Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

1

Assessment of genetic relatedness in the

honeybee Apis mellifera L. (Hymenoptera:

Apidae) colonies by using microsatellite loci

Nadia M. Hassona1, Frans Jacobs2, A. K. Mourad1, O. A. Zaghloul1, O. El- Ansary3

1Plant Protection Department, Faculty of Agriculture- Saba Basha, Alexandria

University, Alexandria, Egypt. 2Zoophysiology Department, Faculty of science, Gent University, Gent, Belgium.

3Entomology Department, Faculty of Agriculture –El-Shatby Alexandria

University, Alexandria, Egypt.

Abstract In this study the relatedness was estimated between mother queen's colony and

her daughters' queens' colonies, by extracting DNA from their individual workers

offspring (N= 20) and using five microsatellite loci. Locus A43 indicated more

diversity in the length of alleles from 130 to 162 PB with frequency from 0.05 to 0.1,

followed by locus A76 that showed alleles lengths 210 to 340 PB with frequency 0.05

to 0.2 that's means big diversity in the colonies individuals due to the numbers of

drones mated with mother queen. On the other hand, A107 illustrated the weight of

alleles from 179 to 205 PB with frequency 0.05 to 0.25. Loci B124 and ACOO6

showed also height frequency of 0.25 and indicated more relatedness. Through locus

B124 the Correlation coefficient was 1.00 between P.Q & F1.Q3 and 0.87 for P.Q &

F1.Q1 & F1.Q3. A43 indicated relatedness through the correlation coefficient (0.968)

between F1.Q1&F2.Q2. The microsatellites demonstrated that there was a genetic

diversity within and between colonies.

Key words: Apis mellifera / DNA microsatellite / sister queens / the relatedness

INTRODUCTION The relatedness is a key component of Hamiltonꞌs rule (Hamilton 1963),

which seeks the explanation of altruism evolution among relatives. The Hymenoptera

have special place in studies of the evolution of social behaviour, because of their

male –haploid sex determination mechanism. Full sister have 3/4 of thier identical

genes by descent (instead of 1/2 in diploid organisms); hence altruistic acts between

them are more likely to be favoured by selection.

Honeybee queens mate many times (Jean-Prost 1957) which dramatically

reduce the average relatedness between nestmate workers, and hence the likelihood

that selection favours altruistic acts between them.

Estoup et. al. (1994) illustrated that the sociobiologists have long sought to

estimate precisely the relatedness among members of social insect colonies, because

of the central significance of kinship in evolutionary and behavioural studies. By

using microsatellites, they directly identified the 7-20 subfamilies (partrilines) present

in five honeybee colonies belonging to three different subspecies (Apis mellifera

mellifera, A.m.carnica and A.m. ligustica). in focusing further investigations on one

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

2

A. m. mellifera colony, they showed that the genetics structure remained largely

unchanged over time as long as the colony was headed by the same queen. The

genetic diversity within the colony also provided a good estimate of the genetic

diversity of the local honeybee population.

Kraus et. al. (2005), reported that the number of colonies rather than the actual

number of individuals in the population, primarily determined the effective population

size. They presented a method where microsatellite data of haploid males could be

used to estimate the number of male producing queens in honeybee populations.

SchlÜns et. al. (2005), illustrated that the honeybee, Apis mellifera, has an

extremely polyandrous mating system, which often involves multiple nuptial flights

by its queens. To understand the evolution of extreme polyandry, they investigated the

cost of multiple nuptial flights in relation to potential benefits.

Kocher et. al. (2008), indicated that, the molecular mechanisms underlying the

post-mating behavioral and physiological transitions undergone by females have not

been explored in great detail. Honey bees represent an excellent model system in

which to address these questions because they exhibit a range of "mating states," with

two extremes (virgins and egg laying, mated queens) that differ dramatically in their

behaviour, pheromone profiles, and physiology.

Moritz et. al. (2008), stated that the population size of social bee colonies in

the wild is often difficult because nests are highly cryptic. Because of the honeybee

Apis mellifera mating behaviour, is characterized by multiple mating of queens at

drone congregation areas (DCA), it is possible to use genotypes of drones caught at

these areas to infer the number of colonies in a given region.

Here in, this paper the microsatellite represent an abundant class of hyper

variable markers in the honeybee and enable highly precise dissection of genetic

structure of colonies.

MATERIALS AND METHODS

1-Biological materials (sampling):

Different honeybee colonies of Apis mellifera carnica were under study.

Worker samples were collected from mother colony, other worker samples were

collected in September 2010 from colonies with F1 queens of natural mated and

artificial inseminated, in addition to drone samples used in the artificial insemination.

Worker samples F2 collected in April 2011 from two different colonies, with queens

mated naturally at Gent in Belgium and others mated naturally at Island in Germany.

Worker samples F3 were collected in August 2011 from colonies headed by queens

mated naturally at Gent in Belgium and queens artificially inseminated in the

laboratory of zoo physiology. All samples have been transferred to liquid nitrogen and

stored at -20 C until "DNA" extraction.

2- DNA extraction:

In this respect, the mother samples have been chosen from artificial

inseminated queens and their "DNA" was extracted from one leg of each worker,

according to the modified Chelex extraction protocol as described by Walsh et al.

(1991), which be summarized in the following steps in order:

1. Separating one medial leg from each worker by forceps, squeezing in liquid

nitrogen.

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

3

2. Transferring the starting material into 1.5 ml reaction tube. (A mechanical

disruption or a cutting of the material will increase the lysis efficiency)

3. Adding 400 µl Lysis Buffer G and 40 µl Proteinase K and vortex thoroughly.

4. Incubate the reaction tube at 52°C until the lysis be completed under constant

shaking. For material that is difficult to lyse, they recommend to vortex the tube

several times (in this case the reaction tube was incubated overnight).

5. Centrifuging for 2 min at maximum speed to spin down non lysed material.

Transfer the supernatant into a new 1.5 ml tube.

6. Adding 200 µl Binding Buffer T and vortex for 10 sec.

7. Placing a Spin Filter into a 2.0 ml Receiver Tube. Transfer the suspension onto the

Spin Filter and incubate for 1 min. Close Spin Filter and centrifuge at 13.000 x g

(12.000 rpm) for 2 min.

8. Discarding the filtrate and place the Spin Filter again into the Receiver Tube.

9. Add 550 µl Wash Buffer, close Spin Filter and centrifuge at 13.000 x g (12.000

rpm) for 1 min. Discard the filtrate, place the Spin Filter again into the Receiver

Tube.

10. Repeating the washing step once, discarding the filtrate, putting the Spin Filter

back into the Receiver Tube and removing the residual ethanol by final

centrifugation for 2 min at 13.000 x g (12.000 rpm).

11. Placing the Spin Filter into a 1.5 ml Receiver Tube, adding 200 µl of the pre-

warmed Elution Buffer D, incubating for 3 min at room temperature and

centrifuging for 2 min. at 8.500 x g (9.500 rpm).

3-Microsatellite analysis: All individuals were genotyped at five microsatellite loci AC006- A43- A127-

A76- B124 according to Kraus et al. (2005). Thereafter standard polymerase chain

reaction (PCR) protocol was carried out according to Estoup et al. (1994).

Polymerase chain reaction (PCR) was done using 10µl solution containing 5-

10 ng DNA template, 400 nM of each primer, 75µM each of dGTP, dCTP and dTTP,

6µM dATP, 0.7 µCi [35

S] dATP, 1.5-2 mM MgCl2 (Table, 1), 20 µg ml-1

bovine

serum albumin, 1X Promega reaction buffer, and 0.4 unit of Promega Taq

polymerase. After a denaturing step for 3 min at 94°C, samples were processed

through 25 cycles (table 1) consisting of 30 s at 94°C, 30 s at 54-62 °C (table 1), and

30 s at 72 °C. The last elongation step was lengthened to 10 min.

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

4

Table (1): Sequence of primers and PCR conditions for the used five

microsatellites

Locus Sequence of primers Mgcl2

(mµ)

Annealing

temperature/ºc

Number of

cycles

ACOO6 F: GATCGTGGAAACCGCGAC

R: CACGGCCTCGTAACGGTC

2 55 25

A76 F: GCCAATACTCTCGAACAATCG

R: GTCCAATTCACATGTCGACATC

1.5 55 25

A107 F: CCGTGGGAGGTTTATTGTCG

R: GGTTCGTAACGGATGACACC

1.5 55 25

A43 F: CACCGAAACAAGATGCAAG

R: CCGCTCATTAAGATATCCG

1.5 55 25

B124 F: GCAACAGGTCGGGTTAGAG

R: CAGGATAGGGTAGGTAAGCAG

2 55 25

RESULTS AND DISSCUSIONS

1- Microsatellite locus ACOO6 and the microsatellite analysis for the mother

queen offspring and first generation queen's offspring:

The Microsatellite analysis showed the difference between the mother offspring

and their daughters' offspring by using the first microsatellite locus ACOO6 photo (1,

A). Tables (2&3) referred to the molecular weight, base pair (BP), for each worker

offspring and the queen mother offspring (P.Q.) which were 175, 175, 170, 170 and

160. The locus ACOO6 opined that the workers offspring number 1 and number 2 had

the same weight of 175 BP, while the workers number 3 and number 4 characterized

by another weight of 170 BP. It means that workers offspring number 1 and 2 were

full sister, and have the same father, and the workers number 3 and 4 were also full

sister and have the same father. The first daughter offspring (F1Q1) molecular weights

were 175, 175, 150, 180 and180. These results indicated that the first and the second

worker offspring had the same weight of 175 BP. It means that both of them had the

same father, while the fourth and fifth workers had the same weight of 180 BP and it

means that both were full sister. The second daughter offspring (F1Q2) molecular

weights were 151, 160, 151, 180 and 180. These data described that the worker

offspring number 1 & 3 had the same weight of 151 BP and the worker offspring

number 4 &5 had the same weight 180 BP; it means that all the workers offspring

(1&3) and (4&5) were full sister. The third daughter offspring (F1Q3) molecular

weights were 181, 181, 178, 181 and 178. F1Q3 data demonstrated that workers

offspring number 1 & 2 and 4 had the same weight of 181, which means that they

came from the same father and another workers numbers 3 & 5 had the same weight

of 178; which means that those workers have the same father. ANOVA showed that

F value was 1.961 it means there was no significant difference among the four groups

P.Q., F1Q1, F1Q2, and F1Q3. The correlation analysis in (Table, 4) indicated that the

correlation between P.Q. and F1Q1 was 0.16, while between P.Q. and F1Q2 was 0.68

whereas; between P.Q. and F1Q3 was 0.75. It means that the relatedness in the

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

5

pedigree between mother queen and third daughter was stronger than that of the

mother and second daughter. Reversely, the relatedness between mother queen and

first daughter was very weak; it may be due to the different patrilines. On the other

hand, the correlation between F1Q1 and F1Q2 & F1Q3 was 0.67 & 0.51 which means

that relatedness between first daughter and second daughter not strong enough, but

better than the relatedness between the first daughter and the third one. The

correlation between F1Q2 and F1Q3 was also 0.068 that indicated unrelatedness

between them which may be due to the big diversity in the patrilines between them.

As a discussion, Chevalet & Cornuet (1982), declared that the drones that sired

the queen of a colony were unrelated to each other and to the queen, the coefficient

relatedness between two females of the same colony is equal to 0.75 if they belong to

the same patrilines, and 0.25 if they belong to different patrilines.

Table (2): Patrilines analysis of Apis mellifera carnica colonies in Belgium

(Genotypes of queens, deduced from their workers progeny, were given for 5

microsatellite loci.)

No. of

Offspring ACOO6

BP A76 BP

A107 BP

A43 BP

B124 BP

1(P.Q) 175 330 190 142 230

2(P.Q) 175 320 190 155 230

3(P.Q) 170 290 187 140 240

4(P.Q) 170 320 195 149 235

5(P.Q) 160 310 195 142 230

1(F1Q1) 175 210 180 130 240

2(F1Q1) 175 230 185 138 250

3(F1Q1) 150 250 195 152 265

4(F1Q1) 180 260 179 150 265

5(F1Q1) 180 242 205 145 245

1(F1Q2) 151 330 200 132 225

2(F1Q2) 160 280 194 139 230

3(F1Q2) 151 290 190 162 225

4(F1Q2) 180 310 190 158 223

5(F1Q2) 180 290 205 145 250

1(F1Q3) 181 340 190 150 220

2(F1Q3) 181 320 195 152 220

3(F1Q3) 178 330 187 160 230

4(F1Q3) 181 320 187 149 225

5(F1Q3) 178 340 195 140 220

P.Q. = Parent Queen. F1 Q1 = First generation for the Queen number 1. F1 Q2 = First generation for

the Queen number 2. F1 Q3 = First generation for the Queen number 3.

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

6

Table (3): Allelic frequencies in all offspring.

Locus A43 Locus A76 Locus A107 Locus B124 Locus ACOO6

N=20 N=20 N=20 N=20 N=20

allele frequency allele frequency allele frequency allele frequency allele frequency

130 0.05 210 0.05 179 0.05 220 0.15 150 0.05

132 0.05 230 0.05 180 0.05 223 0.05 151 0.1

138 0.05

242 0.05

185 0.05

225 0.15

160 0.1

139 0.05 250 0.05 187 0.15 230 0.25 170 0.1

140 0.1 260 0.05 190 0.25 235 0.05 175 0.2

142 0.1 280 0.05 194 0.05 240 0.1 178 0.1

145 0.1 290 0.15 195 0.25 245 0.05 180 0.2

149 0.1 310 0.1 200 0.05 250 0.1 181 0.15

150 0.1 320 0.2 205 0.1 265 0.1

152 0.1 330 0.15

155 0.05 340 0.1

158 0.05

160 0.05

162 0.05

N is number of worker offspring for mother and her three daughters.

Table (4): The correlation among mother queen offspring and her daughter's

offspring through microsatellite loci.

Offspring

ACOO6

Microsatellite loci

A76

A107

A43

B124

P.Q&F1Q1 -0.163 -0.570 0.086 -0.150 0.874

P.Q&F1Q2 -0.680 0.577 0.373 -0.191 -0.471

P.Q&F1Q3 0.745 0.000 0.237 -0.026 1.00**

F1Q1&F1Q2 0.665 -0.401 0.481 0.968**

-0.466

F1Q1&F1Q3 0.509 -0.492 0.409 0.204 0.874

F1Q2&F1Q3 -0.068 0.375 0.679 0.395 -0.471

**. Correlation is significant at the 0.01 level (2-tailed)

2- Microsatellite locus A76 and the microsatellite analysis for mother queen

offspring and first generation queen's offspring:

The single hyper variable A76 photo (1, B) illustrated the difference between the

mother offspring and their daughters' offspring in Tables (2&3) that indicated the

molecular weight, base pair (BP), for each worker offspring. The queen mother

offspring (P.Q.) were 330, 320, 290, 320 and 310. The locus A76 showed that the

workers offspring number 2 and number 4 had the same weight of 320 BP. it means

that worker offspring number 2 and 4 were full sisters. The first daughter offspring

(F1Q1) molecular weights were 210, 230, 250, 260 and 242. The second daughter

offspring (F1Q2) molecular weights were 330, 280, 290, 310 and 290. These data

showed that worker offspring number 3 & 5 had the same weight of 290 BP, which

means that the two workers offspring were full sisters. The third daughter offspring

(F1Q3) molecular weights were 340, 320, 330, 320 and 340. F1Q3data indicated that

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

7

workers offspring numbers 2& 4 had the same weight of 320. It means that they were

sharing the same father. ANOVA showed that F value was 29.096 it is meant that

there were significant differences among the four groups (P.Q., F1Q1, F1Q2, and

F1Q3), while L.S.D. at level 0.05 was 24.22. The correlation analysis indicated that the

correlation between P.Q. and F1Q1 was 0.57, but between P.Q. and F1Q2 was 0.58 also

between P.Q. and F1Q3 was 0. It means that the relatedness in the pedigree between

mother queen and the three daughter queens were not strong enough, whereas there

were unrelated pedigree between mother queen and the third daughter. It was due to

the different patrilines and more diversity among them. On the other hand, in Table

(4) the correlation between F1Q1 and F1Q2 and F1Q3 were 0.40 & 0.49. It means that

there was unrelation among them. The correlation between F1Q2 and F1Q3 also was

0.38 that indicated unrelated pedigree among them, which may be due to the vast

diversity in the patrilines among them.

According to Estoup et al. (1994) the distributions of allele's occurrences in the

population and in the drone samples were not significantly different. It is found

through the Fishers exact test. They illustrated that these similarities in the number,

nature and frequency of alleles clearly indicate a diversified origin of fathers.

3- Microsatellite locus A107 used in the parent offspring and first generation

queens offspring:

The third microsatellite A107 photo (1, C) showed the differences among the

mother offspring and their daughters' offspring in Tables (2&3). It is noticed that the

molecular weight, base pair (BP), for each worker offspring which expressed the

queen mother offspring (P.Q.) were 190, 190, 187, 195 and 195. The locus A107

opined that the workers offspring number 1 and number 2 had the same weight of 190

BP; also number 4 and number 5 had the same weight of 195 BP. This means that

worker offspring number 1 and 2 were full sisters that had the same father, while the

workers number 4 and 5 were full sisters and had another father. The first daughter

offspring (F1Q1) molecular weights were 180, 185, 195, 179 and 205. The second

daughter offspring (F1Q2) molecular weights were 200, 194, 190, 190 and 205. These

data indicated that the workers offspring numbers 3 & 4 had the same weight of 190

BP, this means that the two workers offspring were full sisters. The third daughter

offspring (F1Q3) weight were 190, 195, 187, 187 and 195. F1Q3data showed that the

workers offspring number 2 & 5 have the same weight of 195. It means that they had

the same father and other workers numbers 3 & 4 had the weight of 187, which means

that those workers had the same father. ANOVA showed that "F" value was 0.898

that means that there were no significant differences among the four groups (P.Q.,

F1Q1, F1Q2, and F1Q3). The correlation analysis Table (4) indicated that the

correlation between P.Q. and F1Q1 was 0.086, while between P.Q. and F1Q2 was 0.37

also between P.Q. and F1Q3 was 0.24. It implied that there were unrelated in the

pedigree among mother queen and the three daughters, which was due to the different

patrilines. Conversely the correlation between F1Q1 and F1Q2 & F1Q3 were 0.48 &

0.41 that means the relatedness between the first daughter and the second daughter

was very weak. The correlation between F1Q2 and F1Q3 was 0.068 and that indicated

relation among them, but not strong enough due to the vast diversity in the patrilines

between them.

4- Microsatellite locus A43 was used in the parent offspring and first generation

queens' offspring:

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

8

Microsatellite A43 photo (1, D) and Tables (2&3) illustrated the molecular

weights, base pair (BP), for each worker offspring which expressed the queen mother

offspring (P.Q.) were 142, 155, 140, 149 and 142. The first daughter offspring (F1Q1)

molecular weights were 130, 138, 152, 150 and 145. The second daughter offspring

(F1Q2) molecular weights were 132, 139, 162, 158 and 145. The third daughter

offspring (F1Q3) weights were 150, 152, 160, 149 and 140. ANOVA analysis showed

that "F" value was 0.547, it means that there was no significant differences among the

four groups (P.Q., F1Q1, F1Q2, and F1Q3). The correlation analysis in Table (4) found

that the correlation between P.Q. and F1Q1 was 0.15, while between P.Q. and F1Q2

was 0.19, also between P.Q. and F1Q3 was 0.026. It implied that there were

unrelations in the pedigree among mother queen and the three daughters, which was

due to the different patrilines. On the other hand, the correlation between F1Q1 and

F1Q2 & F1Q3 was 0.96 & 0.20, this means that the relatedness pedigree between first

daughter and second daughter was very strong but there was unrelated between the

first daughter and third daughter. The correlation between F1Q2 and F1Q3 was also

0.40 that indicated a relation among them, but not strong enough, that may be due to

the vast diversity in the patrilines between them.

The locus A43 demonstrated more diversity among the mother queen offspring

and her three daughter offspring. All of them have different molecular weights

although their weights between some of them were approximately having a nearest

degree of molecular weight.

5- The microsatellite locus B124 used in the parent offspring and first generation

queen offspring:

Microsatellite B124 photo (1, E) showed the differences between the mother

offspring and their daughters' offspring. In Tables (2&3) the molecular weight, base

pair (BP), for each worker offspring, which expressed the queen mother offspring

(P.Q.) were 230, 230, 240, 235 and 230. The locus B124 indicated that the workers

offspring numbers 1, 2 and 5 had the same weight of 230 BP. It means that the

workers offspring numbers 1, 2 and 5 were full sisters and had the same father. The

first daughter offspring (F1Q1) molecular weights were 240, 250, 265, 265 and 245.

Results indicated that workers numbers 3 and 4 had the same weight of 265 BP. The

second daughter offspring (F1Q2) molecular weights were 225, 230, 225, 223 and 250.

The third daughter offspring (F1Q3) weights were 220, 220, 230, 225 and 220. F1Q3

data signified that workers offspring numbers 1 & 2 & 5 had the same weight of 220,

which means that they came from the same father. ANOVA showed that "F" value

was 11.036. It means that occurrence of significant differences among the four groups

(P.Q., F1Q1, F1Q2, and F1Q3) and the L.S.D was 12.56 at level 0.05. The correlation

analysis stated that the correlation between P.Q. and F1Q1 was 0.87 while between

P.Q. and F1Q2 was 0.47 also between P.Q. and F1Q3 was 1.00. It is meant that there

were strong relatedness in the pedigree between mother queen and the first & the third

daughter's offspring, but the relation between mother queen offspring and second

daughter offspring was weak. On the other hand, in Table (4) the correlation between

F1Q1 and F1Q2 & F1Q3 was 0.46 & 0.87 which means that the relatedness is very weak

between the first daughter and second daughter, whereas it was very strong between

the first and the third daughter. The correlation between F1Q2 and F1Q3 was also 0.47,

which indicated the relation among them was very weak.

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

9

Microsatellite B124 indicated the stronger relatedness between the mother queen

offspring and the first and third daughter queen's offspring compared with others

microsatellite loci.

The abovementioned results could be explained by Moritz (1986), who found that

the contributions of fathers to the progeny of the queen were unequal. During mating,

ejaculates of drones were first deposited in the median oviduct of the queen. After the

mating flight, a small fraction of sperm of each drone migrates towards the

spermatheca where, it has been stored (Ruttner 1956). The unequal contribution of

fathers to the progeny may be due to several factors (variations in the volume of

ejaculates, mating order, sperm competition, etc.). Estoup et al (1994) mentioned that

the practical importance for population genetic studies is that just a few colonies can

make up a good representative sample for the whole population.

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

10

A B

C D

E

Photo (1): Microsatellite analysis of A) Locus ACOO6, B) Locus A76, C) Locus A107, D) Locus A43,

and E) Locus B124, of four kinds of samples, worker samples from 1:5 express the offspring of the

first daughter queen F1. Workers samples from 6:10 express the offspring of second daughter

queen F1. Workers samples from 11:15 of third daughter F1 offspring. Workers samples from

16:20 of mother offspring. M: DNA marker. P: Positive control DNA. N: Negative control

without DNA. MW: Molecular weight. BP: base pair.

Comm. Appl. Biol. Sci, Ghent University, 78/2, 2013

359 - 368

11

REFERENCES

Chevalet, C. and J. M. Cornuet (1982). Etude théorique sur la selection du caractére

"production de miel" chez Abeille. l. modéle génétique et statistique.

Apidologie 13, 39-65.

Estoup A., M. Solignac and J. M. Cornuet (1994). Precise assessment of the

number of patrilines and of genetic relatedness in honeybee colonies.

Proc. R. Soc. Land. B. 258,1-7.

Hamilton, W. D. (1963). The evolution of altruistic behavior. Am. Nat. 97, 354- 356.

Jean-Prost, P. (1957). Observations sur le vol nuptial desreines d´abeilles. C. hebd.

Séanc. Acad. Sci., Paris 245, 2107- 2110.

Kocher S. D. ; F.J. Richard; D. R. Tarpy and C. M. Grozinger (2008). Genomic

analysis of post-mating changes in the honey bee queen (Apis mellifera).

BMC Genomics ( 9:232)1-15.

Kraus F. B.; P. Neumann and R. F. A. Moritz (2005). Genetic variance of mating

frequency in the honeybee (Apis mellifera L.). Insect. Soc. (52) 1–5.

Moritz R. F. A. (1986). Intracolonial workers relationship and sperm competition in

the honey bee (Apis mellifera L.). Experientia 42, 445-448.

Moritz R. F. A., Dietemann V. and Crewe R. (2008). Determining colony densities

in wild honeybee populations (Apis mellifera) with linked microsatellite

DNA markers, J Insect Conserv (12):455–459.73

Ruttner, F. (1956). The mating of the honey bee. Bee world 37, 2-15, 23-24.

SchlÜns, H.; R. F. A. Moritz; P. Neumann; P. Kryger and G. Koeniger (2005). Multiple nuptial flights, sperm transfer and the evolution of extreme

polyandry in honeybee queens. Animal behaviour (70), 125–131.

Walsh, P. S., D. A. Metzger and R. Higuchi (1991). Chelex (R)100 as a medium for

simple extraction of DNA for PCR-based typing from forensic material.

Biotechniques 10: 507.