lable at ScienceDirect

Microbial Pathogenesis 48 (2010) 85–90

Contents lists avai

Microbial Pathogenesis

journal homepage: www.elsevier .com/locate/micpath

Construction and characterization of rtxA and rtxC mutantsof auxotrophic O139 Vibrio cholerae

Tan Gim Cheong a, Melissa Chan a, Sinniah Kurunathan a,1, Syed Atif Ali b, Tan ZiNing b,Zainul Fadziruddin Zainuddin b, Pattabhiraman Lalitha b,1, Manickam Ravichandran a,*,1

a Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia Health Campus, Kubang Kerian 16150, Kelantan, Malaysiab School of Health Sciences, Universiti Sains Malaysia Health Campus, Kubang Kerian 16150, Kelantan, Malaysia

a r t i c l e i n f o

Article history:Received 15 August 2009Received in revised form27 October 2009Accepted 2 November 2009Available online 10 November 2009

Keywords:Vibrio choleraertxArtxCRTX toxinMARTX toxinO139 Bengal

* Corresponding author. Present address: Departmof Applied Sciences, AIMST University, Semeling, 081Tel.: þ60 4 429 8113; fax: þ60 4 429 8009.

E-mail address: mravichandran08@gmail.com (M.1 Present address: Department of Biotechnology,

AIMST University, Semeling 08100, Bedong, Kedah, M

0882-4010/$ – see front matter � 2009 Elsevier Ltd.doi:10.1016/j.micpath.2009.11.001

a b s t r a c t

Vibrio cholerae is a Gram-negative bacterium that causes diarrheal disease. V. cholerae O1 and O139serogroups are toxigenic and are known to cause epidemic cholera. These serogroups produce choleratoxin and other accessory toxins such as accessory cholera enterotoxin, zonula occludens toxin, andmultifunctional, autoprocessing repeat in toxin (MARTX). In the present study, we incorporated mutatedrtxA and rtxC genes that encode MARTX toxin into the existing aminolevulinic acid (ALA) auxotrophicvaccine candidate VCUSM2 of V. cholerae O139 serogroup. The rtxC mutant was named VCUSM9 and thertxC/rtxA mutant was named VCUSM10. VCUSM9 and VCUSM10 were able to colonize intestinal cellswell, compared with the parent vaccine strain, and produced no fluid accumulation in a rabbit ileal loopmodel. Cell rounding and western blotting assays indicated that mutation of the rtxC gene alone(VCUSM9 strain) did not abolish MARTX toxicity. However mutation of both the rtxA and rtxC genes(VCUSM10) completely abolished MARTX toxicity. Thus we have produced a new, less reactogenic,auxotrophic rtxC/rtxA mutated vaccine candidate against O139 V. cholerae.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

Cholera is an acute intestinal infection characterized by profusewatery diarrhea, which can quickly lead to dehydration and death.It is caused by the Gram-negative bacterium, Vibrio cholerae, whichis transmitted via the oral-fecal route through ingestion of vibrio-contaminated water and food [1]. Among the various serogroups,only V. cholerae O1 and O139 are toxigenic and known to causeepidemic cholera [2]. The most important virulence genes in thetoxigenic strains are those for cholera toxin (CT) and toxin-coregulated pilus (TCP), which are known to contribute to thepathogenicity of V. cholerae. CT causes outflow of fluids from theintestinal cells, leading to profuse watery diarrhea, and TCP assistsin the colonization of the organism in the endothelial lining of theintestine [3,4]. Many studies, however, have shown thatCT-deficient strains of V. cholerae can still produce mild to severeforms of diarrhea and other reactogenic symptoms in some

ent of Biotechnology, Faculty00 Bedong, Kedah, Malaysia.

Ravichandran).Faculty of Applied Sciences,alaysia.

All rights reserved.

volunteers [5–7]. This indicates that other toxins/factors producedby V. cholerae might contribute to the pathogenesis of the disease.

In addition to CT, V. cholerae also produces other toxins such asthe zonula occludens toxin (Zot), accessory cholera enterotoxin(ACE), hemolysin (HlyA), NAG-specific heat-stable toxin (ST), andmultifunctional, autoprocessong repeat in toxin (MARTX) [8–10].MARTX toxin has been identified as a secreted ‘‘accessory’’ toxinthat contributes to disease pathogenesis. MARTX was found tocause depolymerization of actin stress fibers and covalent cross-linking of cellular actin into dimers, trimers and higher multimersin HEp-2 cells, leading to rounding of the cells [11,12]. The toxin isencoded by a 13,635-bp open reading frame located adjacent to theCTX operon designated the rtxA gene [9]. Other genes besides rtxAare known to be related to MARTX toxin, including the rtxB, rtxC,rtxD, rtxE and VC1449 genes, which are known collectively as theMARTX gene cluster. These rtxB, rtxC, rtxD and rtxE genes play animportant role in production and transportation of the MARTXtoxin [13,14]. rtxC encodes an acyltransferase, which acts as anactivator of MARTX toxin, whereas rtxB, rtxD and rtxE encodetransportation proteins that are involved in the transport of thetoxin into the environment. The VC1449 codes for a conservedhypothetical protein [13].

Although numerous studies have been carried out to study theactin cross-linking domain region of rtxA [11,12,14], and the

T.G. Cheong et al. / Microbial Pathogenesis 48 (2010) 85–9086

secretory mechanism of MARTX by rtxBDE [13] in El Tor strains,little research has examined the roles of rtxC gene in the MARTXgene cluster in MARTX toxin production. Thus this study attemptedfor the first time to mutate both the rtxA toxin gene and the rtxCgene, which encodes acyltransferase and acts as an activator ofMARTX toxin in an O139 V. cholerae strain. We assumed that dis-rupting the synthesis of the normal toxin activator (rtxC) andmutating the rtxA gene would prevent the production of functionalRTX toxin. Thus rtxC and rtxC/A mutants were constructed andincorporated by homologous recombination into the pre-existingO139 V. cholerae vaccine candidate VCUSM2, which is an amino-levulinic acid (ALA) auxotroph wherein a housekeeping gene hemAis mutated [15].

2. Results

2.1. Construction and genotypic characterization of VCUSM9 andVCUSM10

VCUSM9 and VCUSM10 were derived from VCUSM2, an ALAauxotroph of WT O139 Bengal [15]. VCUSM9 contained a non-polarmutation of the rtxC gene by insertion of the kanamycin resistancegene, aphA, at a BstXI site. The rtxC gene was mutated in such a wayto allow read-through to the downstream rtxA in the MARTXoperon. VCUSM10 was derived from VCUSM9 by replacement ofrtxC::aphA by deletion mutants of both the rtxA and rtxC genes(Fig. 1). Both VCUSM9 and VCUSM10 exhibited ALA auxotrophy. Thenature of the mutations in VCUSM9 and VCUSM10 was confirmedby polymerase chain reaction (PCR) screening. When screened withrtxC-F1 and rtxC-R1 primers, the vaccine candidates VCUSM9 andVCUSM10 gave the expected PCR product sizes of approximately2.0 kb and 650 bp, respectively, compared with the 1.0-kb PCRproduct from VCUSM2. The deletions in the rtxA and rtxC genes inVCUSM10 were further confirmed by DNA sequencing.

2.2. Cytotoxicity assay

Cell rounding was observed when HEp-2 cells were incubatedwith VCUSM2 or WT O139 Bengal, with an intact MARTX gene

Fig. 1. Genetic organization of MARTX gene cluster and hemA gen

cluster. However, typical cell rounding was not observed whenHEp-2 cells were incubated with VCUSM9 and VCUSM10 vaccinecandidates, indicating the absence of MARTX toxin production. TheWT O1 Classical Inaba strain was used as a negative control (Fig. 2).

2.3. Western blot

Western blot analysis of HEp-2 cells exposed to WT O139 V.cholerae or VCUSM9 strains using anti-actin antibody showed theabsence of 42-kDa monomeric actin, but 84-kDa dimers, 126-kDatrimers and higher multimer actin were present in the cells. Noactin dimers or trimers were detected in HEp-2 cells treated withVCUSM10 or V. cholerae Classical O1 Inaba strains, which onlyproduced the monomeric actin band (43 kDa) (Fig. 3). These datasuggest that mutation of both the rtxC and rtxA genes, as inVCUSM10, completely abolished MARTX toxin activity, whilemutation of the rtxC gene alone, as in VCUSM9, did not abolishMARTX toxin production. These results were supported by DNAsequencing data showing that part of the rtxA gene was deleted inthe VCUSM10 vaccine strain, compared with the VCUSM9 strain, inwhich the rtxA gene was intact.

2.4. Bacterial colonization

Colonization efficiency was studied in a mouse colonizationassay. The rtxC and rtxA/C mutants of VCUSM9 and VCUSM10vaccine candidates were able to colonize the intestine betterwhen compared to VCUSM2. In contrast, the findings of Binaet al. in 2001 showed that the colonization efficiency was notaltered in rtxA mutant [16]. However in this study the colonizationefficiency of rtxC (VCUSM9) and rtxA/C (VCUSM10) mutantswere increased by 65–70% as compare to VCUSM2, but were still100 times less efficient than WT (Table 1).

2.5. Reactogenicity

The rtxC and rtxC/A mutants, VCUSM9 and VCUSM10, producednegligible fluid accumulation in rabbit ileal loops, at varyingconcentrations of inoculum (105–107). VCUSM2 was mildly

e in WT O139 V. cholerae, VCUSM2, VCUSM9 and VCUSM10.

Fig. 2. Comparison of cytotoxicities following addition of (A) PBS or 107 colony-forming units of (B) WT O139 Bengal, (C) WT O1 Classical (Inaba), (D) VCUSM2, (E) V. cholerae rtxCmutant (VCUSM9), and (F) rtxC/A mutant (VCUSM10) strains to HEp-2 cells.

T.G. Cheong et al. / Microbial Pathogenesis 48 (2010) 85–90 87

reactogenic after inoculation with higher numbers of colony-forming units (CFU), compared with the mutant strains. At aninoculum size of 1 � 107 CFU, the fluid accumulation:length ratios(FAR) were 1.46 and 0.36 for WT O139 Bengal and VCUSM2,respectively (Table 2).

3. Discussion

In this study, we mutated the rtxC and rtxA genes of V. choleraeBengal O139 by insertion or deletion. Gene deletion was confirmedby DNA analysis, while cytopathic properties were studied usinga cell rounding assay. The data indicate that the potential activationof MARTX by RtxC is not essential for rtxA function, at least in vivo.As reviewed by Satchell (2007), this observation is consistent withwork in Vibrio vulnificus that rtxC is not required for activation ofthe MARTX of that organism [10]. The cytopathic effects of the

vaccine candidates VCUSM9 and VCUSM10 were further confirmedby western blotting analysis: VCUSM9 which carried an intact rtxAbut a mutated rtxC, produced dimer and trimer actin proteins, butno monomeric proteins. Meanwhile, VCUSM10, which has a dele-tion in portions of both the rtxA and rtxC genes (from 13733 to14073 with reference to Genbank accession no: AF119150)produced only the actin monomer, and no multimeric actinproteins. This indicates that rtxC was not necessary for MARTXtoxin function in V. cholerae which show similarity in V. vulnificus[17]. But the MARTX toxin without rtxC activation showed reducedin actin cross-linking activity as indicated in Fig. 3.

In order for V. cholerae to establish an infection focus, it mustcolonize the small intestine, which is necessary to elicit an immuneresponse from the host [18]. The colonization efficiencies ofVCUSM9 and VCUSM10 were better than that of the parental strainVCUSM2, but were still lower than that of wild type O139

Fig. 3. Western blotting analysis of HEp-2 cells treated with different vaccine candidate strains. Actin proteins were detected using polyclonal rabbit anti-actin antibody. Lane 1:Molecular weight marker; Lane 2: Hep-2 cells alone; Lane 3: WT O139 Bengal; Lane 4: WT O1 Classical; Lane 5: V. cholerae rtxC mutant (VCUSM9); Lane 6: V. cholerae rtxC/A mutant(VCUSM10); Lane 7: E. coli cells.

Table 2Results of fluid accumulation ratio in relation to the fluid volume and loop length inrabbit ileal loops after inoculation of different doses of V. cholerae auxotrophic rtxCand rtxC/A mutants, parent auxotrophic VCUSM2 and WT O139 strains.

T.G. Cheong et al. / Microbial Pathogenesis 48 (2010) 85–9088

V. cholerae This reduced colonization efficiency might be due to thefact that all the VCUSM vaccine candidates are ALA auxotrophs thatare able to multiply for only a few generations in the absence of ALAsupplementation. [15]. Moreover, the reactogenicity assay showedno fluid accumulation with VCUSM9 or VCUSM10 even at higherCFUs (1 � 107 CFU), compared with the parental strain VCUSM2,which showed measurable, but low levels of fluid accumulation(0.36 mL/cm). WT O139 V. cholerae, however, showed massive fluidaccumulation with hemorrhaging at higher CFUs (Table 2). Thereduced reactogenic effect of the vaccine candidates (VCUSM9 andVCUSM10) may be due to the lack of MARTX toxin production, whichcauses damage to the epithelial cells [19]. It should also be noted thatVCUSM9 and VCUSM10 showed little or no reactogenicity despitehaving an intact CTX operon, which could be attributed to their ALAauxotrophy, along with rtxC/A gene mutations.

Several vaccine strains have been constructed by mutating CTand several virulence factors, [5,20] but these had reactogeniceffects in humans. Earlier studies also showed that a vaccine strainderived from the classical biotype strain CVD103 was less reacto-genic and lacked MARTX toxin [21]. Hence we aimed to developa vaccine for O139 using the ALA auxotrophic O139 V. choleraevaccine candidate, VCUSM2, with a full repertoire of virulencefactor antigens. VCUSM2 induced immunity in a rabbit model [15],but had mild reactogenicity in the rabbit ileal loop assay. In order toreduce the reactogenicity of VCUSM2, the rtxC/A gene was mutatedand transferred into the existing VCUSM2 vaccine candidate byhomologous recombination. The presence of the rtxC/A mutationwas confirmed by genotypic and phenotypic studies. Thus we havesuccessfully developed a new auxotrophic O139 vaccine candidate

Table 1Results of infant mouse colonization assay for V. cholerae auxotrophic rtxC and rtxC/Amutants, the parent auxotrophic strain VCUSM2, and WT O139 strain.

Strains CFU recovered afterinoculating 1 � 106 cells

Standard Deviation,SD (Total mice, n ¼ 4)

O139 Bengal WT 5.5 � 107 CFU 0.32 � 107 CFUVCUSM2 (ALA auxotroph) 2.1 � 105 CFU 0.14 � 105 CFUVCUSM9 (rtxC::aphA,

ALA auxotroph)3.0 � 105 CFU 0.43 � 105 CFU

VCUSM10 (DrtxC/rtxA,ALA auxotroph)

3.2 � 105 CFU 0.36 � 105 CFU

Control (PBS) – –

ALA ¼ delta aminolevulinic acid. CFU ¼ colony forming units.

by mutating a housekeeping gene, namely hemA, and by knockingout the gene responsible for MARTX toxin production.

4. Materials and methods

4.1. Bacterial strains

The vaccine candidates VCUSM9 and VCUSM10 with rtxC andrtxC/A mutations were derived from VCUSM2, an ALA auxotroph,and were maintained in Luria-Bertani (LB) medium containingpolymyxin B (0.75 mg/mL) with ALA (80 mg/mL) supplementation.Due to the presence of the kanamycin cassette in VCUSM9, thisstrain was maintained in a medium with added kanamycin (50 mg/mL). The WT O139 Bengal strain is naturally resistant to polymyxinB, and was therefore maintained in LB medium containing poly-myxin B (0.75 mg/mL). The details of the bacterial strains andplasmids are given in Tables 3 and 4, respectively.

4.2. Construction of VCUSM9 and VCUSM10 vaccine candidates

Genetic organization of MARTX gene cluster and hemA gene inWT O139 V. cholerae, VCUSM2, VCUSM9 and VCUSM10 are shownin Fig. 1 and the primer sequences are shown in Table 5. The rtxC

Bacterialstrains/vaccinecandidates

No. of CFU inoculatedinto the ileal loops

Fluid accumulated (ml)/Lengthof the loop (cm) [FAR ratio]

O139 WT 1 � 105 CFU 0.901 � 106 CFU 1.381 � 107 CFU 1.46

VCUSM2 1 � 105 CFU <x1 � 106 CFU <x1 � 107 CFU 0.36

VCUSM9 1 � 105 CFU <x1 � 106 CFU <x1 � 107 CFU 0.06

VCUSM10 1 � 105 CFU <x1 � 106 CFU <x1 � 107 CFU <x

x ¼ 0. CFU ¼ colony forming units.

Table 3Bacterial strains used in this study.

Strains Description References

E. coli BW 20767l-pir

RP4 2tet: mu-1kan::Tn7integrantleu 63::IS10 rec A1 cre(510 hsdR17end A1 Zbf-5 uid) (DMluI): pir thi

Gift from Dr WilliamMetcalf, Universityof Illinois, [24]

O139 Bengal WT Wild type, V. cholerae O139 Bengalisolated from a patient in HUSM

HUSM

VCUSM2 V. cholerae O139 ALA auxotroph(DhemA)

[15]

VCUSM9 V. cholerae O139 ALA auxotroph(DhemA) with rtxC::aphA, KanR

This study

VCUSM10 V. cholerae O139 ALA auxotroph(DhemA) with DrtxC/A

This study

Table 5Oligonucleotides used in this study.

Oligonucleotides Description

rtxC-R1 5’GGTGGCCAGTGGAATCTTCCA 30

rtxC-F1 5’AAAGTCGGTATTGCGGCACGC 30

KanPsy-F 5’AGCGGCCGGCCGCTTACATGGCGATAGCTAG 30

KanPsy-R 5’ATAGGCCGGCCTCAGAAGAACTCGTCAAGAA 30

T.G. Cheong et al. / Microbial Pathogenesis 48 (2010) 85–90 89

gene was amplified by PCR using rtxC-F1 and rtxC-R1 primers andusing WT O139 as a template. The amplified product included thefull-length rtxC gene and part of the downstream sequence ofthe rtxA gene. The PCR product was then successfully cloned intothe pTZ57R cloning vector (Fermentas, Vilnius, Lithuania) by bluntend ligation. The transformants were selected on ampicillin platesand the presence of rtxC was confirmed by PCR screening. The rtxCgene in pTZ57R was mutated by inserting a kanamycin resistancegene (aphA) cassette into the BstXI site of the rtxC gene to producepTZ57R-rtxC::aphA. The presence of the kanamycin resistance genewas confirmed by PCR screening of the transformants using Kan-PsyI-2F and KanPsyI-R1 primers. The mutated rtxC::aphA gene wasthen excised from the pTZ57R plasmid using SacI and SalI restric-tion enzymes and transferred into a pWM91 suicide plasmid bysticky-end ligation, to create pWM91-rtxC::aphA. pWM91-rtxC::a-phA was then digested with PsyI. There are three PsyI restrictionsites in the aphA gene and one PsyI restriction site in the rtxA gene,and the recombinant plasmid was therefore restricted into threesmall fragments and one larger fragment. The larger fragment wasthen used for self-ligation to obtain a new recombinant plasmidwith a deletion in the rtxC and rtxA genes, pWM91-DrtxC/A.

The pWM91-rtxC::aphA plasmid was transformed into Escher-ichia coli strain (BW20767l-pir) and was transferred by conjugationto the ALA auxotrophic V. cholerae strain (VCUSM2) using the filtermating method. The transconjugants resulting from the firstcrossover event were selected on LB kanamycin plates supple-mented with ALA. The resultant mutants were grown in modifiedLB medium containing 15% sucrose but no NaCl. The clones sensi-tive to ampicillin but resistant to kanamycin and polymyxin weredesignated as VCUSM9 and their rtxC::aphA genotypes wereconfirmed by PCR.

A similar protocol was used to construct VCUSM10, except thatthe pWM91-DrtxC/A plasmid without the kanamycin gene wastransformed into E. coli strain (BW20767l-pir) and was transferredby conjugation to the V. cholerae vaccine candidate (VCUSM9) usingthe filter mating method, followed by sucrose selection. The clonessensitive to ampicillin and kanamycin but resistant to polymyxin

Table 4Plasmids used in this study.

Plasmids Description References

pWM91 fl (þ) ori lacZa of pBluescriptII (SKþ) mobRP4, oriR6 K,SacB and AmpR

Gift from Dr William,Metcalf, Universityof Illinois, [24]

pTZ57R PCR cloning vector, T7 promoter,AmpR, pMB1

Fermentas

pWM91-rtxC::aphA pWM91 with rtxC::aphA fragment This studypWM91-DrtxC/A pWM91 with DrtxC/A fragment This studypTZ57R-rtxC pTZ57R with rtxC fragment This studypTZ57R-rtxC::aphA pTZ57R with rtxC::aphA fragment This study

were designated as VCUSM10. Deletion mutation of the rtxC/rtxAgene was confirmed by PCR and DNA sequencing.

4.3. Cytotoxicity assay

Bacterial cultures were grown for 16 h in LB broth with ALAsupplement at 30 �C and washed twice with phosphate-bufferedsaline (PBS, pH 7.4). The bacterial cells were then adjusted to109 CFU/ml with PBS (OD600 ¼ 2.0). HEp-2 cells were cultured at37 �C with 5% CO2 in RPMI 1640 medium containing 10 mM HEPESbuffer, 2 mM glutamine and 10% fetal calf serum. HEp-2 cells ata density of 106 were seeded onto 24-well tissue culture plate and10 ml of the bacterial cells were added to the adhered HEp-2 cells ata multiplicity of infection (m.o.i) of 100 and incubated at 37 �C in 5%CO2 for 1 h [14]. The cytotoxic effect was assessed by observingrounding of HEp-2 cells using an inverted microscope and repre-sentative fields were photographed.

4.4. Western blotting to detect actin laddering

HEp-2 cells treated with the vaccine mutants of O139 V. cholerae(VCUSM2, VCUSM9 or VCUSM10), classical O1, or WT were washedonce with PBS and treated with 0.1 mM EDTA. The cells were thencollected by scraping and centrifuged at 8000 � g. The pellet wasthen resuspended in sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) sample buffer and boiled for 5 min. Theboiled lysates were electrophoresed on 8% SDS-PAGE, transferredonto nitrocellulose membranes and blocked with 5% skimmedmilk. The membrane was probed with a 1:2000 dilution of poly-clonal rabbit anti-actin antibody (Sigma, Missouri, USA) anddetected using 1:2000 goat anti-rabbit IgG horseradish peroxidase(Dako, Glostrup, Denmark). The protein bands were then visualizedusing 4-chloro-1-naphthol and H2O2 as substrate.

4.5. Animal studies

The animal studies were performed to assess the colonizationabilities and reactogenicities of the V. cholerae vaccine strains(VCUSM9 and VCUSM10) developed in this study. All animalexperiments were carried out according to the protocols approvedby the Institutional Animal Ethics Committee, Universiti SainsMalaysia, Malaysia.

4.5.1. Bacterial colonization assayThe colonization assay was performed in 3–5 days old BALB/c

mice by intragastric inoculation of 1 �106 cells/50 ml of the vaccinestrains. Mice were euthanized after 16–18 h and the whole gut wasrecovered aseptically [22]. The whole gut was homogenized andserially diluted in LB broth and plated on LB agar with ALAsupplements for CFU counts.

4.5.2. Reactogenicity assayAdult New Zealand white rabbits (2–2.5 kg) were used in this

study. Reactogenicity studies were performed using the standardileal loop assay [23]. Briefly, the small intestine of the rabbit wasligated into segments of approximately 5 cm each at 1-cm intervals,

T.G. Cheong et al. / Microbial Pathogenesis 48 (2010) 85–9090

and varying concentrations of vaccine mutants of 1 � 105–107 CFUin normal saline were injected into the 5-cm loops, in duplicate. Theintestine was then returned to the bowel and the incision wasclosed by suturing. After 18 h, the rabbit was euthanized and theligated loops were recovered to calculate the FAR ratio.

Acknowledgments

This study was supported by a grant from the ScientificAdvancement Grant Allocation (SAGA) Academic Sains Malaysia,SAGA Fund Reference No: b M 27 and by the National ScienceFoundation, MOSTI, Malaysia through a scholarship awarded toMr.Tan Gim Cheong to carry out this research work.

References

[1] Cash RA, Music SI, Libonati JP, Craig JP, Pierce NF, Hornick RB. Response of manto infection with Vibrio cholerae. II. Protection from illness afforded byprevious disease and vaccine. J Infect Dis 1974;130:325–33.

[2] Rahman MH, Biswas K, Hossain MA, Sack RB, Mekalanos JJ, Faruque SM.Distribution of genes for virulence and ecological fitness among diverse Vibriocholerae population in a cholera endemic area: tracking the evolution ofpathogenic strains. DNA Cell Biol 2008;27:347–55.

[3] Kirn TJ, Taylor RK. TcpF is a soluble colonization factor and protective antigensecreted by El Tor and classical O1 and O139 Vibrio cholerae serogroups. InfectImmun 2005;73:4461–70.

[4] De Haan L, Hirst TR. Cholera toxin: a paradigm for multi-functional engage-ment of cellular mechanisms (Review). Mol Membr Biol 2004;21:77–92.

[5] Kaper JB, Lockman H, Baldini MM, Levine MM. Recombinant nontoxinogenic Vibriocholerae strains as attenuated cholera vaccine candidates. Nature 1984;308:655–8.

[6] Taylor DN, Killeen KP, Hack DC, Kenner JR, Coster TS, Beattie DT, et al.Development of a live, oral, attenuated vaccine against El Tor cholera. J InfectDis 1994;170:1518–23.

[7] Coster TS, Killeen KP, Waldor MK, Beattie DT, Spriggs DR, Kenner JR, et al.Safety, immunogenicity, and efficacy of live attenuated Vibrio cholerae O139vaccine prototype. Lancet 1995;345:949–52.

[8] Mohapatra SS, Ramachandran D, Mantri CK, Singh DV. Characterization of thegenetic background of Vibrio cholerae O1 biotype El Tor serotype Inaba strainsisolated in Trivandrum, southern India. J Med Microbiol 2007;56:260–5.

[9] Lin W, Fullner KJ, Clayton R, Sexton JA, Rogers MB, Calia KE, et al. Identificationof a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the choleratoxin prophage. Proc Natl Acad Sci U S A 1999;96:1071–6.

[10] Satchell KJ. MARTX, multifunctional autoprocessing repeats-in-toxin toxins.Infect Immun 2007;75:5079–84.

[11] Fullner KJ, Mekalanos JJ. In vivo covalent cross-linking of cellular actin by theVibrio cholerae RTX toxin. EMBO J 2000;19:5315–23.

[12] Kudryashov DS, Cordero CL, Reisler E, Satchell KJ. Characterization of theenzymatic activity of the actin cross-linking domain from the Vibrio choleraeMARTX Vc toxin. J Biol Chem 2008;283:445–52.

[13] Boardman BK, Satchell KJ. Vibrio cholerae strains with mutations in an atypicaltype I secretion system accumulate RTX toxin intracellularly. J Bacteriol2004;186:8137–43.

[14] Sheahan KL, Cordero CL, Satchell KJ. Identification of a domain within themultifunctional Vibrio cholerae RTX toxin that covalently cross-links actin. ProcNatl Acad Sci U S A 2004;101:9798–803.

[15] Ravichandran M, Ali SA, Rashid NH, Kurunathan S, Yean CY, Ting LC, et al.Construction and evaluation of a O139 Vibrio cholerae vaccine candidate basedon a hemA gene mutation. Vaccine 2006;24:3750–61.

[16] Bina JE, Mekalanos JJ. Vibrio cholerae tolC is required for bile resistance andcolonization. Infect Immun 2001;69:4681–5.

[17] Liu M, Alice AF, Naka H, Crosa JH. The HlyU protein is a positive regulator ofrtxA1, a gene responsible for cytotoxicity and virulence in the human path-ogen Vibrio vulnificus. Infect Immun 2007;75:3282–9.

[18] Cedre Marrero B, Garcia Imia LG, Garcia Sanchez HM, Farinas Medina M,Talavera Coronel A, Infante Bourzac JF. Intestinal colonization of the infantmouse model by attenuated and virulent Vibrio cholerae strains. Arch Med Res1998;29:231–4.

[19] Fullner KJ, Boucher JC, Hanes MA, Haines 3rd GK, Meehan BM, Walchle C, et al.The contribution of accessory toxins of Vibrio cholerae O1 El Tor to theproinflammatory response in a murine pulmonary cholera model. J Exp Med2002;195:1455–62.

[20] Talavera A, Ano G, Pino Y, Castano J, Uribarri E, Riveron L, et al. Formulation intablets of a cholera whole cells inactivated vaccine candidate. Vaccine2006;24:3381–7.

[21] Ketley JM, Kaper JB, Herrington DA, Losonsky G, Levine MM. Diminishedimmunogenicity of a recombination-deficient derivative of Vibrio choleraevaccine strain CVD103. Infect Immun 1990;58:1481–4.

[22] Angelichio MJ, Spector J, Waldor MK, Camilli A. Vibrio cholerae intestinalpopulation dynamics in the suckling mouse model of infection. Infect Immun1999;67:3733–9.

[23] Thungapathra M, Sharma C, Gupta N, Ghosh RK, Mukhopadhyay A, Koley H,et al. Construction of a recombinant live oral vaccine from a non-toxigenicstrain of Vibrio cholerae O1 serotype inaba biotype E1 Tor and assessment of itsreactogenicity and immunogenicity in the rabbit model. Immunol Lett1999;68:219–27.

[24] Metcalf WW, Jiang W, Daniels LL, Kim SK, Haldimann A, Wanner BL.Conditionally replicative and conjugative plasmids carrying lacZ alpha forcloning, mutagenesis, and allele replacement in bacteria. Plasmid 1996;35:1–13.