Eur. J. Biochem. 259, 188±196 (1999) q FEBS 1999

A new exon in the 5 0 untranslated region of the connexin32 gene

Stefano Duga1, Rosanna Asselta2, Luca Del Giacco3, Massimo Malcovati2,4, Severino Ronchi1,4, Maria L. Tenchini2,4 and

Tatjana Simonic1,4

1Istituto di Fisiologia Veterinaria e Biochimica; 2Dipartimento di Biologia e Genetica per le Scienze Mediche; 3Dipartimento di Biologia,

UniversitaÁ di Milano; 4Centro Interuniversitario per lo Studio delle Macromolecole Informazionali, Milano, Italy

The cloning and sequencing of two bovine connexin32 cDNAs are reported. Comparative analysis with known

corresponding mammalian cDNA and protein sequences, besides confirming a high degree of similarity among these

proteins, allowed us to identify some specific features of the bovine connexin32 gene. The latter include: the

presence of a novel exon in the 5 0 UTR which is alternatively spliced, giving rise to a new mRNA species; the

presence of two potential hairpin loops in the 5 0 and 3 0 UTR; and the presence of an additional amino acid,

glycine235, in the C-terminal domain of the 284 residue protein. Among the common features, the presence of

polypyrimidine clusters within the 3 0 UTR, containing a consensus sequence for a cis-acting element, is noteworthy.

Expression of connexin32 mRNAs was analysed in 16 bovine tissues. Transcript analysis suggests the presence, in

cattle, of an alternative downstream promoter.

Keywords: alternative splicing; bovine connexin32 gene; bovine connexin32 mRNA; tissue-specific gene

expression.

Gap junctions are specialized clusters of transmembranechannels that mediate intercellular communications, allowingsmall molecules and ions to move between neighbouring cellswithout exposure to the extracellular space [1±3]. Gap junctionsappear to be dynamic structures, exhibiting short half-lives (5±6 h). They are functionally controlled by channel opening andclosing and therefore play an important role in the regulation ofintercellular communications [1,3,4].

The major structural components of gap junctions are integralmembrane proteins, connexins, which belong to a multigenefamily [1,3,5,6]. In rodents 13 different members of this family,as well as their complex and often overlapping expressionpatterns [7], have so far been described. Genes belonging to thisfamily share a similar structure consisting of two exonsseparated by a large intron (5±11 kb in size) interrupting the5 0 UTR. The entire coding region and the 3 0 UTR are, therefore,part of the same exon (exon 2). This feature allowed connexingenes in different species to be mapped using rather short cDNAprobes [8±11].

The structure of the connexin32 gene appears to be morecomplex, because, in addition to the upstream promoter P1, analternative promoter P2, close to the 3 0 end of the large intron, ispresent [12±14]. Connexin32 messengers are therefore formedby exon 2 linked either to exon 1, transcribed from the upstreampromoter P1, or to exon 1b transcribed from the downstreampromoter P2. The latter transcript is at least partially specific forthe nervous system both in rodents and in humans [12±14]. Thisis noteworthy since mutations in the human connexin32 gene

have been associated with an X-linked form of Charcot-Marie-Tooth disease (CMTX 1) which shows nervous-tissue-specificsymptoms without affecting other connexin32-expressing organs[12].

The cloning and sequencing of bovine connexin32 cDNAreported here, led to the isolation of a new mRNA speciesderived from the transcript controlled by the upstream promoterP1 through alternative splicing. We demonstrated that the5 0 UTR of this new mRNA comprises a new exon, locatedwithin the large intron of the gene. Expression-pattern analysisof connexin32 mRNAs in 16 bovine tissues, besides allowingthe detection of a transcript originating from the promoter P2,confirmed the existence of two alternatively spliced transcriptsunder the control of promoter P1.

MATERIALS AND METHODS

Screening of cDNA library

A lgt10 bovine liver library (Clontech) was screened using apreviously isolated human connexin32 cDNA fragment (722 bp)[8]. This probe, labelled with [a-32P]dCTP (Amersham), wasused to hybridize the plaque-transferred filters (Hybond N,Amersham) according to standard procedures [15].

PCR assays on genomic DNA

Oligonucleotides, purchased from PE-Applied Biosystems UK,are listed in Table 1. Bovine genomic DNA was extractedaccording to standard procedures [15]. PCR reactions wereperformed in a MJ PTC 100 thermal cycler, using either a TaqDNA polymerase (Promega) or a Gene Amp XL PCR kit(Perkin±Elmer), depending on the size of the fragment to beamplified. The corresponding reaction conditions were: 30 s at95 8C, 30 s at 52 8C, 1 min at 72 8C for 30 cycles, preceded by5 min at 95 8C and followed by further 10 min elongation at72 8C for the Taq DNA polymerase system; and 5 min at 95 8C

Correspondence to Tatjana Simonic, Istituto di Fisiologia Veterinaria e

Biochimica, Via Celoria, 10, 20133 Milano, Italy. Fax: +39-2-2666301,

Tel.: +39-2-2664343, E-mail: tsimonic@imiucca.csi.unimi.it

Abbreviations: CMTX 1, Charcot-Marie-Tooth disease

Note: The nucleotide sequence data reported in this paper have been

submitted to the EMBL/GenBank/DDBJ Nucleotide Sequences Databases

under accession numbers X95311 and AJ224440.

(Received 7 April 1998, revised 16 June 1998, accepted 17 June 1998)

q FEBS 1999 5 0 UTR of Connexin32 (Eur. J. Biochem. 259) 189

followed by 30 cycles of 30 s at 95 8C and 5 min at 60 8C forthe Gene Amp XL PCR kit.

RT±PCR assays and 5 0 rapid amplification of cDNA ends

Total RNA (5 mg), extracted [16] from 16 bovine tissues, wasused as the template for first-strand cDNA synthesis with 30 Uof avian myeloblastoma virus (AMV) reverse transcriptase(Promega) at 42 8C and connexin32-specific primers.

The 5 0 end of the cDNA was isolated from bovine liver by 5 0

RACE using the single-strand ligation to ss-cDNA (SLIC)method [17]: ss-cDNA was ligated, using 10 U of T4 RNAligase (New England Biolabs), to the 5 0 anchor oligonucleotide5 A, previously phosphorylated at the 5 0 end and blocked at the3 0 end by the addition of an amino group. The ligation productswere used as templates for PCR with the primer couple FR/R2.Usually, two additional semi-nested PCR steps, using R3 and R4as 3 0 primers, were required to obtain suitable amounts of theexpected product.

To evaluate the tissue distribution of connexin32 mRNAs,one-tenth of the ss-cDNA was submitted to PCR with primersF3/R6, F2/R6 and F5/R6 following this thermal profile: 15 s foreach step at 95 8C, 56 8C and 72 8C for 35±40 cycles.

Amplification efficiency was evaluated by withdrawingaliquots of the PCR reaction every second cycle. Followingelectrophoresis, the intensity of the bands was measured using acomputer densitometer (GS-700 Imaging Densitometer, Biorad).Densitograms were analysed with Molecular Analyst Software1.4 (Biorad).

Cloning of DNA fragments and sequence analyses

The insert of the single positive lgt10 clone was excised withEcoRI (Promega) and subcloned into pUC9. PCR products wereinserted into pCRII using the `TA cloning kit' (Invitrogen).

DNA sequencing was performed on both strands, either onplasmids or directly on purified PCR products, using the Taqdye-deoxy terminator method, using an automated 370A DNAsequencer (Applied Biosystems).

Northern blot analysis

Northern blots of total RNAs were hybridized to the purified1035 base pair (bp) DNA fragment labelled with [a-32P]dCTPusing a DNA labelling kit (Pharmacia Biotech) according to

standard procedures [15]. Densitometric analyses of thedeveloped films were performed using a computer densitometer.

Computer analyses

Eukaryotic nucleotide sequences in EMBL 46 Data Base andamino acid sequences in SWISS-PROT 33 Data Library wereused for sequence comparisons. Other sequence analyses werecarried out using several programs of the PcGene softwarepackage (Intelligenetics).

RESULTS

Cloning and sequencing of bovine connexin32 cDNAs

The whole nucleotide sequences of two connexin32 mRNAspresent in bovine liver were obtained by isolating overlappingDNA fragments through different approaches.

The first DNA fragment was isolated by library screening. Asingle positive clone, out of 5 £ 105 screened plaques, containeda 481-bp insert whose sequence was very similar (84.3%) to the3 0 end of the human connexin32 cDNA [18] and, therefore,likely to correspond to the 3 0 UTR end of the bovine connexin32cDNA.

The coding region was isolated through amplificationreactions performed on genomic DNA, since in other speciesthe whole coding region is present in a single exon (exon 2) [13,19, 20]. Oligonucleotide R1 (Table 1) was used as the 3 0 primer,while the 5 0 primer F1 was constructed on the basis of asequence of the coding region, conserved among human, rat andmouse cDNAs [18, 21]. Amplification led to the expectedproduct, whose length was determined by sequencing to be1035 bp. This fragment covered the coding sequence fromcodon 69 or nucleotide 205 (being + 1 the first nucleotide of thestart codon), as judged by comparison with human, rat andmouse sequences [18, 21]. DNA-sequencing reactions startingfrom the 3 0 end of this fragment stopped abruptly at position1107, after the addition of only 132 nucleotides. However, thesame segment was readily sequenced from the 5 0 side andoverlapped the 481-bp fragment, obtained from the libraryscreening.

The 5 0 region was obtained by 5 0 RACE. Two products wereobtained using the same primer couple FR/R4: a major band of491 bp (transcript A) and a fainter band of 550 bp (transcript B).Alignment of their nucleotide sequences showed a perfect

Table 1. Primers used in PCR and RT±PCR assays.

Position in transcript

Primer Sequence A B C Location

F1 TTCCCCATCTCCCACGTGCG 205/224 205/224 205/224 CDS*

F2 TTTGGGATCGGACTGCACTCAC ± -19/-40 ± 5 0UTR

F3 GGGCTGACAGTACCTAGTG -89/-71 -148/-130 ± 5 0UTR

F4 CACAGACATGAGACCATAGGNN ± ± -76/-55 5 0UTR

F5 CTGGGTGGCCTCAGGGATAG ± ± -48/-29 5 0UTR

R1 CCCACCAATGTGACTCCAGA 1239/1220 1239/1220 1239/1220 3 0UTR

R2 GGCGTAGCCAGGGTAGAG 483/466 483/466 483/466 CDS*

R3 CCACAGTGTCCCTGAGAT 396/379 396/379 396/379 CDS*

R4 TCTTCACCTCCTCCAGG 364/348 364/348 364/348 CDS*

R5 AGCAAAGCCTGACCATCTC ± ± 48/-66 ± 5 0UTR

R6 ATACTCGGCCAATGGCAGTA 70/51 70/51 70/51 CDS*

5A GAATTCGTCGACAAGCTTAGTCA ± ± ± anchor primer

FR TGACTAAGCTTGTCGACG ± ± ± complementary to part of 5A

Nucleotide positions are numbered according to the sequences reported in Fig. 1. *CDS, coding sequence; F, forward; R, reverse.

190 S. Duga et al. (Eur. J. Biochem. 259) q FEBS 1999

identity, the only difference being the presence in transcript B of59 additional nucleotides, inserted between positions ± 17 and± 16 of transcript A (Fig. 1).

The whole cDNA sequences were derived from theseoverlapping DNA fragments. Possible errors introduced byTaq DNA polymerase activity in amplified products werechecked by sequencing two or more fragments obtained fromindependent experiments for each PCR product. The nucleotidesequences of bovine liver connexin32 cDNAs and the deducedamino acid sequence are shown in Fig. 1. Transcript A is 1624nucleotides long and comprises a 5 0 UTR of 109 nucleotides,while transcript B spans 1683 nucleotides with a 5 0 UTR of 168nucleotides. Both contain the same coding region with an ORFof 852 nucleotides followed by the stop codon TGA (positions853±855) and a 3 0 UTR spanning 660 nucleotides with the poly-adenylation signal ATTAAA (positions 1474±1479) located 19nucleotides upstream the poly(A) tail.

The encoded protein comprises 284 residues, correspondingto an estimated molecular mass of 32 082 Da. An additional

amino acid, namely a glycine at position 235, was found to bepresent following comparison with the known connexin32protein sequences.

Computer analysis gave evidence of the presence, in bovineconnexin32 mRNAs only, of two potential hairpin loops. Thefirst is located at the 5 0 end (positions ± 109 to ± 87 intranscript A and positions ± 168 to ± 146 in transcript B) withan estimated free energy value of ± 82.75 kJ (Fig. 2a), thesecond is within the 3 0 UTR (positions 1076±1107) with anestimated free energy value of ± 127.1 kJ (Fig. 2b). Further-more, three extensive pyrimidine clusters were evidenced in the3 0 UTR: from position 873±932, 974±1005 and 1104±1131. Inthe latter a sequence of 28 contiguous pyrimidines was found.

Identification of a new exon within the large introninterrupting the 5 0 UTR

To determine whether the additional 59 bp of transcript B resultfrom the use of a different splicing donor site for exon 1 or

Fig. 1. Nucleotide and deduced amino acid

sequences of bovine connexin32 cDNAs. The

first base of the start codon is designated + 1 and

the stop codon is indicated by asterisks. The

polyadenylation signal is underlined. The boxed

amino acid, G235, is an additional residue, not

found in other mammalian connexin32s. Putative

phosphorylation sites are emboldened.

q FEBS 1999 5 0 UTR of Connexin32 (Eur. J. Biochem. 259) 191

represent a new exon, a PCR analysis on genomic DNA wasperformed. Two primers (F2 and R5) mapping in the 59 bpinsertion in opposite orientations, were used in conjunction withprimers R6 and F3, respectively. Because F3 is located in the5 0 UTR upstream of the 59 bp insertion and R6 is located, inreverse orientation, within the coding region (exon 2), theexpected PCR products should allow evaluation of the length ofthe intron between exon 1 and exon 2, and mapping of theposition of the possible new exon. PCR reactions yielded afragment of , 4.2 kb for the primer couple F3/R5 and ,1.3 kbfor F2/R6. Both fragments, partially sequenced from both ends,showed the presence of canonical splicing donor and acceptorsites (Fig. 3a). These results supported the hypothesis of the

existence of a new exon in the bovine connexin32 gene, located, 4.2 kb downstream of exon 1 and 1.3 kb upstream of exon 2(Fig. 3b). This new exon will hereafter be referred to asexon 1a. The intron of , 4.2 kb between exon 1 and exon 1awill be named intron 1a1, and the intron of ,1.3 kb betweenexon 1a and exon 2, intron 1a2. For the large intron alterna-tively spliced between exon 1 and exon 2, spanning <5.5 kb,the original name intron 1 will be kept.

Characterization of bovine connexin32 mRNA species

To verify the existence also in cattle of a transcript originatingfrom a downstream promoter P2, we designed primer F4 on the

Fig. 2. Potential secondary structures within

the 5 0 and 3 0 UTRs of connexin32 mRNAs.

Numbering as in Fig. 1. (a) Hairpin at the 5 0 end

(positions ± 109 to ± 87 in transcript A or

positions ± 168 to ± 146 in transcript B), (b)

hairpin present within the 3 0 UTR.

Fig. 3. Schematic outline of the connexin32 gene organization. (A) Location of the four exons (not in scale) within the gene; (B) structure and origin of the

three alternative transcripts. Boxes represent exons: UTRs are dark grey and the coding sequence is light grey. Introns and gene flanking regions are represented

as lines. Upper-case letters correspond to exons, while lower-case correspond to introns. Arrows underlie the primer sequences; sequence corresponding to

primer F4, derived from humans and rodents, is in italic.

192 S. Duga et al. (Eur. J. Biochem. 259) q FEBS 1999

basis of a conserved sequence of exon 1b [12±14]. The last twopositions at the 3 0 end of this primer were completely degene-rated in order to allow a perfect 3 0 match. RT±PCR assays werecarried out on total RNA from bovine liver with the primercouple F4/R3 (the latter mapping in exon 2), followed by asemi-nested PCR with the inner R4 primer. They allowedamplification a 440-bp fragment which contained 60 bp thatwere almost identical (96.6% identity) to the correspondingregion of the human and rodent exon 1b, joined to exon 2.

F4/R4 amplification was also carried out on genomic DNAand yielded a larger fragment of < 800 bp containing an intronof about 370 bp referred to as intron 1b. It shares its acceptorsplicing site with the 5.5-kb intron 1 processed in transcript Aand with the 1.3-kb intron 1a2 processed in transcript B(Fig. 3b).

Tissue distribution of connexin32 mRNAs

A single connexin32 mRNA band of ,1.6 kb was detected infive of 15 bovine tissues assayed by Northern blot (Fig. 4). Thehighest levels of gene expression were found in liver andkidney; lower levels were detected in spinal cord, brain andintestine.

The expression pattern of the three transcripts identified forthe connexin32 gene (Fig. 3b) was studied using RT±PCRassays. Owing to the higher sensitivity of RT±PCR, connexin32mRNAs were detected in more tissues (Fig. 5). Transcripts Aand B are present in liver, kidney, uterus, intestine, abomasum,testis, ovary and pancreas (the last tissue was not included in theNorthern blot because of the poor quality of the extracted RNA).Because exon 1, recognized by primer F3, is common to bothtranscripts, the primer couple F3/R6 amplified two fragments of218 and 159 bp (transcripts B and A, respectively, Fig. 5b).

Transcript C is expressed in brain and spinal cord, neverthelesslow levels are detectable in liver, providing a further nestedamplification step is performed.

The different intensity of bands in Fig. 5b might be due todifferences in amplification efficiencies between the twotemplates, and/or to different levels of the two transcripts. Inorder to evaluate the amplification efficiency of transcripts Aand B, a PCR assay was performed and samples were analysedat different amplification cycles. Amplification efficiency betweenthe two templates was identical during the whole process(Fig. 6a). Therefore, the different intensity of the bands oftranscripts A and B is considered to reflect their relativeexpression levels in tissues [22].

In order to quantify the relative abundance of each transcriptin the expressing tissues, PCRs were extended to 40 cycles(Fig. 6b). Densitometric measurements of the relative bandintensities showed that transcript B always represents less thanone-tenth of transcript A. Tissue differences were detectable:kidney and ovary showed the highest relative expression level oftranscript B (7±8%), testis and abomasum the lowest detectablelevels (2±3%), while in the other tissues tested, with theexception of pancreas, intermediate values were observed. Inpancreas transcript B is not measurable through F3/R6 ampli-fication. As shown in Fig. 5c, this transcript is present, but canbe detected only by specific PCR (primers F2/R6), as a conse-quence of the very low mRNA level present in this tissue.

DISCUSSION

The bovine connexin32 cDNA sequences reported here wereobtained from overlapping DNA fragments, isolated by differentapproaches from RNA and from genomic DNA.

The 284 amino-acid-encoded connexin32 protein is almost

Fig. 4. Tissue-specific expression of bovine

connexin32 mRNA as detected by Northern

blot hybridization. (a) Total RNAs (15 mg) from

the indicated bovine tissues probed with the

1035 bp homologous cDNA fragment. (b)

Densitometric analyses. Expression levels of

connexin32 mRNA were normalized by

hybridization of the same filter to a b-actin probe.

The amount of connexin32 mRNA in the liver was

set to 100%.

q FEBS 1999 5 0 UTR of Connexin32 (Eur. J. Biochem. 259) 193

identical to other known mammalian connexin32s, showing 97±98% identity [18,21]. The only noteworthy difference is thepresence of an additional glycine at position 235 lying in aglycine-rich context (four glycines in an exapeptide) within theC-terminal cytoplasmic domain [23]. A number of potentialphosphorylation sites, conserved among mammals, were identi-fied within this terminal portion of the protein (Fig. 1). Saezet al. [24] showed that in mouse and rat liver, two of these sites

(Ser 229 and Ser 233) can be phosphorylated by protein kinaseC and the latter (Ser 233) by protein kinase A as well.

The structure of the bovine gene for connexin32 appears to bemore complex than in other mammals, since an additional exon(1a) was discovered. The bovine connexin32 gene consists offour exons (1, 1a, 1b and 2) and four introns (1, 1a1, 1a2 and1b). Exons 1, 1a and 1b contain exclusively 5 0 UTR sequences.The data reported here are consistent with the presence, also in

Fig. 5. RT±PCR assays on total RNA from 16

bovine tissues. (a) Location of the primers with

respect to the connexin32 gene (see also Fig. 3).

RT±PCR products obtained with primer pairs: (b)

F3/R6, identifying transcripts A and B; (c) F2/R6,

identifying transcript B; (d) F5/R6, identifying

transcript C. Arrows indicate the size of the

amplification products verified by sequencing.

The low molecular mass band in panel b was

shown to be a PCR artefact by sequence analysis.

Size marker, pUC8 HaeIII; negative control, no

DNA.

194 S. Duga et al. (Eur. J. Biochem. 259) q FEBS 1999

the bovine gene, of two alternative promoters: P1, upstream ofexon 1 and P2, upstream of exon 1b.

We isolated from bovine liver mRNAs two cDNAs derived,through alternative splicing, from promoter P1. Transcript Aincludes exon 1 and exon 2, while transcript B includes exon 1,the new exon 1a and exon 2. These two cDNAs show a highlevel of overall similarity (between 80% and 90%) with othermammalian connexin32 cDNAs [18,21]. The new exon intranscript B, which is discussed below, does not display anysequence similarity with the known connexin32 5 0 UTRs [12±14]. It will be interesting to verify whether this exon is alsopresent in other members of this gene family, whose intronicsequences are only partially known. Transcript C, originatingfrom promoter P2, exhibited a high degree of identity (96.6%)with the corresponding sequences of the other mammalianspecies [12±14].

The 5 0 UTRs of these transcripts do not show any similaritywith a further connexin32 transcript (Dahl. E., accession numberX84214), suggested to originate from a third promoter, whosepresence in mouse has been reported, with no experimental data,by SoÈhl et al. [14].

A feature specific for bovine connexin32 cDNAs, is thepresence of two potential secondary structures within the 5 0 and3 0 UTRs. The calculated free energy value (282.75 kJ) for thehairpin loop at the very beginning of the 5 0 UTR of transcripts Aand B suggests that this structure might be stable enough torestrict translation [25]. The second hairpin loop is locatedwithin the 3 0 UTR (positions 1076±1107). Its calculated freeenergy value (± 127.1 kJ) could explain the cessation of

sequencing reactions from the 3 0 end of the 1035 bp fragment(see Results) exactly at nucleotide 1107. It has been reportedthat stem-loop elements located within 3 0 UTR could beinvolved in the regulation of mRNA half-life, usually throughbinding of specific proteins [26].

A feature conserved among mammalian connexin32 cDNAs,including bovine, is the presence of an upstream open readingframe (uORF) beginning at position ± 10 (i.e. in exon 2), out-of-frame with respect to the connexin32 start codon, extending134 nucleotides into the coding region and encoding verysimilar peptides of unknown function constituted by 48 aminoacids (43 residues in mouse). These peptides do not showsequence similarity with known proteins. This uORF lies in acontext rather unfavourable for translation [27,28]. However, itsconstant presence in connexin32 cDNAs suggests a possiblerole, either disturbing translation start at the correct AUG ormediating regulatory effects through the encoded peptide [29].

Transcript B showed a unique feature, i.e. the presence of twoadditional in-frame overlapping uORFs starting at nucleotides± 63 and ± 45, respectively, and comprising 18 and 12 codons.Their starting codons are located in functionally differentcontexts, only the first being favourable for translation [27,28].They share the same stop codon (TGA) located six nucleotidesupstream of the ATG start codon of connexin32 and partiallyoverlapping the start codon of the common uORF, this stopsignal is therefore present within the common exon 2. Afunctional role of short uORFs terminating before the main ATGcodon has been demonstrated for some genes such as murinecomplement factor B and CCAAT/enhancer-binding protein,

Fig. 6. Ratio of transcript A and B expression in different tissues. (a) Evaluation of amplification efficiency of transcripts A (B) and B (O) (primers F3/R6).

(b) Relative abundance of transcript B with respect to transcript A (set to 100%), evaluated by RT±PCR (primers F3/R6) in different tissues. Size marker: pUC8

HaeIII; negative control: no DNA.

q FEBS 1999 5 0 UTR of Connexin32 (Eur. J. Biochem. 259) 195

where the uORFs act in cis [30,31], and b2 adrenergic receptormRNA, where the encoded peptide itself is able to inhibitprotein expression [32].

Pyrimidine-rich sequences and polypyrimidine-binding pro-teins are important functional elements in RNA metabolism[33]. A putative cis-element, present within the first (positions873±932) of the three pyrimidine clusters of bovine connexin32mRNA, fits the consensus (C/U)CCANXCCC(U/A)YXUC(C/U)CC perfectly and is found in some stable eukaryotic mRNAs[34]. This sequence has been reported to bind cytosolic proteinsable to form an RNA±protein complex (a-complex) involved inmRNA stabilization [34]. An almost identical sequence atcorresponding positions is also present in the other mammalianconnexin32 mRNAs, except for human where the consensus isonly partially recognizable.

Tissue distribution of the connexin32 mRNA is in substantialagreement with the expression patterns detected in othermammals [35±38], including its prevalence in liver and kidney.RT±PCR analyses with primers specific for the differentconnexin32 mRNA species were carried out in order to assessthe tissue distribution of transcripts A, B and C.

Transcripts A and B share the same qualitative expressionpattern, are absent from nervous tissue and are detectable inliver, kidney, intestine, uterus, abomasum, testis, ovary andpancreas. As PCR efficiency was shown to be identical for thesetwo transcripts, their co-expression was further investigated bydensitometric measurements of the corresponding amplificationbands. Although transcript B exhibits low expression levels, ourresults indicate tissue differences in its relative abundance. Themeaning of these differences is unknown, however, they couldbe part of a subtle transcriptional and/or translational control inphysiological and/or pathological conditions.

Transcript C, which is under the control of promoter P2, ispresent in nervous tissue (brain and spinal cord) thus confirmingits expression specificity, already determined in humans androdents [12±14].

The generation of transcripts differing only in their 5 0 regionshas been described for many unrelated genes and mostlyinterpreted as being an evolutionary gain to refine transcrip-tional and translational control. A relationship between thesealternatively spliced transcripts and a particular function hasbeen suggested for a minority of them. Examples are mouse heatshock protein 47 (HSP 47) gene [39] and human lactoferringene [40]. In the first case, one of the alternative transcriptsacquires an increased translatability at high temperatures, whilein the second case it might play an important role in theregulation of cell growth.

When alternative transcripts arise from distinct promoters,they usually show tissue-specific or cell-specific expression, asin the case of mouse leukaemia inhibitory factor receptor (LIF-R)[41] and mammalian connexin32 transcript controlled bypromoter P2 (refs 12±14 and present paper). Indeed it is moredifficult to understand the significance of 5 0 UTR alternativetranscripts originating from the same promoter, since they oftendo not display clear-cut tissue specificity. Among a number ofpublished examples showing co-expression of these transcriptsare: muscle-specific enolase [42], human vigilin [43], humanCC chemokine receptor 5 (CCR5) [44] and bovine prion protein[45]. The most shared hypothesis suggests that their functionalrole might be related to physiological or metabolic changes.Because no quantitation of the relative abundance between thetranscripts has been performed in the above cases, the existenceof some differences cannot be excluded, as reported here forconnexin32. Subtle transcriptional and post-transcriptional regu-lations have already been argued for connexin32 and other

connexin mRNAs in both normal and regenerating rat liver afterpartial hepatectomy [46, 47], but the mechanisms by whichregulation is achieved have not been elucidated. The newconnexin32 transcript reported here may represent a further stepin identifying the components of such complex mechanisms.Additional information could be acquired through a betterknowledge of the large intron 1 interrupting the 5 0 UTR andharbouring both promoter P2 and exons 1a and 1b. Structuraland functional characterization of this intron is in progress in ourlaboratory.

ACKNOWLEDGMENTS

This work was supported by grants from the Ministero dell'UniversitaÁ e

della Ricerca Scientifica e Tecnologica (MURST 40% and 60%). The

authors thank Elena Pupella Rizzo for excellent technical assistance.

REFERENCES

1. Goodenough, D.A., Goliger, J.A. & Paul, D.L. (1996) Connexins,

connexons, and intercellular communication. Annu. Rev. Biochem. 65,

475±502.

2. Sosinsky, G.E. (1996) Molecular organization of gap junction mem-

brane channels. J. Bioenerg. Biomembr. 28, 297±309.

3. Bruzzone, R., White, T.W. & Paul, D.L. (1996) Connections with

connexins: the molecular basis of direct intercellular signaling. Eur. J.

Biochem. 238, 1±27.

4. Laird, D.W. (1996) The life cycle of a connexin: gap junction formation,

removal, and degradation. J. Bioenerg. Biomembr. 28, 311±318.

5. White, T.W., Bruzzone, R. & Paul, D.L. (1995) The connexin family of

intercellular channel forming proteins. Kidney Int. 48, 1148±1157.

6. Kumar, N.M. & Gilula, N.B. (1996) The gap junction communication

channel. Cell 84, 381±388.

7. White, T.W. & Bruzzone, R. (1996) Multiple connexin proteins in

single intercellular channels: connexin compatibility and functional

consequences. J. Bioenerg. Biomembr. 28, 339±350.

8. Raimondi, E., Gaudi, S., Moralli, D., De Carli, L., Malcovati, M.,

Simonic, T. & Tenchini, M.L. (1992) Assignment of the human

connexin 32 gene (GJB1) to band Xq13, Cytogen. Cell Gen. 60, 210±

211.

9. Castiglioni, B., Ferretti, L., Tenchini, M.L., Mezzelani, A., Simonic, T.

& Duga, S. (1996) Physical mapping of connexin 32 (GJB1) and 43

(GJA1) genes to bovine chromosomes Xq22 and 9q15/16 by fluor-

escence in situ hybridization. Mamm. Genome 7, 634±635.

10. Fishman, G.I., Eddy, R.L., Shows, T.B., Rosenthal, L. & Leinwand,

L.A. (1991) The human connexin gene family of gap junction pro-

teins: distinct chromosomal locations but similar structures. Genomics

10, 250±256.

11. Haefliger, J.A., Bruzzone, R., Jenkins, N.A., Gilbert, D.J., Copeland,

N.G. & Paul, D.L. (1992) Four novel members of the connexin family

of gap junction proteins. Molecular cloning, expression, and chromo-

some mapping. J. Biol. Chem. 267, 2057±2064.

12. Neuhaus, I.M., Dahl, G. & Werner, R. (1995) Use of alternate promoters

for tissue-specific expression of the gene coding for connexin32. Gene

158, 257±262.

13. Neuhaus, I.M., Bone, L., Wang, S., Ionasescu, V. & Werner, R. (1996)

The human connexin32 gene is transcribed from two tissue-specific

promoters. Bioscience Rep. 16, 239±248.

14. SoÈhl, G., Gillen, C., Bosse, F., Gleichmann, M., MuÈller, H.W. &

Willecke, K. (1996) A second alternative transcript of the gap junction

gene connexin32 is expressed in murine Schwann cells and modulated

in injured sciatic nerve. Eur. J. Cell Biol. 69, 267±275.

15. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, 2nd edn, pp. 9.16±9.23. Cold Spring Harbor

Laboratory, Cold Spring, Harbor, NY.

16. Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA

isolation by acid guanidinium thiocyanate±phenol±chloroform extrac-

tion. Anal. Biochem. 162, 156±159.

17. Dumas Milne Edwards, J.B., Delort, J. & Mallet, J. (1991)

196 S. Duga et al. (Eur. J. Biochem. 259) q FEBS 1999

Oligodeoxyribonucleotide ligation to single-stranded cDNAs: a new

tool for cloning 5 0 ends of mRNAs and for constructing cDNA

libraries by in vitro amplification. Nucleic Acids Res. 19, 5227±5232.

18. Kumar, N.M. & Gilula, N.B. (1986) Cloning and characterization of

human and rat liver cDNAs coding for a gap junction protein. J. Cell

Biol. 103, 767±776.

19. Miller, T., Dahl, G. & Werner, R. (1988) Structure of a gap junction

gene: rat connexin-32. Bioscience Rep. 8, 455±464.

20. Hennemann, H., Kozjek, G., Dahl, E., Nicholson, B. & Willecke, K.

(1992) Molecular cloning of mouse connexins26 and -32: similar

genomic organization but distinct promoter sequences of two gap

junction genes. Eur. J. Cell Biol. 58, 81±89.

21. Nishi, M., Kumar, N.M. & Gilula, N.B. (1991) Developmental

regulation of gap junction gene expression during mouse embryonic

development. Dev. Biol. 146, 117±180.

22. Gilliland, G., Perrin, S., Blanchard, K. & Bunn, H.F. (1990) Analysis

of cytokine mRNA and DNA: detection and quantitation by com-

petitive polymerase chain reaction. Proc. Natl Acad. Sci. USA 87,

2725±2729.

23. Milks, L.C., Kumar, N.M., Houghten, R., Unwin, N. & Gilula, N.B.

(1988) Topology of the 32-kd liver gap junction protein determined by

site-directed antibody localizations. EMBO J. 7, 2967±2975.

24. Saez, J.C., Nairn, A.C., Czernik, A.J., Spray, D.C., Hertzberg, E.L.,

Greengard, P. & Bennett, M.V.L. (1990) Phosphorylation of connexin

32, a hepatocyte gap-junction protein, by cAMP-dependent protein

kinase, protein kinase C and Ca2+/calmodulin-dependent protein

kinase II. Eur. J. Biochem. 192, 263±267.

25. Kozak, M. (1994) Features in the 5 0 non-coding sequences of rabbit

alpha and beta-globin mRNAs that affect translational efficiency. J.

Mol. Biol. 235, 95±100.

26. Ross, J. (1996) Control of messenger RNA stability in higher

eukaryotes. Trends Genet. 12, 171±175.

27. GruÈnert, S. & Jackson, R.J. (1994) The immediate downstream codon

strongly influences the efficiency of utilization of eukaryotic

translation initiation codons. EMBO J. 13, 3618±3630.

28. Kozak, M. (1997) Recognition of AUG and alternative initiator codons

is augmented by G in position +4 but is not generally affected by the

nucleotides in positions +5 and +6. EMBO J. 16, 2482±2492.

29. Geballe, A.P. & Morris, D.L. (1994) Initiation codons within 5 0-leaders

of mRNAs as regulators of translation. Trends Biochem. Sci. 19, 159±

164.

30. Garnier, G., Circolo, A. & Colten, H.R. (1995) Translational regulation

of murine complement factor B alternative transcripts by upstream

AUG codons. J. Immunol. 154, 3275±3282.

31. Lincoln, A.J., Monczak, Y., Williams, S.C. & Johnson, P.F. (1998)

Inhibition of CCAAT/enhancer-binding protein a and b translation by

upstream open reading frames. J. Biol. Chem. 269, 9552±9560.

32. Parola, A.L. & Kobilka, B.K. (1994) The peptide prouct of a 5 0 leader

cistron in the b2 adrenergic receptor mRNA inhibits receptor

synthesis. J. Biol. Chem. 269, 4497±4505.

33. Morris, D.R., Kakegawa, T., Kaspar, R.L. & White, M.W. (1993)

Polypyrimidine tracts and their binding proteins: regulatory sites for

posttranscriptional modulation of gene expression. Biochemistry 32,

2931±2937.

34. Holcik, M. & Liebhaber, S.A. (1997) Four highly stable eukaryotic

mRNAs assemble 3 0 untranslated region RNA±protein complexes

sharing cis and trans components. Proc. Natl Acad. Sci. USA 94,

2410±2414.

35. Bennett, M.V.L., Barrio, L.C., Bargiello, T.A., Spray, D.C., Hertzberg,

E. & Saez, J.C. (1991) Gap junctions: new tools, new answers, new

questions. Neuron 6, 305±320.

36. Zhang, J.T. & Nicholson, B.J. (1989) Sequence and tissue distribution of

a second protein of hepatic gap junctions, Connexin26, as deduced

from its cDNA. J. Cell Biol. 109, 3391±3401.

37. Winterhager, E., Stutenkemper, R., Traub, O., Beyer, E. & Willecke, K.

(1991) Expression of different connexin genes in rat uterus during

decidualization and at term. Eur. J. Cell Biol. 55, 133±142.

38. Dermietzel, R. & Spray, D.C. (1993) Gap junctions in the brain: where,

what type, how many and why? Trends Neurosci. 16, 186±192.

39. Takechi, H., Hosokawa, N., Hirayoshi, K. & Nagata, K. (1994)

Alternative 5 0 splice site selection induced by heat shock. Mol. Cell.

Biol. 14, 567±575.

40. Siebert, P.D. & Huang, B.C.B. (1997) Identification of an alternative

form of human lactoferrin mRNA that is expressed differentially in

normal tissues and tumor-derived cell lines. Proc. Natl Acad. Sci. USA

94, 2198±2203.

41. Chambers, I., Cozens, A., Broadbent, J., Robertson, M., Lee, M., Li, M.

& Smith, A. (1997) Structure of the mouse leukaemia inhibitory factor

receptor gene: regulated expression of mRNA encoding a soluble

receptor isoform from an alternative 5 0 untranslated region. Biochem.

J. 328, 879±888.

42. Oliva, D., Venturella, S., Passantino, R., Feo, S. & Giallongo, A. (1995)

Conserved alternative splicing in the 5 0-untranslated region of the

muscle-specific enolase gene. Primary structure of mRNAs, expres-

sion and influence of secondary structure on the translation efficiency.

Eur. J. Biochem. 232, 141±149.

43. KuÈgler, S., Plenz, G. & MuÈller, P.K. (1996) Two additional 5 0 exons in

the human vigilin gene distinguish it from the chicken gene and

provide the structural basis for differential routes of gene expression.

Eur. J. Biochem. 238, 410±417.

44. Mummidi, S., Ahuja, S.S., McDaniel, B.L. & Ahuja, S.K. (1997) The

human CC chemokine receptor 5 (CCR5) gene. Multiple transcripts

with 5 0-end heterogeneity, dual promoter usage, and evidence for

polymorphisms within the regulatory regions and noncoding exons. J.

Biol. Chem. 272, 30662±30671.

45. Horiuchi, M., Ishiguro, N., Nagasawa, H., Toyoda, Y. & Shinagawa, M.

(1997) Alternative usage of exon 1 of bovine PrP mRNA. Biochem.

Biophys. Res. Commun. 233, 650±654.

46. Rosenberg, E., Spray, D.C. & Reid, L.M. (1992) Transcriptional and

posttranscriptional control of connexin mRNAs in periportal and

pericentral rat hepatocytes. Eur. J. Cell Biol. 59, 21±26.

47. Kren, B.T., Kumar, N.M., Wang, S., Gilula, N.B. & Steer, C.J. (1993)

Differential regulation of multiple gap junction transcripts and

proteins during rat liver regeneration. J. Cell Biol. 123, 707±718.