A Novel Non-wounding Transient Expression Assayfor Cereals Mediated by Agrobacterium tumefaciens

Surendar Reddy Dhadi & Aparna Deshpande &

Wusirika Ramakrishna

Published online: 12 May 2011# Springer-Verlag 2011

Abstract A novel Agrobacterium tumefaciens-mediatedtransient expression assay (AmTEA) was developed foryoung plants of different cereal species and the modeldicot Arabidopsis thaliana. AmTEA was evaluated usingfive promoters (six constructs) and two reporter genes, gusand egfp. The constitutive 35S promoter and the promoterof the rice glutaredoxin gene showed gus and egfpexpression in the cereals analyzed in the present study. Apromoter for the DEAD-box RNA helicase family proteingene from Arabidopsis showed similar expression patternsof reporter genes in stable transgenic lines as well as intransient expression lines of Arabidopsis. Agrobacteriumtumefaciens co-cultivation and plant incubation times wereoptimized using 35S and the rice expressed protein genepromoter (R2-273). The possibility of non-specific ex-pression of the reporter genes was ruled out by using theantibiotic carbenicillin and the comparison of expressionof the reporter genes driven by full-length and truncatedR2-273 promoters. AmTEA considerably reduced time,space, labor, and cost requirements. Ease of use with stresstreatments is another major advantage of this method.AmTEA can be automated and used for large-scale studiesto decipher promoter and gene functions with the ultimategoal to enhance the performance of cereal crops againstbiotic and abiotic stresses.

Keywords Rice .Agrobacterium . Transient assay . Cereal

Introduction

The majority of the world’s population is dependent oncereal crops for their staple food. Improving the productionof cereal crops is one of the most important missions ofagricultural research. Plant genetic engineering offers awide variety of tools to achieve this goal. These tools canbe used to re-engineer genes and promoters to producebetter cereal crops.

Agrobacterium tumefaciens has become a major tool inthe hands of plant biotechnologists, for genetic engineeringof plants. Binary vector systems based on Ti plasmid for thedelivery of chimeric genes into various plant systems(Barton and Chilton 1983; Gelvin 2003) have revolution-ized the field of plant genetic engineering. The concept oftransient expression assay (TEA) was first developed usingelectroporation of plant protoplasts (Fraley et al. 1983;Fromm et al. 1985). This was followed by other methodssuch as biolistics (Li et al. 1993; Chlan et al. 1995) andAgrobacterium-mediated tissue culture methods (Bartonand Chilton 1983) to transfer foreign DNA into plant cells.Typical transgenic stable line expression studies with tissueculture practices require 3–6 months compared to about 10–15 days to study the same expression pattern with transientexpression assays. Production and analysis of stabletransgenic lines for a large number of promoters and genesis time consuming and expensive. In addition, some plantspecies are recalcitrant to transformation. TEA is rapid,efficient, and successfully used in several plant systems(Kapila et al. 1997; Wroblewski et al. 2005; Li et al. 2009).Agrobacterium-mediated TEA is becoming the prominentchoice of TEA because it is highly efficient and easy toperform. The major drawback of the existing methods is thewounding of plants, which interferes with the functionalevaluation of stress genes. Here, we describe a method that

Electronic supplementary material The online version of this article(doi:10.1007/s11105-011-0314-5) contains supplementary material,which is available to authorized users.

S. R. Dhadi :A. Deshpande :W. Ramakrishna (*)Department of Biological Sciences,Michigan Technological University,Houghton, MI 49931, USAe-mail: wusirika@mtu.edu

Plant Mol Biol Rep (2012) 30:36–45DOI 10.1007/s11105-011-0314-5

completely eliminates the need for wounding of plants. Ourmethod is reproducible, inexpensive, and requires less timeand labor. Furthermore, AmTEA is highly efficient, rapid,and allows for parallel screening of numerous genes andpromoters to identify potential candidate genes or promotersfor downstream applications. In this study, we developed andoptimized a novel non-wounding AmTEA for cereal cropplants.

Materials and Methods

Constructs Used in the Present Study

Five promoters and six constructs were used in this study.Gus gene in pBI121 and pCAMBIA2201 vectors wasdriven by 35S Cauliflower Mosaic Virus promoter (CaMV35S) with pCAMBIA2201 harboring a catalase intron inthe gus gene. CaMV 35S promoter was used to studyAmTEA in all the cereal plants because it is a constitutiveplant promoter. A promoter for a rice gene encodingputative expressed protein (LOC_Os02g16690), designatedas R2-273, its 5′-truncated version, a putative glutaredoxingene (LOC_Os08g45140) promoter, and Arabidopsis pro-moter for the gene encoding DEAD-box RNA helicasefamily protein (At3g58510) were the other four promotersused in this study. Rice promoters were used to establishthe method for rice and other cereal plants. In order toconfirm that this method generates results similar tothose observed in stable transgenic lines, we usedArabidopsis as a model system to test ArabidopsisDEAD-box RNA helicase family protein encoding genepromoter in both AmTEA and stable transgenic lines.These promoters were ligated to gus–egfp fusion reportergene system in the vector pBGWFS7 (Figure S1; Karimiet al. 2002). Rice and Arabidopsis promoters wereamplified by PCR and cloned using Gateway cloningsystem (Invitrogen). Agrobacterium strain GV3101 wasused for all co-cultivation procedures.

Growth of Plants Under Sterile Conditions

Cereal seeds were dehusked and washed thrice withsterile water. Seeds were rinsed twice with 70% alcoholand incubated with 50% commercial bleach (5.25%hypochlorite) on a shaker at 150 RPM for 15–20 min.Seeds were rinsed further with sterile water to ensurecomplete removal of bleach from the seeds. The seedswere then dried on sterile filter paper for 10 min andsowed in magenta boxes containing basal MS/Chu’s N6salts (Phytotechnology Lab) solidified with phytagel(2 g/L; Sigma-Aldrich). Seeds were allowed to growuntil two to three leaf stages (12–15 days) and these

plants were subjected to Agrobacterium co-cultivationprocedures. All the steps were carried out in a laminar airflow cabinet.

Growth of Young Cereal Plants and Arabidopsisin the Greenhouse

Arabidopsis and cereals were grown in soil. After 10 days,the young cereal plants were uprooted, cleaned with water,and soaked in sterile 0.5 MS solution. Before co-cultivation,seed remnants and decaying leaves were removed from theyoung plants and washed with sterile water to avoidsubsequent contamination. Arabidopsis plants (20–25 daysold) with flowers and immature fruits were uprooted fromsoil and cleaned with sterile water to remove soil particles.

Agrobacterium Co-cultivation and Stress Treatments

Young cereal plants were uprooted from the media andthe roots were cleaned with sterile 0.5 MS salt solutionto remove the solidified medium. Overnight grownAgrobacterium culture (~1 OD) in LB broth (Millermodification) was used for all co-cultivation procedures.Five to ten young cereal plants were co-cultivated withAgrobacterium (10 ml overnight grown culture and 30 mlLB broth) harboring the construct of interest supplementedwith 100 μM Acetosyringone (20 μl; Sigma-Aldrich) andSilwet L-77 (10 μl; Lehle Seeds) at 28°C for 15 h at70 rpm. After co-cultivation, the plants were rinsed thricewith sterile distilled water or 0.5 MS salt solutionsupplemented with 500 mg/L carbenicillin (Phytotechnol-ogy Lab) to prevent bacterial contamination. These plantswere placed in a sterile 15-mm petri dish and incubated for8–12 h with 15–20 ml of MS salt solution supplementedwith carbenicillin (500 mg/L) and then subjected to salt ordrought stress for 5 h. For salt stress, 200 mM NaClsolution was added in place of MS salt solution. Fordrought stress, the plants were placed on a sterile filter/Whatman paper and care was taken not to dry themcompletely. Four controls were used to ensure that theobserved expression is a direct result of the promoteractivity and not a false positive result from bacterial orfungal contamination or background expression fromplants. The controls include a water control, Agrobacterium(GV3101) cells (no plasmid), Agrobacterium withpBGWFS7 vector (no promoter), and E. coli withpBGWFS7 vector (no promoter). For water controls, theplants were cleaned and incubated in 20–40 ml of MS saltsolution supplemented with Silwet L-77 (10 μl) and 100 μMAcetosyringone (20 μl). These plants were rinsed andsubjected to the same stress conditions as those of theexperimental plants. The plants subjected to the stresstreatments were incubated for 3–6 h with a photoperiod of

Plant Mol Biol Rep (2012) 30:36–45 37

16:8 (light/dark) and an optimum temperature of 22–24°C (other than temperature stress). The proceduresdescribed above for Agrobacterium co-cultivation andstress treatments were also used for Arabidopsis plants.We also studied this method by wounding the plants withgentle surface scratching of the stem, leaves, and rootswith a sterile needle. The rest of the procedure was thesame as described above (non-wounding method).

Effect of Agrobacterium Co-cultivation and PlantIncubation Times in MS Salt Solution on Reporter GeneExpression

We analyzed the effect of Agrobacterium co-cultivation andplant incubation times in MS salt solution on the efficiencyof expression of reporter genes. For this process, 12 daysold rice plants grown under sterile conditions wereincubated with Agrobacterium cultures for 2, 5, 8, 11, 15,and 20 h. After co-cultivation, the plants were washed andincubated in sterile MS salt solution for 12, 24, 36, and 48 hfollowed by evaluation of GUS expression.

Downstream Process and Applications

Plants were observed for GFP fluorescence under a stereofluorescent dissecting microscope (Leica MZ10F) andsubjected to histochemical GUS staining as described byJefferson (1987). Carbenicillin (500 mg/L) was added to theGUS buffer to prevent non-specific GUS expression. Theentire protocol is shown as a flowchart (Figure S2).

Quantitative Expression Analysis of gus and egfp ReporterGenes

Total RNA was isolated from three plants for eachpromoter using the RNeasy plant mini kit (Qiagen).Double DNase treatment (Qiagen) was carried out toeliminate contaminating DNA. First strand cDNA syn-thesis was performed using high-capacity cDNA reversetranscription kit (Applied Biosystems). qRT-PCR was

performed using Taqman probes, primers, and Taqmangene expression master mix (Applied Biosystems) forgus, egfp, and EF1α genes as per manufacturer’s instruc-tions. Two biological and three technical replicates wereanalyzed for each promoter. Expression of gus and egfpgenes were normalized to the rice endogenous controlEF1α (Qi et al. 2010) and to the experimental control.Taqman primers and probes were designed using thePrimer Express software (Applied Biosystems). Sequencesfor Taqman primers and probes used for this work arelisted in Table 1.

Results

Utility of AmTEA as a Universal Method for Cereals

A novel non-wounding AmTEA was developed for rapidassessment and functional characterization of promotersand genes since wounding and non-wounding AmTEAgave very similar results (Figure S3). This method can beeasily adapted to different plant species. Twelve days oldyoung plants were used for this method, which minimizedboth time and space requirements. Cost and labor effec-tiveness are other major advantages of young-plantlet-basedAmTEA. Two promoters, a constitutive 35S and a ricepromoter for glutaredoxin gene, were used to show theutility of young-plantlet-based AmTEA for the functionalanalysis of promoters and genes (Fig. 1).

CaMV 35S promoter driven expression of gus reportergene was consistent every time the assay was performed incereals (rice, barley, maize, oats, rye, sorghum, and wheat)demonstrating its versatility as a constitutive promoter(Fig. 2). The above experiments establish the adaptabilityand applicability of AmTEA to different cereals. Micro-scopic analysis showed gus gene expression driven by 35Spromoter in stomata, parenchymal, and mesenchymal cellsof rice leaves (Fig. 3).

The putative glutaredoxin gene (LOC_Os08g45140)promoter mostly elicited constitutive expression in rice.

Sequence name 5′ Dye Oligo sequence 3′ Dye

GUSA_F CAAGGTGCACGGGAATATTTCG

GUSA_R GAACATTACATTGACGCAGGTGATC

EF1ALPHA_F CCCAAGAGGCCATCAGACAA

EF1ALPHA_R CCGATCTTGTACACGTCCTGAAG

GFP_F AGAACGGCATCAAGGTGAACTT

GFP_R CGCTGCCGTCCTCGAT

GUSA_M 6FAM TCGGGTCGAGTTTACG MGBNFQ

EF1ALPHA_M 6FAM CCCTGCGTCTTCCC MGBNFQ

GFP_M 6FAM TTGTGGCGGATCTTG MGBNFQ

Table 1 List of Taqman primersand probes used for qRT-PCR

38 Plant Mol Biol Rep (2012) 30:36–45

Under salt and drought stress and to some extent at roomtemperature (25°C), this promoter drove high levels ofreporter expression in rice plants (Fig. 4a). Cold stress(4°C) resulted in very little or no GUS expression. Thispromoter showed good expression levels at room temper-ature (RT) in other cereals: barley, maize, rye, andsorghum (Fig. 4b). The comparison of expression patternsbetween GUS and eGFP driven by the rice gluteredoxingene promoter in rice leaves under RT and drought stress

is shown in Fig. 4c. The observed expression pattern ofgus gene driven by the rice glutaredoxin gene promoterwas in coherence with the established functionality ofglutaredoxin (Eckardt 2007; Diao et al. 2011). Abiotic andbiotic stresses induce the accumulation of reactive oxygenfree radicals in plant cells which leads to increased levelsof cellular glutaredoxin. High levels of glutaredoxinmaintain the delicate redox homeostatic balance in plantcells (Eckardt 2007).

Conserved Expression Patterns of Reporter Genes in Stableand Transiently Expressing Arabidopsis Plants

The construct harboring Arabidopsis promoter for thegene encoding DEAD-box RNA helicase family protein(At3g58510) promoter was used to carry out bothAmTEA and generation of stable transgenic lines inArabidopsis. Reporter genes driven by this promotershowed the same expression pattern in leaves and flowerswith respect to both AmTEA and stable transgenic linesunder drought stress (Fig. 5). Expression of the reportergenes was not observed at room temperature. Thisdemonstrates that the gene/promoter expression detectedby AmTEA is in coherence with that of the stabletransgenic lines. It also indicates the reduction in thetime required for deciphering promoter/gene expressionin plants using AmTEA.

gus

Catalase Intron

Rice glutaredoxin egfp

Arabidopsis DEAD-box RNA helicase family protein

pBI 121

pCAM 2201

pBGWFS7

pBGWFS7

Vector Promoter Reporter Gene

CaMV 35S

Rice expressed protein - 5’ truncated promoter pBGWFS7

Rice expressed protein pBGWFS7

gus

gus

gus

gus

gus

egfp

egfp

egfp

CaMV 35S

Fig. 1 Organization of the six promoter–reporter gene constructs usedfor AmTEA

eziaMeciR

Wheat

Barley

Oats Sorghum Rye

Fig. 2 GUS expression drivenby CaMV 35S promoter inpBI121 vector in young plantsof rice, barley, maize, oats, rye,sorghum, and wheat usingAmTEA

Plant Mol Biol Rep (2012) 30:36–45 39

Agrobacterium Co-cultivation and Plant Incubation Timesin MS Salt Solution Affect Reporter Gene Activity in Plants

CaMV 35S promoter and rice promoter R2-273 were usedto study the effects of Agrobacterium co-cultivation andMS salt solution incubation times of plants on GUSexpression in plants. Rice plants incubated for 2 and 5 hshowed several fold lower expression levels compared tothose incubated for 11, 15, and 20 h with Agrobacteriumcultures (Fig. 6a). Real-time RT-PCR analysis of gusexpression levels confirmed the histochemical GUS results.The second variable studied was the effect of different

incubation times on reporter gene expression of Agro-bacterium-treated young plants. Higher reporter geneexpression was observed from 8 to 24 h of incubation inMS salt solution and it decreased thereafter. Overall,12 days old rice plants grown in sterile MS basal saltmedium incubated for 11–20 h in Agrobacterium culturesand 8–20 h in MS salt solution were ideal for producinghigh expression of the transgenes.

The effect of different concentrations of Agrobacteriumcultures (overnight grown cultures, 1:1, 1:2, and 1:3dilutions with LB broth) on Agrobacterium co-cultivatedfor 2, 5, 11, 15, and 20 h on GUS activity was evaluated.

Stomata

Mesenchymal cells

C

A

Palisade parenchymal cells

B

Fig. 3 Microscopic analysis ofGUS expression driven by 35Spromoter in a rice leaves(×10 magnification). The samesample was sectioned andviewed under ×100 magnifica-tion. GUS expression waslocalized in b parenchymalcells and stomata and cmesenchymal cells

Rice - RT Salt Stress Drought Stress Cold Stress

Sorghum Rye Maize Barley

A

B

Rice- RT Drought Stress Drought Stress RT

C

Fig. 4 Reporter geneexpression driven by the riceglutaredoxin promoter. GUSexpression in a rice plants atroom temperature (RT), salt,drought, and cold stress, and bbarley, maize, rye, and sorghumat RT. c GUS and eGFPexpression in rice leaves at RTand drought stress observedunder a fluorescentsteromicroscope

40 Plant Mol Biol Rep (2012) 30:36–45

Similar results were observed in these experiments withdifferent Agrobacterium concentrations.

AmTEA—A Useful and Reliable Tool for DecipheringPromoter and Gene Function in Plants

In order to establish the reliability of AmTEA and to provethat the observed expression is not a consequence of non-specific bacterial expression, three independent experimentswere performed. The first experiment assessed the activityof residual Agrobacterium cells and other bacterial contam-ination without the use of antibiotics. This experimentresulted in non-specific GUS expression from residualAgrobacterium and endophytes (Fig. 7a). To eliminate thisproblem, three antibiotics, vancomycin, cefotaxime, andcarbenicillin, were tested for their ability to inhibitAgrobacterium growth using antibiotic disk test method.Agrobacterium showed highest sensitivity to carbenicillinwhich is in accordance with the studies by da Silva andFukai (2001). Treating young plants with GUS buffersupplemented with the antibiotic carbenicillin ensuredelimination of non-specific GUS activity from residualAgrobacterium and endophytes (Fig. 7b). Based on theseresults, we used carbenicillin in all the experimentsreported in this study. The second experiment investigatedthe expression of gus reporter gene with an intron(catalase), which cannot be processed by bacterial systems

to demonstrate that AmTEA is effective in this case.Expression of gus gene driven by the 35S promoterobserved in this experiment was comparable to theexpression of gus gene with no intron (Fig. 8). For thethird experiment, the 5′-truncated R2-273 promoter(339 bp deletion out of 1,062 bp full-length promoter)was studied for its ability to drive the expression of thereporter genes, and this resulted in drastic reduction ofGUS and eGFP expression compared to the full-lengthR2-273 promoter (Fig. 9b and c). The above results werevalidated by qRT-PCR which identified about fivefoldhigher expression of gus and egfp driven by the full-lengthR2-273 promoter compared to its 5′-truncated version(Fig. 9d). This experiment verifies that the observedreporter gene expression driven by full-length R2-273promoter with respect to the truncated R2-273 promoter isthe result of a functional promoter and not due to non-specific GUS activity. Summing up the essence of theseindependent experiments, AmTEA can be asserted as apromising method for deciphering gene and promoterexpression patterns in cereals.

Discussion

AmTEA has been successfully employed to study transientgene expression in tobacco seedlings using vacuum

A B C

D E F

Fig. 5 Conserved expression pattern of reporter genes driven byArabidopsis promoter for the gene encoding DEAD-box RNAhelicase family protein in transiently expressing plants and stableArabidopsis lines subjected to drought stress. Stable transgenic lineshowing expression of a eGFP in leaf, b eGFP in flower, and c GUS

expression in the plant. The stigma and the anthers in the flowerexhibit auto-fluorescence, which was also observed in the wild type.Transient expression of d eGFP in leaf, e eGFP in flower, and f GUSexpression in the plant using AmTEA

Plant Mol Biol Rep (2012) 30:36–45 41

Fig. 6 Agrobacteriumco-cultivation time influencesGUS expression in riceplants. GUS assay performedwith rice plants co-cultivatedwith Agrobacterium harboringthe construct with promoterR2-273 for 2, 5, 8, 11, 15,and 20 h and incubated in MSsalt solution for 12 h

Agrobacterium Agrobacterium with pBGWSF7

E. Coli with pBGWSF7

A

B

Water control

Fig. 7 Effect of the antibiotic carbenicillin on GUS expression in young rice plants. a Non-specific expression of GUS was observed whencarbenicillin was not added to GUS buffer. b Complete suppression of non-specific GUS expression was observed on addition of carbenicillin

42 Plant Mol Biol Rep (2012) 30:36–45

infiltration (Rossi et al. 1993), plasmolysed rice embryos(Uze et al. 1997), and maize callus cultures (Amoah et al.2001). We demonstrated the use of our novel non-wounding young-plantlet-based AmTEA for the analysisof promoters in different cereal plants. This methodemployed 12–15 days old intact young plants consistingof leaves, stem, and roots, which is similar to performingthe experiment in a mature plant. AmTEA does not requirevacuum infiltration, sonication, or wounding. Ease of usewith respect to performing stress treatments is an addedadvantage of our method. It works equally well forflowering Arabidopsis plants (1-month-old plants withflowers and immature fruits). AmTEA offers the flexibility

to study the expression patterns in reproductive tissues anddeveloping fruits, which is not possible with callus orprotoplasts. Furthermore, there is no need for advancedinstrumentation or expensive and environmentally hazardouschemicals, demonstrating the cost-effectiveness and eco-friendliness of the method. Conservation of time, space, andresources are the major advantages of this method. AmTEAcan be automated, based on the fact that it uses minimumlabor and contact with young plants.

Agrobacterium co-cultivation with the young plantsresults in Agrobacterium carryover contamination, whichinterferes with downstream applications like GUS and qRT-PCR assays. The contamination problem can be eliminated

BAFig. 8 Expression of an intron(catalase) containing gus genedriven by CaMV 35S promoterin pCAMBIA 2201 usingAmTEA. Histochemical GUSstaining a water control and bpCAMBIA 2201

A

B

C

D

Fig. 9 Full-length rice promoter R2-273 show high levels of GUSand eGFP expression compared to the 5′-truncated promoter.Histochemical staining of GUS and fluorescence microscopic analysisof rice plants subjected to AmTEA showing a water controls, b full-

length promoter, and c 5′-truncated promoter. d Quantitative real-timeRT-PCR of gus and egfp driven by the full-length promoter comparedto its 5′-truncated version

Plant Mol Biol Rep (2012) 30:36–45 43

by the use of the antibiotic carbenicillin and maintainingsterile conditions throughout the experiment and cleaningthe plants with carbenicillin-supplemented sterile water.Previous transient expression assays did not mention theuse of bactericidal or bacteristatic agents to prevent non-specific expression of reporter genes from residual Agro-bacterium or endophytes (Kapila et al. 1997; Wroblewski etal. 2005; Li et al. 2009). Assessing the water controls forbackground GUS activity from plants due to endophytes isanother key factor. Multiple repetitions of the experimentsand proper interpretation of the results with respect to watercontrols is the key to success with AmTEA.

Based on our findings, the young-plantlet-basedAgrobacterium-mediated transient expression assay is auseful tool for functional analysis of promoters and genes.AmTEA can be used to study the role of cis-regulatoryelements in abiotic (Bi et al. 2011; Wang et al. 2010) andbiotic stresses (Meng et al. 2010), gene regulatoryelements conserved in multiple plant species (An andMeagher 2010), characterize enhancers and insulators(Singer et al. 2010; Saha et al. 2011), and tissue-specificpromoters (Kato et al. 2010). Furthermore, gene interrela-tionships or “gene webs” can be studied under differentstress treatments with the aid of microarrays. AmTEA canbe easily adapted to evaluate promoters and genes indicots other than Arabidopsis, including plants with fruitssuch as citrus (Liu et al. 2011) and tomato. The small sizeand tender nature of the young plants offer the possibilityof automation of this method for high throughputscreening of promoters and genes.

Acknowledgment We thank USDA-GRIN for providing the seedsof rice, barley, maize, Sorghum, rye, and oats. This work wassupported by the National Research Initiative of the USDA Cooper-ative State Research, Education and Extension Service, grant number2007-35301-18036. We thank the Michigan Technological Univer-sity’s Biotech Research Centre (BRC) for their continuous support andfunding. We personally thank Lorie Bernhardt (Dale BumpersNational Rice Research Center) for providing bulk quantities of riceseeds. We thank Dr. Chandrashekhar P. Joshi (Michigan TechnologicalUniversity) for the plasmid pBI121 and Dr. Victor Busov forAgrobacterium (GV3101). We also thank the Institute of PlantSystems Biology, Ghent University, Belgium, for pBGWFS7 andCAMBIA, Australia, for pCAMBIA2201.

References

Amoah BK, Wu H, Sparks C, Jones HD (2001) Factors influencingAgrobacterium mediated transient expression of uidA in wheatinflorescence tissue. J Exp Bot 52:1135–1142

An Y-QC, Meagher RB (2010) Strong expression and conservedregulation of ACT2 in Arabidopsis thaliana and Physcomitrellapatens. Plant Mol Biol Rep 28:481–490

Barton KA, Chilton MD (1983) Agrobacterium Ti plasmids asvectors for plant genetic engineering. Methods Enzymol101:527–539

Bi C, Chen F, Jackson L, Gill BS, Li W (2011) Expression of ligninbiosynthetic genes in wheat during development and uponinfection by fungal pathogens. Plant Mol Biol Rep 29:149–161

da Silva JAT, Fukai S (2001) The impact of carbenicillin, cefotaximeand vancomycin on chrysanthemum and tobacco TCL morpho-genesis and Agrobacterium growth. J Appl Hort 3:3–12

Chlan CA, Lin JM, Cary JW, Cleveland TE (1995) A procedure forbiolistic transformation and regeneration of transgenic cottonfrom meristematic tissue. Plant Mol Biol Rep 13:31–37

Diao G, Wang Y, Wang C, Yang C (2011) Cloning and functionalcharacterization of a novel glutathione S-transferase gene fromLimonium bicolor. Plant Mol Biol Rep 29:77–87

Eckardt NA (2007) Oxidation pathways and plant development:crosstalk between thioredoxin and glutaredoxin pathways. PlantCell 19:1719–1721

Fraley RT, Rogers SG, Horsch RB et al (1983) Expression of bacterialgenes in plant cells. Proc Natl Acad Sci U S A 80:4803–4807

Fromm M, Taylor LP, Walbot V (1985) Expression of genestransferred into monocot and dicot plant cells by electroporation.Proc Natl Acad Sci U S A 82:5824–5828

Gelvin SB (2003) Agrobacterium-mediated plant transformation: thebiology behind the “gene-jockeying” tool. Microbiol Mol BiolRev 67:16–37

Jefferson RA (1987) Assaying chimeric genes in plants: the GUS genefusion system. Plant Mol Biol Rep 5:387–405

Kapila J, De Rycke R, Van Montagu M, Angenon G (1997) AnAgrobacterium-mediated transient gene expression system forintact leaves. Plant Sci 122:101–108

Karimi M, Inze D, Depicker A (2002) Gateway vectors for Agro-bacterium-mediated plant transformation. Trends Plant Sci7:193–195

Kato H, Xie G, Sato Y, Imai R (2010) Isolation of anther-specific genepromoters suitable for transgene expression in rice. Plant MolBiol Rep 28:381–387

Li L, Qu R, Kochko AD, Fauquet C, Beachy RN (1993) An improvedrice transformation system using the biolistic method. Plant CellRep 12:250–255

Li J-F, Park E, von Arnim AG, Nebenführ A (2009) The FASTtechnique: a simplified Agrobacterium-based transformationmethod for transient gene expression analysis in seedlings ofArabidopsis and other plant species. Plant Methods 5:6

Liu Y-Z, Dong T, Lei Y, Deng X-X, Gu Q-Q (2011) Isolation of apolygalacturonase gene from Citrus sinensis fruit and itsexpression relative to fruit mastication trait, fruit development,and calcium or boron treatments. Plant Mol Biol Rep 29:51–59

Meng X, Li F, Liu C, Zhang C, Wu Z, Chen Y (2010) Isolationand characterization of an ERF transcription factor gene fromcotton (Gossypium barbadense L.). Plant Mol Biol Rep28:176–183

Qi J, Yu S, Zhang F, Shen X, Zhao X, Yu Y, Zhang D (2010)Reference gene selection for real-time quantitative polymerasechain reaction of mRNA transcript levels in chinese cabbage(Brassica rapa L. ssp. pekinensis). Plant Mol Biol Rep 28:597–604

Rossi L, Escudero J, Hohn B, Tinland B (1993) Efficient assay for T-DNA dependent transient gene expression. Plant Mol Biol Rep11:220–229

Saha D, Kumar V, Bhat SR, Srinivasan R (2011) Characterization ofupstream sequences of the LOJ gene leads to identification of anovel enhancer element conferring lateral organ junction-specificexpression in Arabidopsis thaliana. Plant Mol Biol Rep 29:265–277

Singer SD, Hily J-M, Liu Z (2010) A 1-kb bacteriophage lambdafragment functions as an insulator to effectively block enhancer–promoter interactions in Arabidopsis thaliana. Plant Mol BiolRep 28:69–76

44 Plant Mol Biol Rep (2012) 30:36–45

Uze M, Wunn J, Puonti-Kaerlas J, Potrykus I, Sautter C (1997)Plasmolysis of precultured immature embryos improvesAgrobacterium mediated gene transfer to rice (Oryza sativaL.). Plant Science 130:87–95

Wang X, Dong J, Liu Y, Gao H (2010) A novel dehydration-responsive element-binding protein from Caragana korshinskii is

involved in the response to multiple abiotic stresses and enhancesstress tolerance in transgenic tobacco. Plant Mol Biol Rep28:664–675

Wroblewski T, Tomczak A, Michelmore R (2005) Optimization ofAgrobacterium-mediated transient assays of gene expression inlettuce, tomato and Arabidopsis. Plant Biotechnol J 3:259–273

Plant Mol Biol Rep (2012) 30:36–45 45