Acta Biomaterialia 10 (2014) 4175–4185

Contents lists available at ScienceDirect

Acta Biomaterialia

journal homepage: www.elsevier .com/locate /actabiomat

Bone marrow stromal cells on a three-dimensional bioactive fiber meshundergo osteogenic differentiation in the absence of osteogenic mediasupplements: The effect of silanol groups

http://dx.doi.org/10.1016/j.actbio.2014.05.0261742-7061/� 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

⇑ Corresponding author at: 3B’s Research Group – Biomaterials, Biodegradablesand Biomimetics, University of Minho, Headquarters of the European Institute ofExcellence on Tissue Engineering and Regenerative Medicine, AvePark, 4806-909Taipas, Guimarães, Portugal. Tel.: +351 253510907; fax: +351 253510909.

E-mail address: belinha@dep.uminho.pt (I.B. Leonor).

Márcia T. Rodrigues a,b, Isabel B. Leonor a,b,⇑, Nathalie Gröen a,b,c, Carlos A. Viegas a,b,d, Isabel R. Dias a,b,d,Sofia G. Caridade a,b, João F. Mano a,b, Manuela E. Gomes a,b, Rui L. Reis a,b

a 3B’s Research Group – Biomaterials, Biodegradables and Biomimetics, University of Minho, Headquarters of the European Institute of Excellence on Tissue Engineeringand Regenerative Medicine, AvePark, 4806-909 Taipas, Guimarães, Portugalb ICVS/3B’s – PT Government Associate Laboratory, Braga/Guimarães, Portugalc Biomedical Engineering, University of Twente, PO Box 217, 7500 AE Enschede, The Netherlandsd Department of Veterinary Sciences, University of Trás-os-Montes e Alto Douro, Vila Real, Portugal

a r t i c l e i n f o

Article history:Received 12 December 2013Received in revised form 8 May 2014Accepted 23 May 2014Available online 4 June 2014

Keywords:ApatiteSilanol groupsWet-spinningGoat bone marrow mesenchymal cellsOsteogenic differentiation

a b s t r a c t

Osteogenic differentiation is a tightly regulated process dependent on the stimuli provided by the micro-environment. Silicon-substituted materials are known to have an influence on the osteogenic phenotypeof undifferentiated and bone-derived cells. This study aims to investigate the bioactivity profile as well asthe mechanical properties of a blend of starch and poly-caprolactone (SPCL) polymeric fiber mesh scaf-folds functionalized with silanol (Si–OH) groups as key features for bone tissue engineering strategies.The scaffolds were made from SPCL by a wet spinning technique. A calcium silicate solution was usedas a non-solvent to develop an in situ functionalization with Si–OH groups in a single-step approach.We also explored the relevance of silicon incorporated in SPCL–Si scaffolds to the in vitro osteogenic pro-cess of goat bone marrow stromal cells (gBMSCs) with and without osteogenic supplements in the culturemedium. We hypothesized that SPCL–Si scaffolds could act as physical and chemical millieus to induceper se the osteogenic differentiation of gBMSCs. Results show that osteogenic differentiation of gBMSCsand the production of a mineralized extracellular matrix on bioactive SPCL–Si scaffolds occur for up to2 weeks, even in the absence of osteogenic supplements in the culture medium. The omission of mediasupplements to induce osteogenic differentiation is a promising feature towards simplified and cost-effective cell culturing procedures of a potential bioengineered product, and concomitant translation intothe clinical field. Thus, the present work demonstrates that SPCL–Si scaffolds and their intrinsic proper-ties sustain gBMSC osteogenic features in vitro, even in the absence of osteogenic supplements to the cul-ture medium, and show great potential for bone regeneration strategies.

� 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

Bone formation is a complex process involving sequentialorchestrated steps leading to the development of a functionaland structurally organized tissue that sustains the full mass of anindividual, protects various organs of the body, produces cellsand stores minerals. Despite its extraordinary healing ability, boneresponse may be unsuccessful to repair severe damage caused by

injuries or aging-related problems. Moreover, the injury of thebone tissue also affects nearby tissues and interfaces, translatinginto a decline in the quality of life of thousands of patients world-wide, and represents a medical and socio-economic challenge.

Currently, the therapeutic strategies used for bone replacement/regeneration are based on bone grafting techniques (autografts,allografts, demineralized bone matrix and bone substitutes) withthe all complications and drawbacks associated with these [1,2].Due to their chemical similarity to the inorganic phase of bone, cal-cium phosphate (CaP) biomaterials are one source of bone graftsubstitutes [3,4]. One important bone grafting material is Bioglass�,which Hench [5] have demonstrated provides an ideal environmentfor colonization, proliferation and differentiation of osteoblasts toform new bone [6,7]. This response is due to the influence of silicon

4176 M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185

(Si) ion on the gene upregulation of osteoblastic cells [6–8]. Also,some clinical studies have evidenced the potential biological roleof Si in bone formation [9].

Previously in our group [10,11] it was demonstrated that abioactive three-dimensional (3-D) fiber mesh, made of a blend ofstarch-polycaprolactone (SPCL), with silanol (Si–OH) groups ontheir surface, with a controlled pore size, shape and orientation,could be produced in a reliable and economical way, by using aone-step wet-spinning technique. This simple process has theadvantage that no further coating or chemical modification of thefiber mesh is required besides an organized arrangement of func-tional groups, e.g. Si–OH groups, to induce the bioactive behavioras in classic ceramic materials.

In this work we hypothesize that these bioactive 3-D fibermeshes (SPCL–Si scaffold) could act as physical and chemical milieuto induce per se the process of osteogenic differentiation in goatbone marrow stromal cells (gBMSCs) with and without osteogenicsupplements in the culture medium. Culturing cells onto scaffoldsshould bridge the gap between structural support provided by thescaffold, and the cellular communications between implanted andlocal cells towards bone tissue regeneration. Over the past fewyears, bone marrow mesenchymal stromal cells (BMSCs) have beensuggested as a potential cell source for tissue engineering (TE)applications, including bone tissue repair and regeneration[10,12,13]. BMSCs can be easily guided into multiple cell lineages,such as osteogenic, chondrogenic or adipogenic under specific cul-ture conditions. Physiological mediators, alone or in combination,were also described to participate in bone formation, remodelingand repair [14]. Among them, ascorbic acid, b-glycerolphosphateand dexamethasone have been widely used as supplements in stan-dard osteogenic culture media [15]. Ascorbic acid is an essentialnutrient for collagen synthesis, which stimulates extracellularmatrix (ECM) secretion and mesenchymal stem cells (MSCs) prolif-eration [16]. Furthermore, ascorbic acid in the presence of a sourceof phosphate ions [17], such as b-glycerolphosphate, results in theformation of an area with hydroxyapatite-containing mineralwithin collagen fibrils [18]. Although dexamethasone has beendemonstrated to induce osteogenic differentiation of fetal cal-varia-derived cells [19] and adult BMSCs [17], this synthetic gluco-corticoid presents considerable side-effects [20]. Several strategieshave shown that MSCs are able to develop the osteogenic pheno-type in the absence of osteogenic medium supplements [21].

In this context, we proposed a three-stage study to validate ourhypothesis. In the first phase we intend to evaluate the formationof a CaP layer on the surface of the SPCL–Si scaffolds by soakingthem in a simulated body fluid (SBF) solution and studying theirmechanical properties as key features for bone TE. Then, the behav-ior of gBMSCs will be investigated in SPCL–Si scaffolds with andwithout a CaP layer. The aim of this stage is to understand the rel-evance of SPCL–Si scaffolds for cellular strategies in the presence orabsence of a CaP layer. Finally, and as the ultimate goal of thisstudy, we propose to explore the relevance of the presence of Sion SPCL–Si scaffolds in the process of osteogenic differentiationin the presence and absence of osteogenic supplements in the cul-ture medium. Thus, gBMSCs were cultured in different media con-ditions: basal medium, complete osteogenic medium and mediumin the absence of one of the osteogenic factors: ascorbic acid, b-glycerolphosphate or dexamethasone, for up to 2 weeks.

2. Materials and methods

2.1. Wet-spun fiber mesh scaffold processing

A biodegradable thermoplastic blend of corn starch with polyc-aprolactone (30/70 wt.%, SPCL) was obtained from Novamont, Italy.Chloroform (CHCl3), methanol (CH3OH), tetraethoxysilane (TEOS:

Si(OC2H5)4) and calcium chloride (CaCl2) were obtained fromSigma-Aldrich. Ethyl alcohol (C2H5OH) was obtained from Panreac.

This polymer has been selected to produce SPCL scaffolds withand without silanol (Si–OH) groups by a wet-spinning technique,as previously described by our group [10,11,22]. Briefly, the poly-mer was dissolved in chloroform at a concentration of 30% (w/v),and then the polymeric solution was loaded into a 5 ml plastic syr-inge with a needle (0.8 mm internal diameter) attached to it. Thesyringe was connected to a programmable precision syringe pump(KR analytical, Fusion 200, UK) to inject the polymeric solution at acontrolled pump rate of 4.5 ml h�1. The fiber mesh structure wasformed during the process by the random movement of the coag-ulation bath. Control fiber mesh scaffolds (designated as SPCL scaf-folds) obtained in a methanol coagulation bath were dried at roomtemperature overnight in order to remove any remaining solvent.In the case of using the calcium silicate solution (Si(OC2H5)4/H2O/C2H5OH/HCl/CaCl2 of 1.0/4.0/4.0/0.014/0.20) [10,23] the fibermeshes were dried in an oven at 60 �C for 24 h, and designatedas SPCL–Si. Afterwards, scaffolds were cut into 5 mm diameterdiscs �0.45 ± 0.04 mm thick.

Prior to any cell culture experiments, the scaffolds were steril-ized by ethylene oxide, with a cycle time of 14 h at a working tem-perature of 45 �C in a chamber under a pressure of 50 kPa.

2.2. Evaluation of in vitro bioactivity of wet-spun fiber mesh scaffolds

The SPCL and SPCL–Si scaffolds were soaked in 10 ml of SBFsolution at 36.5 �C for up to 7 days to evaluate the formation of aCaP layer on their surface. The SBF presents ion concentrations(Na+ 142.0, K+ 5.0, Ca2+ 2.5, Mg2+ 1.5, Cl� 147.8, HCO3

� 4.2, HPO42�

1.0, and SO42� 0.5 mM) nearly equal to those of the human blood

plasma [24,25]. After each period of immersion time, the sampleswere removed from SBF, washed with distilled water and driedat room temperature. SPCL scaffolds were used as experimentalcontrols. At least four samples were used per time point.

2.2.1. Morphological and mechanical characterization of wet-spunfiber mesh scaffolds and SBF analysis

Scanning electron microscopy (SEM; Hitachi S-2600N, HitachiScience Systems Ltd.) was used to observe the morphology of thewet-spun fiber mesh scaffolds before and after soaking in SBF forthe different experimental conditions and controls. Previously toSEM analysis, sample surfaces were gold-sputtered (Fisons Instru-ments, Sputter Coater SC502, UK).

Thin film X-ray diffraction (TF-XRD; RINT2500, Rigaku Co.,Japan) was used to identify crystalline phases present on the poly-meric wet-spun fiber mesh (SPCL–Si and SPCL controls) before andafter immersion in SBF, and to characterize the crystalline/amor-phous nature of the CaP films. The data collection was performedby the 2h scan method, with 1� as the incident beam angle usinga Cu Ka X-ray line and a scan speed of 0.05� min�1 in 2h.

To assess the morphometric parameters of the scaffolds, a high-resolution micro-computed tomography (l-CT) system (Skyscan1072, Skyscan, Kontich, Belgium) was used. X-ray scans of bothscaffolds were performed in triplicate, using a resolution of pixelsize of 5.86 lm at 40 keV energy and 248 lA current, as previouslydescribed [10]. Data sets were reconstructed using NRecon v1.4.3,SkyScan software. Representative datasets of 200 slices were seg-mented into binary images with a dynamic threshold of 50–255(grayscale values) to identify the organic and inorganic phases.These data sets were used for morphometric analysis (CT Analyserv. 1.5.1.5, SkyScan) and to build the 3-D virtual models (ANT 3-Dcreator v. 2.4, SkyScan). The 3-D virtual models of representativeregions in the bulk of the scaffolds were created, visualized andregistered using both image processing software (CT Analyserand ANT 3-D creator).

M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185 4177

Elemental concentrations of the SBF before and after soaking ofthe scaffolds were measured using inductively coupled plasmaemission spectroscopy (ICP; JY2000-2, Jobin Yvon, Horiba, Japan).Solutions were collected at the end of each time point, filtered witha 0.22 lm filter and kept at �80 �C until usage. A minimum ofthree samples was used per condition and time point analyzed.

For the viscoelastic measurements of the scaffolds, dynamicmechanical analysis (DMA; TRITEC8000B DMA, Triton Technology,UK) was performed in tensile mode. The distance between theclamps was 5 mm and the membrane samples were cut with awidth of �5 mm (measured accurately for each sample). The mem-branes were always analyzed immersed in a liquid bath placed in aTeflon� reservoir. Samples were previously immersed in a phos-phate buffered saline (PBS) solution until equilibrium was reached(overnight). The geometry of the samples was then measured andthe samples were clamped in the DMA apparatus and immersed inthe PBS solution. After equilibration at 37 �C, the DMA spectra wereobtained during a frequency scan between 0.1 and 25 Hz. Theexperiments were performed under constant strain amplitude(30 lm). A static pre-load of 0.7 N was applied during the teststo keep the sample tight. Five samples were used for eachcondition.

2.3. In vitro assessment of the wet-spun fiber mesh scaffolds

2.3.1. gBMSCs harvesting and isolationgBMSCs were isolated and expanded as previously described

[10]. The BMSC harvesting procedure was conducted according tothe international standards on animal welfare as defined by theNational Ethical Committee for Laboratory Animals and conductedin accordance with Portuguese legislation (Portaria no. 1005/92)and international standards on animal welfare as defined by theEuropean Communities Council Directive (86/609/EEC). Duringthe entire procedure adequate measures were taken to minimizeany pain or discomfort to the animals.

Briefly, gBMSCs were harvested from the iliac crests of adultgoats and cultured in Dulbecco’s modified Eagle medium (DMEM;Sigma) supplemented with 10% fetal bovine serum (Gibco) and 1%antibiotic/antimicotic solution (Gibco). Cells were expanded andcryopreserved. Then, cells were thawed, expanded and sub-cul-tured twice (passage 2) until we achieved a sufficient cell numberto run our experiment.

2.3.2. Assessment of gBMSCs behavior on wet-spun fiber meshscaffolds coated with and without a calcium phosphate coating

The aim of this study was to understand the relevance of SPCL–Si scaffolds for cellular strategies in the presence or absence of aCaP coating. For that the gBMSCs were seeded onto SPCL–Si scaf-folds after 7 days of immersion in SBF (SPCL–Si–7SBF) at a concen-tration of 1 � 105 cells per scaffold and compared with uncoatedSPCL–Si scaffolds (without immersion in a SBF solution). Afterseeding gBMSCs onto the SPCL–Si scaffolds, coated and uncoated,the constructs were cultured in a-MEM (Sigma) in the presenceof osteogenic supplements, namely ascorbic acid (50 lg ml�1,Sigma), b-glycerolphosphate (10 mM, Sigma) and dexamethasone(10�8 M, Sigma) for 7 and 14 days.

2.3.3. Assessment of gBMSCs behavior on wet-spun fiber meshscaffolds in different culture media

A major goal of this study was to evaluate the influence ofSPCL–Si scaffolds in stimulating the osteogenic process of gBMSCsin the presence or absence of biochemical factors supplemented tothe osteogenic medium. For this purpose, gBMSCs were seededonto SPCL–Si scaffolds at a density of 1 � 105 cells per scaffold(3P) and kept in basal medium (DMEM; Sigma) supplemented with10% fetal bovine serum and 1% antibiotic-antimicotic solution (A/A)

solution for 2 days. Subsequently the gBMSC-SPCL–Si constructswere divided into five culture conditions for 7 or 14 days, namely(i) basal medium, (ii) complete osteogenic medium, (iii) osteogenicmedium without ascorbic acid, (iv) osteogenic medium withoutß-glycerolphosphate and (v) osteogenic medium without dexa-methasone, as represented in Table 1.

Goat BMSCs seeded onto SPCL scaffolds cultured in the sameexperimental conditions were used as controls. Samples wereprepared in triplicates.

2.3.4. Characterization of cell–scaffold constructsCell–scaffold constructs with and without CaP coating were

assessed for cell morphology, viability, proliferation and osteogenicdifferentiation through the quantification of alkaline phosphatase(ALP) activity. The histological analysis, immunolocation of colla-gen I, mineralized ECM formation and quantitative PCR analysiswere only performed for studying the influence of SPCL–Si scaf-folds in the osteogenic behavior of gBMSCs in different culturemedia. Two samples were used per condition and time point, andthe experiments were repeated three times.

2.3.4.1. Cell viability assay. The MTS test (Promega) was used toassess cell viability in SPCL–Si scaffolds seeded with gBMSCs after7 and 14 days of culture. After each culturing time, cells wererinsed in PBS and then incubated in a MTS solution for 3 h at37 �C in a 5% CO2 environment, according to the manufacturer’sinstructions. Absorbance was read at 490 nm in a microplate ELISAreader equipment (BioTek).

2.3.4.2. DNA content. gBMSCs content seeded onto SPCL–Si con-structs was analyzed by double-strand DNA (dsDNA) quantifica-tion assay using a fluorimetric dsDNA quantification kit(PicoGreen, Molecular Probes), according to the manufacturer’sinstructions. The fluorescence of dsDNA assay was read in a micro-plate ELISA reader (BioTek) at an excitation of 485/20 nm andemission of 528/20 nm.

2.3.4.3. ALP activity. A substrate solution was added to each sampleconsisting of 0.2% (w/v) p-nitrophenyl phosphate (Sigma) in a sub-strate buffer with 1 M diethanolamine HCl (Merck) at pH 9.8. Sam-ples were then incubated in the dark for 45 min at 37 �C. After theincubation period, a stop solution (2 M NaOH (Panreac) plus0.2 mM ethylenediaminetetraacetic acid (Sigma)) was added tosamples. Absorbance was read at 405 nm in a microplate ELISAreader equipment (BioTek). Standard solutions were prepared withp-nitrophenol (10 lmol ml�1) (Sigma).

2.3.4.4. Cell morphology. The morphology of SPCL and SPCL–Si scaf-folds cultured with gBMSCs was analyzed by SEM. Cell-laden con-structs were rinsed in PBS, fixed in 4% buffered formalin overnightand then dehydrated in a series of ethanol concentrations (up to100% ethanol). Afterwards, the samples were left to dry overnight.

2.3.4.5. l-CT analysis. The characterization of cell–scaffold con-structs and the synthesis of a mineralized matrix were assessed.The X-ray scans of the samples were performed in triplicate andacquired similarly to cell-free scaffolds, described in Section 2.2.1,but with a resolution of pixel size of 6.69 lm. Representative data-sets of 100 slices were segmented into binary images with adynamic threshold of 30–255 (grayscale values) to identify anorganic and inorganic phase on the constructs. These data wereused to build the 3-D virtual models.

2.3.4.6. Histological analysis. After 7 and 14 days of culture in thedifferent culture media, gBMSC-seeded scaffolds were fixed in a10% neutral buffered formalin solution (Bio-Optica) overnight at

Table 1Description of the composition of the different culture media to which gBMSC-SPCL–Si constructs were exposed for up to 14 days.

Group Description Abbreviations

(i) Basal medium: DMEM, FBS (10%), A/A (1%) Basal(ii) Complete osteogenic medium: a-MEM, FBS (10%), A/A (1%), dexamethasone (10�8 M), ascorbic acid (50 lg ml�1), b-glycerolphosphate (10 mM) Osteo(iii) Complete osteogenic medium without ascorbic acid: a-MEM, FBS (10%), A/A (1%), dexamethasone (10�8 M), b -glycerolphosphate (10 mM) Wo asc(iv) Complete osteogenic medium without b-glycerolphosphate: a-MEM, FBS (10%), A/A (1%), dexamethasone (10�8 M), ascorbic acid (50 lg ml�1) Wo beta(v) Complete osteogenic medium without dexamethasone: a-MEM, FBS (10 %), A/A (1%), ascorbic acid (50 lg ml�1), b-glycerolphosphate (10 mM) Wo dex

4178 M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185

4 �C and rinsed in PBS. Then, constructs were kept at 4 �C in PBSuntil performing the histological immunolocation of collagen I.

2.3.4.7. Immunofluorescent staining. The expression of collagen Inaturally present in bone related ECM matrices was assessed byimmunofluorescence. Cellular permeabilization was performedusing a 0.025% Triton/100 (Sigma-Aldrich) in PBS followed by nor-mal serum 2.5% (S-2012, Vector Labs) incubation. Rabbit polyclonalantibody anti-collagen type I was purchased from Abcam (ab292,1:500). Anti-rabbit AlexaFluor 488 (Molecular Probes, Invitrogen;1:200) was selected as secondary antibody. Antibodies werediluted in an antibody diluent with background reducing compo-nents from Dako. 40,6-Diamidino-2-phenylindole (DAPI) staining(Molecular Probes, Invitrogen) served as a nuclear marker for celllocalization and distribution. The presence/absence of collagen Iin the constructs was observed under a fluorescence microscope(Imager Z1M, Zeiss, Germany) equipped with a digital camera(AxioCa MRc5).

2.3.4.8. Gene expression analysis using real-time PCR. The mRNAexpression of the genes of interest, namely OsteoPontin (OP) andOsteoNectin (ON) was measured in gBMSC-SPCL–Si constructsexposed to different culture conditions for 7 or 14 days byreverse-transcription polymerase chain reaction (RT-PCR). TotalRNA was extracted using TRI reagent (T9424, Sigma) followingthe manufacturer’s instructions. First-strand complementary DNA(cDNA) was synthesized from 1 lg RNA using the cSCript cDNAsynthesis kit (733-1175, VWR) in a 20 ll reaction. The primersequences with specificity for goat were obtained from Primer 3software (v. 0.4.0) for glyceraldehyde 3-phosphate dehydrogenase(GAPDH, F- 50_GGGTCATCATCTCTGCACCT_30 and R- 50_GGTCATAAGTCCCTCCACGA_30), osteopontin (OP, F- 50_TGGAAAGCTCGTCACTGT_30 and R- 50_GATGGCCGAGGTGATAG_30) and osteonectin (ON, F –50_CGAGGAAGAGGTGGTAG_30 and R- 50 TGCTGCACACCTTCTCA 30)prior to its synthesis by MWG Biotech Germany. Gene expressionanalysis was performed using a nanodrop 1000 spectrophotometer(ThermoScientific) and a RT-PCR mastercycler (Realplex,Eppendorf).

2.4. Statistical analysis

Statistical analysis was carried out by average ± standard devi-ation. Two-way analysis of variance (ANOVA) followed by Bonfer-roni’s multiple-comparison test was also applied to check theexistence of statistical differences in the results between samplegroups. The data analyses were performed with GraphPath Prismsoftware (version 5) and differences were considered significantat P < 0.05.

3. Results

3.1. Production and characterization of wet-spun fiber mesh scaffolds

The bioactivity of artificial materials is commonly evaluated byexamining the formation of apatite on the surface of the scaffold

after immersion in a SBF solution. The SBF is a protein-free solutionwith an ionic composition (Na+ 142.0, K+ 5.0, Ca2+ 2.5, Mg2+ 1.5, Cl�

147.8, HCO3� 4.2, HPO4

2� 1.0, SO42� 0.5 mM; pH 7.40) proposed by

Kokubo and Takadama [24] to understand the mechanism of apa-tite formation on bioactive materials.

Fig. 1A exhibits the TF-XRD patterns obtained for the SPCL–Sifiber mesh scaffolds and SPCL controls (SPCL) produced by wet-spinning after soaking in SBF for 7 days. The TF-XRD patterns ofthe surface of the SPCL–Si scaffold exhibit several broad diffractionpeaks, whose position and intensities can be assigned to an apa-tite-like phase (ASTM JCPDS 9-0432). The peaks in 2H and theircorrespondence to the diffraction planes of apatite are: 10.82�(100), 25.87� (002) and 31.75� (221). The formed apatite film pre-sents low crystallinity, as the apatite peaks were comparativelybroader than the crystalline apatite.

An apatite layer is formed in SPCL–Si scaffolds after 1 day ofimmersion in a SBF solution, while SPCL scaffolds could not inducethe formation of an apatite layer even after 7 days in SBF (Fig. 1B).

l-CT analysis allowed the formation and growth of an apatitelayer (blue color) to be followed as a function of time (Fig. 1B).The scaffold porosity was found to be �56.84% and 49.77%, beforeand after soaking the scaffolds in SBF, respectively. As the immer-sion time in SBF increases, the apatite layer becomes denser andcompact but still homogeneously distributed without compromis-ing the overall morphology and interconnectivity of the 3-D-fibermesh scaffolds.

The concentrations of calcium (Ca), phosphorus (P) and silicon(Si) in the SBF solution, before and after immersion of SPCL–Siand SPCL scaffolds were measured by ICP analysis as a functionof time (Fig. 1C). A decrease in the Ca concentration was observedafter 24 h for SPCL–Si scaffolds, but for P concentration wasabruptly decreased, and then there was no further practicaldecrease. The release of Si ions from SPCL–Si scaffolds into theSBF quickly occurred at the beginning of soaking and then sloweddown up to 7 days. The decrease in Ca and P concentrations is moreevident in SPCL–Si scaffolds (P < 0.05) after 3 and 7 days in the SBFsolution (Fig. 1C). The differences found in Si concentration ofSPCL–Si scaffolds are not statistically significant (P > 0.05) alongconsecutive soaking periods, and no traces of Si were detected inSPCL control scaffolds.

The dynamic mechanical behavior of SPCL–Si scaffolds with thevariation of the frequency was assessed under simulated physio-logical condition, i.e. in a hydrated environment at 37 �C (Fig. 1D)[26]. Overall, the storage modulus (E’) of the scaffolds tends toincrease with increasing frequency. In the SPCL–Si scaffolds E’increases from 11.38 to 14.81 MPa (P < 0.001) while in the SPCLscaffolds E’ increases from 5.54 to 7.04 MPa.

3.2. Assessment of gBMSCs behavior on wet-spun fiber mesh scaffoldscoated with and without a calcium phosphate coating

gBMSCs were selected in this study, envisioning future autolo-gous approaches in a goat orthotopic model for bone. Goats are afeasible model in the orthopedic field of research as the boneremodeling rate and the sequence of events in bone grafting

Fig. 1. Characterization of fiber mesh SPCL–Si scaffolds produced by the wet-spinning technique: (A) TF-XRD patterns of SPCL–Si scaffolds before (SPCL–Si) and after 7 days ofimmersion in SBF (SPCL–Si 7d in SBF). Apatite characteristic peaks are represented in the spectrum with black dots (�). (B) Morphological characterization by means of l-CTand SEM micrographs of SPCL–Si scaffolds 1, 3 or 7 days after immersion in SBF. SPCL control scaffolds are represented as SPCL after 7 days in SBF. The blue color regions in l-CT images correspond to the apatite deposition. (C) Changes in calcium (Ca), phosphorus (P) and silicon (Si) concentration in the SBF solution after different immersionperiods of SPCL–Si scaffolds. Symbol ⁄ denotes study groups with statistically significant differences, as using the two-way ANOVA method. (D) Variation of the storagemodulus as a function of frequency between 0.1 and 15 Hz after equilibration at 37 �C with the scaffolds immersed in a PBS solution. In (A–D), SPCL wet-spun scaffoldswithout silanol groups are represented as experimental controls.

M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185 4179

incorporation and healing are similar to that of humans, and couldprovide more accurate results towards clinical applications.

The MTS assay indicated that gBMSCs maintained a high cellviability and proliferation rate when seeded onto SPCL–Si scaffolds(SPCL–Si) or onto SPCL–Si scaffolds with an apatite coatingobtained after immersion in SBF (SPCL–Si–7SBF). Nevertheless, cellviability levels are higher and increasing with the culturing time inSPCL–Si scaffolds without the apatite coating (Fig. 2A).

Double strand DNA (dsDNA) proliferation assay and ALP activitylevels of gBMSCs seeded onto SPCL–Si, SPCL–Si–7SFB and SPCLscaffolds are described in Fig. 2B and C. The tendency is to increasethe DNA content and the ALP activity with the time in culture forcells seeded onto both SPCL–Si and SPCL–Si-7SFB scaffolds.Although there is no significant difference in terms of cell prolifer-ation from 7 to 14 days, there is an increment of ALP activity(P < 0.05) in SPCL–Si constructs, which is not verified in the otherconstructs.

According to SEM micrographs (Fig. 2D), cells are more homo-geneously distributed on SPCL–Si scaffolds after both 7 and 14 daysin osteogenic culture. The scaffold colonization is more evident in

SPCL–Si constructs than in SPCL–Si–7SFB constructs. Furthermore,in both scaffolds, cells tend to proliferate bridging between fibers,yet without closing the pores.

Altogether, results represented in Fig. 2 indicate that gBMSCsshow higher viability and higher ALP activity levels for SPCL–Siscaffolds.

3.3. Assessment of gBMSCs behavior on wet-spun fiber mesh scaffoldsin different culture media

gBMSCs adhered and maintained high viability levels seededonto SPCL–Si scaffolds up to 2 weeks in culture regardless of themedium composition, as observed in Fig. 3A. Moreover, gBMSCsviability tends to increase with the time in culture for all condi-tions in both SPCL–Si and SPCL control scaffolds.

The cell content of gBMSC-SPCL–Si constructs also tends toincrease with the time in culture apart from the culture mediumsupplementation (Fig. 3B), while in SPCL controls the tendency isjust the opposite. The highest DNA concentration values areobserved in SPCL–Si cultured with gBMSCs in osteogenic medium

Fig. 2. gBMSCs behavior in the presence of a calcium phosphate coating: cellular viability (MTS assay) (A), double strand DNA (dsDNA) quantification assay (B) andquantification of ALP activity (C) of gBMSCs seeded onto SPCL–Si scaffolds (SPCL–Si) and SPCL–Si scaffolds pre-coated with an apatite layer (SPCL–Si–7SBF) cultured for 7 or14 days in osteogenic medium. Symbol ⁄ denotes study groups with statistically significant differences (P < 0.05), as using the two-way ANOVA method. SEM micrographs (D)show gBMSCs morphology onto SPCL–Si or onto SPCL–Si–7SBF scaffolds for 14 days in osteogenic medium. The small micrographs represent gBMSCs cultured for 7 days inosteogenic medium. Micrograph scale represents 100 lm.

4180 M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185

for 2 weeks. Culture medium composition influences cell prolifera-tion, as the cell content values of gBMSCs are significantly higher(P < 0.05) in complete osteogenic medium than in basal mediumor in culture media without dexamethasone or b-glycerolphos-phate for up to 2 weeks.

SEM micrographs of gBMSCs seeded onto fiber mesh-scaffoldsindicated a good cell colonization and distribution throughout theconstructs. (Fig. 3C). Also, gBMSCs colonization seems to beincreased in SPCL–Si scaffolds than in SPCL control for all cultureconditions at both 7 and 14 days in culture, as a dense cellular coat-ing can be identified over the fiber mesh structure. Furthermore,SEM analysis supports the previous results on gBMSCs proliferation,as gBMSCs were able to colonize the scaffolds without being signif-icantly affected by the absence of osteogenic supplements.

3.3.1. Assessment of a bone-like ECMCollagen I is a major component of bone ECM matrix, providing

the bone with strength and flexibility, and its presence wasassessed in our constructs by immunofluorescence (Fig. 4). Con-structs evidence higher intensity of collagen I in basal and com-plete osteogenic media, despite the fact that the intensity seemsto be similar between SPCL and SPCL–Si scaffolds. After 14 daysin culture, an increase in the immuno-staining intensity of collagenI occurred in complete osteogenic medium and in osteogenic med-ium without ascorbic acid compared to results obtained from7 days in culture. In gBMSC-SPCL–Si constructs cultured in med-ium without dexamethasone, the intensity is very mild, andappears to be lower than in gBMSC–SPCL controls.

The ECM mineralization on the developed constructs was evalu-ated by l-CT analysis. In Fig. 5, constructs are represented by grayand blue colors. Gray indicates the organic phase of gBMSC–SPCL–Si

constructs while the inorganic phase is stained in blue. In order todetermine the inorganic content in the 3-D structure of each con-struct cultured under the different conditions, the percentage ofinorganic volume was assessed and indicated in Fig. 5. The percent-age of inorganic volume was determined by dividing the inorganicvolume (lm3) present in each construct (determined by the 100–255 threshold in the grayscale index) by the organic and inorganicvolume (lm3) of the construct (determined by the 30–255 thresh-old), and then multiplied by 100. The threshold was set based onpreliminary assays and the 100–255 threshold was suggested bythe manufacturer of the l-CT equipment as a threshold value suit-able for binaries the cortical bone.

After 7 days of culture a mineralized matrix determined by thepercentage of inorganic volume obtained by l-CT analysis isalready detected in all studied conditions. At the surface of the con-structs, it seems to be a larger dispersion of the inorganic phase ingBMSC–SPCL–Si constructs cultured in the absence of ascorbic acidcompared to the other conditions studied. Nevertheless, when the3-D structure is considered, the percentage of inorganic volume isconsiderably higher in SPCL–Si constructs in comparison to SPCLcontrols, as expected. The highest values of inorganic volume wereobserved in constructs cultured for 1 week in osteogenic mediumwithout ascorbic acid or without b-glycerolphosphate.

The amount of mineralized matrix increases in SPCL–Si con-structs as observed by the spreading of blue color on the constructsafter 2 weeks in culture. In general, the ECM distribution is welldispersed throughout the constructs.

These results are supported by the quantitative measurementsof inorganic volume detected in the constructs analyzed. An excep-tion is made for SPCL–Si constructs cultured in osteogenic medium.Interestingly is the fact that the inorganic content in SPCL

Fig. 4. Immunofluorescence micrographs obtained from gBMSC–SPCL–Si scaffolds after 7 or 14 days in different culturing media: basal (basal), complete osteogenic (osteo),osteogenic medium without ascorbic acid (Wo asc), osteogenic medium without b-glycerolphosphate (Wo beta) or osteogenic medium without dexamethasone (Wo dex).Collagen I present on the fibers is observed in green. In blue, DAPI stains for cell nuclei. Small micrographs represent SPCL scaffolds seeded with gBMSCs, which were used ascontrols. Scale bar represents 20 lm.

Fig. 3. Cellular viability (MTS assay) (A), double strand DNA (dsDNA) quantification assays (B) and morphological assessment (SEM) (C) of gBMSCs seeded onto SPCL–Siscaffolds after 7 or 14 days in different culturing media: basal (basal), complete osteogenic (osteo), osteogenic medium without ascorbic acid (Wo asc), osteogenic mediumwithout b-glycerolphosphate (Wo beta) or osteogenic medium without dexamethasone (Wo dex). SPCL scaffolds seeded with gBMSCs were used as controls and arerepresented in the small micrographs. Micrograph scale represents 200 lm. Symbol ⁄ denotes study groups with statistically significant differences (P < 0.05) as using thetwo-way ANOVA method.

M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185 4181

Fig. 5. l-CT analysis of gBMSCs seeded onto SPCL–Si scaffolds after 7 or 14 days in different culturing media: basal (basal), complete osteogenic (osteo), osteogenic mediumwithout ascorbic acid (Wo asc), osteogenic medium without b-glycerolphosphate (Wo beta) or osteogenic medium without dexamethasone (Wo dex). SPCL scaffolds seededwith gBMSCs were used as controls and are represented in the small images. Gray color represents the organic content of the constructs while the blue indicates the presenceof an inorganic phase of the construct. The figures represent the average ± standard deviation values found for the percentage of inorganic phase per scaffold using thegrayscale index and a threshold range between 100 and 255.

4182 M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185

constructs tends to diminish more significantly after 14 days inculture in the presence of complete or incomplete osteogenicmedium.

3.3.2. qPCR analysis of osteogenic related genesThe quantitative PCR analysis of constructs cultured in different

media showed dissimilar expressions of the osteogenic genes ana-lyzed, namely osteopontin and osteonectin (Fig. 6).

The RT-PCR analysis indicates increased osteonectin expressionin gBMSC–SPCL–Si constructs compared to gBMSCs–SPCL con-structs (Fig. 6). These results are particularly significant (P < 0.05)for complete osteogenic medium and osteogenic medium withoutdexamethasone at both 7 and 14 days of culture.

After 7 days of culture, the relative osteonectin expression ofgBMSCs shows the highest values in complete osteogenic medium(P < 0.05) due to the specific osteogenic supplementation providedin this medium, followed by a decrease at the 14 day time point.

In a similar way to osteonectin expression, osteopontin expres-sion levels are higher at day 7 than after 14 days in culture. The rel-ative expression of osteopontin is particularly increased in gBMSC-SPCL scaffolds in osteogenic medium without b-glycerolphosphate(P < 0.05) in comparison to all other culture conditions (Fig. 6). Fur-thermore, in the first week of culture, gBMSCs evidence a higherexpression of osteopontin in control SPCL than in SPCL–Si scaffolds(P < 0.05). The exception is made for gBMSCs cultured on SPCL–Siscaffolds in basic medium.

4. Discussion

The combination of wet spinning technology and a calcium sil-icate solution as a coagulation bath leads to the incorporation offunctional groups, silanol (Si–OH), into the structure of the SPCLscaffold, through a simple single step processing methodology.This innovative procedure developed by our group [10,11] resultsin designing bioactive scaffolds by surface functionalization usingfunctional groups instead of a calcium phosphate coating, as oftendescribed in scientific publications [27].

Preliminary results from previous experiments showed thatSPCL scaffolds induce a good cellular response towards the osteo-genic lineage [12,13], suggesting that Si–OH groups incorporated

in SPCL scaffolds seem to participate in the mechanisms of cellularproliferation and osteogenic differentiation [10,11], implying thepotential relevance of Si–OH groups for bone TE strategies.

One of the main goals of this study was to investigate potentialkey features, namely the bioactivity profile and the mechanicalproperties, of SPCL polymeric fiber mesh scaffolds functionalizedwith Si–OH groups for bone TE applications.

The SBF was used in this study to evaluate efficacy of Si–OHgroups, incorporated into SPCL fiber mesh scaffold, in inducingthe nucleation of an apatite layer.

The decrease in the Ca concentration in SPCL–Si scaffoldsobserved after 24 h by ICP analysis can be associated to the entrap-ment of those ions in the SPCL–Si structure, since the coagulationbath is a calcium silicate solution and a source of Ca ions. Besidesthat, the water uptake capability of this polymer allowed the mate-rial to absorb Ca ions from the SBF solution. The release of Ca ionsmight accelerate the apatite nucleation by increasing the ionicactivity product of the apatite in the SBF and simultaneously form-ing Si–OH groups. However, in this work the apatite forming abilitywas dependent only on the release of Si ions. SEM analysis con-firms these results as a dense and compact apatite layer isobserved after 3 days of immersion in a SBF solution. The increasein Si in the presence of SPCL–Si scaffolds is associated to the releaseof Si ions from those scaffolds leading to the formation of Si–OHgroups, responsible for the apatite nucleation. Si–OH groups regu-late calcium binding from the SBF solution and provide nucleationsites for the formation of apatite nuclei. Once apatite nuclei areformed, they can spontaneously grow into a uniform layer by con-suming the calcium and phosphate ions from the SBF solution asthe SBF solution is already highly supersaturated with respect toapatite. These findings are supported by the measurements of cal-cium, phosphorus and silicon concentrations in SBF, and suggestthat the Si released is just enough to promote the formation ofthe apatite layer detected by TF-XRD and l-CT.

The development of an apatite layer is atypical for biodegrad-able polymeric scaffolds, i.e., they are not able to induce by them-selves the apatite layer without a previous bioactive coating or theuse of bioactive fillers. The capacity for inducing the formation ofan apatite layer is typically associated with bioactive ceramicmaterials [28]. Moreover, these results clearly indicate that the

Fig. 6. Relative expression of osteogenic genes by gBMSCs seeded onto SPCL–Si scaffolds after 7 or 14 days in different culturing media: basal (basal), complete osteogenic(osteo), osteogenic medium without ascorbic acid (Wo asc), osteogenic medium without b-glycerolphosphate (Wo beta) or osteogenic medium without dexamethasone (Wodex). SPCL scaffolds seeded with gBMSCs were used as controls. Gene expression was normalized to values of gBMSC-SPCL constructs after 7 days in basal medium(calibrator). GAPDH gene was selected as the endogenous gene control. Symbols ⁄ and + denote study groups with statistically significant differences (P < 0.05) as using thetwo-way ANOVA method.

M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185 4183

incorporation of Si–OH groups in SPCL scaffolds evidences thecapacity to induce an apatite nucleation when immersed in SFBsolution, and confirming SPCL–Si scaffolds’ bioactive properties.

The results on the dynamic mechanical behavior of SPCL–Siscaffolds with the variation of the frequency under simulatedphysiological conditions indicate that SPCL–Si scaffolds presenthigher stiffness than the SPCL control scaffolds, suggesting thatthe in situ functionalization improves the mechanical propertiesof the scaffold, which is likely beneficial for bone-related applica-tions. These differences are attributed to the incorporation of aninorganic phase into the organic phase, leading to a restriction onthe SPCL chain mobility and therefore, an increase in the stiffnessof SPCL–Si structures. It would thus appear that when a polymericsolution, SPCL solution, is precipitated into the coagulation bath,calcium silicate solution, it is incorporating Si–OH groups thatimposed restrictions on the flexible SPCL chains. Some researchworks have reported that the mobility of PCL chains was restrictedwhen this polymer was part of the ceramer [29,30]. All theseexperimental observations from DMA analysis are in accordancewith Fourier transform infrared spectroscopy with attenuated totalreflection (FTIR–ATR) and X-ray photoelectron spectroscopy (XPS)data presented in previous works [10,11], confirming the incorpo-ration of Si–OH groups into the organic matrix, SPCL, with a loss ofmobility. FTIR–ATR and XPS analysis were used to evaluate theinteractions between the organic and inorganic phases after theprecipitation of SPCL polymeric solution into the coagulation bath,calcium silicate solution, as previously described by our group[10,11].

Altogether, results confirm that the described methodologyallows bioactive polymeric scaffolds to be obtained while main-taining their intrinsic mechanical features.

A second major goal of this work was to understand gBMSCsbehavior in the presence of a calcium phosphate coating onSPCL–Si scaffolds. Despite the higher levels found in the MTS assayfor cells cultured onto SPCL–Si, overall, gBMSCs kept a high cell via-bility and proliferation rate when seeded onto SPCL–Si or SPCL–Si–7SBF scaffolds.

Since ALP is a glycoprotein associated to the formation and mat-uration of the ECM matrix [31], the lower ALP levels indicate thatthe presence of an apatite layer on the surface of SPCL–Si scaffoldsmay not be an essential requirement for the development and mat-uration of the ECM produced by gBMSCs in SPCL–Si scaffolds. Theseresults also show that Si–OH groups influence the in vitro processof proliferation and osteogenic differentiation of gBMSCs.

The gBMSCs viability and colonization of the scaffolds observedin MTS assay and SEM micrographs, respectively, indicate that Si–OH groups have a stronger positive impact on cell response thanSPCL–Si scaffolds coated with a CaP coating after soaking in SBFfor 7 days. Moreover, the results suggest that SPCL–Si scaffoldsinteract more actively with cells in the absence of a CaP coating,confirming the osteoconductive properties of silicon-containingscaffolds aimed at bone strategies [10,32]. These results are alsosupported by the literature [27] as osteoblasts were described tobe more sensitive to elemental composition and distribution thanthe physical properties of the surface in a similar way to gBMSCson SPCL–Si scaffolds.

Therefore, the potential of SPCL–Si scaffolds in inducing per sethe osteogenic differentiation of gBMSCs was further investigatedin the presence or absence of standard biochemical osteogenicsupplements, namely dexamethasone, ascorbic acid andb-glycerolphosphate.

Overall and despite the variation found in the different culturemedia, gBMSCs presented high viability levels that tend to increasewith the time in culture on both SPCL–Si and SPCL control scaf-folds. The omission of each osteogenic supplement in cell culturemedium did not promote an inhibitory response in gBMSCs metab-olism that critically affected cellular viability.

Regardless of the minimal amounts present in the natural bone,silicon was shown to have a critical role in bone metabolism and inosteoblast proliferation and differentiation [6–9,33].

Osteoinduction has been commonly associated to bone forma-tion in an in vivo environment. Nevertheless, the induction of oste-ogenic differentiation in the absence of osteogenic supplementedmedium could be considered an in vitro form of pre-osteoinduc-tion. In this study, we observed that gBMSCs cultured onto SPCL–Si scaffolds differentiated into the osteogenic phenotype in theabsence of ascorbic acid, b-glycerolphosphate and dexamethasonesupplements.

The l-CT analysis indicated that the presence of silanol groupsin the constructs influences the inorganic content, as expected.Despite the fact that basal (basal) and complete osteogenic (osteo)culture media display some variations in the calcium and phos-phate contents in the media formulations, the incomplete osteo-genic media formulations (Wo dex, Wo asc and Wo beta) are notexpected to show significant differences in terms of calcium andphosphate levels since these culture media were made withalpha-MEM and under the same conditions as complete osteogenicmedium (osteo), but with depletion of osteogenic supplements.

4184 M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185

The only exception is made for medium without b-glycerolphos-phate, as b-glycerolphosphate is a known source of phosphate ions.In fact, this could explain the reduced increment in inorganiccontent in constructs after 2 weeks in culture withoutb-glycerolphosphate in comparison to the other mediumconditions. Since the calcium ion content is similar in the variousosteogenic culture media, and the phosphate ion content is similaras well as in all osteogenic media but the one without b-glycerol-phosphate, the main differences observed in the percentage ofinorganic volume should be due to the presence of cells, and con-sequently to the mineral extracellular matrix produced. Unlikedepleted media (Wo asc, Wo beta, Wo dex), the inorganic contentdetected in complete osteogenic medium is lower after 14 days inculture. Also, the amount of inorganic content increases in bothSPCL–Si and SPCL constructs cultured in basal medium to very sig-nificant levels. Considering that the calcium supplementation isnot available in basal medium conditions, it is likely that the incre-ment in inorganic volume may be associated to gBMSCs and to theproduction of a mineralized ECM.

Altogether, results suggest that osteogenic medium supple-ments provided to gBMSCs participate in ECM synthesis but arenot essential to stimulate a bone-like ECM in SPCL–Si fiber meshscaffolds. Additionally, gBMSCs were able to differentiate into theosteogenic phenotype and produce a mineralized ECM even inbasal medium, which is likely to relate to the presence of silanolgroups.

With the onset of mineralization, osteopontin, described as par-ticipating in the bone remodeling process and being necessary forthe initiation of bone mineralization as this protein binds tohydroxyapatite [31], should be induced and increase with theaccumulation of mineral, namely calcium and phosphate ions. Inour experimental setup phosphate ions are mainly provided byb-glycerolphosphate, and calcium ions from the a-MEM or DMEMmix, and SPCL–Si scaffolds as well. Interestingly, the omission of aphosphate source from gBMSCs influenced the expression of oste-opontin but did not cause the gene downregulation. The presenceof a construct with a high inorganic content resultant from thescaffold composition and some degree of mineralized ECM mayhave influenced the expression of osteopontin by acting as a poten-tial source of mineral ions to be re-assembled or remodeled into amineralized bone-like ECM.

On the other hand, osteonectin is a glycoprotein known forbeing expressed during the period of active proliferation and forplaying a role in bone mineralization by binding hydroxyapatiteto collagen [28]. The increase in the osteonectin expression ingBMSC–SPCL–Si constructs compared to gBMSCs–SPCL constructssuggests a role for SPCL–Si scaffolds in the osteogenic process ofgBMSCs. This increase in osteonectin expression is likely to beassociated to the high inorganic content in gBMSC-SPCL–Si con-structs as collagen I and some level of mineralization are detectedin the ECM synthesized by gBMSCs.

The dissimilar osteonectin and osteopontin expression in thepresence of SPCL–Si and SPCL control scaffolds indicates that thescaffold composition may directly interfere with the gene expres-sion of these osteogenic-specific markers with the culture timelineand conditioned media. The presence of a mineral-rich substratethat in part may be associated to the production of a mineralizedECM matrix, as demonstrated by previous results, can also influ-ence the differentiation timing and the gene outcomes of culturedgBMSCs.

In the case of SPCL–Si scaffolds, the scaffold itself may work as aresourceful private source for Ca ions. Since Ca ions can be releasedfrom SPCL–Si scaffolds, as demonstrated in the bioactivity tests, itmay be that variations in the medium supplementation may not beas significant as for gBMSCs cultured in SPCL control scaffolds.Thus, the interaction of gBMSCs with SPCL–Si scaffolds may result

in physical, mechanical and biochemical stimulation to the cellstowards the osteogenic lineage.

In summary, both SPCL–Si and SPCL control scaffolds supportedthe synthesis and deposition of a mineralized ECM matrix. The for-mation of a mineralized ECM, indicated by an increment in theinorganic content on the constructs over the culture time, is moreexuberant in SPCL–Si scaffolds, likely because of the presence ofsurface functionalized silanol groups, and their dynamic interac-tion with cells.

Our results also suggest that polymeric materials containing sil-anol groups induce osteogenic differentiation by conditioninggBMSCs to a bone-like micro-environment [6–9,34]. The silanolgroups in SPCL–Si scaffolds can be related to the biological rele-vance of silicon in natural metabolic processes of bone, underlyingthe potential of SPCL–Si scaffolds and its intrinsic properties to sus-tain in vitro osteogenic features. This study, together with previousworks with SPCL based scaffolds [10–13], suggests a considerablepotential of these materials for bone regeneration strategies.

Another important outcome is the elimination of osteogenicsupplement-associated costs and risks. Cell culturing could pro-gress into more cost-effective, controlled (avoiding batch and uservariation) and simplified methodologies, which could facilitate thescale-up of a translational bioengineered product towards clinicalapplication. Moreover, potential side-effects of these supplements,such as dexamethasone [20], could be avoided in in vivo strategiesfocused on cell transplantation within the constructs.

5. Conclusions

A successful and practical clinical application of a tissue-engineered construct will depend not only on the feasibility of thesystem but also on the production costs and applicability in the sur-gical theater. Only a simple, cost-effective and ready-to-use systemwill reach the wider population in need of bioengineered tissue. Inthis study, the potential of functionalized wet-spun fiber mesh scaf-folds for bone TE was assessed by physical, chemical and biologicalcharacterization with promising results in future orthopedicapproaches.

The combination of wet-spinning technology and a calcium sil-icate solution as a coagulation bath leads to the incorporation ofSi–OH functional groups into the structure of SPCL scaffold; thisapproach demonstrates an ability to induce apatite nucleationafter immersion in a SBF solution. SPCL–Si scaffolds were shownto combine the properties of classical bioactive ceramics and thedegradability of an organic polymer.

The favorable assessment of SPCL–Si scaffolds in gBMSC sug-gests that the mechanism involving silicon is likely to be more sim-ilar to the in vivo natural process than that involving CaP coating.Furthermore, it was demonstrated that SPCL–Si scaffolds have suf-ficient biological activity to sustain the osteogenic differentiationof cells and synthesis of a collagen-rich mineralized ECM matrix,even in the absence of exogenous osteogenic factors. The omissionof osteogenic media supplements not only simplifies cell culturingprocedures but shortens the time required and lowers productioncosts, reducing the gap between bioengineered grafts and medicalpractice through a clinically friendly product.

It is envisioned that future studies will confirm constructfunctionality in vivo, and test this system with animal-origin-freeculture media, working towards a clinical field application.

Acknowledgements

M.T.R. and I.B.L. thank the Portuguese Foundation for Scienceand Technology (FCT) for providing a PhD scholarship (Grant No.SFRH/BD/30745/2006), and a post-doctoral scholarship (GrantNo. SFRH/BPD/26648/2006) respectively.

M.T. Rodrigues et al. / Acta Biomaterialia 10 (2014) 4175–4185 4185

This work was partially supported by the MIMESIS project(PTDC/CTM/67560/2006) funded by FCT, and by the EuropeanNoE EXPERTISSUES (NMP3-CT-2004-500283).

Appendix A. Figures with essential colour discrimination

Certain figures in this article, particularly Figs. 1, 4 and 5 are dif-ficult to interpret in black and white. The full colour images can befound in the on-line version, at doi:http://dx.doi.org/10.1016/j.actbio.2014.05.026).

References

[1] Giannoudis PV, Dinopoulos H, Tsiridis E. Bone substitutes: an update. Injury2005;36(Suppl. 3):S20–7.

[2] Drosse I, Volkmer E, Capanna R, De Biase P, Mutschler W, Schieker M. Tissueengineering for bone defect healing: an update on a multi-componentapproach. Injury 2008;39(Suppl 2):S9–S20.

[3] Barradas AM, Fernandes HA, Groen N, Chai YC, Schrooten J, van de Peppel J,et al. A calcium-induced signaling cascade leading to osteogenic differentiationof human bone marrow-derived mesenchymal stromal cells. Biomaterials2012;33:3205–15.

[4] Hoppe A, Guldal NS, Boccaccini AR. A review of the biological response to ionicdissolution products from bioactive glasses and glass-ceramics. Biomaterials2011;32:2757–74.

[5] Hench LL. Bioceramics – from concept to clinic. J Am Ceram Soc1991;74:1487–510.

[6] Xynos ID, Edgar AJ, Buttery LD, Hench LL, Polak JM. Ionic products of bioactiveglass dissolution increase proliferation of human osteoblasts and induceinsulin-like growth factor II mRNA expression and protein synthesis. BiochemBiophys Res Commun 2000;276:461–5.

[7] Hench LL. Genetic design of bioactive glass. J Eur Ceram Soc 2009;29:1257–65.[8] Xynos ID, Hukkanen MV, Batten JJ, Buttery LD, Hench LL, Polak JM. Bioglass

45S5 stimulates osteoblast turnover and enhances bone formation in vitro:implications and applications for bone tissue engineering. Calcif Tissue Int2000;67:321–9.

[9] Jugdaohsingh R. Silicon and bone health. J Nutr Health Aging 2007;11:99–110.[10] Leonor IB, Rodrigues MT, Gomes ME, Reis RL. In situ functionalization of wet-

spun fibre meshes for bone tissue engineering. J Tissue Eng Regen Med2011;5:104–11.

[11] Rodrigues AI, Gomes ME, Leonor IB, Reis RL. Bioactive starch-based scaffoldsand human adipose stem cells are a good combination for bone tissueengineering. Acta Biomater 2012;8:3765–76.

[12] Rodrigues MT, Gomes ME, Viegas CA, Azevedo JT, Dias IR, Guzon FM, et al.Tissue-engineered constructs based on SPCL scaffolds cultured with goatmarrow cells: functionality in femoral defects. J Tissue Eng Regen Med2011;5:41–9.

[13] Rodrigues MT, Lee SJ, Gomes ME, Reis RL, Atala A, Yoo JJ. Amniotic fluid-derived stem cells as a cell source for bone tissue engineering. Tissue Eng PartA 2012;18:2518–27.

[14] Allori AC, Sailon AM, Warren SM. Biological basis of bone formation,remodeling, and repair-part I: biochemical signaling molecules. Tissue EngPart B Rev 2008;14:259–73.

[15] Vater C, Kasten P, Stiehler M. Culture media for the differentiation ofmesenchymal stromal cells. Acta Biomater 2011;7:463–77.

[16] Choi KM, Seo YK, Yoon HH, Song KY, Kwon SY, Lee HS, et al. Effect of ascorbicacid on bone marrow-derived mesenchymal stem cell proliferation anddifferentiation. J Biosci Bioeng 2008;105:586–94.

[17] Maniatopoulos C, Sodek J, Melcher AH. Bone formation in vitro by stromal cellsobtained from bone marrow of young adult rats. Cell Tissue Res1988;254:317–30.

[18] Franceschi RT, Iyer BS, Cui Y. Effects of ascorbic acid on collagen matrixformation and osteoblast differentiation in murine MC3T3-E1 cells. J BoneMiner Res 1994;9:843–54.

[19] Bellows CG, Heersche JN, Aubin JE. Determination of the capacity forproliferation and differentiation of osteoprogenitor cells in the presence andabsence of dexamethasone. Dev Biol 1990;140:132–8.

[20] Schacke H, Docke WD, Asadullah K. Mechanisms involved in the side effects ofglucocorticoids. Pharmacol Ther 2002;96:23–43.

[21] Thibault RA, Scott Baggett L, Mikos AG, Kasper FK. Osteogenic differentiation ofmesenchymal stem cells on pregenerated extracellular matrix scaffolds in theabsence of osteogenic cell culture supplements. Tissue Eng Part A2010;16:431–40.

[22] Tuzlakoglu K, Pashkuleva I, Rodrigues MT, Gomes ME, van Lenthe GH, MullerR, et al. A new route to produce starch-based fiber mesh scaffolds by wetspinning and subsequent surface modification as a way to improve cellattachment and proliferation. J Biomed Mater Res A 2010;92:369–77.

[23] Oyane A, Kawashita M, Nakanishi K, Kokubo T, Minoda M, Miyamoto T, et al.Bonelike apatite formation on ethylene-vinyl alcohol copolymer modified withsilane coupling agent and calcium silicate solutions. Biomaterials2003;24:1729–35.

[24] Kokubo T, Takadama H. How useful is SBF in predicting in vivo bonebioactivity? Biomaterials 2006;27:2907–15.

[25] Kokubo T. Design of bioactive bone substitutes based on biomineralizationprocess. Mater Sci Eng C Bio S 2005;25:97–104.

[26] Mano JF. Viscoelastic properties of chitosan with different hydration degreesas studied by dynamic mechanical analysis. Macromol Biosci 2008;8:69–76.

[27] Yeung WK, Reilly GC, Matthews A, Yerokhin A. In vitro biological response ofplasma electrolytically oxidized and plasma-sprayed hydroxyapatite coatingson Ti-6Al-4V alloy. J Biomed Mater Res B Appl Biomater 2013;101:939–49.

[28] Vallet-Regi M. Ceramics for medical applications. J Chem Soc Dalton2001:97–108.

[29] Tian D, Blacher S, Dubois P, Jerome R. Biodegradable and biocompatibleinorganic–organic hybrid materials – 2. Dynamic mechanical properties,structure and morphology. Polymer 1998;39:855–64.

[30] Tian D, Blacher S, Jerome R. Biodegradable and biocompatible inorganic–organic hybrid materials: 4. Effect of acid content and water content on theincorporation of aliphatic polyesters into silica by the sol–gel process. Polymer1999;40:951–7.

[31] Lian JB, Stein GS. Concepts of osteoblast growth and differentiation: basis formodulation of bone cell development and tissue formation. Crit Rev Oral BiolMed 1992;3:269–305.

[32] Marino G, Rosso F, Cafiero G, Tortora C, Moraci M, Barbarisi M, et al. Beta-tricalcium phosphate 3D scaffold promote alone osteogenic differentiation ofhuman adipose stem cells: in vitro study. J Mater Sci – Mater Med2010;21:353–63.

[33] Obata A, Kasuga T. Stimulation of human mesenchymal stem cells andosteoblasts activities in vitro on silicon-releasable scaffolds. J Biomed MaterRes A 2009;91:11–7.

[34] Carlisle EM. Silicon: a possible factor in bone calcification. Science1970;167:279–80.