1
1
2
Generation of single-copy transposon insertions in 3
Clostridium perfringens by electroporation of phage Mu DNA 4
transposition complexes 5
6
A. LANCKRIET1*
, L. TIMBERMONT1, L. J. HAPPONEN
2, M. I. PAJUNEN
2,3, F. 7
PASMANS1, F. HAESEBROUCK
1, R. DUCATELLE
1, H. SAVILAHTI
2,3 and F. VAN 8
IMMERSEEL1
9
10
11
12
13
14
15
16
17
18
19
20
1Department of Pathology, Bacteriology and Avian Diseases, Research Group Veterinary 21
Public Health and Zoonoses, Faculty of Veterinary Medicine, Ghent University, 22
Salisburylaan 133, B-9820 Merelbeke, Belgium. 23
²Research Program in Cellular Biotechnology, Institute of Biotechnology, Viikki 24
Biocenter, PO Box 56, Viikinkaari 9, FIN-00014 University of Helsinki, Finland 25
3Division of Genetics and Physiology, Department of Biology, Vesilinnantie 5, FIN-26
20014 University of Turku, Finland. 27
28
* Corresponding author. Mailing address : Department of Pathology, Bacteriology and Avian Diseases,
Faculty of Veterinary Medicine, Ghent University, Salisburylaan 133, B-9820 Merelbeke, Belgium. Phone:
(0032) 09 264 74 48. Fax: (0032) 09 264 74 94. E-mail: [email protected]
Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02214-08 AEM Accepts, published online ahead of print on 6 March 2009
2
ABSTRACT 29
Transposon mutagenesis is a widely used tool for the identification of genes involved in 30
the virulence of bacteria. Until now, transposon mutagenesis in Clostridium perfringens 31
has been restricted to the use of Tn916-based methods in laboratory reference strains. The 32
system primarily yields multiple transposon insertions within a single genome, thus 33
compromising its use in the identification of virulence genes. The current study describes 34
a new protocol for transposon mutagenesis in Clostridium perfringens, which is based on 35
the bacteriophage Mu transposition system. The protocol was successfully used to 36
generate a single-insertion mutant library both for a laboratory strain and a field isolate. 37
Thus it can be used as a tool in large-scale screenings to identify virulence genes of C. 38
perfringens. 39
40
41
INTRODUCTION 42
Clostridium perfringens is a Gram-positive, anaerobic bacterium that forms heat resistant 43
spores. It is widespread in the soil and commonly found in the gastro-intestinal tract of 44
mammals. It has been implicated in several medical conditions in humans, ranging from 45
mild food poisoning to necrotic enteritis and gas gangrene. C. perfringens strains also 46
cause a variety of important diseases in domestic animals, including several enteric 47
syndromes such as enterotoxaemia in cattle, sheep and pigs, necrotic enteritis in poultry 48
and typhocolitis in equines (17, 40). 49
50
3
Understanding the pathogenesis of these infections is of crucial importance in the 51
development of new tools for the prevention and control of C. perfringens -related 52
diseases. Genetic modification is a valuable approach to identify new virulence factors 53
and study their role in the pathogenesis of C. perfringens. 54
55
Since the 1980s, several tools for the manipulation of C. perfringens at the molecular 56
level have been developed (1, 5, 28, 35, 38). Among these tools, transposon mutagenesis 57
is a widely used method for the identification of virulence genes. Up till now, the only 58
reproducible method for transposon mutagenesis in C. perfringens is based on Tn916, a 59
tetracycline resistance encoding conjugative transposon originally isolated from 60
Enterococcus faecalis (10, 11, 13). Tn916 has been used extensively for transposon 61
mutagenesis due to its broad host range and has been proven valuable for gene 62
identification in C. perfringens (3, 7, 22). Nevertheless, this method has major 63
disadvantages: multiple Tn916 insertion events occur with an incidence of 65% to 75%, 64
severely complicating the identification of genes responsible for phenotype changes (3, 7, 65
19). Furthermore, Tn916 is still active after insertion resulting in unstable mutants (6, 39, 66
42). The generation of Tn916-derived transposon mutants in C. perfringens field strains, 67
has, to our knowledge, never been described. 68
69
Although a variety of transposon mutagenesis methods are available for Gram-positive 70
bacteria (4, 37, 41, 43), the inherent species non-specificity as well as immobility of the 71
integrated transposon, makes the bacteriophage Mu-based transposon delivery 72
methodology a system of choice for a variety of species (16, 26, 46). The Mu 73
4
transposition approach includes an in vitro assembly of a complex between the 74
transposon DNA and the transposase enzyme, i.e. the transpososome, followed by 75
delivery of the transpososome into the recipient cells. Once inside the cell, the Mu 76
transpososome becomes activated in the presence of divalent cations, resulting in 77
genomic integration of the delivered transposon. The bacteriophage Mu transposition 78
system is also functional in vitro, (15, 32, 33) in contrast to the Tn916 mutagenesis 79
strategy which is restricted to transposon mobilization in vivo following conjugation or 80
electroporation. In the optimal in vitro conditions, the Mu transposition reaction only 81
requires the MuA transposase, a mini-Mu transposon and target DNA as macromolecular 82
components (15). 83
84
In this study, a novel protocol is presented for transposon mutagenesis in C. perfringens 85
that exploits the bacteriophage Mu transposition system. To our knowledge, this work 86
represents the first report of a mutagenesis method generating single-insertion transposon 87
mutants in laboratory and field isolates of C. perfringens. This method is important in the 88
identification of C. perfringens virulence factors involved in the numerous diseases 89
caused by this bacterium. 90
91
92
93
5
MATERIALS AND METHODS 94
95
Bacterial strains and culture conditions. C. perfringens strain JIR325 is a 96
rifampicin and nalidixic acid -resistant derivative of strain 13, a toxinotype A strain 97
originally isolated from the soil (22). C. perfringens strain 56 was isolated from the gut of 98
a broiler chicken having necrotic lesions in the intestine (14). Escherichia coli laboratory 99
strain DH5α (45) was used for routine plasmid DNA isolation. 100
C. perfringens strains were grown anaerobically at 37°C in BHI broth (Oxoid, 101
Basingstoke, UK) or TGY broth (30g tryptone [Oxoid], 20g BactoTM
Yeast extract [BD 102
Biosciences, San Jose, USA], 1g glucose [Sigma, St. Louis MO, USA], 1g L-cystein 103
[Sigma]). Solid medium for C. perfringens consisted of 3.9 % Colombia agar base 104
(Oxoid) supplemented with 5 % defibrinated sheep blood (International Medical, 105
Brussels, Belgium) or 2 % egg yolk, hereafter named egg yolk agar plates. 106
E. coli DH5α was grown aerobically at 37°C in Luria broth (Sigma). 107
When appropriate, plasmid maintenance and genomic transposon insertions were selected 108
by the addition of erythromycin (Sigma) to the growth media at the following 109
concentrations: E. coli: 200 µg/ml, C. perfringens: 10 µg/ml. 110
Plasmids. Plasmid pLEB620 is a pUC19-derived carrier plasmid for the Em-Mu 111
mini-transposon (26). Em-Mu includes the ermB gene from Lactobacillus reuteri, which 112
encodes resistance to macrolides, lincosamides and streptogramin B antibiotics. In the 113
transposon termini as an inverted repeat, the resistance cassette is flanked by a pair of 50-114
bp segments from the Mu right end, including critical MuA transposase binding sites (26, 115
33). Plasmid pTCATT is a derivative of the E. coli /C. perfringens shuttle vector pJIR410 116
(8). Besides the ermB gene, pTCATT carries the ORF from catP and can therefore be 117
6
used as a reporter system. In this work, pTCATT was used as a replicative control 118
plasmid for the efficacy of electroporation. 119
Electrocompetent cells. Electrocompetent E. coli cells were prepared essentially 120
as described by Sambrook and Russell (30). Electrocompetent C. perfringens cells were 121
prepared using the method of Scott and Rood (35) with minor modifications. 122
C. perfringens cells were cultured overnight in liquid BHI medium and diluted 1:30 in 12 123
ml of TGY broth. The cells were grown to an optical density of 0.2-0.3 and harvested by 124
centrifugation at 4300 rpm (~650 g) for 20 minutes at 21°C. Cells were then rinsed twice 125
with 1.2 ml of electroporation buffer (272 mM sucrose, 7 mM sodium phosphate buffer 126
[pH 7.4]). In between the rinsing steps, the cells were collected by centrifugation at 127
13000 rpm (~1250 g) for 10 minutes at 21°C. After the second rinse, 1.2 ml of 128
electroporation buffer containing lysostaphin (Sigma) was added, and the cells were 129
incubated for 1 hour at 37°C. The two rinsing steps with electroporation buffer were 130
repeated. Finally, the cells were resuspended in 1.2 ml of electroporation buffer and 131
divided into aliquots of 400 µl. 132
Isolation of the Em-Mu transposon and transpososome assembly. For 133
transposon mutagenesis in C. perfringens, the Em-Mu mini transposon was used (26). 134
Isolation of Em-Mu transposon and transpososome assembly were performed as 135
described by Pajunen et al. (26). Briefly, the plasmid pLEB620 containing the Em-Mu 136
transposon was propagated in E. coli DH5α and isolated using the Plasmid Midi kit 137
(Qiagen, Hilden, Germany). 138
The Em-Mu transposon was released from pLEB620 by BglII (Sigma) digestion. The 139
digested DNA was extracted sequentially using phenol and chloroform and concentrated 140
7
by ethanol precipitation. The transposon fragment was purified chromatographically 141
using an anion exchange column MonoQ HR 5/5 (Pharmacia Amersham Biosciences, 142
Piscataway, USA). Fractions containing Em-Mu were pooled and concentrated by 143
ethanol precipitation. 144
The in vitro transpososome assembly reaction mixture (80 µl) consisted of 4.4 pmol Em-145
Mu and 19.6 pmol (1600 ng) MuA transposase (Finnzymes, Espoo, Finland), 50% (v/v) 146
glycerol, 150 mM Tris [pH 6], 0.025% Triton X-100, 150 mM NaCl, 0.1 mM EDTA. The 147
reaction was carried out at 30°C for 4 hours. Eight transpososome assembly reactions 148
were pooled and concentrated by PEG precipitation essentially as described (31). The 149
pellet was resuspended in 50 µl TGD buffer (10 mM Tris-HCl,pH 6, 0.5% glycerol, 0.1 150
M DTT). Transposition complexes were stored at –80 °C unless otherwise indicated. 151
Successful complex assembly was monitored on 2% agarose (Nusieve 3:1, Cambrex) gel 152
containing 87 µg/ml of heparin and 87 µg/ml of bovine serum albumin as described (21). 153
Transposon mutagenesis. For electroporation, electrocompetent cells (400 µl) 154
were mixed with the transpososome preparation (1 µl) on ice and transferred to a 155
prechilled 0.2 cm electrode spacing cuvette (Biorad, Hercules, USA). The cells were 156
incubated on ice for 10 minutes. Electroporation was then performed in a Gene Pulser 157
Xcell™ Eukaryotic System (Biorad) using the following settings: 400 Ω, 1.25 kV and 25 158
µF. Following the pulse, the cells were incubated on ice for 10 minutes and then 159
transferred to 1 ml of TGY broth containing 10 mM MgCl2. JIR325 cells were incubated 160
for 2 hours at 37°C following the pulse. Depending on the protocol being tested, cells of 161
the field isolate 56 were incubated for 3 hours at 37°C or 4 hours at 20°C or 30°C 162
following the pulse. In the optimized protocol for the field isolate 56, the cells were first 163
8
incubated at 37°C, then 1 µg/ml of erythromycin was added, and the cells were incubated 164
for another hour at 37° in the presence of erythromycin. Following a total incubation time 165
of 2, 3 or 4 hours, the transformed cells were plated on egg yolk agar plates containing 10 166
µg/ml of erythromycin. 167
Southern blot. Genomic DNA was isolated from C. perfringens using the CTAB 168
method (44) and subsequently digested with PsiI (Fermentas, Burlington, Canada). The 169
resulting fragments were separated by agarose gel electrophoresis and subsequently 170
transferred onto a nylon membrane (Roche Diagnostics, Basel, Switzerland) with SSC 171
solution (Roche Diagnostics). Fixation was done by heating the membrane for 2 hours at 172
80°C. A DIG-labeled Em-Mu probe was synthesized with the PCR DIG Probe synthesis 173
kit (Roche diagnostics) using the following primers: Em-Mu probe fw 174
(ACTGAATACTCGTGTCAC) and Em-Mu probe rev 175
(GTCAGATAGATGTCAGACGC). For hybridization and immunodetection, the DIG 176
Easy Hyb Wash and Block buffer set and CDP-Star (Roche diagnostics) were used 177
according to the manufacturer's guidelines. 178
Identification of transposon-flanking genome sequences. To amplify the 179
transposon-flanking genome sequences, a modification of the method by Kwon and 180
Ricke (20) was used. Genomic DNA was prepared and digested with XapI (Fermentas). 181
The Y-linkers were prepared as described (20) by annealing the following two 182
oligonucleotides: Linker1 (TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGG 183
ACA) and Linker 2 (AATTTGTCCCCGTACATCGTTAGAACTACTCGTACCATCC 184
ACAT). The DNA fragments were ligated to Y-linkers (20) using T4 DNA ligase 185
(Invitrogen, Merelbeke, Belgium). For the amplification of the genome region 5’ and 3’ 186
9
to the inserted transposon the primer pairs Y-linker primer 187
(CTGCTCGAATTCAAGCTTCT) and Em-Mu seq rev (ATCAGCGGCCGCGATC) or 188
the Y-linker primer and Em-Mu seq fw (TCTGCAGACGCGTCGACGTCA) were used, 189
respectively. Nucleotide sequences were analyzed using the BigDye® Terminator v 3.1 190
Cycle sequencing-kit (Applied Biosystems, Foster city, USA), the DyeEx 2.0 spin kit 191
(Qiagen) and the ABI Prism 3100 Genetic Analyzer (Applied Biosystems). 192
Genomic transposon insertion sites were identified by comparing the sequences to the 193
publicly available genomic sequences of C. perfringens strains 13, ATCC13124 and 194
SM101, using BLAST on the European Bioinformatics Institute server. 195
10
RESULTS AND DISCUSSION 196
Optimization of the electroporation process. Several protocols have been 197
published for the electroporation of the C. perfringens laboratory strain 13 (1, 2, 7, 18, 198
27, 35). However, field isolates often behave differently from laboratory strains, and the 199
currently available electroporation protocols do not guarantee a successful electroporation 200
of field isolates. 201
As the electroporation efficiency is the key factor affecting bacteriophage Mu 202
transpososome delivery, an optimal electroporation protocol needed to be generated for 203
C. perfringens. To prevent premature activation of the transpososome, contact with 204
divalent cations outside the bacterium should be avoided, and therefore, electroporation 205
buffers should be prepared without Mg2+
or Ca2+
ions. Several electroporation protocols 206
(1, 7, 18, 35) were tested for the field isolate 56. The highest electroporation yield, using 207
a control plasmid pTCATT containing an erythromycin resistance gene, was generated 208
with the modified protocol of Scott and Rood (35). Due to the altered ion contents of the 209
Mg2+
and Ca2+
-free buffer (272 mM sucrose, 7 mM sodium phosphate buffer[pH 7.4]), 210
new electroporation parameters needed to be established. The optimal settings were 211
determined to be 400 Ω, 1.25 kV and 25 µF. Electrocompetent cells for both the 212
laboratory strain JIR325 and the field isolate 56 were prepared using the same protocol, 213
with the exception of the concentration of lysostaphin used. As the field isolate 56 214
appeared to be more sensitive to lysostaphin, a lower concentration of lysostaphin, (2 215
µg/ml) was used as compared with strain JIR325 (10 µg/ml). Electrocompetent cells from 216
field isolate 56 could not be stored at -80°C but needed to be prepared freshly prior to 217
electroporation. 218
11
Transposon mutagenesis. In each electroporation experiment, 1 µl of 219
transpososome preparation was delivered into strain JIR325 or isolate 56 cells. Following 220
the pulse, the transformants were allowed to recover in TGY before the antibiotic 221
selection was applied on egg yolk agar plates containing 10µg/ml erythromycin. For 222
strain JIR325, an incubation time of 2 hours in non-selective TGY was sufficient to allow 223
plating on selective agar plates. However, transformants of field isolate 56 required an 224
incubation time of three hours in non-selective medium. Sequencing data (not shown) 225
revealed that three hours of incubation in non-selective medium resulted in the presence 226
of multiple identical mutants in each batch. Thus, several strategies to prevent mutant 227
amplification in non-selective TGY were tested. A decrease in incubation temperature to 228
20°C or 30°C combined with a longer incubation time appeared unsuccessful. Finally, by 229
the addition of erythromycin to the incubation medium in a concentration below the 230
minimum inhibitory concentration (MIC) for both strains, i.e. 1 µg/ml, after 1 hour of 231
incubation, the transformants could be plated on selective agar plates 2 hours after the 232
pulse and multiplication of the mutants was avoided. 233
The yield of transposon mutants fluctuated depending on the quality of the 234
electrocompetent cells used. As a control, the plasmid pTCATT was electroporated with 235
each batch of electrocompetent cells. Absence or low yields of transposon mutants were 236
consistently reflected in the absence or low number of positive transformants obtained 237
with pTCATT. Due to the difference in competency status, the yield of transposon 238
mutants was higher for the laboratory strain JIR325 than for the field isolate 56 (see table 239
1). In total, 3200 mutants of field isolate 56 were obtained. 240
12
The efficiency of the Em-Mu transposon insertion into C. perfringens is at a workable 241
level and intermediate when compared to other Gram positive bacteria. The yield is 242
similar to the one obtained with Streptococcus suis (100 cfu/µg DNA) and Lactococcus 243
lactis (110 cfu/µg DNA), lower than with Staphylococcus aureus (20,000 or 12000 cfu/ 244
µg transposon DNA depending on the strain) and higher than with Streptocococcus 245
pyogenes (10 cfu/µg transposon) (26, 46). When compared to the efficiency in Gram 246
negative bacteria, the efficiency in C. perfringens is two to three magnitudes lower (21). 247
Genomic integration. A PCR was performed to confirm the presence of the Em-248
Mu transposon on the genomic DNA of 50 mutants. Genomic DNA from 30 249
erythromycin resistant isolate 56 was isolated, digested with PsiI that does not cut 250
transposon DNA, and analyzed by Southern hybridization with a DIG-labeled Em-Mu 251
transposon probe. All mutants analyzed contained a single copy of the Em-Mu 252
transposon. The results of the southern blot for 7 mutants are shown in Figure 1. 253
Identification of the Em-Mu insertional regions 254
For the identification of the transposon-flanking genome regions, a modification of the 255
method designed by Kwon and Ricke (20) was used. After each successful mutagenesis 256
experiment, mutants were randomly picked for sequencing. In total, 200 mutants were 257
sequenced. A 5 bp target duplication is present in all the clones (see table 2), which is 258
characteristic for Mu transposition in vivo and excludes other types of DNA restructuring 259
reactions as the cause of genomic integration. The sequencing data revealed relatively 260
even distribution of integrations, although rRNA gene regions appeared to be favored. 261
Among the transposon insertion sites of 200 mutants sequenced, protein encoding genes 262
comprised 44.5 % of the integration sites. 43% of the mutants carried a transposon 263
13
inserted into one of the rRNA genes and 12.5 % had a transposon inserted into an 264
intergenic sequence. 2% carried a mutation in a pCW9-like plasmid. Preferential insertion 265
of the Em-Mu transposon into the rRNA gene clusters has also been described for 266
Saccharomyces cerevisiae, in which a positive correlation was found between GC 267
richness and MuA integration frequency (25). In C. perfringens strains, the number of 268
rRNA genes varies between 23 and 29, accounting for about 1.5% of the organism's 269
coding capacity (23, 36). Furthermore, it was reported that rRNA genes have a 270
significantly higher G+C content compared to the rest of the genome (12, 36). Both the 271
high copy number and the G+C content of the rRNA genes could be an explanation for 272
the higher prevalence of rRNA mutants. 273
Compared to Em-Mu, the use of Tn916 has several limitations. First, Tn916 shows a 274
preference for regions with sequence similarity to its transposon ends, i.e. consisting of a 275
5 to7 bp run of adenines followed by a similar number of thymines (34). These AT-rich 276
regions are usually found in intergenic regions in low GC content genomes (34). The 277
preferential insertion of Tn916 in AT-rich regions has been described for other low GC-278
content bacteria like Mycoplasma gallisepticum, Haemophilus influenza and, 279
Streptococcus mutans (9, 24, 29). The exact proportion of intergenic Tn916 insertion 280
mutants for C. perfringens is not known, as the insertion spectrum of the transposon has 281
always been analyzed by Southern hybridization and not by sequencing (7, 19). Secondly, 282
only 25 to 35% of the Tn916 derived C. perfringens mutants carry a single copy of the 283
transposon, while no multiple insertions were detected in the Em-Mu derived mutants (3, 284
7, 19). Taking both the multiple insertion events and the preference of Tn916 for AT-rich 285
intergenic regions into account, the proportion of single insertions into protein encoding 286
14
genes must be lower than 25%-35%. Thirdly, gene regions can be removed when Tn916 287
insertion is followed by a deletion event (3). No such deletion events have been described 288
for Em-Mu. 289
290
In conclusion, a new protocol for transposon mutagenesis in C. perfringens was 291
developed that is based on the bacteriophage Mu DNA transposition system. The method 292
described surpasses the formerly used protocols based on Tn916 since mutants, 293
containing only a single copy of the transposon, are generated and the proportion of hits 294
in protein encoding genes is higher. Furthermore, the method is also applicable to field 295
isolates of C. perfringens, given they can be made electrocompetent. 296
297
298
ACKNOWLEDGEMENTS 299
We would like to thank Professor Richard Titball, School of Biosciences, University of 300
Exeter, UK for the provision of plasmid pTCATT and Professor Julian Rood, Monash 301
University, Australia for the provision of strain JIR325. 302
We would like to thank Renzo Vercammen for his skilful technical assistance. This work 303
was supported by the Institute for Science and Technology, Flanders (IWT). Dr. F. Van 304
Immerseel is supported by a Postdoctoral Research Grant of the Research Foundation - 305
Flanders (FWO) and by the Research Fund of Ghent University. 306
REFERENCES 307
1. Allen, S. P., and H. P. Blaschek. 1988. Electroporation-induced transformation 308
of intact cells of Clostridium perfringens. Appl Environ Microbiol 54:2322-4. 309
15
2. Allen, S. P., and H. P. Blaschek. 1990. Factors involved in the electroporation-310
induced transformation of Clostridium perfringens. FEMS Microbiol Lett 58:217-311
20. 312
3. Awad, M. M., and J. I. Rood. 1997. Isolation of alpha-toxin, theta-toxin and 313
kappa-toxin mutants of Clostridium perfringens by Tn916 mutagenesis. Microb 314
Pathog 22:275-84. 315
4. Bae, T., E. M. Glass, O. Schneewind, and D. Missiakas. 2008. Generating a 316
collection of insertion mutations in the Staphylococcus aureus genome using 317
bursa aurealis. Methods Mol Biol 416:103-16. 318
5. Bannam, T. L., and J. I. Rood. 1993. Clostridium perfringens-Escherichia coli 319
shuttle vectors that carry single antibiotic resistance determinants. Plasmid 320
29:233-5. 321
6. Betschel, S. D., S. M. Borgia, N. L. Barg, D. E. Low, and J. C. De Azavedo. 322
1998. Reduced virulence of group A streptococcal Tn916 mutants that do not 323
produce streptolysin S. Infect Immun 66:1671-9. 324
7. Briolat, V., and G. Reysset. 2002. Identification of the Clostridium perfringens 325
genes involved in the adaptive response to oxidative stress. J Bacteriol 184:2333-326
43. 327
8. Bullifent, H. L., A. Moir, and R. W. Titball. 1995. The construction of a 328
reporter system and use for the investigation of Clostridium perfringens gene 329
expression. FEMS Microbiol Lett 131:99-105. 330
9. Chen, P., J. Novak, F. Qi, and P. W. Caufield. 1998. Diacylglycerol kinase is 331
involved in regulation of expression of the lantibiotic mutacin II of Streptococcus 332
mutans. J Bacteriol 180:167-70. 333
10. Flannagan, S. E., L. A. Zitzow, Y. A. Su, and D. B. Clewell. 1994. Nucleotide 334
sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. 335
Plasmid 32:350-4. 336
11. Franke, A. E., and D. B. Clewell. 1981. Evidence for a chromosome-borne 337
resistance transposon (Tn916) in Streptococcus faecalis that is capable of 338
"conjugal" transfer in the absence of a conjugative plasmid. J Bacteriol 145:494-339
502. 340
16
12. Garnier, T., B. Canard, and S. T. Cole. 1991. Cloning, mapping, and molecular 341
characterization of the rRNA operons of Clostridium perfringens. J Bacteriol 342
173:5431-8. 343
13. Gawron-Burke, C., and D. B. Clewell. 1984. Regeneration of insertionally 344
inactivated streptococcal DNA fragments after excision of transposon Tn916 in 345
Escherichia coli: strategy for targeting and cloning of genes from gram-positive 346
bacteria. J Bacteriol 159:214-21. 347
14. Gholamiandekhordi, A. R., R. Ducatelle, M. Heyndrickx, F. Haesebrouck, 348
and F. Van Immerseel. 2006. Molecular and phenotypical characterization of 349
Clostridium perfringens isolates from poultry flocks with different disease status. 350
Vet Microbiol 113:143-52. 351
15. Haapa, S., S. Taira, E. Heikkinen, and H. Savilahti. 1999. An efficient and 352
accurate integration of mini-Mu transposons in vitro: a general methodology for 353
functional genetic analysis and molecular biology applications. Nucleic Acids Res 354
27:2777-84. 355
16. Hao, J. A., Cao, Z.H., Xu, H.J., Bai, Y.L., Zhang, X.M. and Qiao, M.Q. . 356
2006. A new method for gene mutagenesis in Bacillus amyloliquefaciens. Lett 357
Biotechnol 17:311-312. 358
17. Herholz, C., R. Miserez, J. Nicolet, J. Frey, M. Popoff, M. Gibert, H. Gerber, 359
and R. Straub. 1999. Prevalence of beta2-toxigenic Clostridium perfringens in 360
horses with intestinal disorders. J Clin Microbiol 37:358-61. 361
18. Jiraskova, A., L. Vitek, J. Fevery, T. Ruml, and P. Branny. 2005. Rapid 362
protocol for electroporation of Clostridium perfringens. J Microbiol Methods 363
62:125-7. 364
19. Kaufmann, P., Lehmann, Y. & Meile, L. . 1996. Conjugative transposition of 365
Tn916 from Enterococcus faecalis and Escherichia coli into Clostridium 366
perfringens. Syst Appl Microbiol 19:35-39. 367
20. Kwon, Y. M., and S. C. Ricke. 2000. Efficient amplification of multiple 368
transposon-flanking sequences. J Microbiol Methods 41:195-9. 369
21. Lamberg, A., S. Nieminen, M. Qiao, and H. Savilahti. 2002. Efficient insertion 370
mutagenesis strategy for bacterial genomes involving electroporation of in vitro-371
17
assembled DNA transposition complexes of bacteriophage mu. Appl Environ 372
Microbiol 68:705-12. 373
22. Lyristis, M., A. E. Bryant, J. Sloan, M. M. Awad, I. T. Nisbet, D. L. Stevens, 374
and J. I. Rood. 1994. Identification and molecular analysis of a locus that 375
regulates extracellular toxin production in Clostridium perfringens. Mol 376
Microbiol 12:761-77. 377
23. Myers, G. S., D. A. Rasko, J. K. Cheung, J. Ravel, R. Seshadri, R. T. DeBoy, 378
Q. Ren, J. Varga, M. M. Awad, L. M. Brinkac, S. C. Daugherty, D. H. Haft, 379
R. J. Dodson, R. Madupu, W. C. Nelson, M. J. Rosovitz, S. A. Sullivan, H. 380
Khouri, G. I. Dimitrov, K. L. Watkins, S. Mulligan, J. Benton, D. Radune, D. 381
J. Fisher, H. S. Atkins, T. Hiscox, B. H. Jost, S. J. Billington, J. G. Songer, B. 382
A. McClane, R. W. Titball, J. I. Rood, S. B. Melville, and I. T. Paulsen. 2006. 383
Skewed genomic variability in strains of the toxigenic bacterial pathogen, 384
Clostridium perfringens. Genome Res 16:1031-40. 385
24. Nelson, K. E., D. L. Richardson, and B. A. Dougherty. 1997. Tn916 386
transposition in Haemophilus influenzae Rd: preferential insertion into noncoding 387
DNA. Microb Comp Genomics 2:313-21. 388
25. Paatero, A. O., H. Turakainen, L. J. Happonen, C. Olsson, T. Palomaki, M. I. 389
Pajunen, X. Meng, T. Otonkoski, T. Tuuri, C. Berry, N. Malani, M. J. 390
Frilander, F. D. Bushman, and H. Savilahti. 2008. Bacteriophage Mu 391
integration in yeast and mammalian genomes. Nucleic Acids Res 36:e148. 392
26. Pajunen, M. I., A. T. Pulliainen, J. Finne, and H. Savilahti. 2005. Generation 393
of transposon insertion mutant libraries for Gram-positive bacteria by 394
electroporation of phage Mu DNA transposition complexes. Microbiology 395
151:1209-18. 396
27. Phillips-Jones, M. K. 1990. Plasmid transformation of Clostridium perfringens 397
by electroporation methods. FEMS Microbiol Lett 54:221-6. 398
28. Rood, J. I., and S. T. Cole. 1991. Molecular genetics and pathogenesis of 399
Clostridium perfringens. Microbiol Rev 55:621-48. 400
29. Ruffin, D. C., V. L. van Santen, Y. Zhang, L. L. Voelker, V. S. Panangala, 401
and K. Dybvig. 2000. Transposon mutagenesis of Mycoplasma gallisepticum by 402
18
conjugation with Enterococcus faecalis and determination of insertion site by 403
direct genomic sequencing. Plasmid 44:191-5. 404
30. Sambrook J. and Russel, D. W. 2002. Molecular cloning: a laboratory manual, 405
vol. 3. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York. 406
31. Savilahti, H., and D. H. Bamford. 1993. Protein-primed DNA replication: role 407
of inverted terminal repeats in the Escherichia coli bacteriophage PRD1 life 408
cycle. J Virol 67:4696-703. 409
32. Savilahti, H., and K. Mizuuchi. 1996. Mu transpositional recombination: donor 410
DNA cleavage and strand transfer in trans by the Mu transposase. Cell 85:271-80. 411
33. Savilahti, H., P. A. Rice, and K. Mizuuchi. 1995. The phage Mu transpososome 412
core: DNA requirements for assembly and function. Embo J 14:4893-903. 413
34. Scott, J. R., F. Bringel, D. Marra, G. Van Alstine, and C. K. Rudy. 1994. 414
Conjugative transposition of Tn916: preferred targets and evidence for 415
conjugative transfer of a single strand and for a double-stranded circular 416
intermediate. Mol Microbiol 11:1099-108. 417
35. Scott, P. T., and J. I. Rood. 1989. Electroporation-mediated transformation of 418
lysostaphin-treated Clostridium perfringens. Gene 82:327-33. 419
36. Shimizu, T., K. Ohtani, H. Hirakawa, K. Ohshima, A. Yamashita, T. Shiba, 420
N. Ogasawara, M. Hattori, S. Kuhara, and H. Hayashi. 2002. Complete 421
genome sequence of Clostridium perfringens, an anaerobic flesh-eater. Proc Natl 422
Acad Sci U S A 99:996-1001. 423
37. Slater, J. D., A. G. Allen, J. P. May, S. Bolitho, H. Lindsay, and D. J. Maskell. 424
2003. Mutagenesis of Streptococcus equi and Streptococcus suis by transposon 425
Tn917. Vet Microbiol 93:197-206. 426
38. Sloan, J., T. A. Warner, P. T. Scott, T. L. Bannam, D. I. Berryman, and J. I. 427
Rood. 1992. Construction of a sequenced Clostridium perfringens-Escherichia 428
coli shuttle plasmid. Plasmid 27:207-19. 429
39. Smidt, H., D. Song, J. van Der Oost, and W. M. de Vos. 1999. Random 430
transposition by Tn916 in Desulfitobacterium dehalogenans allows for isolation 431
and characterization of halorespiration-deficient mutants. J Bacteriol 181:6882-8. 432
19
40. Songer, J. G. 1996. Clostridial enteric diseases of domestic animals. Clin 433
Microbiol Rev 9:216-34. 434
41. Sprusansky, O., L. Zhou, S. Jordan, J. White, and J. Westpheling. 2003. 435
Identification of three new genes involved in morphogenesis and antibiotic 436
production in Streptomyces coelicolor. J Bacteriol 185:6147-57. 437
42. Whetzel, P. L., L. L. Hnatow, C. L. Keeler, Jr., and J. E. Dohms. 2003. 438
Transposon mutagenesis of Mycoplasma gallisepticum. Plasmid 49:34-43. 439
43. Wilson, A. C., M. Perego, and J. A. Hoch. 2007. New transposon delivery 440
plasmids for insertional mutagenesis in Bacillus anthracis. J Microbiol Methods 441
71:332-5. 442
44. Wilson, K. 1990. Preparation of genomic DNA from bacteria. In F. M. Ausubel, 443
Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, 444
K. (ed.), Current Protocols in Molecular Biology. Greene Publ. Assoc. and 445
Wiley Interscience, New York. 446
45. Woodcock, D. M., P. J. Crowther, J. Doherty, S. Jefferson, E. DeCruz, M. 447
Noyer-Weidner, S. S. Smith, M. Z. Michael, and M. W. Graham. 1989. 448
Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine 449
methylation in plasmid and phage recombinants. Nucleic Acids Res 17:3469-78. 450
46. Wu, Z., Z. Xuanyuan, R. Li, D. Jiang, C. Li, H. Xu, Y. Bai, X. Zhang, H. 451
Turakainen, P. E. Saris, H. Savilahti, and M. Qiao. 2009. Mu transposition 452
complex mutagenesis in Lactococcus lactis- identification of genes affecting nisin 453
production. J Appl Microbiol. 106: 41-48 454
455
Substrate Strain JIR325 Isolate 56
pTCATT 32700 23600
Em-Mu 239 134
TABLE 1. Number of erythromycin resistant colonies obtained (cfu/µg DNA)
following electroporation of plasmid pTCATT and Em-Mu transpososomes.
FIGURE 1. Southern blot detection of the genomic fragments harboring the Em-Mu
transposon insertion. Genomic DNAs from mutants M1 to M7 (lanes 1-7) and the
wild-type parental strain 56 (lane 8) were digested with PsiI and hybridized with a
digoxigenin-labeled probe against the Em-Mu transposon. Lane 9 contains purified
Em-Mu transposon (1.4 kb) as a positive control. Lane M contains a DIG-labeled
DNA molecular weight marker (Roche Diagnostics), the fragment sizes are, from top
to bottom, 23.1, 9.4, 6.5 and 4.3 kb.
1
TABLE 2. Integration sites of transposons in the mutants derived from the field isolate 56. 1
Target site duplications are shown in bold capitals. All genomic locations were determined by comparison with the 2
complete sequence of strain ATCC13124 GenBank accession number NC_008261 (18). All genes described were 3
transcribed in the sense direction. Transcription of the transposon as compared to the local transcription within the 4
genomic location. 5
6
Mutant Integration site Genomic location Description Transposon
orientation
M1
AAAGCTATTGTACTT-Em-Mu-TACCTAAAGATTTAT
2540298-2540302
Heat inducible transcriptional
repressor HrcA
+
M2
ACATTAAAATGTAAA-Em-Mu -GTAAAGACTGTGGAG 1431407-143411 Conserved hypothetical protein -
M3
TGTTCAGCTGACCGA-Em-Mu-ACCGATACTAATAGA 77125-77129 23S rRNA +
M4
CTTCAGTTTAACTGA-Em-Mu-ACTGAAAGTTCTTTG 3215472-3215476 Intergenic -
M5
TTCTGCCTCTTCTGA-Em-Mu -TCTGATAGTATTAC 2963631-2963635
Methionine aminopeptidase,
type I -
M6
TTACCTTTGTAGTTA-Em-Mu-AGTTACAACATCTCT 332463-332467
Transcriptional regulator,
AbrB family -
M7
TGTAAAGGTGTTTCAG-Em-Mu-TTCAGAAGAAAAAAT 530994-530998
BFD-like iron-sulfur cluster
binding protein +
