Ž .Molecular Brain Research 52 1997 307–317

Research report

Behavioural sensitization in 6-hydroxydopamine-lesioned rats is relatedto compositional changes of the AP-1 transcription factor: evidence for

induction of FosB- and JunD-related proteins

Daniela Vallone c, Maria Teresa Pellecchia a, Micaela Morelli b, Pasquale Verde c,Gaetano DiChiara b, Paolo Barone a,d,)

a Department of Neurological Sciences, UniÕersity of Napoli, 80131 Napoli, Italyb Department of Toxicology, UniÕersity of Cagliari, 09100 Cagliari, Italyc International Institute of Genetics and Biophysics, 80125 Napoli, Italy

d NEUROMED, 04100 Pozzilli, Italy

Accepted 22 July 1997

Abstract

Rats with unilateral dopamine denervation exhibit turning behaviour in response to the selective D1 agonist SKF 38393 only after aprevious exposure to dopamine agonists. We demonstrate here that this ‘priming’ phenomenon is related to both an increased expressionof the pre-existing AP-1 complex and the occurrence of novel AP-1 complexes which are formed by FosB- and JunD-related proteins.While the former protein is expressed as a consequence of the dopamine denervation, the latter is related to the first exposure to adopamine agonist. Pre-treatment with MK-801, an antagonist for glutamatergic receptors, prevents both the priming development and theAP-1 compositional changes. Rotational behaviour induced by SKF 38393 closely correlates with the presence of the priming AP-1complexes, regardless of the capability of the D1 agonist to induce the immediate-early gene cFos. q 1997 Elsevier Science B.V.

Keywords: 6-Hydroxydopamine; Priming; Supersensitivity; Dopamine agonist; AP-1; FosB; JunD; cFos

1. Introduction

Ž .The experimental lesion of nigral dopamine DA neu-Ž .rons by 6-hydroxydopamine 6-OHDA is currently uti-

lized as an animal model for the study of the adaptativemechanisms which take place in Parkinson’s disease inresponse to the loss of DA neurons and to the treatment

w xwith L-DOPA and DA receptor agonists 10,39 . Ratsbearing unilateral 6-OHDA lesions turn contralaterally tothe lesioned side in response to DA receptor agonists,

Ž .either generic apomorphine, L-DOPA or selective for D1and D2 receptors. The turning behaviour is regarded as anexpression of striatal DA receptor denervation supersensi-

w xtivity 39 . Furthermore, this behavioural response isstrongly enhanced when the lesioned rats are exposed to asingle administration of a generic or selective DA agonist

) Corresponding author. Department of Neurological Sciences, Univer-sita di Napoli Federico II, via S. Pansini 5, 80131 Napoli, Italy. Fax:`

Ž .q39 81 746-2670; E-mail: barone@unina.it

a few days before the challenge with either DA agonistw x23 .

This sensitization phenomenon, termed ‘priming’, isparticularly strong in the case of challenge with the D1receptor agonist SKF 38393. This drug elicits contralateralturning in drug-naive 6-OHDA-lesioned rats only at high

w xdoses but becomes quite effective in primed rats 23 . Onthe basis of in vitro and ex vivo evidence, D1-dependentcontralateral turning in primed rats is related to an increase

w xin efficiency of the transduction of the D1 message 2,24 .The mechanism by which such change takes place isobscure but might conceivably involve changes in geneexpression of striatal cells as a result of combined influ-ence of DA denervation and exposure to a dopamineagonist.

Transcription factors are nuclear proteins which regu-late gene expression. Long-lasting changes in gene expres-sion have been associated to the development of sensitiza-

w xtion and tolerance to drugs 9,29 . The activating protein 1Ž .AP-1 complexes are products of heterodimerization oftwo of several transcription factors, including c-Fos, c-Jun,

0169-328Xr97r$17.00 q 1997 Elsevier Science B.V. All rights reserved.Ž .PII S0169-328X 97 00253-2

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317308

w xFra-1, Fra-2 and FosB 1,20,26,30,42 . Changes in eithercomposition or quantitative expression of some of thesecomplexes in neurons have been shown in a wide varietyof experimental conditions, including seizures, circadian

wrhythms, drug treatments and noxious stimulations 17–x19,28,34 .

In 6-OHDA-lesioned rats, both the lesion per se and therepeated treatment with mixed D1rD2 agonists increasethe expression of putative transcription factors related to

Ž .Fos Fos-related antigens, FRAs in the denervated stria-w xtum 17,35 . Among the FRAs, the truncated form of

w xFosB, DFosB 27 , reportedly increases following thechronic alterations in dopaminergic neurotransmissionw x5,6,12,18 . Although providing strong evidence of changesin certain transcription factors after dopamine denervation,the above studies had not focused on the priming aspectsof the 6-OHDA lesion model and not correlated the be-havioural response, i.e. turning, to the molecular changes.

This study was designed to evaluate the possible changesin the transcription complexes occurring in striatal neurons

Ž .as a consequence of 1 the unilateral dopamine denerva-Ž .tion according to the 6-OHDA lesion paradigm, 2 the

first exposure of lesioned animals to a dopamine agonistŽ . Ž .induction of priming , 3 the challenge with a low doseof SKF 38393 which is able to induce rotation only in

Ž .primed animals expression of priming . Finally, the effectof pharmacological manipulation of priming on transcrip-tion factors was studied in animals pre-treated with MK-801, a N-methyl-D-aspartate antagonist able to prevent the

w xpriming of SKF 38393-induced rotation 25 .

2. Materials and methods

2.1. Animals, surgical procedures and experimental design

Male Sprague-Dawley rats, weighing 250–300 g wereŽ .anaesthetized with chloral hydrate 400 mgrkg i.p. , posi-

tioned in a David Kopf stereotaxic apparatus and injectedŽinto the left medial forebrain bundle coordinates A: y2.2,

L: y1.5, V: y7.4, according to the atlas of Pellegrino etw x.al. 33 with 8 mg 6-OHDA dissolved in 4 ml saline

containing 0.05% ascorbic acid, in order to lesion the DAnigrostriatal pathway. The animals were housed in groups

Žof four per cage on a 12-lightrdark cycle from 07:00 to.19:00 h with free access to food and water. For 3 consecu-

tive days after the lesioning, rats were tested for theirspontaneous ipsilateral turning during the dark period.Only rats showing at least ten ipsilateral rotations in a3-min observation time were used for the subsequentexperiments. This procedure allows to select animals carry-ing )95% decrease of dopamine in the striatum of the

w xlesioned side as compared to the contralateral one 15,22 .14 days after lesioning, rats were randomly assigned to

Ž .two groups and received either saline not primed rats orL-DOPA, 50 mgrkg i.p., plus the DOPA decarboxylase

Ž .inhibitor benserazide, 30 mgrkg i.p. primed rats . Thefirst group of experiments was designed to study themolecular alterations following dopamine denervationandror priming. At 17 days after the lesion, both primedand not primed rats were sacrificed by decapitation. Thestriata of both sides were dissected out on ice and frozen inliquid nitrogen until use.

The second group of experiments evaluated the effectsof pharmacological manipulations of priming at the molec-ular level. For this purpose, at 14 days after lesioning, ratswere randomly assigned to three groups and received

Ž . Ž .either saline not primed rats , or L-DOPA primed rats , orŽ . Ž .L-DOPAqMK-801 0.1 mgrkg s.c. primedqMK-801 .

It is known that blockade of the N-methyl-D-aspartateŽ .NMDA receptors by MK-801 during priming prevents

w xthe ability of L-DOPA to act as a primer 25 . After 3 days,all animals of this experimental set were tested for rota-

Ž .tional behaviour by SKF 38393 injection 3 mgrkg s.c. .Circling behaviour was recorded in plastic hemisphericindividual cages. Turns recorded during 5 min prior to thesacrifice were considered for the analysis.

The third group of experiments evaluated the relation-ship between molecular alterations and turning behaviourfollowing D1 agonist injection. In this animal group, at 17days after the lesion, both primed and not primed rats were

Ž .injected with SKF 38393 3 mgrkg s.c. . All rats weresacrificed 45 min after SKF 38393 injection. Turningrecording, sacrifice and tissue dissection were performedas described above.

2.2. Nuclear extract preparation

Tissues were Dounce homogenized in 10 vols. of asolution containing 10 mM HEPES pH 7.9, 10 mM KCl,

Ž1.5 mM MgCl , O.1 mM EGTA, O.5 mM DTT homo-2.genization solution . The cells were disrupted by passage

through a 26-ga needle. Nuclei were collected by centrifu-gation at 1500 rpm and re-suspended in a 1.2 vol. ofextraction solution containing 10 mM HEPES pH 7.9, 0.4M NaCl, 1.5 mM MgCl , O.1 mM EGTA, 0.5 mM DTT,2

5% glycerol, to allow elution of nuclear proteins by gentleshaking at 48C. Nuclei were pelletted again by centrifuga-tion at 12 000 rpm and the supernatant was stored at

Žy708C until use. The protease inhibitors leupeptin 5. Ž . ŽmM , aprotinin 1.5 mM , phenylethylsulfunilfluoride 2. Ž . Ž .mM , peptastatin A 3 mM , benzamidine 1 mM were

added to both homogenization and extraction solutions.Protein concentration was determined by a Bio-Rad pro-tein assay.

( )2.3. Electrophoretic mobility shift assay EMSA

Ž .Nuclear extracts 2.5 mg of proteins were incubated in20 mM HEPES pH 7.5, 40 mM KCl, 5% glycerol with 1

Ž .mg poly dI-dC and 5 mM spermidine for 10 min at roomtemperature. The incubation continued for 15 min after the

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317 309

probe addition. The incubation was carried out in 20 mlvol. The sequences of the probe oligonucleotides were:

ŽAP-1 canonical TRE of human collagenase promoter,. X X w xcollTRE 5 TTCCGGCTGACTCATCAAGCG3 1 ;

CREB consensus oligonucleotide of the somatostatin pro-Ž . Xmoter somCRE 5 AGAGATTGCCTGACGTCAGA-

X w x ŽGAGCTAG3 4 ; AP-1 non-canonical sequence from nu-. Ž .cleotide y71 of the human c-jun promoter c-jun1TRE

X X w x5 GCCCATGATGTCACCCCA3 40 . The core consen-sus sequences are in bold. EMSA were performed on 5 or

Ž8% native polyacrylamide gels acrylamide : biss29 : 1 in

.0.5=TBE . Competition experiments were performed byŽ .adding unlabelled olingonucleotides 5–100-fold excess

to the reaction mixture.For the antibody-mediated inhibition and supershift

analysis, the reactions were performed by pre-incubatingnuclear extracts with 1 mg of antibody at 48C for a

Ž .minimum of 3 h. The anti-c-JunrAP-1 N -specific, anti-Ž . Ž . Ž . Ž .JunrAP1 D a Jun , anti-JunB N-17 , anti-JunD 329 ,Ž . Ž . Ž .anti-c-Fos 4 -specific, anti-FosB 102 , anti-Fra-1 N-17 ,Ž . Ž .anti-Fra-2 L-15 , anti-CREB-1 24H4B , anti-ATF-1

Ž . Ž .C41-5.1 , anti-ATF-2 F2BR-1 were purchased from

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317310

Ž . Ž .Fig. 2. Supershift analysis of the multiple AP-1 complexes in denervated striatum of primed rats L-P . A: supershifted complexes SS were detectedfollowing the incubation with antibodies exhibiting partial or complete selectivity for the individual Jun and Fos proteins. a J236 and a J237 are polyclonal

Ž .antibodies recognizing all Jun family members with a relative affinity for c-Jun)JunB)JunD and c-Jun)JunD)JunB, respectively see Section 2 .a Jun recognizes all members with equal affinity. Evident supershift was obtained by a J237, a Jun, a JunB, a JunD and a FosB. Both the pre-existing

Ž .AP-1 complex and the two novel complexes a,b are shifted by selective a FosB and a JunD. A smaller amount of supershifted complex was obtainedŽ .with a JunB. B: identification of complexes bound to Jun1TRE. The novel priming-induced complexes a,b were supershifted by a JunD and a FosB

antibodies but not by aATF2 and a CREB antibodies.

Ž .Santa Cruz Biotechnology and anti-c-Jun J-236 and J-237Žwere kindly gifted by Dr. M. Yaniv Institute Pasteur,

.Paris .

2.4. Immunoblotting and antibody

The nuclear extracts separated by 12% sodium dodecylŽ .sulfate-polyacrylamide gel electrophoresis SDS-PAGE

were transferred to Immobilon-P Transfer membranesŽ .Millipore . Membranes were blocked with 5% non-fat

milk proteins and incubated with anti-FosB and anti-JunDantibodies at a diluition of 1 : 5000. Bound antibodies weredetected by the appropriate horseradish peroxidase-con-jugated secondary antibodies followed by enhanced chemi-

Ž .luminescence ECL; Amersham .

2.5. RNA extraction and Northern analysis

Striatal total RNA was extracted by using the guanidinew xthiocyanate method 7 . Northern blots and hybridizations

Fig. 1. In vitro AP-1rATF2rCREB binding following 6-OHDA-induced lesion and priming. Electrophoretic mobility shift analysis of the binding to theŽ . Ž . Ž . Ž .consensus AP-1 A; collTRE , a CRE-like B; Jun1TRE and the consensus CRE C; somCRE binding sites of striatal nuclear extracts from control cont.

Ž . Žand 6-OHDA unilaterally lesioned rats. In the latter group, both left and right striata of primed L-P and R-P, respectively and not primed L-NP and.R-NP rats were analysed. In all 6-OHDA-lesioned rats, the left striatum corresponded to the dopamine denervated side. A: the upper band representing the

pre-existing AP-1 complex was observed in all tissues, resulting augmented in both L-P and L-NP nuclear extracts with a more intense signal in the formerŽ .tissue. Only in the denervated striatum of primed rats two complexes with faster migration were revealed a,b . B: detection of multiple complexes by the

Ž .Jun1TRE sequence. The arrows indicate ATF2-containing complexes, the CREB-containing complex and the faster complexes a,b which were formedonly in the presence of L-P nuclear extracts. C: no difference in the binding pattern to the somCRE oligonucleotide was observed in all tissues. Thebinding specificity of the complexes in L-P nuclear extracts was studied by competition experiments adding 5–100-fold molar excess of the unlabeled

Ž . Ž X . Ž X . Ž X .oligonucleotides comp. : collTRE A , Jun1TRE B and somCRE C . The probe DNA sequences and concentrations are described in Section 2. Theresults of A–C are representative of three experiments with four animals for each experimental group. The complexes, as indicated by arrows were

Ž .identified on the basis of results shown in Fig. 3 and data of previous analysis data not shown .

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317 311

were carried out as previously described by Sambrook etw x w 32 xal. 37 . cDNA probes were labelled with a P dCTP

Žusing the random oligonucleotide primer Ready-To-Go,. 8Pharmacia to a specific activity G7=10 cpmrmg. The

probes used were: a 2.1-kb EcoRI-EcoRI fragment corre-w xsponding to the cDNA of the mouse fosB gene 42 ; a

1.7-kb EcoRI-EcoRI fragment corresponding to the cDNAw xof the mouse junD gene 16 ; a 0.4-kb EcoRI-HindIII

fragment corresponding to the cDNA ribosomal of thehuman 18S.

( )2.6. ReÕerse transcriptase-PCR RT-PCR analysis

2 mg of total RNA, digested with DNase, werereverse-transcribed using random exonucleotides as primersŽ . Ž .100 mM and 12 U AMV reverse transcriptase Promega .10 ng of cDNA were amplified in a 25 ml reaction mixturecontaining Taq DNA polymerase buffer, O.2 mM dNTPs,1.5 mM MgCl , 0.4 mM of each primer, 0.5 ml of2

Žformamide, 1 U Taq DNA polymerase RED-HOT Ad-. Žvanced Biotechnology . After a first denaturing step 958C

.for 4 min , PCR amplification was performed for 30 cyclesŽ .958C for 1 min, 598C for 45 s, 728C for 45 s and was

Ž .followed by a final extension step 728C for 5 min .Ž X X.Sequences 5 -3 of oligonucleotide forward and reverse

primers used for amplification of specific cDNAs were:GGCGGGGCAAGCGGAAGTGGTG and CAGGTGAG-GACAAACGAGGAAG for murine fosB; AGCG-G C G G G A T T G A A A C C A a n d G G C G -GCGGGAAGGGCACTG for rat junD. These primers weredesigned on the basis of the sequence of the fosB murine

Žgene nucleotides 2552–2573 and 4877–4899, respec-. w x Žtively 21 and the junD rat gene nucleotides 361–381

. w xand 798–816, respectively 41 . The amplified productswere separated by 2% agarose gel electrophoresis. Ampli-fication of contaminating genomic DNA was excluded by

Ž .control experiments not shown .

3. Results

3.1. DNA-binding actiÕity: deÕelopment of a noÕel AP-1complex

DNA-binding activity of nuclear protein extracts wasŽ .studied by using three different probes: 1 the consensus

Fig. 3. FosB and JunD immunoblots. A: the Western blots were incubated with an antibody specific for FosB protein. Apparent molecular mass valuesŽ .kDa are indicated on the sides. Dopamine denervation augmented the band at 35–37 kDa in the lesioned side striata of both primed and not primed ratsŽ .L-P and L-NP, respectively . While the 46-kDa protein was in agreement with the size expected for FosB, the 58-kDa band remained unidentified and was

Ž X . Ž . Ž .not reproducibly obtained. A FosB immunoblot of L-P compared with rat thyroid phorbol esther-treated "TPA cells PC chosen as a positive controlŽ .for FosB and DFosB induction. Note that the 35–37-kDa protein in L-P exhibited electrophoresis mobility different from DFosB 33 kDa in PC cells. B:

the JunD-specific antibody allowed to show that the 41-kDa protein, presumably JunD, was not modified by either denervation or priming while anadditional 28-kDa protein was detected in both striata of primed rats. These results are representative of three experiments with four animals for eachexperimental group.

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317312

AP-1 site because of its extensive involvement in manyŽ .signal-dependent processes in neurons; 2 a CRE-like

Ž .site-sharing nucleotides with both AP-1 and CRE sites; 3Ž .the CRE cAMP response element site since it is closely

related to the dopamine signal transduction pathway.In the first set of experiments, AP-1-binding activity

was evaluated by incubating protein extracts in the pres-ence of the collTRE probe. Gel mobility shift assaysrevealed differences in intensity of the major AP-1 com-plex in the lesioned side striata compared with the unle-sioned side. This complex, the pre-existing AP-1, is repre-sented in all treatment groups, but it appeared enhanced in

Ž .the denervated striatum of primed rats L-P . Furthermore,only in this tissue two lower bands were detected and

Ž . Ž .named priming-related AP-1 pAP-1 complexes Fig. 1A .Competition experiments in which incubation was carriedout in the presence of unlabelled collTRE sequence, con-

Ž X.firmed the specificity of the AP-1 complexes Fig. 1A .In the second set of experiments, nuclear extracts were

incubated with the Jun1TRE probe. This octanucleotidecan be alligned to the consensus sequences for both AP-1and CRE. In our conditions of binding assay, the jun1TREbinds multiple complexes formed by ATF2 and CREB,

Žthat we have identified by gel supershift analysis see Fig.

.2 . Mobility shift assays showed that, together with theŽ .expected complexes, two novel bands a,b occurred only

in the L-P samples. The specificity of the complexes wasŽconfirmed by binding competition experiments Fig.

X .1B,B , showing that all the observed complexes could becompeted at high affinity by an excess of cold oligonucleo-tide.

The third set of experiments explored the DNA-bindingactivity to the CRE consensus sequence. No alteration ofthe binding activity was observed in both the lesioned andunlesioned sides of either experimental group. Migration

Žof complexes was identical in all treatment groups Fig.X.1C,C .

3.2. Supershifts of the AP-1 and CREBrATF complexes

To identify the protein composition of the DNA-bindingcomplexes, antibodies were incubated with protein extractsof the L-P tissue 3 h before the addition of the

Ž . Žradioactive-labelled probes collTRE and Jun1TRE Fig..2A,B . With the collTRE probe, both the pre-existing and

the pAP-1 complexes were supershifted by the addition ofboth anti-FosB- and anti-JunD-specific antibodies. Whenanti-JunB-specific antibody was used, a small amount of

Fig. 4. fosB and junD expression following 6-OHDA lesion and priming: Northern hybridization and RT-PCR analysis. A: Northern hybridization. 20 mgŽ . Ž . Ž .of total RNA from striatal tissues of control cont. , left and right striatum of primed L-P and R-P and not primed L-NP and R-NP rats were analysed

with fosB and junD probes. For both genes, no difference in the level of expression was observed. For normalization, a 18 S ribosomal cDNA probe wasused. B: reverse transcriptase-polymerase chain reaction. Striatal derived cDNAs were amplified by oligonucleotide primers designed on murine fosB andrat junD sequences. The arrows on the left indicate the size and position of PCR products. The 581- and 441-bp amplification products were in agreementwith the size expected for fosB and DfosB, respectively. The 456-bp amplification product corresponded to the expected size for junD. C: quantitativeRT-PCR. The experiments revealed no significant difference in fosB, DfosB and junD products among tissues. Results are mean"S.D. of threeexperiments with four animals for each experimental group.

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317 313

the supershifted complex was found without a detectablemodification of the pAP-1 complex. The presence of bothJunB and JunD was further suggested by the doubletsupershifted by an antibody recognizing the three members

Ž .of Jun family a Jun . When supershift was performedusing the jun1TRE probe, the priming-induced complexeswere supershifted in the presence of anti-FosB- and anti-JunD-specific antibodies, but did not react with the anti-CREB or anti-ATF antibodies. Therefore, the pAP-1 com-plexes interacting with the Jun1TRE has the same compo-sition of the novel AP-1 complexes detected by the coll-TRE probe.

3.3. Western blots of FosB and JunD immunoreactiÕity

In order to determine whether the observed alterationsof binding activity were due to quantitative or qualitativechanges in protein components, Western blots analysis was

Ž .performed Fig. 3A . All samples showed similar patternsof protein migration. While the proteins with the size of 58

Ž . Ž .kDa unidentified and 46 kDa Fos B were unaffected bytreatments, the 35–37-kDa protein was significantly moreprominent in the striatum of the denervated sides of both

Ž . Ž .primed L-P and not primed animals L-NP . We alsocompared the FosB immunoblot pattern of L-P rat striatumwith the immunoblot pattern of nuclear proteins fromphorbol-ester-treated rat thyroid cells. In the latter system,two proteins were detected in agreement with the molecu-

Ž . Ž .lar mass expected for FosB 46 kDa and DFosB 33 kDaŽ X .Fig. 3A . These proteins have been previously character-ized as alternatively spliced fosB gene products induced by

w xseveral stimuli in different cellular systems 11,27 . Thus,while an identical pattern of migration was observed for

Ž .FosB 46 kDa in both striatal and thyroid cells, the striatal

35–37-kDa protein exhibited a migration pattern differentfrom that of DFosB.

The immunoblot analysis with the anti-JunD antibodyshowed a clear qualitative change of the JunD patternfollowing the priming treatment but not the dopaminedenervation. In fact, only in primed rats and symmetricallyin lesioned and unlesioned side striata we observed theappearance of a robust signal corresponding to a 28-kDa

Ž .protein Fig. 3B . On the other hand, we detected nosignificant changes in the level of the 41-kDa protein,corresponding to the predicted size of JunD. In order toestablish the specificity of the anti-JunD antibody, Westernblots were performed after pre-absorbing the antibody withimmunizing peptide. While the non-specific bands werenot affected, the detection of both 41- and 21-kDa proteins

Ž .was suppressed data not shown .

3.4. Northern blot and RT-PCR analysis of fosB and junDmRNA

To verify whether the modifications of transcriptionwere related to increased mRNA levels, the expression offosB and junD transcripts was examined. Northern blotanalysis revealed no difference in the expression of bothfosB and junD mRNA in the five striatal nuclear extractsŽ .Fig. 4A . A previous report has shown that the fosB genecan be alternatively spliced, generating a transcript missing

w xof 140 nucleotides and encoding for DFosB 27 . Since theNorthern hybridization would not allow to discriminatebetween fosB and DfosB transcripts, we performed RT-PCR assay using primers designed on the basis of the

w xsequence of the fosB murine gene 21 . We found threeŽspecific amplified products for fosB mRNA 581, 550 and

.441 bp . The 581 and 441 bp corresponded to the molecu-

ŽFig. 5. Effects of pharmacological manipulation of priming on AP-1 complexes. A: turning behaviour in response to the D1 agonist SKF 38393 3 mgrkg.s.c. was recorded by automatic recorder in rats with unilateral 6-OHDA-induced lesion of nigro-striatal pathway. The test was performed 3 days after the

Ž . Ž . Ž .injection of L-DOPA primed group , L-DOPAq the NMDA receptor antagonist MK-801 primedqMK-801 , or saline not primed . As previouslyreported, a single administration of SKF 38393-induced turning behaviour only in rats previously primed with L-DOPA. Priming effect was abolished by

Ž .the pre-treatment with MK-801. B: MK-801 pre-treatment inhibited the induction of the novel priming-related a,b and the pre-existing AP-1 complexesŽ . ŽAP-1 . Representative autoradiography of Electrophoretic Mobility Shift Assay showing AP-1-binding activity in nuclear extracts from both left lesioned

. Ž . Ž . Ž .side and right striata of primed rats L-P and R-P , primedqMK-801-treated rats L-PqMK and R-PqMK and not primed rats L-NP and R-NP .

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317314

Žlar size predicted for fosB and DfosB PCR-products Fig..4B . The 550-bp product was not identified. In agreement

with Northern hybridization analysis, no quantitative dif-Žference was detected among the samples analysed Fig.

.4C . The same analysis was performed by using probesw x Ž .designed on the basis of the junD rat gene 41 Fig. 4B .

Only one amplification product was detected with noŽ .difference among the tissue samples Fig. 4C .

3.5. Pharmacological inhibition of priming and AP-1 com-plexes

MK-801, an antagonist of the N-methyl-D-aspartateŽ .NMDA glutamate receptor subtype, is able to blockpriming development when is co-administered with theprimer-agonist, suggesting the involvement of glutamater-gic systems in the control of the DA-mediated signal

w xtransduction 25 . DNA-binding activity paralleled the de-velopment of priming as observed by mobility shift analy-

Ž .sis with the collTRE probe Fig. 5 . In fact, in ratspre-treated with MK-801, the upper and lower bands of thepAP-1 complex were barely detectable or undetectable,respectively. Moreover, MK-801 pre-treatment antago-nized the priming-induced increase in binding of the pre-existing AP-1.

3.6. Correlation between SKF 38393-induced turning be-haÕiour and priming AP-1 complexes

By definition priming is the supersensitive phenomenoncharacterized by the fact that the D1 agonist SKF 38393,the challenge drug, induces turning behaviour in 6-OHDA-lesioned rats only after a previous exposure to adopamine agonist, the primer drug. Primed and unprimed

Ž .Fig. 6. Dissociation between the SKF 38393-induced turning behaviour and the c-Fos expression. A: the administration of SKF 38393 3 mgrkg s.c.augmented the binding of the pre-existing AP-1 complex in the denervated striatum of both primed and not primed rats. Compare with Fig. 1A for thesamples of SKF 38393-untreated rats. B: following SKF 38393 administration, a supershifted complex was obtained in the presence of a c-Fos in bothprimed and not primed animals. Compare with Fig. 2A in which the same antibody induced no supershift in L-P of rats not challenged with SKF 38393. C:identification of 55-kDa c-Fos protein following SKF 38393 administration.

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317 315

Žanimals were tested with a fixed dose of SKF 38393 3.mgrkg s.c. , at 2 h time before sacrifice. As predicted,

only rats previously exposed to L-DOPA developed thecontralateral turning behaviour.

Regardless of the priming treatment, the test drug aug-mented the binding of the pre-existing AP-1 complex, with

Ž .a major extent in the lesioned side striata Fig. 6A . On theother hand, pAP-1 complexes were not altered by the SKF38393 administration. Supershift analysis revealed that theSKF 38393 treatment augments both c-Fos and c-Junwhich contribute to the increase in binding of the pre-exist-

Ž .ing AP-1 complex Fig. 6B . Consistently, immunoblotsrevealed the induction of c-Fos as closely related to the D1receptor stimulation but not to either denervation or prim-

Ž .ing procedure Fig. 6C .

4. Discussion

This study provides the first evidence that the develop-ment of priming, a dopamine-dependent behavioural sensi-

w xtization phenomenon 10,23 , is associated to the appear-ance of two novel AP-1-binding complexes in the dener-

Ž .vated striatum priming-related AP-1, pAP-1 . The in vitrobinding analysis revealed that the amount of the major

Ž .AP-1 complex pre-existing AP-1 is augmented in thestriatum ipsilateral to the 6-OHDA-induced lesion, thus

w xconfirming previous reports 12 . Furthermore, the presentstudy shows the occurrence of expression of yet uncharac-terized components of the AP-1 dimers. One of thesecomponents, a FosB-related protein, is increasingly ex-pressed in striatal neurons as a consequence of thedopamine denervation. On the other hand, the emergenceof a JunD-related protein correlates well with the firstexposure of the 6-OHDA-lesioned animals to L-DOPA.

As far as regards the novel pAP-1 dimers, circumstan-tial evidence indicate that both FosB- and JunD-relatedproteins might contribute to their formation. First, pAP-1complexes are supershifted by both anti-FosB- and anti-JunD-antibodies. Second, the increased expression ofFosB-related protein in denervated striata of both primedand unprimed rats is not sufficient to form the pAP-1complexes, while the concomitant induction of the JunD-related protein, following the priming, seems to allow theformation of the pAP-1 dimers exclusively in the dener-vated striatum of primed rats. Finally, the faster elec-trophoretic mobility of pAP-1 complexes, as compared tothe pre-existing AP-1 complex, might reflect the smaller

Ž .size of its components, such as FosB- 35–37 kDa andŽ .JunD-related 28 kDa proteins.

The pAP-1 complexes were able to bind not only theconsensus AP-1 site, but also a CRE-site, suggesting thatthe novel complexes might exhibit a different bindingspecificity with respect to the classical AP-1 dimers. Con-ceivably, the combinatorial diversity of the dimers formedby multiple components of Jun and Fos families might

allow the differential regulation of various subsets of targetw xgenes 30 .

Several studies indicate that the dopamine denervationinduces the expression of chronic FRA proteinsw x5,13,14,34 , one of which migrating at 35 kDa is assumed

w xto be DFosB 18 , the product of differential splicing ofw x w xthe FosB transcript 11,27 . Recently, Doucet et al. 12

have shown the increase of a 45-kDa protein identified asDFosB in the denervated striata of 6-OHDA-lesioned ratsafter repeated treatment with dopamine agonists. Our studyconfirms the increase of a FosB-related protein of 35–37kDa as a consequence of the dopamine denervation butprovides evidence that this nuclear protein is not DFosB.In fact, we failed to detect the DFosB protein in the striatalprotein extracts as shown by comparative analysis of im-munoblots between striatal tissues and TPA-stimulated PCcells. We also found no modification of expression ofeither FosB or DFosB as revealed by mRNA analysis. Tofurther characterize the 35–37-kDa protein, we also exam-ined Fra1 and Fra2, two nuclear proteins previously char-acterized as slowly responsive AP-1 components, as possi-ble candidates for the denervation-induced changes. Super-shift analysis using anti-Fras-selective antibodies rule outthe 35–37-kDa protein as Fra1 or Fra2. Altogether, ourresults indicate that the FosB-related protein might repre-sent either a novel protein antigenically related to FosB ora post-translationally modified form of DFosB. Interest-ingly, FosB-immunoreactive proteins of 35–37 kDa, dif-ferent from DFosB, have been described in rats afterchronic electroconvulsive seizures, kainate-induced

w xseizures or cocaine treatments 3,6 , all experimental mod-els very distinct from the 6-OHDA lesion. These resultssuggest that the induction of a FosB-related protein mightrepresent a common mechanism in response to diversestimuli which all require long lasting adaptative changes.

In the present study, we have also detected a novelJunD-related protein in the striatal nuclear extracts of thedenervated animals after the priming with L-DOPA. West-ern blotting analysis with anti-JunD-selective antibodiesrevealed the expression a 28-kDa protein with a fastermigration than JunD, in both denervated and intact striataof primed rats. At our knowledge, there is no report of atruncated form of JunD and no alternative splicing has

w xbeen reported for the intronless JunD gene 41 . Consis-tently, we have found only one junD mRNA species in alltissues; therefore we postulate that the JunD-related pro-tein is either a post-translationally modified JunD, or anovel protein antigenically related to JunD. Supershiftexperiments suggest the JunD-related protein participatesto the formation of the pAP-1 complexes in the denervatedstriatum of primed rats.

The development of priming has been previously re-lated to the up-regulation of the D1 receptor-mediatedsignal transduction. Increased activity of adenylate-cyclasew x w x24 , protein kinase A and C 38 and augmented phospho-

w x w xrylation of DARPP-32 2 and CREB 8 have been found

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317316

in the lesioned striatum of primed rats in response to D1receptor stimulation. The present study found no changesin either expression or binding of CREBrATF proteins,supporting the notion that phosphorylation of pre-existingcomponents, rather than transcriptional induction, repre-sents the regulatory mechanism of these transcription fac-tors in response to neuronal activation.

The ability of SKF 38393 to elicit turning in primed ratsseems to be related to the previous induction of the novelpAP-1 complexes. In fact, pre-treatment with the NMDAreceptor antagonist, MK-801, which blocks the induction

w xof priming 25 , also prevents the appearance of pAP-1-bi-nding activity in the denervated striatum. On the otherhand, the ability of SKF 38393 to increase c-Fos immuno-

w xreactivity in the denervated striatum 31,32,36 is dissoci-ated from the D1-mediated rotation. In fact, an increase ofboth c-Fos expression and AP-1 binding was observed inthe denervated striata of both primed and unprimed ani-mals, regardless of the induction of rotational behaviour.

In conclusion, the major contribution of this study is thecharacterization of the different molecular mechanismsunderlying the priming development. While nigraldopamine denervation is reflected by the expression of aFosB-related protein in the denervated striatum, the firstexposure to a dopamine agonist induces a JunD-relatedprotein, a putative transcription factor which requires fur-ther characterization. The concurrence of the two eventscontributes to the formation of new heterodimers namedpriming-related AP-1 complexes, which exhibit DNA-bi-nding activity to both consensus and non-consensus AP-1sequences. The requirement of pAP-1 complexes for theinduction of the D1-receptor-mediated behavioural changeswill be object of further investigations.

Acknowledgements

Supported by a grant of the Italian Ministery of Univer-Ž .sity and Research MURST .

References

w x1 P. Angel, M. Karin, The role of Jun, Fos and AP-1 complex in cellprolification and transformation, Biochem. Biophys. Acta 1072Ž .1991 129–157.

w x2 P. Barone, M. Morelli, M. Popoli, G. Cicarelli, G. Campanella, G.Di Chiara, Behavioural sensitization in 6-hydroxydopamine lesionedrats involves the dopamine signal transduction: changes in DARPP-

Ž .32 phosphorylation, Neuroscience 61 1994 867–873.w x3 G. Bing, W. Wang, Q. Qi, Z. Feng, P. Hudson, L. Jin, W. Zhang, R.

Bing, J.S. Hong, Long-term expression of Fos-related antigen andtransient expression of DFosB associated with seizures in the rat

Ž .hippocampus and striatum, J. Neurochem. 68 1997 272–279.w x4 P.K. Brindle, M.R. Montminy, The CREB family of transcription

Ž .activators, Curr. Opin. Genet. Dev. 2 1992 199–204.w x5 D.M. Bronstein, H. Ye, K.R. Pennypacker, P.M. Hudson, J.S. Hong,

Ž .Role of a 35 kDa fos-related antigen FRA in the long-term

induction of striatal dynorphin expression in the 6-hydroxydopamineŽ .lesioned rat, Mol. Brain Res. 23 1994 191–203.

w x6 J. Chen, H.E. Nye, M.B. Kelz, N. Hiroi, B.T. Nakabeppu, J. Nestler,Regulation of DFosB ad FosB-like proteins by electroconvulsive

Ž .seizure and cocaine treatments, Mol. Pharmacol. 48 1995 880–889.w x7 P. Chomczynski, N. Sacchi, Single step method of RNA isolation by

acid guanidinium thiocyanate-phenol-chloroform extraction, Anal.Ž .Biochem. 162 1987 156–159.

w x8 D.G. Cole, L.A. Kobierski, K. Konradi, S.E. Hyman, 6-Hydroxy-dopamine lesions of rat substantia nigra up-regulate dopamine-in-duced phosphorylation of the cAMP-response element-binding pro-

Ž .tein in striatal neurons, Proc. Natl. Acad. Sci. USA 91 19949631–9635.

w x9 M.J. Comb, L. Kobierski, H.M. Chu, Y. Tan, D. Borsook, K.Herrup, S.E. Hyman, Regulation of opioid gene expression: a model

Ž .to understand neural plasticity, NIDA Res. Monogr. 126 199298–112.

w x10 G. Di Chiara, M. Morelli, P. Barone, F. Pontieri, Priming as a modelŽ .of behavioural sensitization, Dev. Pharmacol. Ther. 18 1992 223–

227.w x11 P. Dobrzanski, T. Noguchi, K. Kovary, C.A. Rizzo, P.S. Lazo, R.

Bravo, Both products of the fosB gene, FosB and its short form,FosBrSF, are transcriptional activators in fibroblasts, Mol. Cell

Ž .Biol. 11 1991 5470–5478.w x12 J.P. Doucet, Y. Nakabeppu, P.J. Bedard, B.T. Hope, E.J. Nestler,

B.J. Jasmin, J.S. Chen, M.J. Iadarola, M. St-Jean, N. Wigle, P.Blanchet, R. Grondin, G.S. Robertson, Chronic alterations indopaminergic neurotransmission produce a persistent elevation of

Ž .DFosB-like protein s in both the rodent and primate striatum, Eur.Ž .J. Neurosci. 8 1996 365–381.

w x13 M. Dragunow, J.D. Leah, R.L. Faull, Prolonged and selective induc-tion of Fos-related antigens in striatal neurons after 6-hydroxy-dopamine lesions of the rat substantia nigra pars compacta, Mol.

Ž .Brain Res. 10 1991 355–358.w x14 M. Dragunow, N. Butterworth, H. Waldvogel, R.L. Faull, L.F.

Nicholson, Prolonged expression of Fos-related antigens, JunB andTrkB in dopamine-denervated striatal neurons, Mol. Brain Res. 30Ž .1995 393–396.

w x15 J. Fornaguera, R.J. Carey, J.P. Huston, R.K.W. Schwarting, Behav-ioral asymmetries and recovery in rats with different degrees of

Ž .unilateral striatal dopamine depletion, Brain Res. 664 1994 178–188.

w x16 S.I. Hirai, F. Mechta, R. Bravo, M. Yaniv, Characterization of JunD:Ž .a new member of Jun proto-oncogene family, EMBO J. 8 1989

1433–1439.w x17 B.T. Hope, M.B. Kelz, R.S. Duman, E.J. Nestler, Chronic electro-

Ž .convulsive seizure ECS treatment results in expression of a long-lasting AP-1 complex in brain with altered composition and charac-

Ž .teristics, J. Neurosci. 14 1994 4318–4328.w x18 B.T. Hope, H.E. Nye, M.B. Kelz, D.W. Self, M.J. Iadarola, Y.

Nakabeppu, R.S. Duman, E.J. Nestler, Induction of a long-lastingAP-1 complex composed of altered Fos-like proteins in brain by

Ž .chronic cocaine and other chronic treatments, Neuron 13 19941235–1244.

w x19 B. Kaminska, R.K. Filipkowski, G. Zurkowska, W. Lason, R.Przewlocki, L. Kaczmarek, Dynamic changes in the composition ofthe AP-1 transcription factor DNA-binding activity in rat brainfollowing kainate-induced seizures and cell death, Eur. J. Neurosci.Ž .6 1994 1558–1566.

w x20 T.K. Kerppola, T. Curran, Fos-Jun heterodimers and Jun homod-imers bend DNA in apposite orientation: implications for transcrip-

Ž .tion factor cooperativity, Cell 66 1991 317–326.w x21 P.S. Lazo, K. Dorfman, T. Noguchi, M.G. Mattei, R. Bravo, Struc-´

ture and mapping of the fosB gene. FosB downregulates the activityŽ .of the fosB promoter, Nucleic Acids Res. 20 1992 343–350.

w x22 H. Matsuda, Y. Akechi, Y. Shimada, K. Terasawa, H. Watanabe,Relationship of the ipsilateral rotation in night period and striatal

( )D. Vallone et al.rMolecular Brain Research 52 1997 307–317 317

dopamine content reduction in unilateral nigrostriatal 6-OHDA le-Ž .sioned rats, Brain Res. 686 1995 111–114.

w x23 M. Morelli, G. Di Chiara, Agonist-induced homologous and heterol-ogous sensitization to D1 and D2 dependent contraversive turning,

Ž .Eur. J. Pharmacol. 141 1987 101–107.w x24 M. Morelli, G. De Montis, G. Di Chiara, Changes in the D1

receptor-adenylate cyclase complex after priming, Eur. J. Pharmacol.Ž .180 1990 365–367.

w x25 M. Morelli, S. Fenu, A. Carta, G. Di Chiara, Effect of MK 801 onpriming of D1-dependent contralateral turning and its relationship toc-fos expression in the rat caudate-putamen, Behav. Brain Res. 79Ž .1996 93–100.

w x26 J.I. Morgan, T. Curran, Stimulus–transcription coupling in neurons:role of cellular immediate-early genes, Trends Neurol. Sci. 12Ž .1989 459–462.

w x27 Y. Nakabeppu, D. Nathans, A naturally occurring truncated form ofŽ .fosB that inhibits FosrJun transcriptional activity, Cell 64 1991

751–759.w x28 J.R. Naranjo, B. Mellstrom, M. Achaval, P. Sassone-Corsi, Molecu-

lar pathways of pain: FosrJun-mediated activation of a noncanoni-Ž .cal AP-1 site in the prodynorphin gene, Neuron 6 1991 607–617.

w x29 E.J. Nestler, B.T. Hope, K. Widnell, Drug addiction: a model for theŽ .molecular basis of neural plasticity, Neuron 11 1993 995–1006.

w x Ž .30 A.G. Papavassiliou, Transcription factors, Mol. Med. 332 199545–47.

w x31 M.L. Paul, A.M. Graybiel, J.C. David, H.A. Robertson, D1-like andD2-like dopamine receptors synergistically activate rotation andc-fos expression in the dopamine-depleted striatum in a rat model of

Ž .Parkinson’s disease, J. Neurosci. 12 1992 3729–3742.w x32 M.L. Paul, R.W. Currie, H.A. Robertson, Priming of a D1 dopamine

receptor behavioural response is dissociated from striatalŽ .immediate-early gene activity, Neuroscience 66 1995 347–359.

w x33 L.J. Pellegrino, A.S. Pellegrino, A. Cushman, A Stereotaxic Atlas ofThe Rat Brain, Plenum, New York, NY, 1979.

w x34 K. Pennypacker, L. Thai, J.S. Hong, M.K. McMillian, Prolongedexpression of AP-1 transcription factors in the rat hippocampus after

Ž .systemic kainate treatment, J. Neurosci. 14 1994 3998–4006.w x35 K.R. Pennypacker, J.S. Hong, M.K. McMillian, Implications of

prolonged expression of Fos-related antigens, Trends Pharmacol.Ž .Sci. 16 1995 317–321.

w x36 H.A. Robertson, M.R. Peterson, K. Murphy, G.S. Robertson, D1-dopamine receptor agonists selectively activate striatal c-Fos inde-

Ž .pendent of rotational behaviour, Brain Res. 503 1989 346–349.w x37 J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Labo-

ratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,NY, 1989.

w x38 C.S. Simpson, B.J. Morris, Induction of c-fos and zifr268 geneexpression in rat striatal neurons, following stimulation of D1-likedopamine receptors, involves protein kinase A and protein kinase C,

Ž .Neuroscience 68 1995 97–106.w x39 U. Ungerstetd, Postsynaptic supersensitivity after 6-hydroxydopa-

mine induced degeneration of the nigro-striatal dopamine system,Ž .Acta Physiol. Scand. 367 1971 69–93.

w x40 H. Van Dam, M. Duyndam, R. Rottier, A. Bosch, L. De Vries-Smits,P. Herrlich, A. Zantema, P. Angel, A.J. Van der Eb, Heterodimerformation of c-Jun and ATF-2 is responsible for induction of c-jun

Ž .by the 243 amino acid adenovirus E1A protein, EMBO J. 12 1993479–481.

w x41 T. Yamada, S. Nakao, S. Osada, M. Imagawa, T. Nishihara, Se-Ž .quence analysis of the rat jun-D gene, Gene 153 1995 285–286.

w x42 M. Zerial, L. Toschi, R.P. Ryseck, M. Schuermann, W. Muller, R.Bravo, The product of a novel growth factor activated gene, fosB,interacts with Jun proteins enhancing their binding activity, EMBO

Ž .J. 8 1989 805–813.