Comparison of Amplified Ribosomal DNA Restriction Analysis,Random Amplified Polymorphic DNA Analysis, and Amplified
Fragment Length Polymorphism Fingerprinting forIdentification of Acinetobacter Genomic Species
and Typing of Acinetobacter baumanniiJOHANNES G. M. KOELEMAN, JEROEN STOOF, DENNIS J. BIESMANS, PAUL H. M. SAVELKOUL,*
AND CHRISTINA M. J. E. VANDENBROUCKE-GRAULS
Department of Clinical Microbiology and Infection Control, University HospitalVrije Universiteit, 1007 MB Amsterdam, The Netherlands
Received 29 January 1998/Returned for modification 12 March 1998/Accepted 21 May 1998
Thirty-one strains of Acinetobacter species, including type strains of the 18 genomic species and 13 clinicalisolates, were compared by amplified ribosomal DNA restriction analysis (ARDRA), random amplified poly-morphic DNA analysis (RAPD), and amplified fragment length polymorphism (AFLP) fingerprinting. ARDRA,performed with five different enzymes, showed low discriminatory power for differentiating Acinetobacter at thespecies and strain level. The standardized commercially available RAPD kit clearly enabled the discriminationof all Acinetobacter genomic species but showed great polymorphism between isolates of Acinetobacter bauman-nii. AFLP fingerprinting with radioactively as well as fluorescently labelled primers showed high discrimina-tory power for the identification of 18 Acinetobacter genomic species and typing of 13 clinical Acinetobacterisolates. Compared to radioactive AFLP, fluorescent AFLP was technically fast and simple to perform, and itpermitted analysis with an automated DNA sequencer. Fluorescent AFLP seems particularly well suited forstudying the epidemiology of nosocomial infections and outbreaks caused by Acinetobacter species.
Over the past 10 years, numerous outbreaks of nosocomialinfections with Acinetobacter spp. have been reported, identi-fying Acinetobacter baumannii as the most predominant speciesinvolved. In hospitalized patients, Acinetobacter spp. frequentlycolonize the skin and upper respiratory tract and may causevarious types of opportunistic infections (3). Risk factors foracquisition of these organisms include prolonged hospital stay,serious underlying disease, intravascular and intravesical cath-eterization, and treatment with broad-spectrum antibiotics (21,24, 27, 33). Characteristics of Acinetobacter spp. may contributeto their epidemic behavior, such as the ability to acquire mul-tiple antibiotic resistance (2) and the ability to survive on in-animate and dry surfaces for prolonged periods of time (13, 20,37). In order to understand the epidemiology of Acinetobacterspp. in hospitalized patients and in the hospital environment,accurate identification of members of the genus at the specieslevel is important. Delineation of species within the genusAcinetobacter is still the subject of extensive research. DNA-DNA hybridization studies have resulted in the identificationof at least 18 DNA groups (genomic species) (5, 6, 12, 30). Forstrain typing, a number of genomic fingerprinting methodshave been proposed. These include pulsed-field gel electro-phoresis (14, 25), ribotyping (9, 12, 25), and PCR-based finger-printing techniques such as random amplified polymorphicDNA analysis (RAPD) (15), repetitive extragenic palindromicsequence-based PCR (26), amplified ribosomal DNA restric-tion analysis (ARDRA) (35), and RNA spacer fingerprinting(11). A novel high-resolution genomic fingerprinting method,
the amplified fragment length polymorphism (AFLP), has beenshown to be applicable to a wide range of bacterial species in-cluding those of the genus Acinetobacter (10, 18, 19, 36).
In the present study, two generally used DNA typing tech-niques were compared to the AFLP technique, and their ap-plicability was studied for the identification of Acinetobacter atthe genomic species level and of A. baumannii at the strainlevel.
MATERIALS AND METHODS
Bacterial strains. Eighteen different genomic species of Acinetobacter, as de-lineated by DNA-DNA hybridization, were studied (Table 1) (5, 6, 22, 30).Thirteen clinical Acinetobacter isolates were collected from samples of 13 differ-ent patients. All these isolates were collected within a period of 14 years in fivedifferent hospitals in The Netherlands. Five of them (A-1 to A-5) belonged to awell-characterized outbreak on a surgical ward (21). The other eight strains areepidemiologically unrelated; four of them (R-1, D-1, U-1, and E-1) are singleisolates from larger outbreaks (7, 8). All outbreak isolates have been character-ized previously by antibiograms, cell envelope protein electrophoretic typing, andribotyping (10, 21). Presumptive identification of the 13 isolates was obtained bythe analytical profile index procedure (API 20NE system; bioMerieux, Marcyl’Etoile, France). All strains were grown aerobically in Luria-Bertani medium(Difco Laboratories, Detroit, Mich.) and incubated in a rotary shaker at 37°C for18 h. Bacterial strains were stored at 280°C in nutrient broth supplemented with20% (wt/vol) glycerol.
DNA isolation. DNA was isolated as described previously (4). Extracted DNAwas resolved in 100 ml of TE buffer (10 mM Tris, 1 mM EDTA [pH 8.0])supplemented with 10 mg of RNase (Sigma, St. Louis, Mo.). Purified DNA wasaliquoted and stored at 220°C. DNA concentrations were estimated by agarosegel electrophoresis against diluted samples of l DNA (New England Biolabs,Inc., Beverly, Mass.).
ARDRA. The ARDRA was performed as described previously (34). Briefly,amplification reactions were performed in a final volume of 50 ml containing 1.25U of Taq polymerase, 100 mM (each) deoxynucleoside triphosphates (dNTPs),and 0.2 mM (each) primer in reaction buffer (1.5 mM MgCl2, 50 mM KCl in 10mM Tris-HCl [pH 8.3]). Amplification was performed in a GeneAmp PCRSystem 9600 thermal cycler (Perkin-Elmer). After initial denaturation at 95°C for5 min, the reaction mixture was run through 35 cycles of denaturation at 95°C for45 s, annealing at 50°C for 45 s, and extension at 72°C for 1 min followed by a
* Corresponding author. Mailing address: Department of ClinicalMicrobiology and Infection Control, University Hospital Vrije Univer-siteit, P.O. Box 7057, 1007 MB Amsterdam, The Netherlands. Phone:31 204440552. Fax: 31 204440473. E-mail: [email protected].
2522
7-min extension period at 72°C. The primers used were 59TGGCTCAGATTGAACGCTGGCGGC (59 end of 16S rRNA) and 59TACCTTGTTACGACTTCACCCCA (39 end of 16S rRNA) (23). Amplified products of approximately1,500 bp each were visualized by agarose gel electrophoresis after staining withethidium bromide (50 mg/ml). Amplified DNA (3 to 10 ml) was digested for 1 hat 37°C in 20-ml volumes of commercially supplied incubation buffer containing5 U of restriction enzyme AluI (AGCT), CfoI (GCGC), MboI (GATC), MspI(CCGG), or RsaI (GTAC). Restriction was stopped by addition of 5 ml of 53sample buffer (25% [wt/vol] glycerol, 0.5% [wt/vol] sodium dodecyl sulfate, 50mM EDTA, 0.05% bromophenol blue). Restriction fragment patterns wereseparated by agarose gel electrophoresis at 150 V in 23 Tris-borate-EDTA(TBE) buffer and visualized after being stained with ethidium bromide (50ng/ml). Gels were photographed under UV illumination.
RAPD. The RAPD assay was performed as described previously (38) with thecommercially available Ready-To-Go RAPD analysis kit (Pharmacia Biotech,Uppsala, Sweden). This product contains a RAPD Analysis Primer Set and Ready-To-Go RAPD Analysis Beads with thermostable polymerases (AmpliTAQ andStoffel fragment), lyophilized buffer (10 mM Tris, 30 mM KCl, 3 mM MgCl2 [pH8.3] in a 25-ml reaction volume), dNTPs (0.4 mM [each] in a 25-ml reaction vol-ume), and bovine serum albumin (2.5 mg). Briefly, DNA was amplified by addi-tion of 25 pmol of primer, H2O to a final volume of 25 ml, and one RAPDanalysis bead to 10 ng of template DNA. The mixtures were subjected to 45 cy-cles of amplification (95°C for 60 s, 36°C for 60 s, and 72°C for 120 s for eachcycle) with an initial incubation step at 95°C for 5 min, in a GeneAmp PCR Sys-tem 9600 thermocycler (Perkin-Elmer). The six primers (RAPD Analysis PrimerSet) used were AP1 (59GGTGCGGGAA39), AP2 (59GTTTCGCTCC39), AP3(59GTAGACCCGT39), AP4 (59AAGAGCCCGT39), AP5 (59AACGCGCAAC39), and AP6 (59CCCGTCAGCA39) (1). Amplified fragments were separated byagarose gel electrophoresis at 150 V in 0.53 TBE buffer and were visualized afterstaining with ethidium bromide (10 mg/ml). Gels were photographed under UVillumination. The negative control contained all components except templateDNA. Escherichia coli C1a DNA (Pharmacia Biotech) was used as a positive control.
AFLP. All procedures relating to the preparation of AFLP templates wereperformed essentially as described by Janssen et al. (18) and Vos et al. (36).
Briefly, purified chromosomal DNA (50 ng) was digested with 1 U of EcoRI(Pharmacia LKB Biotechnology, Uppsala, Sweden) and 1 U of MseI (NewEngland Biolabs, Inc.). The EcoRI adapter was prepared by mixing equimolaramounts of the oligonucleotide sequences 59CTCGTAGACTGCGTACC39 and59AATTGGTACGCAGTC39, which were heated until 65°C and slowly cooled toroom temperature. Preparation of the MseI adapter was performed in the samemanner by using the sequences 59GACGATGAGTCCTGAG39 and 59TACTCAGGACTCATC39. Ligation of adapters to the restriction fragments was per-formed overnight at 20°C in a final volume of 30 ml. The ligation mixture con-sisted of 50 ng of chromosomal DNA, 50 pmol (each) EcoRI and MseI adapter,1.2 U of T4 DNA ligase (Pharmacia LKB Biotechnology), 1 mM ATP, and ligasebuffer (10 mM Tris-acetate [pH 7.5], 10 mM magnesium acetate, 50 mM potas-sium acetate, 5 mM dithiothreitol, 50 ng of bovine serum albumin per ml). Afterligation, the DNA was diluted with distilled water to a final volume of 500 ml andstored at 220°C until use.
AFLP reactions with radioactively labelled primers. AFLP reactions withradioactively labelled primers were performed as described previously (21).
AFLP reactions with fluorescently labelled primers. A Texas Red fluores-cently labelled EcoA primer (Isogen Bioscience BV, Maarssen, The Nether-lands) was used for DNA amplification in 10 ml of a reaction mixture containing0.5 ng of template DNA, 20 ng of labelled Eco primer, 1 ml of 2 mM dNTPs, 60ng of unlabelled MseC primer, 1 U of Taq polymerase (Perkin-Elmer) in 10 mMTris-HCl (pH 8.3), 50 mM KCl, and 1.5 mM MgCl2. Amplification was per-formed in a GeneAmp PCR System 9600 thermal cycler (Perkin-Elmer) for 35cycles of denaturation (30 s at 94°C), annealing (30 s at 65 to 56°C), and DNAmolecule extension (60 s at 72°C). In the first 12 cycles, the annealing temper-ature was lowered by 0.7°C per cycle. After completion of the cycle program, 3ml of loading buffer (Amersham Life Science, Cleveland, Ohio) was added to thereaction mixtures. Prior to gel loading, the amplicons were denatured by heatingfor 1 min at 95°C and rapid cooling on ice. Fluorescent amplified fragments wereseparated on a denaturing polyacrylamide gel (RapidGel-XL-6%; AmershamLife Science) in 13 TBE buffer (100 mM Tris, 100 mM boric acid, 2 mM EDTA[pH 8.0], 6 M urea) according to the manufacturer’s instructions in a Vistra 725
TABLE 1. Reference strains and clinical isolates used in the present study
Strain Genomic speciesa Species name Strain codec Outbreakd Specimen Reference
1 1 A. calcoaceticus ATCC 23055 No 62 2 A. baumannii ATCC 19606 No 63 3 UNb ATCC 19004 No 64 4 A. haemolyticus ATCC 17906 No 65 5 A. junii ATCC 17908 No 66 6 UN ATCC 17979 No 67 7 A. johnsonii ATCC 17909 No 68 8 A. lwoffii NCTC 5866 No 69 10 UN ATCC 17924 No 610 11 UN ATCC 11171 No 611 12 A. radioresistens IAM 13186 No 612 13 UN ATCC 17903 No 2913 14 UN ATCC 17905 No 2914 15 UN MGH 98795 No 2915 BJ14 UN CCUG 14816 No 916 BJ15 UN Adam Ac 606 No 917 BJ16 UN ATCC 17988 No 918 BJ17 UN SEIP Ac 87.314 No 919 2 A. baumannii HK 20 A-1 Skin 2120 2 A. baumannii HK 70 A-2 Sputum 2121 2 A. baumannii HK 71 A-3 Wound 2122 2 A. baumannii HK 72 A-4 Wound 2123 2 A. baumannii HK 73 A-5 Urine 2124 3 UN HK 74 No Blood25 2 A. baumannii HK 75 No Rectum26 2 A. baumannii HK 76 No Sputum27 2 A. baumannii HK 77 No Rectum28 2 A. baumannii HK 21 R-1 Urine 1129 2 A. baumannii HK 22 D-1 Urine 1130 2 A. baumannii HK 23 U-1 Sputum 1131 2 A. baumannii HK 24 E-1 Bronchus 11
a Numbered according to the work of Bouvet and Grimont (5) for groups 1 to 12, according to the work of Tjernberg and Ursing (29) for groups 13 to 15, andaccording to the work of Bouvet and Jeanjean (6) for groups BJ14 to BJ17. Group 14 is identical to BJ13.
b UN, unnamed genomic species.c CCUG, Culture Collection, University of Goteborg, Goteborg, Sweden; IAM, Institute of Applied Microbiology, The University of Tokyo, Tokyo, Japan; MGH,
Collection of Malmo General Hospital, Malmo, Sweden; SEIP, Service des Enterobacteries de l’Institut Pasteur, Paris, France.d No, epidemiologically unrelated isolate; 1 to 5, outbreak number in Dutch cities: Amsterdam (A), Rotterdam (R), Dordrecht (D), Utrecht (U), or Enschede (E).
VOL. 36, 1998 ARDRA, RAPD, AND AFLP TYPING OF ACINETOBACTER 2523
automated DNA sequencer (Amersham Life Science). A 2-ml sample of eachreaction mixture was loaded on the gel. Gels were run at 1,500 V for 6 h.
Densitometric scanning and data processing. ARDRA and RAPD photo-graphs as well as AFLP autoradiograms were scanned with a densitoscanner(Scanjet 4C; Hewlett-Packard, Bracknell, United Kingdom), and images werestored as tagged image file format files with Deskscan II version 2.3 (Hewlett-Packard). Fluorescently labelled AFLP fingerprints were analyzed on the Vistra725 DNA sequencer and stored as tagged image file format files with the Vistra2 Tiff software (Amersham). Both types of images were processed with GelCom-par 3.1 software (Applied Maths, Kortrijk, Belgium). Following conversion,normalization, and background subtraction with mathematical algorithms, levelsof similarity between fingerprints were calculated with the Pearson productmoment correlation coefficient (r). Cluster analysis was performed with theunweighted pair group method using average linkages (UPGMA).
RESULTS
ARDRA genomic typing. The 16S rRNA gene of each of the31 Acinetobacter strains was amplified and restricted with the
enzymes AluI, CfoI, MboI, MspI, and RsaI. This resulted in fiveseparate restriction patterns for each strain. The five patternswere digitized and subsequently combined in one overall pat-tern in one single analysis. Each enzyme generated up to 10fragments per strain. The cumulative DNA patterns yielded amaximum of approximately 50 bands per strain which weresubjected to cluster analysis. ARDRA could not distinguishthe 18 different Acinetobacter genomic species because all thestrains were clustered within a broad range of linkage levelsbetween 37 and 88%. Two strains were linked below the 40%level, whereas several other strains showed almost identicalrestriction patterns resulting in clustering at high correlationlevels (Fig. 1).
ARDRA strain typing. Analysis of the 13 clinical isolatesshowed that all the strains except one clustered with the A. bau-mannii type strain (ATCC 19606) at a linkage level of 78%.
FIG. 1. Digitized ARDRA patterns and dendrogram of 18 Acinetobacter genomic species (1 to 18) and 13 clinical Acinetobacter isolates (19* to 31*) obtained afterrestriction of the amplified 16S rRNA gene with five different enzymes (AluI, CfoI, MboI, MspI, and RsaI). For each strain, all restriction patterns have been combinedinto one single lane. The dendrogram was constructed with Gelcompar cluster analysis by UPGMA. Percentages of similarity and molecular weights are shown abovethe dendrogram. The strain code as presented in Table 1 is shown on the right.
2524 KOELEMAN ET AL. J. CLIN. MICROBIOL.
Strain 24 (HK 74) was linked to DNA group 3 (ATCC 19004)at a level of 87%. The five Amsterdam outbreak isolates (A-1to A-5) and three epidemiologically unrelated strains, 25, 26,and 28, showed a similarity of 82%.
Analysis of combined clustering results of genomic strainsand clinical isolates showed a clear overlap in linkage levels,indicating low discriminatory power for the method. Omissionof any one of the restriction enzyme patterns from the overallARDRA pattern further decreased the discriminatory power(data not shown).
RAPD genomic typing. The 31 Acinetobacter strains were sub-jected to six PCRs with different primers individually presentin the RAPD kit. With each primer, different PCR fingerprintsof up to seven amplified fragments were generated. For eachstrain, all the bands obtained in the six RAPD assays were dig-itized and combined for cluster analysis (Fig. 2). Overall, RAPDwas able to discriminate the 18 different Acinetobacter genomicisolates with similarity levels of 48% or lower.
RAPD strain typing. Analysis of RAPD profiles of the 13clinical isolates showed that all of them were allocated to thetype strain of A. baumannii (ATCC 19606) at a correlation lev-
el of only 26%. This level increased in analysis of a separate gelwith RAPD patterns of clinical isolates and the type strain ofA. baumannii (data not shown). Five strains from the outbreakin Amsterdam and two unrelated isolates, 26 and 28, werelinked at an average similarity of 75%. This group of sevenstrains was clearly separated from the other clinical Acineto-bacter isolates.
The RAPD strain typing of the 13 clinical isolates has beenperformed by using all six primers which were enclosed in theRAPD kit. We investigated the minimal number of primersneeded to obtain the same results as with the full set of sixprimers. These results showed that at least five different prim-ers are needed for optimal RAPD fingerprinting.
AFLP genomic typing. AFLP fingerprinting with radioac-tively labelled primers was compared to AFLP with fluores-cently labelled primers. Cluster analysis of both methods gavecomparable results (Fig. 3 and 4). The 18 genomic species wereclearly distinguishable at correlation levels of 41 and 50% forthe radioactive and fluorescent AFLP patterns, respectively.
AFLP strain typing. Among the 13 clinical isolates, bothAFLP methods clustered 12 strains with A. baumannii at cor-
FIG. 2. Digitized RAPD patterns and dendrogram of 18 Acinetobacter genomic species (1 to 18) and 13 clinical Acinetobacter isolates (19* to 31*) obtained afterseparate PCRs with six different primers. For each strain, all six RAPD patterns have been combined into one single lane (1 to 6). The dendrogram was constructedwith Gelcompar cluster analysis by UPGMA. Percentages of similarity and molecular weights are shown above the dendrogram. The strain code as presented in Table1 is shown on the right.
VOL. 36, 1998 ARDRA, RAPD, AND AFLP TYPING OF ACINETOBACTER 2525
relation levels of 55 and 57%; strain 24 (HK 74) was clusteredwith Acinetobacter DNA group 3 (ATCC 19004). All five out-break-related A. baumannii strains from Amsterdam and twoepidemiologically unrelated strains (26 and 28) were clusteredwithin one group at a cutoff value of 85% for the radioactiveAFLP versus 87% for the fluorescent AFLP.
DISCUSSION
Discrimination of Acinetobacter at the species and strainlevel has been performed by a variety of phenotypic and ge-nomic techniques. During the last decade, a number of PCRfingerprinting methods such as RAPD (15, 27), repetitive ex-tragenic palindromic sequence-based PCR (26), ARDRA (37),RNA spacer fingerprinting (12), and 16S ribosomal DNA se-quence analysis (17) have been found to be useful for typingclinical strains of Acinetobacter species. Recently, AFLP fin-gerprinting was shown to be a sensitive method for the iden-tification of Acinetobacter genomic species (19). In the presentstudy, we evaluated the discriminatory power of ARDRA,RAPD, and AFLP fingerprinting for the identification of Acin-etobacter isolates by using a set of well-characterized strains. Inaddition, 13 clinical isolates, including five strains from oneoutbreak (A-1 to A-5), were used to compare the usefulness ofthe three genomic techniques for strain typing of Acinetobacterspecies.
ARDRA fingerprinting could not distinguish the 18 genomicspecies at low cutoff levels (,50%), in contrast to RAPD and
AFLP. Only two strains (16 and 17) could be discriminatedwith linkage levels below 40%. Eight of the genomic specieswhich were clustered in three different groups (4, 6, and 7; 5,13, and 18; 9 and 10) could not be identified because linkagelevels were above 80%. In the study of Vaneechoutte et al.(35), ARDRA was not able to identify six of these eight geno-mic species, namely, strains 4 and 7, 5 and 18, and 9 and 10,which is slightly better than our findings. This difference ismost likely due to the computerized analysis of the ARDRApatterns instead of visual comparison of the patterns as per-formed by Vaneechoutte et al. Identification of the 13 clinicalisolates was similar for ARDRA and AFLP, which identified12 strains as A. baumannii and 1 as DNA group 3. Biotyping ofall these strains, however, identified all 13 strains as A. bau-mannii. This difference was not surprising, since identificationby use of biochemical tests does not differentiate the closelyrelated DNA groups 1, 2, 3, and 13 (the Acinetobacter calcoace-ticus-A. baumannii complex) (12).
The RAPD technique is being used increasingly in manylaboratories for epidemiologic typing of a wide range of micro-organisms including Acinetobacter (15, 27). Although the RAPDtechnique offers the advantages of simplicity and rapidity, alack of reproducibility has been reported due to its high sus-ceptibility to variation by primer and DNA concentration,DNA template quality, gel electrophoresis, and the type ofDNA polymerase (31, 33). To overcome some of these prob-lems, we used standardized concentrations of purified genomicDNA and a standardized RAPD kit. Besides the good discrim-
FIG. 3. Digitized radioactively labelled AFLP patterns and dendrogram of 18 Acinetobacter genomic species (1 to 18) and 13 clinical Acinetobacter isolates (19* to31*) obtained after PCR on EcoA and MseC templates. The dendrogram was constructed with Gelcompar cluster analysis by UPGMA. Percentages of similarity andmolecular weights are shown above the dendrogram. The strain code as presented in Table 1 is shown on the right.
2526 KOELEMAN ET AL. J. CLIN. MICROBIOL.
ination of the 18 Acinetobacter genomic species with linkagelevels below 50%, RAPD identification clustered the 13 clini-cal isolates with A. baumannii at a low cutoff level (,50%).However, a higher linkage level was obtained when separategel analysis of RAPD patterns of only the clinical isolates incombination with the type strain of A. baumannii was per-formed. All strains were typeable by RAPD, and analysis of allpossible RAPD pattern combinations showed that at least fiveprimers were necessary to amplify enough fragments to obtainthe same clustering of isolates. This indicates that one cannotspeed up or perform cheaper RAPD fingerprinting by using asmaller number of primers. It is possible that the number ofprimers for RAPD typing can be reduced by using other prim-ers (e.g., ERIC 1 and ERIC 2); however, it is obvious thatseveral primers will be necessary to obtain high discriminatorypower for RAPD analysis.
AFLP, a novel PCR-mediated DNA fingerprinting method,was first described in 1993 (39). It can be used for character-izations and comparisons of any DNA, irrespective of its originor complexity (18, 36, 39). AFLP genotyping has been used fora number of different bacterial species including Acinetobacter(16, 18, 19). The AFLP has several advantages compared tovarious other typing methods, including discriminatory power,flexibility, reproducibility, and production of clear banding pat-terns suitable for computerized analysis. In this study, the levelof AFLP reproducibility was determined by performing dupli-cate radioactive AFLP fingerprinting of all Acinetobacter ge-nomic strains, which yielded homologous patterns (data notshown). Both AFLP and RAPD fingerprinting could clearlydistinguish all the 18 Acinetobacter genomic species with link-age levels below 50%, in contrast to ARDRA. In a previous
study, radioactive AFLP also was found to be a good methodfor the identification of Acinetobacter at the genomic level (19).Use of radioactive compounds, however, is laborious and ex-pensive and needs special laboratory equipment and protec-tion. Therefore, we investigated AFLP fingerprinting with theuse of fluorescently labelled primers in an automated sequenceapparatus. Despite differences in PCR volume, PCR program,thermocycler, and detection techniques, cluster analysis of ra-dioactively and fluorescently labelled AFLP patterns showedcomparable clustering of the different Acinetobacter strainswith minimal differences in correlation levels. These resultsshow that fluorescently labelled AFLP fingerprinting, in com-bination with direct analysis of patterns by use of an automatedDNA sequencer, is an excellent alternative to radioactiveAFLP.
Comparison of typing results with epidemiologic data for theclinical isolates gave concordant results for all three DNA fin-gerprinting methods. Outbreak strains were clearly discrimi-nated although clustered with two or three unrelated strains,which suggests a clonal origin. This indicates that all threemethods are useful to delineate outbreaks of nosocomialA. baumannii.
In this study, evaluation of different genomic fingerprintingmethods was performed by computerized comparison ofdigitized fingerprinting patterns instead of visual compari-son. Data analysis by computer offers the possibility of com-parison of large numbers of patterns, formation of data-bases, and cluster analysis. ARDRA and RAPD photographsas well as AFLP autoradiograms had to be scanned, whereasfluorescently labelled AFLP fingerprints could be directly an-alyzed. Recently, Tenover et al. have published excellent guide-
FIG. 4. Fluorescently labelled AFLP patterns and dendrogram of 18 Acinetobacter genomic species (1 to 18) and 13 clinical Acinetobacter isolates (19* to 31*)obtained after PCR on EcoA and MseC templates. The dendrogram was constructed with Gelcompar cluster analysis by UPGMA. Percentages of similarity andmolecular weights are shown above the dendrogram. The strain code as presented in Table 1 is shown on the right.
VOL. 36, 1998 ARDRA, RAPD, AND AFLP TYPING OF ACINETOBACTER 2527
lines concerning visual comparison and interpretation of chro-mosomal DNA restriction patterns produced by pulsed-fieldgel electrophoresis for bacterial strain typing (28). Supplemen-tary guidelines for interpretation of cluster analysis data toidentify and differentiate bacterial strains may be necessary inthe near future, as computer-based image acquisition and anal-ysis become more and more widely available in clinical labo-ratories.
In summary, the results of this study demonstrate thatARDRA has low discriminatory power for differentiatingAcinetobacter at the species and strain level. The commerciallyavailable RAPD kit enabled the discrimination of Acinetobac-ter genomic species but showed great polymorphism betweenisolates of A. baumannii. This technique, however, seems to beuseful for a rapid identification of outbreak-related strains in aroutine clinical microbiology laboratory. The radioactive andfluorescent AFLP fingerprinting methods showed high dis-criminatory power for the identification of 18 Acinetobactergenomic species and typing of 13 clinical Acinetobacter isolates.Compared to radioactive AFLP, fluorescent AFLP is techni-cally faster and simpler, and analysis is more accurate sincescanning of the fingerprints for computerized analysis is notnecessary. Therefore, fluorescent AFLP seems particularlywell suited to the study of the epidemiology of nosocomialinfections and outbreaks caused by Acinetobacter species.
ACKNOWLEDGMENTS
We thank Myrthe Otsen, Department of Infection and Immunity,University of Utrecht, Utrecht, The Netherlands, for technical advice,and Lenie Dijkshoorn, Department of Medical Microbiology, Univer-sity Hospital Leiden, Leiden, The Netherlands, for the donation ofsome of the strains used in this study.
REFERENCES
1. Akopyanz, N., N. O. Bukanov, T. U. Westblom, S. Kresovich, and D. E. Berg.1992. DNA diversity among clinical isolates of Helicobacter pylori detected byPCR-based RAPD fingerprinting. Nucleic Acids Res. 20:5137–5142.
2. Amyes, S. G. B., and H. K. Young. 1996. Mechanisms of antibiotic resistancein Acinetobacter spp.—genetics of resistance, p. 185–223. In E. Bergogne-Berezin and M. L. Joly-Guillou (ed.), Acinetobacter: microbiology, epidemi-ology, infections, management. CRC Press, Inc., Boca Raton, Fla.
3. Bergogne-Berezin, E., and K. J. Towner. 1996. Acinetobacter spp. as noso-comial pathogens: microbiological, clinical, and epidemiological features.Clin. Microbiol. Rev. 9:148–165.
4. Boom, R., C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. E. Wertheim-Van Dillen, and J. Van Der Noorda. 1990. Rapid and simple method forpurification of nucleic acids. J. Clin. Microbiol. 28:495–503.
5. Bouvet, P. J. M., and P. A. D. Grimont. 1986. Taxonomy of the genusAcinetobacter with the recognition of Acinetobacter baumannii sp. nov., Acin-etobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acineto-bacter junii sp. nov., and emended descriptions of Acinetobacter calcoaceticusand Acinetobacter lwoffii. Int. J. Syst. Bacteriol. 36:228–240.
6. Bouvet, P. J. M., and S. Jeanjean. 1989. Delineation of new proteolyticgenomic species in the genus Acinetobacter. Res. Microbiol. 140:291–299.
7. Dijkshoorn, L., J. L. Wubbels, A. J. Beunders, J. E. Degener, A. L. Boks, andM. F. Michel. 1989. Use of protein profiles to identify Acinetobacter cal-coaceticus in a respiratory care unit. J. Clin. Pathol. 42:853–857.
8. Dijkshoorn, L., A. van Ooyen, W. C. J. Hop, M. Theuns, and M. F. Michel.1990. Comparison of clinical acinetobacter strains using a carbon sourcegrowth assay. Epidemiol. Infect. 104:443–453.
9. Dijkshoorn, L., H. M. Aucken, P. Gerner-Smidt, M. E. Kaufmann, J. Ursing,and T. L. Pitt. 1993. Correlation of typing methods for Acinetobacter isolatesfrom hospital outbreaks. J. Clin. Microbiol. 31:702–705.
10. Dijkshoorn, L., H. M. Aucken, P. Gerner-Smidt, P. Janssen, M. E. Kauf-mann, J. Garaizar, J. Ursing, and T. L. Pitt. 1996. Comparison of outbreakand nonoutbreak Acinetobacter baumannii strains by genotypic and pheno-typic methods. J. Clin. Microbiol. 34:1519–1525.
11. Ehrenstein B., A. T. Bernards, L. Dijkshoorn, P. Gerner-Smidt, K. J.Towner, P. J. M. Bouvet, F. D. Daschner, and H. Grundmann. 1996. Acin-etobacter species identification by using tRNA spacer fingerprinting. J. Clin.Microbiol. 34:2414–2420.
12. Gerner-Smidt, P., I. Tjernberg, and J. Ursing. 1991. Reliability of pheno-typic tests for identification of Acinetobacter species. J. Clin. Microbiol. 29:277–282.
13. Getchell-White, S. J., L. G. Donowitz, and D. H. M. Groschel. 1989. Theinanimate environment of an intensive care unit as a potential source ofnosocomial bacteria: evidence for long survival of Acinetobacter calcoaceti-cus. Infect. Control Hosp. Epidemiol. 10:402–407.
14. Gouby, A., M. Carles-Nurit, N. Bouziges, G. Bourg, R. Mesnard, and P. J. M.Bouvet. 1992. Use of pulsed-field gel electrophoresis for investigation ofhospital outbreaks of Acinetobacter baumannii. J. Clin. Microbiol. 30:1588–1591.
15. Graser, Y., I. Klare, E. Halle, R. Gantenberg, P. Buchholz, H. D. Jacobi, W.Presber, and G. Schonian. 1993. Epidemiological study of an Acinetobacterbaumannii outbreak by using polymerase chain reaction fingerprinting.J. Clin. Microbiol. 31:2417–2420.
16. Huys, G., R. Coopman, P. Janssen, and K. Kersters. 1996. High-resolutiongenotypic analysis of the genus Aeromonas by AFLP fingerprinting. Int. J.Syst. Bacteriol. 46:572–580.
17. Ibrahim, A., P. Gerner-Smidt, and W. Liesack. 1997. Phylogenetic relation-ship of the twenty-one DNA groups of the genus Acinetobacter as revealed by16S ribosomal DNA sequence analysis. Int. J. Syst. Bacteriol. 47:837–841.
18. Janssen, P., R. Coopman, G. Huys, J. Swings, M. Bleeker, P. Vos, M. Za-beau, and K. Kersters. 1996. Evaluation of the DNA fingerprinting meth-od AFLP as a new tool in bacterial taxonomy. Microbiology 142:1881–1893.
19. Janssen, P., K. Maquelin, R. Coopman, I. Tjernberg, P. Bouvet, K. Kerstens,and L. Dijkshoorn. 1997. Discrimination of Acinetobacter genomic species byAFLP fingerprinting. Int. J. Syst. Bacteriol. 47:1179–1187.
20. Jawad, A., J. Heritage, A. M. Snelling, D. M. Gascoyne-Binzi, and P. M.Hawkey. 1996. Influence of relative humidity and suspending menstrua onsurvival of Acinetobacter spp. on dry surfaces. J. Clin. Microbiol. 34:2881–2887.
21. Koeleman, J. G. M., G. A. Parlevliet, L. Dijkshoorn, P. H. M. Savelkoul, andC. M. J. E. Vandenbroucke-Grauls. 1997. Nosocomial outbreak of multire-sistant Acinetobacter baumannii on a surgical ward: epidemiology and riskfactors for acquisition. J. Hosp. Infect. 37:113–123.
22. Nishimura, Y., T. Ino, and H. Iizuka. 1988. Acinetobacter radioresistens sp.nov. isolated from cotton and soil. Int. J. Syst. Bacteriol. 38:209–211.
23. Rossau, R., M. Duhamel, G. Jannes, J. L. Decourt, and H. van Heuverswyn.1991. The development of specific rRNA-derived oligonucleotide probes forHaemophilus ducreyi, the causative agent of chancroid. J. Gen. Microbiol.137:277–285.
24. Scerpella, E. G., A. R. Wanger, L. Armittage, and C. D. Ericsson. 1995.Nosocomial outbreak caused by a multiresistant clone of Acinetobacter bau-mannii: results of the case-control and molecular epidemiologic investiga-tions. Infect. Control Hosp. Epidemiol. 16:92–97.
25. Seifert, H., and P. Gerner-Smidt. 1995. Comparison of ribotyping andpulsed-field gel electrophoresis for molecular typing of Acinetobacter iso-lates. J. Clin. Microbiol. 33:1402–1407.
26. Snelling, A., P. Gerner-Smidt, P. M. Hawkey, J. Heritage, P. Parnell, C.Porter, A. R. Bodenham, and T. Inglis. 1996. Validation of use of whole-cellrepetitive extragenic palindromic sequence-based PCR (REP-PCR) for typ-ing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter bau-mannii complex and application of the method to the investigation of ahospital outbreak. J. Clin. Microbiol. 34:1193–1202.
27. Struelens, M. J., E. Carlier, N. Maes, E. Serruys, W. G. V. Quint, and A. vanBelkum. 1993. Nosocomial colonization and infection with multiresistantAcinetobacter baumannii: outbreak delineation using DNA macro restrictionanalysis and PCR-fingerprinting. J. Hosp. Infect. 25:15–32.
28. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray,D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNArestriction patterns produced by pulsed-field gel electrophoresis: criteria forbacterial strain typing. J. Clin. Microbiol. 33:2233–2239.
29. Tjernberg, I., and J. Ursing. 1989. Clinical strains of Acinetobacter classifiedby DNA-DNA hybridization. Acta Pathol. Microbiol. Immunol. Scand. 97:595–605.
30. Tyler, K. D., G. Wang, S. D. Tyler, and W. M. Johnson. 1997. Factorsaffecting reliability and reproducibility of amplification-based DNA finger-printing of representative bacterial pathogens. J. Clin. Microbiol. 35:339–346.
31. Valsangiacomo, C., F. Baggi, V. Gaia, T. Balmelli, R. Peduzzi, and J. Piff-aretti. 1995. Use of amplified fragment length polymorphism in moleculartyping of Legionella pneumophila and application to epidemiological studies.J. Clin. Microbiol. 33:1716–1719.
32. Van Belkum, A., J. Kluytmans, W. van Leeuwen, R. Bax, W. Quint, E. Peters,A. Fluit, C. Vandenbroucke-Grauls, A. van den Brule, H. Koeleman, W.Melchers, J. Meis, A. Elaichouni, M. Vaneechoutte, F. Moonens, N. Maes,M. Struelens, F. Tenover, and H. Verbrugh. 1995. Multicenter evaluation ofarbitrarily primed PCR for typing of Staphylococcus aureus strains. J. Clin.Microbiol. 33:1537–1547.
33. Vandenbroucke-Grauls, C. M. J. E., A. J. H. Kerver, J. H. Rommes, R.Jansen, C. den Dekker, and J. Verhoef. 1988. Endemic Acinetobacter anitra-tus in a surgical intensive care unit: mechanical ventilators as a reservoir.Eur. J. Clin. Microbiol. Infect. Dis. 7:485–489.
34. Vaneechoutte, M., H. De Beenhouwer, G. Claeys, G. Verschraegen, A. De
2528 KOELEMAN ET AL. J. CLIN. MICROBIOL.
Rouck, N. Paepe, A. Elaichouni, and F. Portaels. 1993. Identification ofMycobacterium species by using amplified ribosomal DNA restriction anal-ysis. J. Clin. Microbiol. 31:2061–2065.
35. Vaneechoutte, M., L. Dijkshoorn, I. Tjernberg, A. Elaichouni, P. de Vos, G.Claeys, and G. Verschraegen. 1995. Identification of Acinetobacter genomicspecies by amplified ribosomal DNA restriction analysis. J. Clin. Microbiol.33:11–15.
36. Vos, P., R. Hogers, M. Bleeker, M. Reijans, T. van de Lee, M. Hornes,A. Frijters, J. Pot, J. Peleman, M. Muiper, and M. Zabeau. 1995. AFLP: a
new concept for DNA fingerprinting. Nucleic Acids Res. 21:4407–4414.37. Wendt, C., B. Dietze, E. Dietz, and H. Ruden. 1997. Survival of Acinetobacter
baumannii on dry surfaces. J. Clin. Microbiol. 35:1394–1397.38. Williams, J. G. K., A. R. Kubelik, K. J. Livak, J. A. Rafalski, and S. V.
Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are usefulas genetic markers. Nucleic Acids Res. 18:6531–6535.
39. Zabeau, M., and P. Vos. 1993. Selective restriction fragment amplification: ageneral method for DNA fingerprinting. European Patent Office, publica-tion 0 534 858 A1, bulletin 93/13.
VOL. 36, 1998 ARDRA, RAPD, AND AFLP TYPING OF ACINETOBACTER 2529
