Fungal Genetics and Biology 47 (2010) 602–607

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/ locate/yfgbi

A laccase exclusively expressed by Metarhizium anisopliae during isotropic growthis involved in pigmentation, tolerance to abiotic stresses and virulence

Weiguo Fang a,*, Éverton K.K. Fernandes b, Donald W. Roberts b, Michael J. Bidochka c, Raymond J. St. Leger a

a University of Maryland, Department of Entomology, 4112 Plant Sciences Building, College Park, MD 20742, USAb Utah State University, Department of Biology, Logan, UT 84322 5305, USAc Brock University, Department of Biological Sciences, St. Catharines, ON, Canada L2S 3A1

a r t i c l e i n f o a b s t r a c t

Article history:Received 4 January 2010Accepted 30 March 2010Available online 9 April 2010

Keywords:Metarhizium anisopliaeLaccasePigmentationPathogenesisAbiotic stress

1087-1845/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.fgb.2010.03.011

* Corresponding author. Fax: +1 301 314 9290.E-mail address: wfang1@umd.edu (W. Fang).

Insect pathogenic fungi including Metarhizium anisopliae offer an environmentally friendly alternative tochemical pesticides. However, their use has been limited by their relatively slow killing speed comparedto chemicals and low tolerance to abiotic stresses. We report here on a class 1 laccase (MLAC1) that isinvolved in both virulence and tolerance to environmental stresses. Mlac1 is expressed during isotropicgrowth (swelling) but not during polarized growth (e.g., germ tubes and hyphae); Mlac1 is thereforeexpressed exclusively in the later stages of conidiation and in blastospores when M. anisopliae is livingas a saprophyte. During infection processes, Mlac1 is also expressed by appressoria (infection structures)on the cuticle surface and hyphal bodies inside the insect haemocoel. Disrupting Mlac1 reduced virulenceto caterpillars because of impaired appressoria and delayed post-infection events. It also produced a yel-low-conidia phenotype with increased conidial susceptibility to heat shock (45 �C for 2 h) and UV-Bstress. The relationship between M. anisopliae’s pigment-synthesis pathway and its adaptation to diversenatural habitats is discussed.

� 2010 Elsevier Inc. All rights reserved.

1. Introduction

Entomopathogenic fungi have been developed as alternatives tochemical insecticides in biocontrol programs for agricultural pestsand vectors of disease (Blanford et al., 2005; Prior, 1992; Scholteet al., 2005). However, their use has been limited by low virulence(St. Leger et al., 1996) and poor persistence in the field caused byUV damage and other abiotic stresses (Rangel et al., 2006). Detailedmechanistic knowledge of fungal pathogenesis and tolerance toabiotic stresses is needed for mycoinsecticide improvement.

Metarhizium anisopliae has been used as a model to study fungalpathogenicity to insects (Roberts and St. Leger, 2004). Infection isvia conidia that adhere to the insect cuticle and produce germtubes that meander across the cuticle until they find a suitable sitefor penetration. They then cease polar growth and the hyphal tipsdifferentiate into swollen ‘‘holdfasts” called appressoria. Theappressoria produce infection pegs which penetrate the cuticlevia a combination of mechanical pressure and cuticle degradingenzymes. The fungus proliferates in the host haemocoel as ayeast-like phase (blastospores), and the insect is killed by a combi-nation of fungal growth and toxins. Hyphae subsequently ree-merge from the cadaver to produce conidia. Many key genesinvolved in these processes have been identified including an

ll rights reserved.

adhesin (MAD1) and hydrophobins that are responsible for adher-ence to the cuticle (St. Leger et al., 1992; Wang and St. Leger,2007a). The cuticle degrading enzymes and their genes have alsobeen characterized (Bagga et al., 2004). An osmosensor signals topenetrant hyphae that they have reached the haemocoel (Wanget al., 2008) and a perilipin (the first characterized in fungi) regu-lates the turgor pressure of infection structures (Wang and St.Leger, 2007b). The production of a collagen-like protein MCL1 isrequired for evading insect immune responses (Wang and St. Leger,2006). A regulator of the G protein signaling pathway is involved inconidiation and hydrophobin synthesis (Fang et al., 2007), and aprotein kinase A (MaPKA1) regulates production of appressoriaand many other virulence determinants (Fang et al., 2009).

Although there is still much to learn, there has clearly been pro-gress in elucidating the mechanisms of M. anisopliae pathogenicity.In comparison, the molecular mechanisms by which M. anisopliaetolerates abiotic stresses are poorly understood. Protein kinase A(MaPKA1) (Fang et al., 2009) and the osmosensor (MOS1) (Wanget al., 2008) are involved in tolerance to oxidative and high osmo-larity stresses encountered during insect infection. Environmentalstresses, i.e. UV and heat, are also serious obstacles for the use ofM. anisopliae in agriculture. To date, only the dark green pigmentin the conidia has been implicated in tolerance to these two stres-ses (Roberts and St. Leger, 2004).

In this study, we identified a laccase gene (Mlac1, Metarhiziumlaccase 1) (EU769126) from a mutant (M1252) with yellow

W. Fang et al. / Fungal Genetics and Biology 47 (2010) 602–607 603

conidia. Mlac1 is expressed exclusively in rounded structures thatresult from isotropic growth (conidia, blastospores and appresso-ria), and is not expressed in germ tubes and hyphae that areproduced by polarized growth. Functional analysis showed thatM. anisopliae Mlac1 is both a virulence determinant and requiredfor tolerance to abiotic stresses.

2. Materials and methods

2.1. Fungal isolates

The M. ‘‘anisopliae” wild type used in this study is ARSEF2575from the USDA/ARS Collection of Entomopathogenic Fungal Cul-tures, Ithaca, NY. This isolate was recently assigned to a new spe-cies, Metarhizium robertsii, within a group of species, M. anisopliaesensu lato (Bischoff et al., 2009).

2.2. Gene cloning and disruption

The flanking sequences of T-DNA were cloned by YADE (Y-shapedadaptor dependent extension) from M. anisopliae mutants generatedby T-DNA insertion as previously described (Fang et al., 2005). Theprimers used in this study are listed in Table 1. All PCR products inthis study were first cloned into the pGEM-T easy vector (Promega)and sequenced for confirmation. The full length sequence of Mlac1was cloned also with YADE and its cDNA was cloned using the 2ndgeneration RACE kit (Roche Applied Science, Indianapolis, IN).

Mlac1 was disrupted by A. tumefaciens mediated homologousrecombination as previously described (Fang et al., 2007). The 50-end and 30-end of Mlac1 were cloned by PCR and inserted intothe Xba I and Spe I sites, respectively of the master plasmidpBARGFP (Fang et al., 2009) to form Mlac1 disruption plasmidpBARGFP-Mlac1. To complement M1252 and DMlac1, the genomicsequence of Mlac1 including its promoter (1400 bp) and terminatorregion (300 bp) was cloned and inserted into the Xba I site ofpFBENGFP to form pFBENGFP-Mlac1. pFBENGFP-Mlac1 was thentransformed into M1252 and DMlac1. Transformants were selectedby benomyl resistance (Fang et al., 2006).

Table 1Primers used in this study.

Name Sequence Usage

L1 tgtcgtgccagctgcattaa Cloning the left flankingsequence of T-DNAL2 gcaattcggcgttaattcag

R1 tttcgccagctggcgtaata Cloning the right flankingsequence of T-DNAR2 gagcttggatcagattgtcg

Mlac5-1 agccatttcattataaac Cloning full lengthsequence of Mlac1Mlac5-2 tcaccacatgaaccaacc

Mlac3-1 gtactggaagatatctacMlac3-2 acgtcgcccccaggtcac5RACE1 gagacattttctcgtgag Cloning the full length of

cDNA of Mlac1 by RACE5RACE2 ggagacgccttgaacctg3RACE1 acgatccagaatatctgg3RACE2 agagtactggaagatatcDMlac5-1 tctagaacggaatgagtcaaatacc Disruption of Mlac1DMlac5-2 tctagacgacgtaagcgtacaatacDMlac3-1 tctagacctacttcacccgatgtcDMlac3-2 tctagacgtgacattgtccgtcatcDMlacCF-1 cgccatcgttaccatgag Confirmation of the

disruption of Mlac1DMlacCF-2 tagtgcattaataaaaccMlac5 ccactagt acggaatgagtcaaatacc Cloning full length of Mlac1

for complementing M1252and DMlac1

Mlac3 ccactagt cgtgacattgtccgtcatc

PMlac5 gggatatctctgtccttgggtcgtag Cloning the promoterregion of Mlac1PMlac3 gggatatcggtaacgatggcgaaagtg

GFP5 gggatatcatggtgagcaagggcgag Cloning the ORF of egfpGFP3 ggctcgagttacttgtacagctcgtc

2.3. Expression pattern of Mlac1

The expression pattern of Mlac1 was investigated by followingGFP fluorescence in transformants expressing GFP which was dri-ven by the promoter region (1400 bp) of Mlac1. The 1400 bp pro-moter region of the Mlac1 and the ORF of egfp were both clonedby PCR using primers described in Table 1. The resultant egfp prod-uct was digested with EcoR V and Xho I, and inserted into the cor-responding sites of pBARGPE1 (McCluskey, 2003) to form pGFP.The Mlac1 promoter was digested with EcoR I and EcoR V, and in-serted into the corresponding sites of pGFP to form PMlac1:GFP.The egfp cassette was then mobilized into Ppk2-bar (Fang et al.,2007) to form pPMlac1:GFP. This Ti plasmid was then transformedinto the wild type ARSEF2575 mediated by A. tumefaciens (Fanget al., 2006). GFP fluorescence was observed in aerial hyphae, con-idiophores, conidia, blastospores produced in SDB (Sabouraud dex-trose broth) cultures, appressoria and hyphal bodies produced ininsect hemolymph. Aerial hyphae, conidiophores and conidia weresampled from PDA plates. Blastospores were obtained by growingfungi in SDB for 10 d. To obtain hyphal bodies in insect hemo-lymph, 1 � 105 conidia were injected into a 5th instar Manduca sex-ta larvae (Carolina, Burlington, NC). After 48 h at 27 �C, the insectwas bled and hyphal bodies in the hemolymph were checked bymicroscopy. Appressoria were induced on locust hind wings aspreviously described (Fang et al., 2009).

2.4. Testing conidial tolerance to heat, chilling, freezing and thawing,high osmolarity, oxidative stress and UV

Tolerance to cold stress or heat shock was tested by measuringthe germination rate of conidia (1.5 � 106) in Petri dishes contain-ing 2 ml 0.01% yeast extract. Tolerance to heat shock was investi-gated by incubating conidia at 45 �C for 2 h then transferred to27 �C to continue growth. Germination was checked every 2 h. Toproduce cold stress the plates were incubated at 15 �C and germi-nation was checked at 2 h intervals.

To test tolerance of conidia to repeated cycles of freezing andthawing, petri dishes containing yeast extract inoculated with con-idia were first subjected to cold acclimation (10 �C for 10 h), andthen to freezing and thawing stress for up to 30 cycles [�20 �Cfor 12 h and 1 h at room temperature (RT)]. Conidial viabilitywas tested by the fluorescein-diacetate/ethidium-bromide method(Correa et al., 1986). Living and dead cells show green and red fluo-rescence, respectively.

Tolerance to oxidative stress (0.005% H2O2) and high osmolaritystress (1.5 M KCl) was tested as previously described (Fang et al.,2009).

The tolerance to UV radiation was determined by measuring theconidial germination rate following exposure to 978 mW m�2 ofQuaite-weighted UV-B radiance. Exposures of 30 min and 120 minafforded total doses of 1.76 to 7.04 kJ m�2, respectively. Afterirradiation, conidia were grown on PDA (potato dextrose agar) sup-plemented with 1 g l�1 yeast extract at 27 �C for 48 h, and germina-tion rates were determined (Fernandes et al., 2007).

2.5. Insect bioassay

Wild type and mutant M. anisopliae were bioassayed using lastinstar Galleria mellonella larvae from Pet Solutions (Beavercreek,OH) as described (Fang et al., 2009). Insects were inoculated byimmersion in conidial suspensions (1 � 107 conidia ml�1) andLT50 (the time taken to kill 50% of G. mellonella larvae) values weredetermined using the SPSS Statistical Package (SSPS Inc., Chicago,IL). All bioassays were repeated three times with 30 insects perreplicate. Infection events (germination, appressorial formationand turgor, the effect of cuticular melanin on appressoria), and

604 W. Fang et al. / Fungal Genetics and Biology 47 (2010) 602–607

post-infection events in M. sexta, including the appearance of hy-phal bodies in insect hemolymph and phagocytosis, were moni-tored as previously described (Fang et al., 2009).

2.6. Exploring pigment-synthesis pathways in M. anisopliae

To date, four pigment-synthesis pathways have been identifiedin filamentous fungi: (1) the dihydroxynaphthalene (DHN)–mela-nin pathway found in the human pathogen Aspergillus fumigatus(Wheeler and Bell, 1988) and some plant pathogenic fungi (Kuboand Furusawa, 1991; Money and Howard, 1996); (2) the L-DOPA–melanin pathway (Bell and Wheeler, 1984); (3) the pyomel-anin pathway of A. fumigates (Schmaler-Ripcke et al., 2009); and(4) carotenoid production by Neurospora crassa (Nelson et al.,1989).

To identify the pigment-synthesis pathways of M. anisopliae,kojic acid (10–1000 lg/ml), tricyclazole (10–100 lg/ml), sulcotri-one (50–500 lM) or glufosinate ammonium (100–800 lg/ml) wereadded to minimal medium. These block the synthesis of DOPA-melanin, DHN-melanin, pyomelanin and carotenoids, respectively(Suryanarayanan et al., 2004; Schmaler-Ripcke et al., 2009). To testfor the pyomelanin-synthesis pathway, L-tyrosine (10 mM or20 mM) was also added to minimal medium with sulcotrione.Phenylthiourea (PTU) (0.5–2.5 mM), an inhibitor of polyphenolicoxidases including laccases (Klabunde et al., 1998), was used toconfirm their involvement in the pigmentation of M. anisopliae.

3. Results

3.1. A pigmentation mutant from T-DNA insertion mutagenesis library

We have obtained pigmentation mutants from a random T-DNAinsertion library containing nearly 20,000 transformants of M. ani-sopliae (Fig. 1). Transformant M1252 produced yellow conidia innutrient-rich PDA and SDA (Sabouraud dextrose agar), as well asminimal medium, confirming that colorization of M1252 conidiais not dependant on culture-conditions. Southern blotting showedonly one copy of T-DNA in M1252 (data not shown). Both the leftand right flanking sequences of the T-DNA insert in M1252 showedsignificant similarity (<3 e�19) to a laccase gene (ACJ13064) fromAspergillus flavus, and we designated the disrupted gene as Mlac1(Metarhizium anisopliae laccase 1).

Fig. 1. Conidial color phenotypes of wild type M. anisopliae and the pigmentationmutant M1252 on minimal medium supplemented with or without pigment-synthesis inhibitor (phenylthiourea, PTU). Cultures were grown for 14 d on (A)minimal medium, and (B) on minimal medium with PTU (1.25 mM). (For interpre-tation of the references to color in this figure legend, the reader is referred to theweb version of this article.)

Disrupting Mlac1 resulted in colonies with yellow conidia iden-tical to those of M1252. Complementing M1252 and DMlac1 with agenomic clone containing Mlac1 and its upstream (1400 bp) anddownstream (300 bp) regions produced strains indistinguishablefrom the wild type strain, and so we do not include data for thecomplemented transformants in this study.

3.2. Sequence analysis of Mlac1

The ORF of Mlac1 is 1812 bp long and is interrupted by three in-trons. It encodes a protein containing 603 amino acid residues.MLAC1 contains three copper-oxidase domains that are similar topfam07732 (9 e�13), pfam00394 (9 e�10) and pfam07731 (5 e�15),characteristic of a laccase. MLAC1 is a class 1 laccase becausemethionine is the fourth amino acid residue in the Cu2+ bindingsite of the pfam07731 domain (Fig. 2) (Eggert et al., 1998).

Homologs of MLAC1 were identified in most Basidiomyceteand Ascomycete fungi, including sequences in Gibberella zeae(XP_382504) (42% identity), A. fumigatus (ACJ13064) (34% identity),Aspergillus nidulans (CAA36787) (35% identity) and Ustilago maydis(XP_761508) (27% identity). However, homologs of MLAC1 wereabsent in the genomes of Chytrid and Zygomycete fungi, includingAllomyces macrogynus, Batrachochytrium dendrobatidis and Rhizopusstolinifer. Homologs of MLAC1 may have been lost from thesegroups as MLAC1 showed low similarity (up to 22%) with animal,plant and bacterial copper oxidases.

3.3. Expression pattern of Mlac1

Three transformants containing PMlac1:GFP were randomly se-lected to investigate the expression pattern of Mlac1. No differ-ences in GFP signal at different developmental stages wereobserved. During growth in artificial media, Mlac1 was expressedexclusively in blastospores, conidia and in conidiophore cells at-tached to newly budded conidia, i.e., the very late stages of conidi-ation (Fig. 3A and B). During insect infection processes, Mlac1 washighly expressed during differentiation of appressoria (Fig. 3C), byhyphal bodies budding in the insect hemolymph (Fig. 3D) and invery late stages of conidiation on the cadaver surface (as with con-idiation on artificial media). Overall, the data indicated that MLAC1is expressed whenever M. anisopliae is producing rounded cells(conidia, blastospores, hyphal bodies or appressoria), but not dur-ing polarized hyphal growth.

3.4. MLAC1 and pathogenesis

Comparisons of LT50 values showed that DMlac1 (LT50 = 9.4 d)took significantly longer (27%) to kill than the wild type (LT50 =7.4 d) (P < 0.001).

Fig. 2. Alignment of the amino acid sequences comprising the copper bindingdomain (pfam07731) closest to the carboxyl termini in laccases from a variety ofsources. Residues in the box farthest to the right (M, L, and F) influence the redoxcharacteristics of laccases, and provide the basis for assigning laccases to class 1, 2,or 3. The numbers on either side of the sequences indicate the positions of theamino acids within the laccase polypeptide, starting from the translational startsite.

Fig. 3. The expression pattern of Mlac1 was followed by observing GFP fluorescencein cells transformed by egfp driven by the Mlac1 promoter (the 1400 bp regionupstream of Mlac1). (A) GFP fluorescence in aerial hyphae, conidia and conidiophore(A1) and the same frame under transmitted light (A2). Note the GFP signal in thenewly budded conidium and the conidiophore cell attached to this conidium. (B1)GFP fluorescence in blastospores in nutrient-rich medium (SDB), and (B2) the sameframe under transmitted light. Blastospores were obtained by growing thetransformant in SDB at 27 �C for 10 d. (C) GFP fluorescence in appressoria producedon locust hind wings. (D) GFP fluorescence in (D2) hyphal bodies in the insecthemolymph and the corresponding picture under (D1) transmitted light. Hyphalbodies were collected from the hemolymph of 5th instar larvae of M. sexta that wereinjected with 105 spores. NC: newly produced conidium; CP: conidiophore; BS:blastospores; HY: hyphae; A: appressorium; C: conidia; IH: insect hemocytes; HB:hyphal body.

Fig. 5. Interactions between M. anisopliae and hemocytes. Manduca larvae wereinoculated by immersion in conidial suspensions (5 � 107 conidia ml�1) and bledevery 24 h to obtain hemolymph. Both the wild type and DMlac1 produced singlecelled hyphal bodies (blastspores) that did not visibly interact with hemocytes. Thepicture shows wild type blastospores 72 h post inoculation, H: hemocytes;B: blastospores.

W. Fang et al. / Fungal Genetics and Biology 47 (2010) 602–607 605

There was evidence for changes in the cell wall surface proper-ties of DMlac1. Melanin generated in culture media by oxidizingL-DOPA (3,4-dihydroxy-L-phenylalanine) using tyrosinase fromG. mellonella larvae (Fang et al., 2009), precipitated onto appresso-ria of DMlac1 but not on appressoria of the wild type (Fig. 4). Theturgor pressure of DMlac1 appressoria (8.2 ± 1.1 MPa) was alsosignificantly lower than that of the wild type (10 ± 1.5 MPa)(P < 0.001).

Post-infection events were monitored by counting hyphal bodiesin the hemolymph as described (Fang et al., 2009). Three days aftertopical inoculation of wild type conidia on wax worm larva, the hosthemolymph contained 101 hyphal bodies ±11.8/ml. However, hy-phal bodies of DMlac1 did not appear until 5 d after inoculation(95 hyphal bodies ±7.5/ml), demonstrating that post-infectionevents were delayed in DMlac1. No differences were observed inthe ability of insect hemocytes to encapsulate or phagocytose wildtype and mutant hyphal bodies. Both the wild type and DMlac1 pro-duced identical single celled hyphal bodies (blastospores) that didnot interact with hemocytes indicating that Mlac1 is not requiredto evade cellular immunity (Fig. 5).

Fig. 4. The effect of insect cuticular melanin (produced by oxidizing L-DOPA bytyrosinase) on appressoria. Note the precipitation of melanin on the appressoria ofthe mutant (M1252). A: appressorium; C: conidium; M: melanin.

3.5. MLAC1. and stress tolerance

Short time exposure to UV-B (30 min) had no effect on thegermination rates of either the wild type or DMlac1. Sixty minutesof exposure reduced germination rates slightly, but the germina-tion rate of the wild type (95.4% ± 0.7) was not significantlydifferent from that of DMlac1 (94.5% ± 2.7) (P = 0.32). However,DMlac1 showed significantly lower tolerance (P < 0.01) to longtime exposure (P90 min) compared to the wild type. Thus, germi-nation rates of the wild type were 86% ± 2.7 (90 min) and 58.6% ± 4(120 min), while germination rates of DMlac1 were 78.3% ± 5.4(90 min) and 47.2% ± 3.7 (120 min).

Heat shock (2 h at 45 �C) greatly reduced germination rates forboth DMlac1 and the wild type. However, after 12 h incubation at27 �C, significantly fewer (�8 ± 2.1%) of the heat-shocked conidiaof DMlac1 had germinated as compared to the wild type(17.3 ± 1.7%) (P < 0.001). DMlac1 germinated at the same rate asthe wild type during cold stress (15 �C), and was equally tolerantto oxidative stress (0.05% H2O2), high osmolarity stress (1.5 MKCl) and up to 30 cycles of freezing/thawing (a cycle was �20 �Cfor 12 h and 25 �C for 1 h).

3.6. Pigment production by M. anisopliae

Tricyclazole, kojic acid and glufosinate ammonium do not inhi-bit conidial color formation suggesting that DHN-melanin, DOPA-melanin and carotenoids pathways are not contributing to pigmen-tation in M. anisopliae. Likewise, M. anisopliae did not generate pyo-melanin on the medium containing L-tyrosine with or withoutsulcotrione, suggesting it may not use the pyomelanin-synthesispathway. In contrast, both the wild type and DMlac1 producedonly white conidia on minimal medium with PTU (P1.25 mM)(Fig. 1), confirming that additional polyphenolic oxidase(s) besideMLAC1 are involved in pigmentation.

4. Discussion

Laccases are copper proteins that contain three multicopperblue protein domains and have an oxidase activity toward aro-matic compounds. They are widely distributed in fungi, plant,bacteria and animals, and effect many biological processes(Nakamura and Go, 2005). In fungi, laccases are involved in lignindegradation (Thurston, 1994), pigmentation (Aramayo and Tim-

606 W. Fang et al. / Fungal Genetics and Biology 47 (2010) 602–607

berlake, 1990; Tsai et al., 1999), and pathogenesis (Choi et al.,1992; Williamson, 1994; Zhu and Williamson, 2004). In thisstudy, we identified a laccase MLAC1 in the filamentous fungusM. anisopliae that contributes to conidial pigmentation, toleranceto abiotic stresses and pathogenicity. MLAC1 is only expressedduring isotropic growth, i.e. in conidia (pigmented), blastospores,appressoria and hyphal bodies produced in insecta. The expressionof MLAC1 very late in conidiation and impaired pigmentationwhen Mlac1 is disrupted suggest an involvement in conidial pig-mentation. However, high level expression of MLAC1 also occursin M. anisopliae appressoria and hyphal bodies even though theseare not pigmented, indicating that MLAC1 has additional func-tions besides production of pigments. Laccases in insect cuticleand plant cell walls cross-link structures increasing rigidity (Mar-co and Roubelakis-Angelakis, 1997; Suderman et al., 2006).MLAC1 could be similarly involved in stabilizing the cell wallsby forming cross-links. The reduced ability of the DMlac1 appres-soria to resist turgor pressure is consistent with a change in thecell walls rigidity and/or permeability. Structural changes in thecell wall of DMlac1 could also explain melanization of appressoriaand decreased tolerance of M. anisopliae to various stresses.MLAC1 could have additional modes of action. Thus, C. neofor-mans laccase is a cell wall-associated protein that converts mam-malian substrates into reactive intermediates including pigmentsthat protect the fungus and cause damage to the mammalian host(Zhu and Williamson, 2004).

Pigments enhance the survival and competitive abilities offungi in diverse environments (Bell and Wheeler, 1984). Presum-ably linked with adaptations to these different environments, fun-gi use at least four pathways to produce a diversity of pigments.The inhibitor assays suggest that M. anisopliae does not use one ofthe previously characterized pigment-synthesis pathways, andhas a novel pathway that involves laccases. However, more directevidence is needed to confirm this as M. anisopliae may prevententry of these inhibitors or they may not completely block theirM. anisopliae targets. Nevertheless, DHN-melanin is probably ab-sent in M. anisopliae because Rangel et al. (2006) found that M.anisopliae lacked scytalone dehydratase activity (a central enzymein the DHN-melanin synthesis pathway). M. anisopliae also differsfrom other fungi in the signal transduction pathways involved inpigmentation. Protein kinase A (PKAC1) regulates pigment-syn-thesis in A. fumigatus (Grosse et al., 2008), but the homolog inM. anisopliae (MaPKA1, 6 e�169) does not (Fang et al., 2009). Pre-viously, however, we found that a G protein signal pathway up-stream of MaPKA1 regulates M. anisopliae pigmentation (Fanget al., 2007). This suggests that downstream component(s) ofthe G protein signal pathway other than MaPKA1 control the pig-ment-synthesis pathway in M. anisopliae. It is yet to be deter-mined whether pigment production by M. anisopliae provides amodel for any other fungi, but being both insect pathogenic andrhizosphere competent (Hu and St. Leger, 2002; Roberts and St.Leger, 2004), M. anisopliae is adapted to deal with a broad vistaof environmental stresses.

Although M. anisopliae apparently lacks the DHN-melanin syn-thesis pathway of A. fumigatus, the Abr2 gene of A. fumigatus (Tsaiet al., 1999), is a homolog of MLAC1. An Abr2 homolog (yA) also ex-ists in A. nidulans that likewise lacks the DHN-melanin synthesispathway (Aramayo and Timberlake, 1990). Disruption of Abr2and yA resulted in a yellow-conidia phenotype in A. fumigatusand A. nidulans (Aramayo and Timberlake, 1990; Tsai et al.,1999), similar to the spore color of DMlac1. This suggests somecommonalities in pigmentation, even if major mechanistic and sig-naling elements in these three fungi are different. Perhaps fungalpigment-synthesis pathways are derived from a common ancestor,but diversified when they adapted to different environmentalstresses.

Acknowledgments

This work was supported by the Cooperative State Research,Education, and Extension Service, US Department of Agriculture,under Agreement No. 20106510620580.

References

Aramayo, R., Timberlake, W.E., 1990. Sequence and molecular structure of theAspergillus nidulans yA (laccase I) gene. Nucleic Acids Res. 18, 3415.

Bagga, S., Hu, G., Screen, S.E., St. Leger, R.J., 2004. Reconstructing the diversificationof subtilisins in the pathogenic fungus Metarhizium anisopliae. Gene 324, 159–169.

Bell, A.A., Wheeler, M.H., 1984. Biosynthesis and functions of fungal melanins. Ann.Rev. Phytopathol. 24, 411–451.

Bischoff, J.F., Rehner, S.A., Humber, R.A., 2009. A multilocus phylogeny of theMetarhizium anisopliae lineage. Mycologia 101, 512–530.

Blanford, S., Chan, B.H., Jenkins, N., Sim, d., Turner, R.J., Read, A.F., Thomas, M.B.,2005. Fungal pathogen reduces potential for malaria transmission. Science 308,1638–1641.

Choi, G.H., Larson, T.G., Nuss, D.L., 1992. Molecular analysis of the laccase gene fromthe chestnut blight fungus and selective suppression of its expression in anisogenic hypovirulent strain. Mol. Plant-Microbe Interact. 5, 119–128.

Correa, B., Purchio, A., Paula, C.R., Gambale, W., 1986. Evaluation of a fluorescentmethod (fluorescein diacetate and ethidium bromide solution) in the study ofthe viability Cryptococcus neoformans strains. Mycopathologia 96, 91–96.

Eggert, C., Lafayette, P.R., Temp, U., Eriksson, K.L., Dean, J.F.D., 1998. Molecularanalysis of a laccase gene from the white rot fungus Pycnoporus cinnabarinus.Appl. Environ. Microbiol. 64, 1766–1772.

Fang, W., Leng, B., Xiao, Y., Jin, K., Ma, J., Fan, Y., Yang, X., Zhang, Y., Pei, Y., 2005.Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application toimprove fungal strain virulence. Appl. Environ. Microbiol. 71, 363–370.

Fang, W., Pei, Y., Bidochka, M.J., 2006. Transformation of Metarhizium anisopliaemediated by Agrobacterium tumefaciens. Can. J. Microbiol. 52, 623–626.

Fang, W., Pei, Y., Bidochka, M.J., 2007. A regulator of a G protein signalling (RGS)gene, cag8, from the insect-pathogenic fungus Metarhizium anisopliae isinvolved in conidiation, virulence and hydrophobin synthesis. Microbiology153, 1017–1025.

Fang, W., Pava-Ripoll, M., Wang, S., St. Leger, R.J., 2009. Protein kinase A regulatesproduction of virulence determinants by the entomopathogenic fungus,Metarhizium anisopliae. Fungal Genet. Biol. 46, 277–285.

Fernandes, E.K.K., Rangel, D.E.N., Moraes, A.M.L., Bittencourt, V.R.E.P., Roberts, D.W.,2007. Variability in tolerance to UV-B radiation among Beauveria spp. isolates. J.Invertebr. Pathol. 96, 237–243.

Grosse, C., Heinekamp, T., Kniemeyer, O., Gehrke, A., Brakhage, A.A., 2008. Proteinkinase A regulates growth, sporulation, and pigment formation in Aspergillusfumigatus. Appl. Environ. Microbiol. 74, 4923–4933.

Hu, G., St. Leger, R.J., 2002. Field studies using a recombinant mycoinsecticide(Metarhizium anisopliae) reveal that it is rhizosphere competent. Appl. Environ.Microbiol. 68, 6383–6387.

Klabunde, T., Eicken, C., Sacchettini, J.C., Krebs, B., 1998. Crystal structure of a plantcatechol oxidase containing a dicopper center. Natl. Struct. Biol. 5, 1084–1090.

Kubo, Y., Furusawa, I., 1991. Melanin biosynthesis: prerequisite for successfulinvasion of the plant host by appressoria of Colletotrichum and Magnaporthe. In:Cole, G.T., Hoch, H.C. (Eds.), The Fungal Spore and Disease Initiation in Plantsand Animals. Plenum Publishing, New York, pp. 205–217.

Marco, A., Roubelakis-Angelakis, K.A., 1997. Laccase activity could contribute to cell-wall reconstitution in regenerating protoplasts. Phytochemistry 46, 421–425.

McCluskey, K., 2003. The fungal genetics stock center: from molds to molecules.Adv. Appl. Microbiol. 52, 245–262.

Money, N.P., Howard, R.J., 1996. Confirmation of a link between fungalpigmentation, turgor pressure, and pathogenicity using a new method ofturgor measurement. Fungal Genet. Biol. 20, 217–227.

Nakamura, K., Go, N., 2005. Function and molecular evolution of multicopper blueproteins. Cell Mol. Life Sci. 62, 2050–2066.

Nelson, M.A., Morelli, G., Carattoli, A., Romano, N., Macino, G., 1989. Molecular cloningof a Neurospora crassa carotenoid biosynthetic gene (albino-3) regulated by bluelight and the products of the white collar genes. Mol. Cell Biol. 9, 1271–1276.

Prior, C., 1992. Discovery and characterization of fungal pathogens for locust andgrasshopper control. In: Lomer, J., Prior, C. (Eds.), Biological Control of Locustsand Grasshoppers. CABI International, Wallinford, pp. 159–180.

Rangel, D.E.N., Butler, M.J., Torabinejad, J., Anderson, A.J., Braga, G.U.L., Day, A.W.,Roberts, D.W., 2006. Mutants and isolates of Metarhizium anisopliae are diversein their relationships between spores pigmentation and stress tolerance. J.Invertebr. Pathol. 93, 170–182.

Roberts, D.W., St. Leger, R.J., 2004. Metarhizium spp., cosmopolitan insect-pathogenic fungi: mycological aspects. Adv. Appl. Microbiol. 54, 1–70.

Schmaler-Ripcke, J., Sugareva, V., Gebhardt, P., Winkler, R., Kniemeyer, O.,Heinekamp, T., Brakhage, A.A., 2009. Production of pyomelanin, a second typeof melanin, via the tyrosine degradation pathway in Aspergillus fumigatus. Appl.Environ. Microbiol. 75, 493–503.

Scholte, E.J., Ng’habi, K., Kihonda, J., Takken, W., Paaijmans, K., Abdulla, S., Killeen,G.F., Knols, B.G., 2005. An entomopathogenic fungus for control of adult Africanmalaria mosquitoes. Science 38, 1641–1642.

W. Fang et al. / Fungal Genetics and Biology 47 (2010) 602–607 607

St. Leger, R.J., Staples, R.C., Roberts, D.W., 1992. Cloning and regulatoryanalysis of starvation-stress gene, ssgA, encoding a hydrophobin-likeprotein from the entomopathogenic fungus, Metarhizium anisopliae. Gene120, 119–124.

St. Leger, R.J., Joshi, L., Bidochka, M.J., Roberts, D.W., 1996. Construction of animproved mycoinsecticide overexpressing a toxic protease. Proc. Natl. Acad. Sci.USA 93, 6349–6354.

Suderman, R.J., Dittmer, N.T., Kanost, M.R., Kramer, K.J., 2006. Model reactions forinsect cuticle sclerotization: cross-linking of recombinant cuticular proteinsupon their laccase-catalyzed oxidative conjugation with catechols. InsectBiochem. Mol. Biol. 36, 353–365.

Suryanarayanan, T.S., Ravishankar, J.P., Venkatesan, G., Murali, T.S., 2004.Characterization of the melanin pigment of a cosmopolitan fungal endophyte.Mycol. Res. 108, 974–978.

Thurston, C.F., 1994. The structure and function of fungal laccases. Microbiology140, 19–26.

Tsai, H.F., Wheeler, M.H., Chang, Y.C., Kwon-Chung, K.J., 1999. A developmentallyregulated gene cluster involved in conidial pigment biosynthesis in Aspergillusfumigatus. J. Bacteriol. 181, 6469–6477.

Wang, C., St. Leger, R.J., 2006. A collagenous protective coat enables Metarhiziumanisopliae to evade insect immune responses. Proc. Natl. Acad. Sci. USA 103,6647–6652.

Wang, C., St. Leger, R.J., 2007a. The MAD1 adhesin of Metarhizium anisopliae linksadhesion with blastospore production and virulence to insects, and the MAD2adhesin enables attachment to plants. Eukaryot. Cell. 6, 808–816.

Wang, C., St. Leger, R.J., 2007b. The Metarhizium anisopliae perilipin homolog MPL1regulates lipid metabolism, appressorial turgor pressure, and virulence. J. Biol.Chem. 282, 21110–21115.

Wang, C., Duan, Z., St. Leger, R.J., 2008. MOS1 osmosensor of Metarhizium anisopliaeis required for adaptation to insect host hemolymph. Eukaryot. Cell. 7, 302–309.

Wheeler, M.H., Bell, A.A., 1988. Melanins and their importance in pathogenic fungi.In: McGinnis, M.R. (Ed.), Current Topics in Medical Mycology. Springer Verlag,New York, NY, pp. 338–387.

Williamson, P.R., 1994. Biochemical and molecular characterization of the diphenoloxidase of Cryptococcus neoformans: identification as a laccase. J. Bacteriol. 176,656–664.

Zhu, X., Williamson, P.R., 2004. Role of laccase in the biology and virulence ofCryptococcus neoformans. FEMS Yeast Res. 5, 1–10.