, Navab, M, Fogelman, AM, Frank, JS, Demer, LL, Edwards, PA, Watson, AD & Lusis, AJ 1995, 'Atherosclerosis: Basic Mechanisms: Oxidation, Inflammation, and Genetics', Circulation, vol. 91, no. 9, May 1, 1995, pp. 2488-2496.

Biasutto, L, Mattarei, A & Zoratti, M 2012, 'Resveratrol and health: the starting point', Chembiochem, vol. 13, no. 9, Jun 18, pp. 1256-9.

Bordignon-Luiz, MT, Gauche, C, Gris, EF & Falcão, LD 2007, 'Colour stability of anthocyanins from Isabel grapes (Vitis labrusca L.) in model systems', LWT - Food Science and Technology, vol. 40, no. 4, 5//, pp. 594-599.

Borresen, EC & Ryan, EP 2014, 'Chapter 22 - Rice Bran: A Food Ingredient with Global Public Health Opportunities', in RRWRP Zibadi (ed.) Wheat and Rice in Disease Prevention and Health, Academic Press, San Diego, pp. 301-310.

169

Bouayed, J & Bohn, T 2010, 'Exogenous antioxidants - Double-edged swords in cellular redox state: Health beneficial effects at physiologic doses versus deleterious effects at high doses', Oxid Med Cell Longev, vol. 3, no. 4, Jul 1, pp. 228-237.

Britz, SJ, Prasad, PV, Moreau, RA, Allen, LH, Jr., Kremer, DF & Boote, KJ 2007, 'Influence of growth temperature on the amounts of tocopherols, tocotrienols, and gamma-oryzanol in brown rice', J Agric Food Chem, vol. 55, no. 18, Sep 5, pp. 7559-65.

Bucci, R, Magrì, A, Magrì, A & Marini, F 2003, 'Comparison of three spectrophotometric methods for the determination of γ-oryzanol in rice bran oil', Analytical and Bioanalytical Chemistry, vol. 375, no. 8, 2003/04/01, pp. 1254-1259.

Burdon, RH & Rice-Evans, C 1989, 'Free radicals and the regulation of mammalian cell proliferation', Free Radic Res Commun, vol. 6, no. 6, pp. 345-58.

Cayman Chemical 2014, 'Superoxide dismutase assay kit', Item No. 706002,

Cederberg, J, Siman, CM & Eriksson, UJ 2001, 'Combined Treatment with Vitamin E and Vitamin C Decreases Oxidative Stress and Improves Fetal Outcome in Experimental Diabetic Pregnancy', Pediatr Res, vol. 49, no. 6, 06//print, pp. 755-762.

Ceriello, A 2008, 'Possible Role of Oxidative Stress in the Pathogenesis of Hypertension', Diabetes Care, vol. 31, no. Supplement 2, February 1, 2008, pp. S181-S184.

Cesar, GF & Patricia, IO 2012, 'Interactions of Flavan-3-ols within Cellular Signaling Pathways', in Flavonoids and Related Compounds, CRC Press.

Chang, PN, Yap, WN, Lee, DT, Ling, MT, Wong, YC & Yap, YL 2009, 'Evidence of gamma-tocotrienol as an apoptosis-inducing, invasion-suppressing, and chemotherapy drug-sensitizing agent in human melanoma cells', Nutr Cancer, vol. 61, no. 3, pp. 357-66.

Chantal, MCB, Richelle, SM, Justin, FD, rea, LE, rew, F, Delfin, R-L, Mirna, NC & Grant, NP 2012, 'The Pathophysiology of Coronary Artery Disease', in Functional Foods and Cardiovascular Disease, CRC Press, pp. 1-28.

Chatterjee, M, Saluja, R, Kanneganti, S, Chinta, S & Dikshit, M 2007, 'Biochemical and molecular evaluation of neutrophil NOS in spontaneously hypertensive rats', Cell Mol Biol (Noisy-le-grand), vol. 53, no. 1, pp. 84-93.

Chen, MH & Bergman, CJ 2005, 'A rapid procedure for analysing rice bran tocopherol, tocotrienol and γ-oryzanol contents', Journal of Food Composition and Analysis, vol. 18, no. 2–3, 3//, pp. 139-151.

170

Chen, MH, Choi, SH, Kozukue, N, Kim, HJ & Friedman, M 2012, 'Growth-inhibitory effects of pigmented rice bran extracts and three red bran fractions against human cancer cells: relationships with composition and antioxidative activities', J Agric Food Chem, vol. 60, no. 36, Sep 12, pp. 9151-61.

Chen, Z, Siu, B, Ho, YS, Vincent, R, Chua, CC, Hamdy, RC & Chua, BH 1998, 'Overexpression of MnSOD protects against myocardial ischemia/reperfusion injury in transgenic mice', J Mol Cell Cardiol, vol. 30, no. 11, Nov, pp. 2281-9.

Cheng, Y, Liu, X, Zhang, S, Lin, Y, Yang, J & Zhang, C 2009, 'MicroRNA-21 protects against the H(2)O(2)-induced injury on cardiac myocytes via its target gene PDCD4', J Mol Cell Cardiol, vol. 47, no. 1, Jul, pp. 5-14.

Cho, JG, Song, NY, Nam, TG, Shrestha, S, Park, HJ, Lyu, HN, Kim, DO, Lee, G, Woo, YM, Jeong, TS & Baek, NI 2013, 'Flavonoids from the grains of C1/R-S transgenic rice, the transgenic Oryza sativa spp. japonica, and their radical scavenging activities', J Agric Food Chem, vol. 61, no. 43, Oct 30, pp. 10354-9.

Chotimarkorn, C & Silalai, N 2008, 'Addition of rice bran oil to soybean oil during frying increases the oxidative stability of the fried dough from rice flour during storage', Food Research International, vol. 41, no. 3, //, pp. 308-317.

Christ, B & Müller, KH 1960, 'Zur serienmäßigen Bestimmung des Gehaltes an Flavonol-Derivaten in Drogen', Archiv der Pharmazie, vol. 293, no. 12, pp. 1033-1042.

Chung, JS, Lee, SB, Park, SH, Kang, ST, Na, AR, Chang, TS, Kim, HJ & Yoo, YD 2009, 'Mitochondrial reactive oxygen species originating from Romo1 exert an important role in normal cell cycle progression by regulating p27(Kip1) expression', Free Radic Res, vol. 43, no. 8, Aug, pp. 729-37.

Cunha, SC, Amaral, JS, Fernandes, JO & Oliveira, MB 2006, 'Quantification of tocopherols and tocotrienols in portuguese olive oils using HPLC with three different detection systems', J Agric Food Chem, vol. 54, no. 9, May 3, pp. 3351-6.

Dai, J & Mumper, RJ 2010, 'Plant phenolics: extraction, analysis and their antioxidant and anticancer properties', Molecules, vol. 15, no. 10, pp. 7313-52.

Davies, KJ 1999, 'The broad spectrum of responses to oxidants in proliferating cells: a new paradigm for oxidative stress', IUBMB Life, vol. 48, no. 1, Jul, pp. 41-7.

de Kok, TM, van Breda, SG & Manson, MM 2008, 'Mechanisms of combined action of different chemopreventive dietary compounds: a review', Eur J Nutr, vol. 47 Suppl 2, May, pp. 51-9.

de Munter, JSL, Hu, FB, Spiegelman, D, Franz, M & van Dam, RM 2007, 'Whole Grain, Bran, and Germ Intake and Risk of Type 2 Diabetes: A Prospective Cohort Study and Systematic Review', PLoS Med, vol. 4, no. 8, p. e261.

171

Decker, EA 1997, 'Phenolics: prooxidants or antioxidants?', Nutr Rev, vol. 55, no. 11 Pt 1, Nov, pp. 396-8.

Dembinska-Kiec, A, Mykkanen, O, Kiec-Wilk, B & Mykkanen, H 2008, 'Antioxidant phytochemicals against type 2 diabetes', Br J Nutr, vol. 99 E Suppl 1, May, pp. Es109-17.

Dos Santos, WG, Pacheco, I, Liu, M-Y, Teixeira, M, Xavier, AV & LeGall, J 2000, 'Purification and Characterization of an Iron Superoxide Dismutase and a Catalase from the Sulfate-Reducing Bacterium Desulfovibrio gigas', Journal of Bacteriology, vol. 182, no. 3, 11 April, pp. 796-804.

Drane, P, Bravard, A, Bouvard, V & May, E 2001, 'Reciprocal down-regulation of p53 and SOD2 gene expression-implication in p53 mediated apoptosis', Oncogene, vol. 20, no. 4, pp. 430-439.

Droge, W 2002, 'Free radicals in the physiological control of cell function', Physiol Rev, vol. 82, no. 1, Jan, pp. 47-95.

Dröge, W & Schipper, HM 2007, 'Oxidative stress and aberrant signaling in aging and cognitive decline', Aging cell, vol. 6, no. 3, pp. 361-370.

Drotleff, AM & Ternes, W 2001, 'Determination of RS,E/Z-tocotrienols by HPLC', J Chromatogr A, vol. 909, no. 2, Feb 16, pp. 215-23.

Eguchi, Y, Shimizu, S & Tsujimoto, Y 1997, 'Intracellular ATP Levels Determine Cell Death Fate by Apoptosis or Necrosis', Cancer Research, vol. 57, no. 10, May 15, 1997, pp. 1835-1840.

Elaine, TC, Delilah, FW, Bienvenido, OJ & Donald, BB 2004, 'CHAPTER 4: THE RICE GRAIN AND ITS GROSS COMPOSITION', in RICE: Chemistry and Technology, American Association of Cereal Chemists, Inc., pp. 77-107.

Eloff, JN 1998, 'Which extractant should be used for the screening and isolation of antimicrobial components from plants?', J Ethnopharmacol, vol. 60, no. 1, Feb, pp. 1-8.

Esiri, MM 2007, 'Ageing and the brain', J Pathol, vol. 211, no. 2, Jan, pp. 181-7.

Esworthy, RS, Ho, YS & Chu, FF 1997, 'The Gpx1 gene encodes mitochondrial glutathione peroxidase in the mouse liver', Arch Biochem Biophys, vol. 340, no. 1, Apr 1, pp. 59-63.

Fahey, JW & Kensler, TW 2007, 'Role of Dietary Supplements/Nutraceuticals in Chemoprevention Through Induction of Cytoprotective Enzymes', Chemical research in toxicology, vol. 20, no. 4, 03/16, pp. 572-576.

Fang, N, Yu, S & Badger, TM 2003, 'Characterization of triterpene alcohol and sterol ferulates in rice bran using LC-MS/MS', J Agric Food Chem, vol. 51, no. 11, May 21, pp. 3260-7.

172

Fasahat, P, Abdullah, A, Muhammad, K, Karupaiah, T & Ratnam, W 2012, 'Red pericarp advanced breeding lines derived from Oryza rufipogon × Oryza sativa: physicochemical properties, total antioxidant activity, phenolic compounds and vitamin E content', Advance Journal of Food Science & Technology, vol. 4, no. 3, pp. 155-165.

Finocchiaro, F, Ferrari, B, Gianinetti, A, Dall'asta, C, Galaverna, G, Scazzina, F & Pellegrini, N 2007, 'Characterization of antioxidant compounds of red and white rice and changes in total antioxidant capacity during processing', Mol Nutr Food Res, vol. 51, no. 8, Aug, pp. 1006-19.

Fleury, C, Mignotte, B & Vayssiere, JL 2002, 'Mitochondrial reactive oxygen species in cell death signaling', Biochimie, vol. 84, no. 2-3, Feb-Mar, pp. 131-41.

Folin, O & Ciocalteu, V 1927, 'On tyrosine and tryptophan determinations in proteins', The Journal of Biological Chemistry, vol. 73, pp. 627-650.

Forycki, ZF 2010, 'Dietary Lipids and Coronary Heart Disease', in Chemical, Biological, and Functional Aspects of Food Lipids, Second Edition, CRC Press, pp. 211-226.

Fujita, A, Fujitake, H, Kawakami, K & Nomura, M 2010, 'Antioxidant activity of colored rice bran obtained at different milling yields', J Oleo Sci, vol. 59, no. 10, pp. 563-8.

Fulda, S, Gorman, AM, Hori, O & Samali, A 2010, 'Cellular Stress Responses: Cell Survival and Cell Death', International Journal of Cell Biology, vol. 2010, p. 23.

Fuleki, T & Francis, FJ 1968, 'Quantitative Methods for Anthocyanins', Journal of Food Science, vol. 33, no. 1, pp. 78-83.

Gaetani, GF, Ferraris, AM, Rolfo, M, Mangerini, R, Arena, S & Kirkman, HN 1996, 'Predominant role of catalase in the disposal of hydrogen peroxide within human erythrocytes', Blood, vol. 87, no. 4, Feb 15, pp. 1595-9.

Garcia-Lafuente, A, Guillamon, E, Villares, A, Rostagno, MA & Martinez, JA 2009, 'Flavonoids as anti-inflammatory agents: implications in cancer and cardiovascular disease', Inflamm Res, vol. 58, no. 9, Sep, pp. 537-52.

Gaspar, J, Rodrigues, A, Laires, A, Silva, F, Costa, S, Monteiro, MJ, Monteiro, C & Rueff, J 1994, 'On the mechanisms of genotoxicity and metabolism of quercetin', Mutagenesis, vol. 9, no. 5, Sep, pp. 445-9.

Gerhardt, AL & Gallo, NB 1998, 'Full-fat rice bran and oat bran similarly reduce hypercholesterolemia in humans', J Nutr, vol. 128, no. 5, May, pp. 865-9.

Ghasemzadeh, A, Jaafar, H, Juraimi, A & Tayebi-Meigooni, A 2015, 'Comparative Evaluation of Different Extraction Techniques and Solvents for the Assay of Phytochemicals and Antioxidant Activity of Hashemi Rice Bran', Molecules, vol. 20, no. 6, p. 10822.

173

Ghatak, S & Panchal, S 2012, 'Anti-diabetic activity of oryzanol and its relationship with the anti-oxidant property', International Journal of Diabetes in Developing Countries, vol. 32, no. 4, 2012/12/01, pp. 185-192.

Giusti, MM & Wrolstad, RE 2001, 'Characterization and Measurement of Anthocyanins by UV-Visible Spectroscopy', in Current Protocols in Food Analytical Chemistry, John Wiley & Sons, Inc.

Goffman, F & Bergman, C 2004, 'Rice Kernel phenolic content and its relationship with antiradical efficiency', J Sci Food Agric, vol. 84, pp. 1235 - 1240.

Goldstein, JL, Ho, YK, Basu, SK & Brown, MS 1979, 'Binding site on macrophages that mediates uptake and degradation of acetylated low density lipoprotein, producing massive cholesterol deposition', Proceedings of the National Academy of Sciences, vol. 76, no. 1, January 1, 1979, pp. 333-337.

Goufo, P, Ferreira, LMM, Trindade, H & Rosa, EAS 2014a, 'Distribution of antioxidant compounds in the grain of the Mediterranean rice variety ‘Ariete’', CyTA - Journal of Food, vol. 13, no. 1, 2015/01/02, pp. 140-150.

Goufo, P, Pereira, J, Moutinho-Pereira, J, Correia, CM, Figueiredo, N, Carranca, C, Rosa, EAS & Trindade, H 2014b, 'Rice (Oryza sativa L.) phenolic compounds under elevated carbon dioxide (CO2) concentration', Environmental and Experimental Botany, vol. 99, no. 0, 3//, pp. 28-37.

Goufo, P & Trindade, H 2014, 'Rice antioxidants: phenolic acids, flavonoids, anthocyanins, proanthocyanidins, tocopherols, tocotrienols, gamma-oryzanol, and phytic acid', Food Sci Nutr, vol. 2, no. 2, Mar, pp. 75-104.

Grebenstein, N & Frank, J 2012, 'Rapid baseline-separation of all eight tocopherols and tocotrienols by reversed-phase liquid-chromatography with a solid-core pentafluorophenyl column and their sensitive quantification in plasma and liver', J Chromatogr A, vol. 1243, Jun 22, pp. 39-46.

Gunaratne, A, Wu, K, Li, D, Bentota, A, Corke, H & Cai, Y-Z 2013, 'Antioxidant activity and nutritional quality of traditional red-grained rice varieties containing proanthocyanidins', Food Chemistry, vol. 138, no. 2–3, 6/1/, pp. 1153-1161.

Gupta, A, Naraniwal, M & Kothari, V 2012, 'Modern extraction methods for preparation of bioactive plant extracts', International Academy of Science, Engineering and Technology, vol. 1, no. 1, pp. 8-26.

Ha, T-Y, Ko, S-N, Lee, S-M, Kim, H-R, Chung, S-H, Kim, S-R, Yoon, H-H & Kim, I-H 2006, 'Changes in nutraceutical lipid components of rice at different degrees of milling', European Journal of Lipid Science and Technology, vol. 108, no. 3, pp. 175-181.

Halliwell, B 2009, 'The wanderings of a free radical', Free Radic Biol Med, vol. 46, no. 5, Mar 1, pp. 531-42.

174

Hausenloy, DJ & Yellon, DM 2008, 'Time to take myocardial reperfusion injury seriously', N Engl J Med, vol. 359, no. 5, Jul 31, pp. 518-20.

Havlíková, L & Míková, K 1985, 'Heat Stability of Anthocyanins', Zeitschrift für Lebensmittel-Untersuchung und Forschung, vol. 181, no. 5, 1985/11/01, pp. 427-432.

He, F, Liang, N-N, Mu, L, Pan, Q-H, Wang, J, Reeves, MJ & Duan, C-Q 2012, 'Anthocyanins and Their Variation in Red Wines I. Monomeric Anthocyanins and Their Color Expression', Molecules, vol. 17, no. 2, pp. 1571-1601.

Helmut, S 1994, 'Oxidative Stress', in Trace Elements and Free Radicals in Oxidative Diseases, AOCS Publishing, pp. 1-7.

Henderson, AJ, Ollila, CA, Kumar, A, Borresen, EC, Raina, K, Agarwal, R & Ryan, EP 2012, 'Chemopreventive properties of dietary rice bran: current status and future prospects', Adv Nutr, vol. 3, no. 5, pp. 643-53.

Henryk, Z 2008, 'Tocotrienols', in Tocotrienols, CRC Press, pp. 23-42.

Heo, HJ, Choi, SJ, Choi, SG, Shin, DH, Lee, JM & Lee, CY 2008, 'Effects of banana, orange, and apple on oxidative stress-induced neurotoxicity in PC12 cells', J Food Sci, vol. 73, no. 2, Mar, pp. H28-32.

Herald, TJ, Gadgil, P & Tilley, M 2012, 'High-throughput micro plate assays for screening flavonoid content and DPPH-scavenging activity in sorghum bran and flour', Journal of the Science of Food and Agriculture, vol. 92, no. 11, pp. 2326-2331.

Heuberger, AL, Lewis, MR, Chen, M-H, Brick, MA, Leach, JE & Ryan, EP 2010, 'Metabolomic and Functional Genomic Analyses Reveal Varietal Differences in Bioactive Compounds of Cooked Rice', PLoS ONE, vol. 5, no. 9, p. e12915.

Hirose, M, Takesada, Y, Tanaka, H, Tamano, S, Kato, T & Shirai, T 1998, 'Carcinogenicity of antioxidants BHA, caffeic acid, sesamol, 4-methoxyphenol and catechol at low doses, either alone or in combination, and modulation of their effects in a rat medium-term multi-organ carcinogenesis model', Carcinogenesis, vol. 19, no. 1, Jan, pp. 207-12.

Hodnick, WF, Kung, FS, Roettger, WJ, Bohmont, CW & Pardini, RS 1986, 'Inhibition of mitochondrial respiration and production of toxic oxygen radicals by flavonoids. A structure-activity study', Biochem Pharmacol, vol. 35, no. 14, Jul 15, pp. 2345-57.

Hoffman, DL & Brookes, PS 2009, 'Oxygen sensitivity of mitochondrial reactive oxygen species generation depends on metabolic conditions', J Biol Chem, vol. 284, no. 24, Jun 12, pp. 16236-45.

Hori, M & Nishida, K 2009, Oxidative stress and left ventricular remodelling after myocardial infarction.

175

Hou, Z, Qin, P, Zhang, Y, Cui, S & Ren, G 2013, 'Identification of anthocyanins isolated from black rice (Oryza sativa L.) and their degradation kinetics', Food Research International, vol. 50, no. 2, 3//, pp. 691-697.

Hsieh, TC & Wu, JM 2008, 'Suppression of cell proliferation and gene expression by combinatorial synergy of EGCG, resveratrol and gamma-tocotrienol in estrogen receptor-positive MCF-7 breast cancer cells', Int J Oncol, vol. 33, no. 4, Oct, pp. 851-9.

Hu, C, Zawistowski, J, Ling, W & Kitts, DD 2003, 'Black rice (Oryza sativa L. indica) pigmented fraction suppresses both reactive oxygen species and nitric oxide in chemical and biological model systems', J Agric Food Chem, vol. 51, no. 18, Aug 27, pp. 5271-7.

Huang, S-H & Ng, L-T 2012, 'Quantification of polyphenolic content and bioactive constituents of some commercial rice varieties in Taiwan', Journal of Food Composition and Analysis, vol. 26, no. 1–2, 5//, pp. 122-127.

Hudson, EA, Dinh, PA, Kokubun, T, Simmonds, MSJ & Gescher, A 2000, 'Characterization of Potentially Chemopreventive Phenols in Extracts of Brown Rice That Inhibit the Growth of Human Breast and Colon Cancer Cells', Cancer Epidemiology Biomarkers & Prevention, vol. 9, no. 11, November 1, 2000, pp. 1163-1170.

Hundemer, JK, Nabar, SP, Shriver, BJ & Forman, LP 1991, 'Dietary fiber sources lower blood cholesterol in C57BL/6 mice', J Nutr, vol. 121, no. 9, Sep, pp. 1360-5.

Iloki Assanga, SB, Gil-Salido, AA, Lewis Luján, LM, Rosas-Durazo, A, Acosta-Silva, AL, Rivera-Castañeda, EG & Rubio-Pino, JL 2013, 'Cell growth curves for different cell lines and their relationship with biological activities', International Journal of Biotechnology and Molecular Biology Research, vol. 4, no. 4, pp. 60-70.

Imai, H & Nakagawa, Y 2003, 'Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells', Free Radic Biol Med, vol. 34, no. 2, Jan 15, pp. 145-69.

Irwin, MW, Mak, S, Mann, DL, Qu, R, Penninger, JM, Yan, A, Dawood, F, Wen, WH, Shou, Z & Liu, P 1999, 'Tissue expression and immunolocalization of tumor necrosis factor-alpha in postinfarction dysfunctional myocardium', Circulation, vol. 99, no. 11, Mar 23, pp. 1492-8.

Islam, MS, Matsuki, N, Nagasaka, R, Ohara, K, Takamitsu, H, Ozaki, H, Ushio, H & Hori, M 2014, 'Chapter 34 - Rice Bran Antioxidants in Health and Wellness', in RRWRP Zibadi (ed.) Wheat and Rice in Disease Prevention and Health, Academic Press, San Diego, pp. 443-451.

176

Islam, MS, Murata, T, Fujisawa, M, Nagasaka, R, Ushio, H, Bari, AM, Hori, M & Ozaki, H 2008, 'Anti-inflammatory effects of phytosteryl ferulates in colitis induced by dextran sulphate sodium in mice', Br J Pharmacol, vol. 154, no. 4, Jun, pp. 812-24.

Ito, N, Fukushima, S, Hagiwara, A, Shibata, M & Ogiso, T 1983, 'Carcinogenicity of butylated hydroxyanisole in F344 rats', J Natl Cancer Inst, vol. 70, no. 2, Feb, pp. 343-52.

Ito, N, Fukushima, S & Tsuda, H 1985, 'Carcinogenicity and modification of the carcinogenic response by BHA, BHT, and other antioxidants', Crit Rev Toxicol, vol. 15, no. 2, pp. 109-50.

Jariwalla, RJ 2001, 'Rice-bran products: phytonutrients with potential applications in preventive and clinical medicine', Drugs Exp Clin Res, vol. 27, no. 1, pp. 17-26.

Javadov, S & Karmazyn, M 2007, 'Mitochondrial permeability transition pore opening as an endpoint to initiate cell death and as a putative target for cardioprotection', Cell Physiol Biochem, vol. 20, no. 1-4, pp. 1-22.

Jeng, TL, Shih, YJ, Ho, PT, Lai, CC, Lin, YW, Wang, CS & Sung, JM 2012, 'gamma-Oryzanol, tocol and mineral compositions in different grain fractions of giant embryo rice mutants', J Sci Food Agric, vol. 92, no. 7, May, pp. 1468-74.

Jewett, SL, Rocklin, AM, Ghanevati, M, Abel, JM & Marach, JA 1999, 'A new look at a time-worn system: oxidation of CuZn-SOD by H2O2', Free Radic Biol Med, vol. 26, no. 7-8, Apr, pp. 905-18.

Jia, Z, Tang, M & Wu, J 1999, 'The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals', Food Chemistry, vol. 64, no. 4, 3//, pp. 555-559.

Jiang, J, Yu, S, Jiang, Z, Liang, C, Yu, W, Li, J, Du, X, Wang, H, Gao, X & Wang, X 2014, 'N-Acetyl-Serotonin Protects HepG2 Cells from Oxidative Stress Injury Induced by Hydrogen Peroxide', Oxidative Medicine and Cellular Longevity, vol. 2014, p. 15.

Jin Son, M, W. Rico, C, Hyun Nam, S & Young Kang, M 2010, 'Influence of Oryzanol and Ferulic Acid on the Lipid Metabolism and Antioxidative Status in High Fat-Fed Mice', Journal of Clinical Biochemistry and Nutrition, vol. 46, no. 2, pp. 150-156.

Juliano, C, Cossu, M, Alamanni, MC & Piu, L 2005, 'Antioxidant activity of gamma-oryzanol: mechanism of action and its effect on oxidative stability of pharmaceutical oils', Int J Pharm, vol. 299, no. 1-2, Aug 11, pp. 146-54.

177

Justo, ML, Candiracci, M, Dantas, AP, de Sotomayor, MA, Parrado, J, Vila, E, Herrera, MD & Rodriguez-Rodriguez, R 2013, 'Rice bran enzymatic extract restores endothelial function and vascular contractility in obese rats by reducing vascular inflammation and oxidative stress', The Journal of Nutritional Biochemistry, vol. 24, no. 8, 8//, pp. 1453-1461.

Kamal-Eldi, A, Gorgen, S, Pettersson, J & Lampi, AM 2000, 'Normal-phase high-performance liquid chromatography of tocopherols and tocotrienols. Comparison of different chromatographic columns', J Chromatogr A, vol. 881, no. 1-2, Jun 9, pp. 217-27.

Kamaraj, S, Vinodhkumar, R, Anandakumar, P, Jagan, S, Ramakrishnan, G & Devaki, T 2007, 'The effects of quercetin on antioxidant status and tumor markers in the lung and serum of mice treated with benzo(a)pyrene', Biol Pharm Bull, vol. 30, no. 12, Dec, pp. 2268-73.

Kaneko, R & Tsuchiya, T 1954, 'New compound in rice bran and germ oils', Journal of Chemistry Society of Japan, vol. 57, p. 526.

Kang, DH & Kang, SW 2013, 'Targeting Cellular Antioxidant Enzymes for Treating Atherosclerotic Vascular Disease', Biomolecules & Therapeutics, vol. 21, no. 2, 3 December, pp. 89-96.

Kashiwagi, K, Harada, K, Yano, Y, Kumadaki, I, Hagiwara, K, Takebayashi, J, Kido, W, Virgona, N & Yano, T 2008, 'A redox-silent analogue of tocotrienol inhibits hypoxic adaptation of lung cancer cells', Biochemical and Biophysical Research Communications, vol. 365, no. 4, pp. 875-881.

Kedare, SB & Singh, RP 2011, 'Genesis and development of DPPH method of antioxidant assay', Journal of food science and technology, vol. 48, no. 4, pp. 412-422.

Kiing, SC, Yiu, PH, Rajan, A & Wong, SC 2009, 'Effect of germination on γ-oryzanol content of selected Sarawak rice cultivars', American Journal of Applied Science, vol. 6, no. 9, pp. 1658-1661.

Kim, J-S & Godber, JS 2001, 'Oxidative stability and vitamin E levels increased in restructed beef roasts with added rice bran oil ', Journal of Food Quality, vol. 24, no. 1, pp. 17-26.

Kim, JK, Lee, SY, Chu, SM, Lim, SH, Suh, SC, Lee, YT, Cho, HS & Ha, SH 2010, 'Variation and correlation analysis of flavonoids and carotenoids in Korean pigmented rice (Oryza sativa L.) cultivars', J Agric Food Chem, vol. 58, no. 24, Dec 22, pp. 12804-9.

Kim, SP, Kang, MY, Nam, SH & Friedman, M 2012, 'Dietary rice bran component gamma-oryzanol inhibits tumor growth in tumor-bearing mice', Mol Nutr Food Res, vol. 56, no. 6, Jun, pp. 935-44.

178

Kohen, R & Nyska, A 2002, 'Oxidation of biological systems: oxidative stress phenomena, antioxidants, redox reactions, and methods for their quantification', Toxicol Pathol, vol. 30, no. 6, Nov-Dec, pp. 620-50.

Kokoszka, JE, Coskun, P, Esposito, LA & Wallace, DC 2001, 'Increased mitochondrial oxidative stress in the Sod2 (1y2) mouse results in the age-related decline of mitochondrial function culminating in increased apoptosis', Proceedings of the National Academy of Sciences, vol. 98, no. 5, pp. 2278-2283.

Kozuka, C, Yabiku, K, Sunagawa, S, Ueda, R, Taira, S, Ohshiro, H, Ikema, T, Yamakawa, K, Higa, M, Tanaka, H, Takayama, C, Matsushita, M, Oyadomari, S, Shimabukuro, M & Masuzaki, H 2012, 'Brown rice and its component, gamma-oryzanol, attenuate the preference for high-fat diet by decreasing hypothalamic endoplasmic reticulum stress in mice', Diabetes, vol. 61, no. 12, Dec, pp. 3084-93.

Kozuka, C, Yabiku, K, Takayama, C, Matsushita, M, Shimabukuro, M & Masuzaki, H 2013, 'Natural food science based novel approach toward prevention and treatment of obesity and type 2 diabetes: Recent studies on brown rice and γ-oryzanol', Obesity Research & Clinical Practice, vol. 7, no. 3, 5//, pp. e165-e172.

Krishnamurthy, P & Wadhwani, A 2012, in Antioxidant Enzymes and Human Health(ed MA El-Missiry) InTech, Croatia.

Kuhad, A & Chopra, K 2009, 'Attenuation of diabetic nephropathy by tocotrienol: Involvement of NFkB signaling pathway', Life Sciences, vol. 84, no. 9–10, pp. 296-301.

Kunwar, A & Priyadarsini, KI 2011, 'Free radicals, oxidative stress and importance of antioxidants in human health', Journal of Medical and Allied Sciences, vol. 1, no. 2, pp. 53-60.

Lambert, JD & Elias, RJ 2010, 'The antioxidant and pro-oxidant activities of green tea polyphenols: a role in cancer prevention', Arch Biochem Biophys, vol. 501, no. 1, Sep 1, pp. 65-72.

Lee, JM 2005, 'Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study', Journal of AOAC International, vol. 88, no. 5, pp. 1269-1278.

Lee, S-M, Choi, Y, Sung, J, Kim, Y, Jeong, H-S & Lee, J 2014, 'Protective Effects of Black Rice Extracts on Oxidative Stress Induced by tert-Butyl Hydroperoxide in HepG2 Cells', Preventive Nutrition and Food Science, vol. 19, no. 4, 31 October, pp. 348-352.

179

Lee, S-P, Mar, G-Y & Ng, L-T 2009, 'Effects of tocotrienol-rich fraction on exercise endurance capacity and oxidative stress in forced swimming rats', European Journal of Applied Physiology, vol. 107, no. 5, 2009/11/01, pp. 587-595.

Lee, S, Tak, E, Lee, J, Rashid, MA, Murphy, MP, Ha, J & Kim, SS 2011, 'Mitochondrial H(2)O(2) generated from electron transport chain complex I stimulates muscle differentiation', Cell Research, vol. 21, no. 5, 20 October, pp. 817-834.

Lemus, C, Angelis, A, Halabalaki, M & Skaltsounis, AL 2014, 'Chapter 32 - γ-Oryzanol: An Attractive Bioactive Component from Rice Bran', in RR Watson, VR Preedy and S Zibadi (eds), Wheat and Rice in Disease Prevention and Health, Academic Press, San Diego, pp. 409-430.

Leone, M, Cupane, A, Militello, V, Stroppolo, ME & Desideri, A 1998, 'Fourier Transform Infrared Analysis of the Interaction of Azide with the Active Site of Oxidized and Reduced Bovine Cu,Zn Superoxide Dismutase', Biochemistry, vol. 37, no. 13, 1998/03/01, pp. 4459-4464.

Lester, GE, Lewers, KS, Medina, MB & Saftner, RA 2012, 'Comparative analysis of strawberry total phenolics via Fast Blue BB vs. Folin–Ciocalteu: Assay interference by ascorbic acid', Journal of Food Composition and Analysis, vol. 27, no. 1, 8//, pp. 102-107.

Li, H, Deng, Z, Liu, R, Loewen, S & Tsao, R 2013, 'Carotenoid compositions of coloured tomato cultivars and contribution to antioxidant activities and protection against H2O2-induced cell death in H9c2', Food Chemistry, vol. 136, no. 2, 1/15/, pp. 878-888.

Li, Y & Schellhorn, HE 2007, 'New developments and novel therapeutic perspectives for vitamin C', J Nutr, vol. 137, no. 10, Oct, pp. 2171-84.

Lieberthal, W, Menza, SA & Levine, JS 1998, 'Graded ATP depletion can cause necrosis or apoptosis of cultured mouse proximal tubular cells', Am J Physiol, vol. 274, no. 2 Pt 2, Feb, pp. F315-27.

Ling, WH, Cheng, QX, Ma, J & Wang, T 2001, 'Red and Black Rice Decrease Atherosclerotic Plaque Formation and Increase Antioxidant Status in Rabbits', The Journal of Nutrition, vol. 131, no. 5, May 1, 2001, pp. 1421-1426.

Lip, GYH & Hall, JE 2007, Comprehensive Hypertension, Elsevier Health Sciences.

Litwack, G 2007, Vitamin E, Elsevier Science.

Liva, H 2008, 'Tocotrienols in Plants', in Tocotrienols, CRC Press, pp. 43-60.

Lönn, ME, Dennis, JM & Stocker, R 2012, 'Actions of “antioxidants” in the protection against atherosclerosis', Free Radical Biology and Medicine, vol. 53, no. 4, pp. 863-884.

180

Luqman, S & Rizvi, SI 2006, 'Protection of lipid peroxidation and carbonyl formation in proteins by capsaicin in human erythrocytes subjected to oxidative stress', Phytother Res, vol. 20, no. 4, Apr, pp. 303-6.

Lusis, AJ 2000, 'Atherosclerosis', Nature, vol. 407, no. 6801, 09/14/print, pp. 233-241.

Ma, X, Zhang, K, Li, H, Han, S, Ma, Z & Tu, P 2013, 'Extracts from Astragalus membranaceus limit myocardial cell death and improve cardiac function in a rat model of myocardial ischemia', Journal of Ethnopharmacology, vol. 149, no. 3, 10/7/, pp. 720-728.

Magalhaes, AS, Silva, BM, Pereira, JA, Andrade, PB, Valentao, P & Carvalho, M 2009, 'Protective effect of quince (Cydonia oblonga Miller) fruit against oxidative hemolysis of human erythrocytes', Food Chem Toxicol, vol. 47, no. 6, Jun, pp. 1372-7.

Makino, N, Mochizuki, Y, Bannai, S & Sugita, Y 1994, 'Kinetic studies on the removal of extracellular hydrogen peroxide by cultured fibroblasts', Journal of Biological Chemistry, vol. 269, no. 2, January 14, 1994, pp. 1020-5.

Malta, LG & Liu, RH 2014, 'Analyses of Total Phenolics, Total Flavonoids, and Total Antioxidant Activities in Foods and Dietary Supplements', in NKV Alfen (ed.) Encyclopedia of Agriculture and Food Systems, Academic Press, Oxford, pp. 305-314.

Manach, C, Scalbert, A, Morand, C, Rémésy, C & Jiménez, L 2004, 'Polyphenols: food sources and bioavailability', The American Journal of Clinical Nutrition, vol. 79, no. 5, May 1, 2004, pp. 727-747.

Markus, MA & Morris, BJ 2008, 'Resveratrol in prevention and treatment of common clinical conditions of aging', Clin Interv Aging, vol. 3, no. 2, pp. 331-9.

Matsui, T, Ebuchi, S, Kobayashi, M, Fukui, K, Sugita, K, Terahara, N & Matsumoto, K 2002, 'Anti-hyperglycemic effect of diacylated anthocyanin derived from Ipomoea batatas cultivar Ayamurasaki can be achieved through the alpha-glucosidase inhibitory action', J Agric Food Chem, vol. 50, no. 25, Dec 4, pp. 7244-8.

McBride, AG, Borutaite, V & Brown, GC 1999, 'Superoxide dismutase and hydrogen peroxide cause rapid nitric oxide breakdown, peroxynitrite production and subsequent cell death', Biochim Biophys Acta, vol. 1454, no. 3, Aug 30, pp. 275-88.

Meier, B, Scherk, C, Schmidt, M & Parak, F 1998, 'pH-dependent inhibition by azide and fluoride of the iron superoxide dismutase from Propionibacterium shermanii', Biochemical Journal, vol. 331, pp. 403-407.

181

Metodiewa, D, Jaiswal, AK, Cenas, N, Dickancaite, E & Segura-Aguilar, J 1999, 'Quercetin may act as a cytotoxic prooxidant after its metabolic activation to semiquinone and quinoidal product', Free Radic Biol Med, vol. 26, no. 1-2, Jan, pp. 107-16.

Meyer, ABS & Meyer, ABS 2005, 'Enzymatic upgrading of antioxidant phenolics in berry juice and in press residues', Fruit Processing, vol. 6, pp. 382-387.

Miller, A & Engel, KH 2006, 'Content of gamma-oryzanol and composition of steryl ferulates in brown rice (Oryza sativa L.) of European origin', J Agric Food Chem, vol. 54, no. 21, Oct 18, pp. 8127-33.

Miller, A, Frenzel, T, Schmarr, HG & Engel, KH 2003, 'Coupled liquid chromatography-gas chromatography for the rapid analysis of gamma-oryzanol in rice lipids', J Chromatogr A, vol. 985, no. 1-2, Jan 24, pp. 403-10.

Milne, JC, Lambert, PD, Schenk, S, Carney, DP, Smith, JJ, Gagne, DJ, Jin, L, Boss, O, Perni, RB, Vu, CB, Bemis, JE, Xie, R, Disch, JS, Ng, PY, Nunes, JJ, Lynch, AV, Yang, H, Galonek, H, Israelian, K, Choy, W, Iffland, A, Lavu, S, Medvedik, O, Sinclair, DA, Olefsky, JM, Jirousek, MR, Elliott, PJ & Westphal, CH 2007, 'Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes', Nature, vol. 450, no. 7170, Nov 29, pp. 712-6.

Min, B, McClung, AM & Chen, MH 2011, 'Phytochemicals and antioxidant capacities in rice brans of different color', J Food Sci, vol. 76, no. 1, Jan-Feb, pp. C117-26.

Mireia, U-S, Joseph, R, Christine, M & Claudine, M 2012, 'Bioavailability of Flavanones', in Flavonoids and Related Compounds, CRC Press.

Mohanlal, S, Parvathy, R, Shalini, V, Mohanan, R, Helen, A & Jayalekshmy, A 2013, 'Chemical indices, antioxidant activity and anti-inflammatory effect of extracts of the medicinal rice "Njavara" and staple varieties: a comparative study ', Journal of Food Biochemistry, vol. 37, no. 3, pp. 369-380.

Morais, H, Ramos, C, Forgasc, E, Cserháti, T, Matos, N, Almeida, V & Oliveira, J 2002, 'Stability of anthocyanins extracted from grape skins', Chromatographia, vol. 56, no. 1, 2002/01/01, pp. S173-S175.

Moreno, AO, Dorantes, L, Galindez, J & Guzman, RI 2003, 'Effect of different extraction methods on fatty acids, volatile compounds, and physical and chemical properties of avocado (Persea americana Mill.) oil', J Agric Food Chem, vol. 51, no. 8, Apr 9, pp. 2216-21.

Most, MM, Tulley, R, Morales, S & Lefevre, M 2005, 'Rice bran oil, not fiber, lowers cholesterol in humans', Am J Clin Nutr, vol. 81, no. 1, Jan, pp. 64-8.

Muid, S, Ali, AM, Yusoff, K & Nawawi, H 2013, 'Optimal antioxidant activity with moderate concentrations of tocotrienol rich fraction (TRF) in in vitro assays', International Food Research Journal, vol. 20, no. 2, pp. 687-694.

182

Mukhopadhyay, M 2000, 'Natural Antioxidants', in Natural Extracts Using Supercritical Carbon Dioxide, CRC Press, pp. 225-248.

Muntana, N & Prasong, S 2010, 'Study on total phenolic contents and their antioxidant activities of Thai white, red and black rice bran extracts', Pak J Biol Sci, vol. 13, no. 4, Feb 15, pp. 170-4.

Nagendra Prasad, M, Sanjay, K, Shravya Khatokar, M, Vismaya, M & Nanjunda Swamy, S 2011, 'Health Benefits of Rice Bran - A Review', Journal of Nutrition & Food Sciences, 2011 Sep 22

Naidu, KA 2003, 'Vitamin C in human health and disease is still a mystery? An overview', Nutr J, vol. 2, Aug 21, p. 7.

Nanua, JN, McGregor, JU & Godber, JS 2000, 'Influence of high-oryzanol rice bran oil on the oxidative stability of whole milk powder', J Dairy Sci, vol. 83, no. 11, Nov, pp. 2426-31.

Navindra, PS 2010, 'Polyphenols Overview', in Encyclopedia of Dietary Supplements, Second Edition, CRC Press, pp. 632-634.

Newaz, MA & Nawal, NN 1999, 'Effect of gamma-tocotrienol on blood pressure, lipid peroxidation and total antioxidant status in spontaneously hypertensive rats (SHR)', Clin Exp Hypertens, vol. 21, no. 8, Nov, pp. 1297-313.

Nian, M, Lee, P, Khaper, N & Liu, P 2004, 'Inflammatory cytokines and postmyocardial infarction remodeling', Circ Res, vol. 94, no. 12, Jun 25, pp. 1543-53.

Nindl, G, Peterson, NR, Hughes, EF, Waite, LR & Johnson, MT 2004, 'Effect of hydrogen peroxide on proliferation, apoptosis and interleukin-2 production of Jurkat T cells', Biomed Sci Instrum, vol. 40, pp. 123-8.

Nishikawa, M, Tamada, A, Kumai, H, Yamashita, F & Hashida, M 2002, 'Inhibition of experimental pulmonary metastasis by controlling biodistribution of catalase in mice', Int J Cancer, vol. 99, no. 3, May 20, pp. 474-9.

Noaman, E, Badr El-Din, NK, Bibars, MA, Abou Mossallam, AA & Ghoneum, M 2008, 'Antioxidant potential by arabinoxylan rice bran, MGN-3/biobran, represents a mechanism for its oncostatic effect against murine solid Ehrlich carcinoma', Cancer Lett, vol. 268, no. 2, Sep 18, pp. 348-59.

Noori, S 2012, 'An overview of oxidative stress and antioxidant defensive system', Open Access Scientific Reports, vol. 1, no. 8

Ondier, GO, Siebenmorgen, T & Mauromoustakos, A 2012, 'Drying Characteristics and Milling Quality of Rough Rice Dried in a Single Pass Incorporating Glass Transition Principles', Drying Technology, vol. 30, no. 16, 2012/12/15, pp. 1821-1830.

183

Pandey, KB & Rizvi, SI 2009, 'Plant polyphenols as dietary antioxidants in human health and disease', Oxid Med Cell Longev, vol. 2, no. 5, Nov-Dec, pp. 270-8.

Pandey, KB & Rizvi, SI 2010, 'Protective effect of resveratrol on markers of oxidative stress in human erythrocytes subjected to in vitro oxidative insult', Phytother Res, vol. 24 Suppl 1, Jan, pp. S11-4.

Panfili, G, Fratianni, A & Irano, M 2003, 'Normal phase high-performance liquid chromatography method for the determination of tocopherols and tocotrienols in cereals', J Agric Food Chem, vol. 51, no. 14, Jul 2, pp. 3940-4.

Papa, L, Hahn, M, Marsh, EL, Evans, BS & Germain, D 2014, 'SOD2 to SOD1 switch in breast cancer', Journal of Biological Chemistry, January 21, 2014

Parvathy, R, Mohanlal, S, Pushpan, C, Helen, A & Jayalekshmy, A 2014, 'Antioxidant properties, anti-inflammatory effects, and bioactive constituents of the Indian medicinal rice Njavara yellow compared with staple varieties', Food Science and Biotechnology, vol. 23, no. 5, 2014/10/01, pp. 1379-1388.

Pękal, A & Pyrzynska, K 2014, 'Evaluation of Aluminium Complexation Reaction for Flavonoid Content Assay', Food Analytical Methods, vol. 7, no. 9, 2014/10/01, pp. 1776-1782.

Pellegrini, N, Serafini, M, Salvatore, S, Del Rio, D, Bianchi, M & Brighenti, F 2006, 'Total antioxidant capacity of spices, dried fruits, nuts, pulses, cereals and sweets consumed in Italy assessed by three different in vitro assays', Mol Nutr Food Res, vol. 50, no. 11, Nov, pp. 1030-8.

Pham-Huy, LA, He, H & Pham-Huy, C 2008, 'Free Radicals, Antioxidants in Disease and Health', International Journal of Biomedical Science : IJBS, vol. 4, no. 2, 5 May, pp. 89-96.

Pietta, P-G 2000, 'Flavonoids as Antioxidants', Journal of Natural Products, vol. 63, no. 7, 2000/07/01, pp. 1035-1042.

Pirola, L & Frojdo, S 2008, 'Resveratrol: one molecule, many targets', IUBMB Life, vol. 60, no. 5, May, pp. 323-32.

Pisoschi, AM, Cheregi, MC & Danet, AF 2009, 'Total antioxidant capacity of some commercial fruit juices: electrochemical and spectrophotometrical approaches', Molecules, vol. 14, no. 1, pp. 480-93.

Pyrzynska, K & Pekal, A 2013, 'Application of free radical diphenylpicrylhydrazyl (DPPH) to estimate the antioxidant capacity of food samples', Analytical Methods, vol. 5, no. 17, pp. 4288-4295.

Qiagen 2011, 'QuantiFast® SYBR® Green RT-PCR Handbook ', For fast, quantitative, real-time, one-step RT-PCR using SYBR Green I

184

Quillard, T & Libby, P 2012a, 'Molecular imaging of atherosclerosis for improving diagnostic and therapeutic development' National Center for Biotechnology Information, U.S. National Library of Medicine, viewed 21 April 2015, <http://circres.ahajournals.org/content/111/2/231.long>.

Quillard, T & Libby, P 2012b, 'Molecular Imaging of Atherosclerosis for Improving Diagnostic and Therapeutic Development', Circulation Research, vol. 111, no. 2, July 6, 2012, pp. 231-244.

Qureshi, AA, Bradlow, BA, Brace, L, Manganello, J, Peterson, DM, Pearce, BC, Wright, JJ, Gapor, A & Elson, CE 1995, 'Response of hypercholesterolemic subjects to administration of tocotrienols', Lipids, vol. 30, no. 12, Dec, pp. 1171-7.

Qureshi, AA, Burger, WC, Peterson, DM & Elson, CE 1986, 'The structure of an inhibitor of cholesterol biosynthesis isolated from barley', J Biol Chem, vol. 261, no. 23, Aug 15, pp. 10544-50.

Qureshi, AA, Mo, H, Packer, L & Peterson, DM 2000, 'Isolation and identification of novel tocotrienols from rice bran with hypocholesterolemic, antioxidant, and antitumor properties', J Agric Food Chem, vol. 48, no. 8, Aug, pp. 3130-40.

Qureshi, AA, Qureshi, N, Hasler-Rapacz, JO, Weber, FE, Chaudhary, V, Crenshaw, TD, Gapor, A, Ong, AS, Chong, YH & Peterson, D 1991, 'Dietary tocotrienols reduce concentrations of plasma cholesterol, apolipoprotein B, thromboxane B2, and platelet factor 4 in pigs with inherited hyperlipidemias', The American Journal of Clinical Nutrition, vol. 53, no. 4, April 1, 1991, pp. 1042S-1046S.

Radi, R, Rodriguez, M, Castro, L & Telleri, R 1994, 'Inhibition of mitochondrial electron transport by peroxynitrite', Arch Biochem Biophys, vol. 308, no. 1, Jan, pp. 89-95.

Randall, JM, Sayre, RN, Schultz, WG, Fong, RY, Mossman, AP, Tribelhorn, RE & Saunders, RM 1985, 'Rice Bran Stabilization by Extrusion Cooking for Extraction of Edible Oil', Journal of Food Science, vol. 50, no. 2, pp. 361-364.

Rao, A, Reddy, S, Babu, P & Reddy, A 2010, 'The antioxidant and antiproliferative activities of methanolic extracts from Njavara rice bran', BMC Complementary and Alternative Medicine, vol. 10, no. 1, p. 4.

Renuka Devi, R & Arumughan, C 2007, 'Antiradical efficacy of phytochemical extracts from defatted rice bran', Food Chem Toxicol, vol. 45, no. 10, Oct, pp. 2014-21.

Robaszkiewicz, A, Balcerczyk, A & Bartosz, G 2007, 'Antioxidative and prooxidative effects of quercetin on A549 cells', Cell Biol Int, vol. 31, no. 10, Oct, pp. 1245-50.

185

Rodrigo, R & Gil-Becerra, D 2014, 'Chapter 17 - Implications of Polyphenols on Endogenous Antioxidant Defense Systems in Human Diseases', in RR Watson, VR Preedy and S Zibadi (eds), Polyphenols in Human Health and Disease, Academic Press, San Diego, pp. 201-217.

Rodrigo, R, Libuy, M, Feliu, F & Hasson, D 2013, 'Oxidative stress-related biomarkers in essential hypertension and ischemia-reperfusion myocardial damage', Dis Markers, vol. 35, no. 6, pp. 773-90.

Romero-Pérez, AI, Lamuela-Raventós, RM, Andrés-Lacueva, C & de la Torre-Boronat, MC 2000, 'Method for the Quantitative Extraction of Resveratrol and Piceid Isomers in Grape Berry Skins. Effect of Powdery Mildew on the Stilbene Content', Journal of Agricultural and Food Chemistry, vol. 49, no. 1, 2001/01/01, pp. 210-215.

Romier, B, Van De Walle, J, During, A, Larondelle, Y & Schneider, YJ 2008, 'Modulation of signalling nuclear factor-kappaB activation pathway by polyphenols in human intestinal Caco-2 cells', Br J Nutr, vol. 100, no. 3, Sep, pp. 542-51.

Rong, N, Ausman, LM & Nicolosi, RJ 1997, 'Oryzanol decreases cholesterol absorption and aortic fatty streaks in hamsters', Lipids, vol. 32, no. 3, Mar, pp. 303-9.

Rossi, L, Mazzitelli, S, Arciello, M, Capo, CR & Rotilio, G 2008, 'Benefits from dietary polyphenols for brain aging and Alzheimer's disease', Neurochem Res, vol. 33, no. 12, Dec, pp. 2390-400.

Rostagno, MA & Prado, JM 2013, Natural Product Extraction: Principles and Applications, Royal Society of Chemistry.

Ruekeith, GO 2013, 'Worrying statistics on heart diseases', The Borneo Post,

Sagach, VF, Scrosati, M, Fielding, J, Rossoni, G, Galli, C & Visioli, F 2002, 'The water-soluble vitamin E analogue Trolox protects against ischaemia/reperfusion damage in vitro and ex vivo. A comparison with vitamin E', Pharmacol Res, vol. 45, no. 6, Jun, pp. 435-9.

Scalbert, A, Johnson, IT & Saltmarsh, M 2005, 'Polyphenols: antioxidants and beyond', The American Journal of Clinical Nutrition, vol. 81, no. 1, January 1, 2005, pp. 215S-217S.

Scalbert, A, Manach, C, Morand, C, Remesy, C & Jimenez, L 2005, 'Dietary polyphenols and the prevention of diseases', Crit Rev Food Sci Nutr, vol. 45, no. 4, pp. 287-306.

Schafer, FQ & Buettner, GR 2001, 'Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple', Free Radic Biol Med, vol. 30, no. 11, Jun 1, pp. 1191-212.

186

Schramm, R, Abadie, A, Hua, N, Xu, Z & Lima, M 2007, 'Fractionation of the rice bran layer and quantification of vitamin E, oryzanol, protein, and rice bran saccharide', Journal of Biological Engineering, vol. 1, 28 December, pp. 9-9.

Schreck, R & Baeuerle, PA 1991, 'A role for oxygen radicals as second messengers', Trends in Cell Biology, vol. 1, no. 2–3, 8//, pp. 39-42.

Seetharamaiah, GS & Chandrasekhara, N 1989, 'Studies on hypocholesterolemic activity of rice bran oil', Atherosclerosis, vol. 78, no. 2-3, Aug, pp. 219-23.

Sen, CK, Khanna, S & Roy, S 2004, 'Tocotrienol: The Natural Vitamin E to Defend the Nervous System?', Annals of the New York Academy of Sciences, vol. 1031, no. 1, pp. 127-142.

Sen, CK, Khanna, S & Roy, S 2006, 'Tocotrienols: Vitamin E beyond tocopherols', Life Sciences, vol. 78, no. 18, pp. 2088-2098.

Sen, CK, Khanna, S, Roy, S & Packer, L 2000, 'Molecular Basis of Vitamin E Action: Tocotrienol potentialy inhibits glutamate-induced pp60c-Src kinase activation and death of HT4 neuronal cells', Journal of Biological Chemistry, vol. 275, no. 17, April 28, 2000, pp. 13049-13055.

Seo, W, Kim, J, Song, Y-C, Cho, J-H, Jang, K, Han, S-I, Ra, J-E, Oh, S-H, Kang, H-J, Kim, B-J, Baek, N-I, Jeong, R-H & Nam, M 2013, 'Comparative analysis of physicochemicals and antioxidative properties in new red rice (Oryza sativa L. cv. Gunganghongmi)', Journal of Crop Science and Biotechnology, vol. 16, no. 1, 2013/03/01, pp. 63-68.

Serbinova, E, Kagan, V, Han, D & Packer, L 1991, 'Free radical recycling and intramembrane mobility in the antioxidant properties of alpha-tocopherol and alpha-tocotrienol', Free Radic Biol Med, vol. 10, no. 5, pp. 263-75.

Shao, Y, Xu, F, Sun, X, Bao, J & Beta, T 2014, 'Identification and quantification of phenolic acids and anthocyanins as antioxidants in bran, embryo and endosperm of white, red and black rice kernels (Oryza sativa L.)', Journal of Cereal Science, vol. 59, no. 2, 3//, pp. 211-218.

Sharma, OP & Bhat, TK 2009, 'DPPH antioxidant assay revisited', Food Chemistry, vol. 113, no. 4, 4/15/, pp. 1202-1205.

Sharma, V & Rao, LJ 2009, 'A thought on the biological activities of black tea', Crit Rev Food Sci Nutr, vol. 49, no. 5, May, pp. 379-404.

Sheffield, JB & Hilfer, SR 2012, The Microenvironment and Vision, Springer New York.

Shen, Y, Jin, L, Xiao, P, Lu, Y & Bao, J 2009, 'Total phenolics, flavonoids, antioxidant capacity in rice grain and their relations to grain color, size and weight', Journal of Cereal Science, vol. 49, no. 1, 1//, pp. 106-111.

187

Sheng, R, Gu, ZL, Xie, ML, Zhou, WX & Guo, CY 2010, 'Epigallocatechin gallate protects H9c2 cardiomyoblasts against hydrogen dioxides- induced apoptosis and telomere attrition', Eur J Pharmacol, vol. 641, no. 2-3, Sep 1, pp. 199-206.

Sigma-Aldrich 2010, Fundamental Techniques in Cell Culture Laboratory Handbook, 2nd edn, Sigma-Aldrich

Singh, RP & Chakraverty, A 2014, 'Rice Bran', in Postharvest Technology and Food Process Engineering, CRC Press.

Singh, U & Jialal, I 2006, 'Oxidative stress and atherosclerosis', Pathophysiology, vol. 13, no. 3, 8//, pp. 129-142.

Singleton, VL & Rossi, JA 1965, 'Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents', American Journal of Enology and Viticulture, vol. 16, no. 3, January 1, 1965, pp. 144-158.

Sirikul, A, Moongngarm, A & Khaengkhan, P 2009, 'Comparison of proximate composition, bioactive compounds and antioxidant activity of rice bran and defatted rice bran from organic rice and conventional rice ', Asian Journal of Food and Agro-Industry, vol. 2, no. 4, pp. 731-743.

Slater, TF 1984, 'Free-radical mechanisms in tissue injury', Biochemical Journal, vol. 222, no. 1, pp. 1-15.

Sompong, R, Siebenhandl-Ehn, S, Linsberger-Martin, G & Berghofer, E 2011, 'Physicochemical and antioxidative properties of red and black rice varieties from Thailand, China and Sri Lanka', Food Chemistry, vol. 124, no. 1, 1/1/, pp. 132-140.

Son, MJ, Rico, CW, Nam, SH & Kang, MY 2011, 'Effect of oryzanol and ferulic acid on the glucose metabolism of mice fed with a high-fat diet', J Food Sci, vol. 76, no. 1, Jan-Feb, pp. H7-h10.

Steinberg, D, Parthasarathy, S, Carew, TE, Khoo, JC & Witztum, JL 1989, 'Beyond Cholesterol', New England Journal of Medicine, vol. 320, no. 14, pp. 915-924.

Stocker, R & Keaney, JF, Jr. 2004, 'Role of oxidative modifications in atherosclerosis', Physiol Rev, vol. 84, no. 4, Oct, pp. 1381-478.

Stone, JR & Yang, S 2006, 'Hydrogen peroxide: a signaling messenger', Antioxid Redox Signal, vol. 8, no. 3-4, Mar-Apr, pp. 243-70.

Stratil, P, Klejdus, B & Kubáň, V 2007, 'Determination of phenolic compounds and their antioxidant activity in fruits and cereals', Talanta, vol. 71, no. 4, 3/15/, pp. 1741-1751.

188

Surarit, W, Jansom, C, Lerdvuthisopon, N, Kongkham, S & Hansakul, P 2015, 'Evaluation of antioxidant activities and phenolic subtype contents of ethanolic bran extracts of Thai pigmented rice varieties through chemical and cellular assays', International Journal of Food Science & Technology, vol. 50, no. 4, pp. 990-998.

Suzuki, YJ, Tsuchiya, M, Wassall, SR, Choo, YM, Govil, G, Kagan, VE & Packer, L 1993, 'Structural and dynamic membrane properties of .alpha.-tocopherol and .alpha.-tocotrienol: Implication to the molecular mechanism of their antioxidant potency', Biochemistry, vol. 32, no. 40, 1993/10/01, pp. 10692-10699.

Swaminathan, MS & Rao, SA 2008, 'Rice for Sustainable Food and Nutritions Security', in Rice Improvement in the Genomics Era, CRC Press, pp. 375-415.

Swirski, FK & Nahrendorf, M 2013, 'Leukocyte Behavior in Atherosclerosis, Myocardial Infarction, and Heart Failure', Science, vol. 339, no. 6116, January 11, 2013, pp. 161-166.

Talwinder, SK 2009, 'Rice Bran', in Fiber Ingredients, CRC Press.

Tan, B 2005, 'Appropriate spectrum vitamin E and new perspectives on desmethyl tocopherols and tocotrienols', Journal of American Nutraceutical Association, vol. 8, pp. 35-42.

Tanaka, T & Takahashi, R 2013, 'Flavonoids and Asthma', Nutrients, vol. 5, no. 6, pp. 2128-2143.

Teo, GK 2000, 'Rice biodiversity of Sarawak,' Internationational Biodiversity Conference, 1-3.

Toh, B-H, Kyaw, T, Tipping, P & Bobik, A 2014, 'Chapter 71 - Atherosclerosis', in NRRR Mackay (ed.) The Autoimmune Diseases (Fifth Edition), Academic Press, Boston, pp. 1049-1066.

Trachootham, D, Lu, W, Ogasawara, MA, Valle, NR-D & Huang, P 2008, 'Redox Regulation of Cell Survival', Antioxidants & Redox Signaling, vol. 10, no. 8, 6 February, pp. 1343-1374.

Tsuda, T, Horio, F, Kato, Y & Osawa, T 2002a, 'Cyanidin 3-O-beta-D-glucoside attenuates the hepatic ischemia-reperfusion injury through a decrease in the neutrophil chemoattractant production in rats', J Nutr Sci Vitaminol (Tokyo), vol. 48, no. 2, Apr, pp. 134-41.

Tsuda, T, Horio, F, Kato, Y & Osawa, T 2002b, 'Cyanidin 3-O-beta-D-glucoside attenuates the hepatic ischemia-reperfusion injury through a decrease in the neutrophil chemoattractant production in rats', J Nutr Sci Vitaminol (Tokyo), vol. 48, no. 2, pp. 134-141.

Valko, M, Leibfritz, D, Moncol, J, Cronin, MT, Mazur, M & Telser, J 2007, 'Free radicals and antioxidants in normal physiological functions and human disease', Int J Biochem Cell Biol, vol. 39, no. 1, pp. 44-84.

189

Van Hoed, V, Depaemelaere, G, Ayala, JV, Santiwattana, P, Verhe, R & De Greyt, W 2006, 'Influence of chemical refining on the major and minor components of rice brain oil', Journal of the American Oil Chemists' Society, vol. 83, no. 4, 2006/04/01, pp. 315-321.

Vance, CK & Miller, A-F 1998, 'Spectroscopic Comparisons of the pH Dependencies of Fe-Substituted (Mn)Superoxide Dismutase and Fe-Superoxide Dismutase', Biochemistry, vol. 37, no. 16, 1998/04/01, pp. 5518-5527.

Vasanthi, HR, Parameswari, RP & Das, DK 2012, 'Multifaceted role of tocotrienols in cardioprotection supports their structure: function relation', Genes Nutr, vol. 7, no. 1, Jan, pp. 19-28.

Vázquez, CV, Rojas, MGV, Ramírez, CA, Chávez-Servín, JL, García-Gasca, T, Ferriz Martínez, RA, García, OP, Rosado, JL, López-Sabater, CM, Castellote, AI, Montemayor, HMA & de la Torre Carbot, K 2015, 'Total phenolic compounds in milk from different species. Design of an extraction technique for quantification using the Folin–Ciocalteu method', Food Chemistry, vol. 176, no. 0, 6/1/, pp. 480-486.

Verma, S, Fedak, PWM, Weisel, RD, Butany, J, Rao, V, Maitland, A, Li, R-K, Dhillon, B & Yau, TM 2002, 'Fundamentals of Reperfusion Injury for the Clinical Cardiologist', Circulation, vol. 105, no. 20, May 21, 2002, pp. 2332-2336.

Vichapong, J, Sookserm, M, Srijesdaruk, V, Swatsitang, P & Srijaranai, S 2010, 'High performance liquid chromatographic analysis of phenolic compounds and their antioxidant activities in rice varieties', LWT - Food Science and Technology, vol. 43, no. 9, 11//, pp. 1325-1330.

Vissers, MN, Zock, PL, Meijer, GW & Katan, MB 2000, 'Effect of plant sterols from rice bran oil and triterpene alcohols from sheanut oil on serum lipoprotein concentrations in humans', Am J Clin Nutr, vol. 72, no. 6, Dec, pp. 1510-5.

Wang, P, Chen, H, Qin, H, Sankarapandi, S, Becher, MW, Wong, PC & Zweier, JL 1998, 'Overexpression of human copper, zinc-superoxide dismutase (SOD1) prevents postischemic injury', Proc Natl Acad Sci U S A, vol. 95, no. 8, Apr 14, pp. 4556-60.

Wang, P, Henning, SM & Heber, D 2010, 'Limitations of MTT and MTS-Based Assays for Measurement of Antiproliferative Activity of Green Tea Polyphenols', PLoS ONE, vol. 5, no. 4, p. e10202.

Wang, S, Melnyk, JP, Tsao, R & Marcone, MF 2011, 'How natural dietary antioxidants in fruits, vegetables and legumes promote vascular health', Food Research International, vol. 44, no. 1, 1//, pp. 14-22.

Wang, Y-X, Li, Y, Sun, A-M, Wang, F-J & Yu, G-P 2014, 'Hypolipidemic and Antioxidative Effects of Aqueous Enzymatic Extract from Rice Bran in Rats Fed a High-Fat and -Cholesterol Diet', Nutrients, vol. 6, no. 9, 27 August, pp. 3696-3710.

190

Watjen, W, Michels, G, Steffan, B, Niering, P, Chovolou, Y, Kampkotter, A, Tran-Thi, QH, Proksch, P & Kahl, R 2005, 'Low concentrations of flavonoids are protective in rat H4IIE cells whereas high concentrations cause DNA damage and apoptosis', J Nutr, vol. 135, no. 3, Mar, pp. 525-31.

Weng-Yew, W, Selvaduray, KR, Ming, CH & Nesaretnam, K 2009, 'Suppression of Tumor Growth by Palm Tocotrienols Via the Attenuation of Angiogenesis', Nutrition and Cancer, vol. 61, no. 3, 2009/05/07, pp. 367-373.

WHO 2004, WHO publishes definitive atlas on global heart disease and stroke epidemic, World Health Organization, viewed 20 March, <http://www.who.int/mediacentre/news/releases/2004/pr68/en/>.

WHO 2015, Cardiovascular diseases (CVDs), World Health Organization, viewed 16 July 2013,

Wiese, AG, Pacifici, RE & Davies, KJ 1995, 'Transient adaptation of oxidative stress in mammalian cells', Arch Biochem Biophys, vol. 318, no. 1, Apr 1, pp. 231-40.

Williams, GM 1986, 'Epigenetic promoting effects of butylated hydroxyanisole', Food Chem Toxicol, vol. 24, no. 10-11, Oct-Nov, pp. 1163-6.

Williams, GM & Iatropoulos, MJ 1996, 'Inhibition of the hepatocarcinogenicity of aflatoxin B1 in rats by low levels of the phenolic antioxidants butylated hydroxyanisole and butylated hydroxytoluene', Cancer Lett, vol. 104, no. 1, Jun 24, pp. 49-53.

Wilson, TA, Idreis, HM, Taylor, CM & Nicolosi, RJ 2002, 'Whole fat rice bran reduces the development of early aortic atherosclerosis in hypercholesterolemic hamsters compared with wheat bran', Nutrition Research, vol. 22, no. 11, 11//, pp. 1319-1332.

Wolf, G 2005, 'The Discovery of the Antioxidant Function of Vitamin E: the contribution of Henry A. Mattill', The Journal of Nutrition, vol. 135, no. 3, March 1, 2005, pp. 363-366.

Wong, RSY & Radhakrishnan, AK 2012, 'Tocotrienol research: past into present', Nutrition Reviews, vol. 70, no. 9, pp. 483-490.

Wu, S-J & Ng, L-T 2010a, 'Tocotrienols Inhibited Growth and Induced Apoptosis in Human HeLa Cells Through the Cell Cycle Signaling Pathway', Integrative Cancer Therapies, vol. 9, no. 1, March 1, 2010, pp. 66-72.

Wu, SJ & Ng, LT 2010b, 'Tocotrienols inhibited growth and induced apoptosis in human HeLa cells through the cell cycle signaling pathway', Integr Cancer Ther, vol. 9, no. 1, Mar, pp. 66-72.

Xu, Z & Godber, JS 1999, 'Purification and identification of components of gamma-oryzanol in rice bran Oil', J Agric Food Chem, vol. 47, no. 7, Jul, pp. 2724-8.

191

Xu, Z, Hua, N & Godber, JS 2001, 'Antioxidant activity of tocopherols, tocotrienols, and gamma-oryzanol components from rice bran against cholesterol oxidation accelerated by 2,2'-azobis(2-methylpropionamidine) dihydrochloride', J Agric Food Chem, vol. 49, no. 4, Apr, pp. 2077-81.

Yawadioa, R, Tanimorib, S & Moritta, N 2007, 'Identification of phenolic compounds isolated from pigmented rices and their aldose reductase inhibitory activities ', Food Chemistry, vol. 102, pp. 1616-1625.

Yonekura-Sakakibara, K, Nakayama, T, Yamazaki, M & Saito, K 2009, 'Modification and Stabilization of Anthocyanins', in C Winefield, K Davies and K Gould (eds), Anthocyanins, Springer New York, pp. 169-190.

Yoshida, Y, Niki, E & Noguchi, N 2003, 'Comparative study on the action of tocopherols and tocotrienols as antioxidant: chemical and physical effects', Chem Phys Lipids, vol. 123, no. 1, Mar, pp. 63-75.

Yoshie, A, Kanda, A, Nakamura, T, Igusa, H & Hara, S 2009, 'Comparison of gamma-oryzanol contents in crude rice bran oils from different sources by various determination methods', J Oleo Sci, vol. 58, no. 10, pp. 511-8.

Yu, LL 2008, Wheat Antioxidants, Wiley.

Yu, S, Nehus, ZT, Badger, TM & Fang, N 2007, 'Quantification of vitamin E and gamma-oryzanol components in rice germ and bran', J Agric Food Chem, vol. 55, no. 18, Sep 5, pp. 7308-13.

Zelko, IN, Mariani, TJ & Folz, RJ 2002, 'Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression', Free Radic Biol Med, vol. 33, no. 3, Aug 1, pp. 337-49.

Zhang, L, Jiang, H, Gao, X, Zou, Y, Liu, M, Liang, Y, Yu, Y, Zhu, W, Chen, H & Ge, J 2011, 'Heat shock transcription factor-1 inhibits H2O2-induced apoptosis via down-regulation of reactive oxygen species in cardiac myocytes', Mol Cell Biochem, vol. 347, no. 1-2, Jan, pp. 21-8.

Zhang, M-w, Guo, B-j, Zhang, R-f, Chi, J-w, Wei, Z-c, Xu, Z-h, Zhang, Y & Tang, X-j 2006, 'Separation, Purification and Identification of Antioxidant Compositions in Black Rice', Agricultural Sciences in China, vol. 5, no. 6, 6//, pp. 431-440.

Zhang, MW, Zhang, RF, Zhang, FX & Liu, RH 2010, 'Phenolic profiles and antioxidant activity of black rice bran of different commercially available varieties', J Agric Food Chem, vol. 58, no. 13, Jul 14, pp. 7580-7.

Date post:	16-Oct-2021
Category:	Documents
Upload:	others
View:	7 times
Download:	0 times

Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA

Documents