Journal of Integrative Plant Biology 2010, 52 (10): 868–878

Research Article

Coordinated Regulation of Gene Expression forCarotenoid Metabolism in Chlamydomonas reinhardtiiTian-Hu Sun1, Cheng-Qian Liu1, Yuan-Yuan Hui1, Wen-Kai Wu2, Zhi-Gang Zhou2

and Shan Lu1,3∗

1State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, China2College of Fisheries and Life Science, Shanghai Ocean University, Shanghai 201306, China3Discipline Crossing Center, Nanjing University, Nanjing 210093, China∗Corresponding author

Tel: +86 25 8368 6217; Fax: +86 25 8359 2705; E-mail: shanlu@nju.edu.cnAvailable online on 26 August 2010 at www.jipb.net and www.interscience.wiley.com/journal/jipbdoi: 10.1111/j.1744-7909.2010.00993.x

Abstract

Carotenoids are important plant pigments for both light harvesting and photooxidation protection.Using the model system of the unicellular green alga Chlamydomonas reinhardtii, we characterizedthe regulation of gene expression for carotenoid metabolism by quantifying changes in the transcriptabundance of dxs, dxr and ipi in the plastidic methylerythritol phosphate pathway and of ggps, psy,pds, lcyb and bchy, directly involved in carotenoid metabolism, under different photoperiod, lightand metabolite treatments. The expression of these genes fluctuated with light/dark shifting. Lighttreatment also promoted the accumulation of transcripts of all these genes. Of the genes studied, dxs,ggps and lcyb displayed the typical circadian pattern by retaining a rhythmic fluctuation of transcriptabundance under both constant light and constant dark entrainments. The expression of these genescould also be regulated by metabolic intermediates. For example, ggps was significantly suppressed bya geranylgeranyl pyrophosphate supplement and ipi was upregulated by isopentenyl pyrophosphate.Furthermore, CrOr , a C. reinhardtii homolog of the recently characterized Or gene that accounts forcarotenoid accumulation, also showed co-expression with carotenoid biosynthetic genes such as pdsand lcyb. Our data suggest a coordinated regulation on carotenoid metabolism in C. reinhardtii at thetranscriptional level.

Sun TH, Liu CQ, Hui YY, Wu WK, Zhou ZG, Lu S (2010) Coordinated regulation of gene expression for carotenoid metabolism in Chlamydomonasreinhardtii. J. Integr. Plant Biol. 52(10), 868–878.

Introduction

Carotenoids are a group of pigments that are widely distributedin bacteria, yeasts, plants and animals (Yeum and Russell2002). In plants, they serve as both antenna pigments in theprocess of light harvesting and quenchers that protect pho-tosynthetic organelles against photooxidation damage (Frankand Cogdell 1996). In addition, carotenoids furnish the flowersand fruits of flowering plants with distinct colors to attractanimals for pollination and seed dispersal (Tanaka et al.2008).

In higher plants and green algae, carotenoids are de novosynthesized in plastids via the methylerythritol phosphate(MEP) pathway, where the condensation of glyceraldehyde3-phosphate and pyruvate produces five-carbon (C5) isopen-tenyl pyrophosphate (IPP) (Lichtenthaler 1999). Two enzymes,1-deoxy-D-xylulose 5-phosphate synthase (DXS) and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR), play impor-tant roles in IPP production and are proposed as key enzymesin the MEP pathway (Takahashi et al. 1998; Estevez et al.2001; Zulak and Bohlmann 2010). IPP isomerase (IPI) cat-alyzes the reversible isomerization of IPP and its allylic isomer

C© 2010 Institute of Botany, Chinese Academy of Sciences

Carotenoid Metabolism in Chlamydomonas 869

dimethylallyl pyrophosphate (DMAPP). This reaction favorsDMAPP production and thus is also suggested to be the rate-limiting step (Albrecht and Sandmann 1994; Sun et al. 1998).

Geranylgeranyl pyrophosphate (GGPP) synthase (GGPS)synthesizes GGPP from IPP and DMAPP. The C20 GGPP is acentral intermediate for geranylgeranyl reductase (GGR), phy-toene synthase (PSY) and other enzymes, allowing distributionof metabolic flux among different pathways (Lange and Ghas-semian 2003; Lu and Li 2008). PSY catalyzes the condensationof two GGPP molecules into the first C40 carotenoid, phytoene,which is then desaturated into ζ-carotene by phytoene desat-urase (PDS). Both PSY and PDS have also been proposed asregulatory points for carotenoid biosynthesis (Chamovitz et al.1993; Fraser et al. 1994). Further desaturation and cyclizationlead to generation of β-carotene and other carotenoids. Onekey enzyme in this process is lycopene β-cyclase (LCYB),which catalyzes a two-step reaction that creates a β-ionone ringat each end of the lycopene molecule to produce β-carotene(Cunningham 2002).

In the past decades, carotenoid constituents, enzymes andthe genes for most steps of carotenoid metabolism have beencharacterized in different plant species (Cunningham and Gantt1998; Tanaka et al. 2008; Cazzonelli and Pogson 2010).This characterization has raised interest in, and increased thefeasibility of, deciphering the regulatory network of carotenoidmetabolism at the gene level, without requiring the steps ofchemical analysis and gene identification.

Chlamydomonas reinhardtii is one of the best-studied algae,and also an attractive model organism in plant physiology andmolecular genetics (Harris 2001; Matsuo et al. 2008). Theavailability of nuclear, plastidic and mitochondrial genome se-quences (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html)makes it a simple but important system for dissecting compli-cated plant metabolic pathways (Lohr et al. 2005). In additionto this, chemical and molecular genetic analyses have provedthat Chlamydomonas exclusively uses the MEP pathway forthe biosynthesis of isoprenoids, including sterols in the cytosol(Disch et al. 1998; Schwender et al. 2001). Carotenoids andtheir metabolism in Chlamydomonas have also been wellstudied (Sager and Zalokar 1958; Francis et al. 1975; Lohret al. 2005).

Light is a key component in regulating plant growth and de-velopment. In higher plants such as rice, it has been estimatedthat 70% of genes are induced at least twofold in responseto either light or dark (Jung et al. 2008). As it is involvedin photosynthesis and photooxidation, carotenoid metabolismis regulated by light at different metabolic steps by variousmechanisms (Lu and Li 2008). For example, psy, pds, andlcyb in pepper were all highly expressed in the day (Simkinet al. 2004). In C. reinhardtii, it was also reported that bothPSY and PDS could be rapidly induced by light, likely at thetranscriptional level (Bohne and Linden 2002).

Recently, it has been revealed that many genes for photo-synthesis and other types of plastidic metabolism are regulatedby the circadian clock (Hwang and Herrin 1994; Jacobshagenand Johnson 1994; Lemaire et al. 1999; Zulak and Bohlmann2010). Most of these genes exhibit an expression peak duringthe day, although some peak during the night. For carotenoidmetabolism, the petunia gene for the carotenoid cleavagedioxygenase PhCCD1 was demonstrated to be circadian-regulated (Simkin et al. 2003). For C. reinhardtii, it was reportedthat the carotenoid components varied with cell cycle, showinga diurnal fluctuation (Francis et al. 1975). However, it is still yetto be uncovered if circadian rhythm is involved in the regulation.

In addition to genes encoding enzymes, genes for plastiddivision and development such as FtsZ and Or were alsoreported to have effects on the biosynthesis and accumulationof carotenoids in higher plants (Moehs et al. 2001; Lu andLi 2008). In green algae, the availability of plastidic storagestructures was found to regulate carotenoid biosynthesis inDunaliella bardawil (Rabbani et al. 1998), but the molecularmechanism is yet to be understood.

In the present study, we report a comparison at the tran-scriptional level of genes that are related to either carotenoidmetabolism or plastid development under different treatments.Our aim was to determine how the expression of these genes iscoordinated in the model system Chlamydomonas.

Results

Amplification and identification of gene sequences

To study the regulation of Chlamydomonas carotenoidmetabolism, we selected eight genes encoding enzymesof DXS, DXR and IPI in the MEP pathway for IPP andDMAPP biosynthesis, of GGPS, PSY, PDS and LCYB forcarotene biosynthesis, and of β-carotene hydroxylase (BCHY),for carotene hydroxylation into xanthophylls. Furthermore, weisolated a homolog of Or , the gene recently characterizedin cauliflower for carotenoid accumulation, by a homologouscloning strategy and analyzed its expression. The full-lengthcDNA sequence of this C. reinhardtii Or homolog (CrOr) wasidentical to the previously identified cpl6 but not annotatedas such. The expression of CrFtsZ1 was also studied as anindication of cell division (Hu et al. 2008).

The genes studied are listed in Table 1. Primers were de-signed for amplifying fragments of about 100–350 bp, which isa suitable size for both quantitative polymerase chain reaction(qPCR) analysis and agarose gel image documentation afterethidium bromide staining. Before comparing gene expression,we amplified fragments of all genes to check both primer speci-ficity and reaction efficiency. We also sequenced the amplifiedfragment for each gene to confirm that every primer pair exactlyamplified the corresponding gene (data not shown).

870 Journal of Integrative Plant Biology Vol. 52 No. 10 2010

Table 1. Chlamydomonas reinhardtii carotenoid metabolism-

related and reference genes, and designed forward (F) and reverse

(R) primers for this study

Gene Accession Designed primers (5′ to 3′)

dxs XM_001702010 F: ATTGATGCGTGTGTGTCTGTGTGC

R: TGCATGGCATGGCCTATTTGACTG

dxr XM_001693906 F: GGGACAGGGCTCGGAACAAAGT

R: CGGCAGCAACAACAAGAAAGGTG

AAT

ipi XM_001701366 F: TAGCGATATGACGTTGTGCTTGGC

R: TATGGCCACTATGTTACACGCGCA

ggps XM_001703117 F: ATCCCGACTTACTTACCCCG

R: AACAACTCCCCAATCCAAAC

psy XM_001701140 F: ATCAAGACACACGTAGTAGGCCGT

R: TTACTCAAGCGCTCGTAAGCAGGT

pds XM_001690807 F: TTTGCACCTACACTGGTTTGGCAC

R: TCTGTACGAGGGCAACCAAATCCT

lcyb AY860818 F: CCGCTTGTGTGCCATACACAGTTT

R: AACGACTGCATTGTGGCTTTCGAC

bchy XM_001698646 F: CGTTCAAATCCATGTGCTTCGGGT

R: CCGTCCATGAAGAACATCTGCCAA

CrOr XM_001695252 F: GTTGTTGCGGGCTTATTCGT

R: TCTCTGGTGTTGGTGGGTTCT

CrFtsZ1 XM_001702368 F: AGCTTAGGGTCAACGTCCGTAGCA

R: TAGGCACGGGTCACCTTCAAATCT

actin XM_001699016 F: CAGTAGGAGGCATAGGGTTTGG

R: TCAACGAATTGGGGTGTGTG

yptC1 U13168 F: CATTCCGTTCCTTGAAACCTC

R: TTTAGCAGCAAGACGACGAC

α-tubulin XM_001691824 F: CTCGCTTCGCTTTGACGGTG

R: CGTGGTACGCCTTCTCGGC

RACK1 EU306630 F: CTTCTCGCCCATGACCAC

R: CCCACCAGGTTGTTCTTCAG

Genes for 1-deoxy-D-xylulose 5-phosphate synthase (dxs), 1-deoxy-D-

xylulose 5-phosphate reductoisomerase (dxr), isopentenyl pyrophos-

phate isomerase (ipi), geranylgeranyl pyrophosphate synthase (ggps),

phytoene synthase (psy), phytoene desaturase (pds), lycopene β-

cyclase (lcyb) and β-carotene hydroxylase (bchy) were studied in this

work.

Diurnal fluctuation of gene expression

Using reverse transcription-polymerase chain reaction (RT-PCR), we found that the steady-state transcript abundancesof all eight enzyme genes fluctuated with light/dark shifting(Figure 1). For both dxs and dxr , steady-state levels of their tran-scripts started to increase from the fifth to the ninth hour in thedark phase (D5–D9). The abundance of dxs transcripts peakedat the fifth hour in the light phase (L5), which was around noon,whereas that of dxr did not change much throughout the day.Transcripts of ipi and ggps could be detected in both the lightand dark phases, but with significantly higher abundance levelsobserved from D9 to L9.

Figure 1. Diurnal expression of genes involved in carotenoid

metabolism and plastid development.

The samples were collected for two continuous days with 12:12 h

light : dark cycle at the first, fifth, and ninth hour in the light (L1, L5

and L9) and dark (D1, D5 and D9) phases of each day. The bar

under sampling time shows the light/dark shifts. The expression of

actin was used as a reference.

Phytoene desaturase and LCYB are two enzymes closelyrelated to carotenoid biosynthesis. The transcript levels of pdsand lcyb were relatively high in the day, from L1 to L9, as shownin our RT-PCR results (Figure 1). Both of these genes, togetherwith ggps, showed the lowest expression level around D1–D5,when CrFtsZ1, the gene that regulates cell division, was highlyexpressed (Figure 1).

In this study, CrOr showed a clear diurnal rhythm thatwas complementary to that of CrFtsZ1. We found that CrOrtranscripts were highly accumulated at L1–L9, accompaniedby pds and lcyb for carotenoid biosynthesis, and maintained arelatively high level for most of the day.

Light-induced gene expression

We then tried to determine whether the diurnal fluctuationpattern of these genes resulted from the joint effects of lightinduction and the internal circadian clock. Because the ex-pression of all genes might have been changing continuouslywhen Chlamydomonas cells were synchronously cultivated (asFigure 1 suggested), for each gene studied, the change intranscript abundance was compared between the light-inducedsample and the control group, which stayed in the dark but wassampled in parallel, instead of between the same sample beforeand after the treatment.

Carotenoid Metabolism in Chlamydomonas 871

With a 30 min illumination to break the dark phase (at D3),the transcript abundances of all genes encoding enzymesincreased. Immediately after the illumination, the abundanceof ipi transcripts was enriched 9.0-fold compared with the darkcontrol (Figure 2A). In the next 30 min in dark, the transcriptabundance of the dark control increased, probably because ofthe rhythmic regulation, whereas that of illuminated algae didnot change obviously and thus lowered to about one third of thedark control. After an additional hour, the illuminated samplesshowed a slightly lower expression level of ipi, comparing withthe dark control. The expression of dxr increased to 2.2-fold ofthe dark control after the 30 min illumination; however, it alsodescended rapidly to less than 60% of the control in the next30 min, because of both the decrease of transcript abundanceof the treated algal cells and the increase of that of the controlones (Figure 2A). The light treatment also resulted in a mildbut constant induction of psy. The expression of this gene was2.7-fold greater than the control after illumination and 3.0-foldgreater after 30 min of being returned to the dark (Figure 2B).

All other genes studied showed a long-lasting induction. Theabundances of dxs, ggps, pds and lcyb were 2.2-, 2.0-, 4.1- and1.7-fold greater than the dark controls after the illumination, andcontinued to increase to 6.2-, 11.7-, 7.5- and 4.0-fold in the first30 min after returning to the dark, respectively (Figure 2A–C).

When compared with the other genes encoding enzymes,the induction of bchy was slower. Its transcript abundance wasonly 1.6-fold greater than the dark control after the 30 minillumination but approached an increase of about 11.0-fold inthe following 30 min, despite being in the dark (Figure 2C). bchywas the only gene in this study with the transcript abundancehigher in the treated cells than in the dark control after 90 minpostillumination.

The expression of CrOr also showed a drastic increase afterillumination (Figure 2C). It was induced to 3.5-fold over the darkcontrol during the first 30 min in light and increased to 14.0-foldduring the following 30 min in the dark.

Circadian rhythmic gene expression

We noticed that although the expression of all genes encodingenzymes was induced by short illumination, it would eventuallyreturn to a level that was close to the dark control (Figure 2).We thus inferred that the circadian clock might also be involvedin the transcriptional regulation of these genes, which showedlight induction.

One of the key characteristics of the circadian rhythm is thatgene expression maintains its free running pattern without atime cue. Therefore, we further entrained synchronized algalcells into constant light (LL) or constant dark (DD), respectively,and quantified the transcript abundances of genes encodingenzymes by qPCR, although they all showed diurnal fluctuationby RT-PCR under a 12 : 12 h light : dark regime (LD) (Figure 1).

Figure 2. Light-induction of gene expression.

Synchronized algal cells at the third hour in the dark were treated

with a 30 min illumination and sampled before (0) and at 30 min

(immediately after illumination), 60 min (30 min after returning to

the dark), and 120 min (90 min after returning to the dark) post-

treatment. Gene expression was studied by quantitative polymerase

chain reaction (qPCR) using the 2−�CT method. The transcript

abundance was normalized against a normalization factor that was

calculated using actin, α-tubulin, RACK1 and yptC1. The values

presented are the means ± SDs for three independent replicates.

872 Journal of Integrative Plant Biology Vol. 52 No. 10 2010

Our results found that when algal cells were entrained byeither LL or DD, only three genes, dxs, ggps and lcyb, continuedto fluctuate (Figure 3). Under LL, the transcripts of all threegenes reached their first maximal abundances about 4 h earlierthan their LD counterparts, although the peak abundances ofggps and lcyb were only 63% and 36% of those found inLD, respectively (Figure 3B, C). dxs did not show an obviousdecrease in its peak abundance under LL (Figure 3A).

The expression of these three genes was highly suppressedby DD. In the two continuous days studied, dxs showed a slowfluctuation every 24 h, with a maximal abundance of about21% of the peak in LD (Figure 3A). For ggps and lcyb, only tinypeaks were detected at the presumable early morning (L1 andL5 of LD, respectively); these levels were only at 9% and 7%of their LD counterparts, respectively, or which were roughlyequal to the lowest levels seen when the cells were growing inLD (Figure 3B, C).

Metabolite-driven gene expression

The continuous increase of ggps, lcyb and bchy transcriptabundance after the illumination (Figure 2B, C) raised thequestion of whether carotenoid metabolism could also beregulated by metabolic intermediates. We supplied C. rein-hardtii synchronized cells with 40 µmol/L IPP, GPP (geranylpyrophosphate), FPP (farnesyl pyrophosphate) and GGPP,respectively, and quantified the transcript abundances of genesencoding enzymes flanking each metabolite by qPCR. As in thelight induction study, the abundances were compared betweencells treated by the metabolic intermediate and the controlstreated by 40 µmol/L NH4Cl and sampled in parallel, instead ofbetween the same cells before and after the treatment.

Isopentenyl pyrophosphate was the first metabolite we ana-lyzed. As a product of DXS and DXR, and a substrate for IPI,40 µmol/L IPP suppressed the expression of dxs significantlyat both 1.5 h and 4.5 h (Figure 4A), revealing a key role ofDXS in IPP biosynthesis. ipi was induced by 2.0-fold at 1.5 hpost-treatment, which supports the notion that IPI functions infavor of DMAPP production (Sun et al. 1998). The supplementof GPP showed suppression of ipi and induction of ggps in thefirst 1.5 h (Figure 4B). It also suppressed the accumulation of dxrtranscripts at 4.5 h, and that of psy transcripts at both 1.5 and4.5 h (Figure 4B). Our work also showed a significant suppres-sion of dxs expression by 40 µmol/L FPP at both 1.5 and 4.5 h,and an induction of ggps by FPP after 4.5 h (Figure 4C). Thisresult agreed that Chlamydomoas uses only the MEP pathwayfor the biosynthesis of isoprenoids (Schwender et al. 2001).

When we treated C. reinhardtii cells with GGPP, we observedthe suppression of ggps at 1.5 and 4.5 h to be about one-thirdthat found in controls, as we had expected. However, therewas also a significant suppression of psy, pds, lcyb and bchy.The transcript abundances of all these four genes decreased

Figure 3. Circadian rhythm of enzyme gene expression.

Synchronized algal cells were entrained by either constant light

(LL) or constant dark (DD), with controls remaining in the normal

light/dark regime (LD). The bar under the sampling time shows the

light/dark shifting. The cells were sampled every 4 h and the gene

expression was studied by quantitative polymerase chain reaction

(qPCR) using the 2−�CT method. The transcript abundance was

normalized against a normalization factor that was calculated using

actin, α-tubulin, RACK1 and yptC1. The values presented are the

means ± SDs for three independent replicates.

Carotenoid Metabolism in Chlamydomonas 873

Figure 4. Gene expression induced by metabolic intermedi-

ates.

Synchronized algal cells were treated with 40 µmol/L isopentenyl

pyrophosphate (IPP) (A), geranyl pyrophosphate (GPP) (B) or

farnesyl pyrophosphate (FPP) (C) and sampled at 1.5 and 4.5 h

post-treatment. Cells treated with 40 µmol/L NH4Cl were parallel-

sampled as controls. Gene expression was studied by quantita-

tive polymerase chain reaction (qPCR) using the 2−�CT method.

to about half that of the control samples within 1.5 h, but thenreturned to a level higher than that of the controls at 4.5 hpost-treatment (data not shown).

To determine whether this different effect on gene expressionreflected a regulatory response or an experimental error, werepeated the experiment by adding an additional sampling timeat 3 h post-GGPP treatment. Although the expression levelsof lcyb and bchy were still significantly lower than those ofcontrols, they increased from 58% and 51% of the control levelto 79% and 71%, respectively, showing a substantial recovery.Furthermore, the abundances of the psy and pds transcriptswere no longer significantly lower than in the controls. At 4.5 h,the abundances of pds, lcyb and bchy were all significantlyhigher than in the controls (Figure 5), revealing a delayedpromotion of carotenoid metabolism.

Figure 5. Gene expression induced by 40 µmol/L geranylger-

anyl pyrophosphate (GGPP).

Synchronized algal cells were treated with 40 µmol/L GGPP and

sampled at 1.5, 3.0, and 4.5 h post treatment. Cells treated with

40 µmol/L NH4Cl were parallel-sampled as controls. Gene expres-

sion was studied by quantitative polymerase chain reaction (qPCR)

using the 2−�CT method. The transcript abundance was normalized

against a normalization factor calculated using actin, α-tubulin,

RACK1 and yptC1. The values presented are the means ± SDs for

three independent replicates. An asterisk (∗) indicates a significant

(P < 0.05) change in the transcript abundance.

←−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−The transcript abundance was normalized against the normalization

factor calculated using actin, α-tubulin, RACK1 and yptC1. The

values presented are the means ± SDs for three independent

replicates. An asterisk(∗) indicates a significant (P < 0.05) change

in the transcript abundance.

874 Journal of Integrative Plant Biology Vol. 52 No. 10 2010

There is the possibility that these pyrophosphate metabolicintermediates could be hydrolyzed into alcohols in the culturalmedium before uptake, and thus interfere with the effects ofGGPP treatment. To clarify this, we estimated the hydrolyzationof GGPP into geranylgeraniol in the growth medium, after algalcells have been removed by centrifugation, by high perfor-mance liquid chromatography (HPLC). Our result suggestedthat about 1.8% of GGPP supplied was hydrolyzed in themedium after a 3 h inoculation (data not shown). We alsocompared the effects of geranylgeraniol and GGPP treatments,both at 40 µmol/L for 3 h, on the steady-state level of ggps andpds transcripts by qPCR. The expression of both genes wassuppressed by geranylgeraniol, comparing with control cells(data not shown). GGPP did not show significant effects on ei-ther gene, although the transcript abundance of pds seemed tobe induced slightly, which agreed with our metabolite treatmentresults at 3 h.

Discussion

Carotenoid composition has been well-studied in many dif-ferent organisms from higher plants to microalgae, helpingus to understand how the metabolic pathway is regulated(Cunningham and Gantt 1998). Recent work has revealedthat Chlamydomonas and Arabidopsis thaliana are signifi-cantly different in terms of the number of genes encodingenzymes in the carotenoid biosynthetic pathway (Lohr et al.2005). For example, C. reinhardtii has only one copy of ggps,whereas Arabidopsis has 12 putative copies, with at least fivecharacterized to be functioning in plastids, mitochondria, andcytoplasm (Okada et al. 2000; Lohr et al. 2005). There is alsoonly one psy gene found in the C. reinhardtii genome (Tranet al. 2009). Fewer genes for the enzymes and the absenceof the mevalonate pathway make C. reinhardtii a simplifiedand straightforward system for studying metabolism at thegene level. However, multiple regulatory mechanisms mightbe imposed on a single gene and their coordination needs tobe studied in detail to understand the regulatory network.

From our results, it is obvious that light regulates all genesin the carotenoid pathway. When Chlamydomonas cells wereshifted into the dark for 3 h, the transcript abundances of allenzyme genes decreased substantially; however, they wereupregulated significantly by a 30 min illumination. dxs, dxrand ipi are involved in not only carotenoid biosynthesis butalso the production of other isoprenoids, and dxs also takespart in the biosynthesis of thiamin and pyridoxal (Lichtenthaler1999). These genes were immediately induced by illumination.However, when compared with dxr , which did not have a long-lasting induction, the transcripts of both dxs and ipi continuedto accumulate in the following 30 min despite the cells beingreturned to the dark. We assumed that there was an extended

requirement for substrate supply from downstream pathways.This hypothesis is supported by the slow induction of ggps,pds and lcyb. Both ggps and pds were not highly inducedimmediately after the illumination, but showed a significantaccumulation of their transcripts afterwards. Our work alsoconfirmed that both psy and pds can be upregulated by lightin C. reinhardtii, as has been found in higher plants and othermicroalgae (von Lintig et al. 1997; Wetzel and Rodermel 1998).

For carotenoid turnover, the transcripts of bchy were ex-pressed at a relatively high level after 90 min post-illumination.The increase in bchy transcript abundance might be a jointeffect of two mechanisms: first, xanthophyll biosynthesis isstimulated by the light signal, and second, turnover of thesynthesized carotenes, which were indeed not essential in thedark, is triggered by the substrate.

The circadian clock is believed to be involved in both de-velopmental and metabolic regulations (Wijnen and Young2006; Quail 2007). For most plants studied, DXS, GGPS andLCYB have been unanimously reported as key enzymes in theisoprenoid pathway. Here, our real-time quantification provedthat the genes for these three enzymes were also regulatedby the circadian clock in Chlamydomonas. When cells wereentrained by LL or DD conditions, the expression of thesethree genes continued to fluctuate. The expression level ofthese three genes in DD was much lower than that in LD andLL, suggesting a co-regulation by the internal circadian clockand external light signals. However, the influence of the cellcycle on gene expression could not be ruled out. When C.reinhardtii was subjected to DD, its cell division was reportedto be suspended for at least the first 48 h (Hwang and Herrin1994), which might also have led to the relatively low geneexpression found in our circadian work.

Our metabolite treatment analysis provided an additionalview on how carotenoid metabolism might be regulated atthe transcriptional level. Treatment with IPP, GPP and FPP,resulted in relatively small changes in mRNA levels that whilesignificant, were not suggestive of transcriptional responseto these metabolites. GGPP treatment gave larger and morerobust changes in gene expression with most genes showinga rapid (1.5 h of treatment) but transient decrease in mRNAlevels. Whether this response is indicative transcriptional sup-pression or another regulatory mechanism will require furtherstudies.

In addition to the biosynthesis, there has been evidenceshowing that carotenoid metabolism might be associated withplastid development in both microalgae and higher plants. InDunaliella bardawil, a green alga well studied for massiveβ-carotene accumulation, it was reported that formation ofsequestering structures controlled β-carotene biosynthesis andaccumulation in intra-plastidic lipid droplets (Rabbani et al.1998). Similar results in higher plants have also suggestedthat carotenoid biosynthesis and plastid protein expression

Carotenoid Metabolism in Chlamydomonas 875

are coordinated (Bohne and Linden 2002). Or is a newlyidentified gene well conserved in all plants, ranging fromalgae to flowering plants, that creates a metabolic sink toaccumulate carotenoid (Lu et al. 2006; Giuliano and Diretto2007; Cazzonelli and Pogson 2010). The expression of its C.reinhardtii homolog was found to fluctuate with other genesfor carotenoid metabolism, and to be co-expressed with pdsand lcyb in our study. This suggests that C. reinhardtii cellsmight also regulate their plastidic sequestration machinery forcarotenoid metabolism at the gene level. Further studies onhow CrOr functions might help to better understand the source-sink relationship for carotenoid metabolism.

A recent study on C. reinhardtii (Adams et al. 2008) reportedthat CrFtsZ1 was highly expressed around the third hour in thedark phase under a 14:10 h light : dark regime, while most algalcells divided at about the eighth hour. In our work, the CrFtsZ1transcripts also peaked between D1 and D5 (Figure 1), beforethe transcriptional levels of enzyme genes and CrOr startedto increase. It appeared that the expression of this gene wasassociated more with cell division machinery than the directregulation of carotenoid metabolism.

In general, our work here has generated a framework ofhow C. reinhardtii regulates its carotenoid metabolism at thetranscription level by the internal circadian clock, light and pos-sibly by metabolite sensing, and has preliminarily depicted thepossibility of the co-regulation of the genes for both enzymesand plastid development.

Materials and Methods

Algal strain and cultural conditions

The cell wall-deficient Chlamydomonas reinhardtii strain CC-3491 (cw15, mt-) was obtained from the ChlamydomonasCenter (Duke University, Durham, NC, USA). The cells weregrown in Tris-acetate-phosphate (TAP) medium (Harris 1989)with gentle shaking (∼100 rpm) under a moderate light intensityof 70 µE/m2 per s at 23 ◦C. The optical density at 730 nm wasmaintained at between 0.40 and 0.49 for logarithmic growthby continuous dilution with fresh medium. For all experiments,algal growth was synchronized by a 12:12 h light : dark (LD)photoperiod.

In the light induction experiment, algal cultures at the thirdhour in the dark phase (D3) were exposed to a 30 minillumination at 70 µE/m2 per s, with all other growth conditionsunchanged, and then returned to the dark. Cells were sampledimmediately before and after this illumination process, and alsoat 30 and 90 min post-illumination. Another batch of algal cellsthat were kept in the dark was sampled in parallel as controls.

For circadian rhythm analysis, algal cells were sampled every4 h for 2 days in constant light (LL) or constant dark (DD). Algalcells growing in LD were sampled in parallel for comparison.

To analyze the effect of the different metabolic intermediateson gene expression, cells at the logarithmic growth phasewere treated with IPP, GPP, FPP or GGPP (Tris-ammoniumsalt, Echelon Biosciences Inc., UT, USA) at 40 µmol/L. Cellswere sampled at 1.5 and 4.5 h post-treatment. For GGPP,we also harvested cells at 3.0 h after treatment. Cells treatedwith 40 µmol/L NH4Cl were used as controls and sampled inparallel.

To estimate the hydrolyzation of GGPP in the experiment,algal culture at logarithmic growth was centrifuged to precip-itate algal cells. 40 µmol/L of GGPP was added to the cell-free supernatant and inoculated at the growth condition for3 h. For the hydrolyzation control, 40 µmol/L of GGPP wastreated with 20 units of shrimp alkaline phosphatase (Kelleret al. 1998) in 50 mmol/L Tris-HCl, pH 9.0 and 10 mmol/LMgCl2. The produced geranylgeraniol was quantified by highperformance liquid chromatography (HPLC) with SpherisorbODS2 reversed-phase column (5 µm, 4.6 × 250 mm, Waters,Milford, MA, USA), using acetonitrile and 20 mmol/L ammoniumacetate (80:20) as the mobile phase at 1 mL/min. Absorbanceat 210 nm was monitored. Purchased geranylgeraniol (EchelonBiosciences Inc.) was used as a standard. In addition tothis, 40 µmol/L of geranylgeraniol was also used to treat C.reinhardtii, in parallel with GGPP, for 3 h to understand itspossible effects on the expression of pds and ggps. Cells wereharvested as mentioned above.

For all experiments, algal cells were collected in triplicate bycentrifugation at 10 000 g for 5 min, and the cell pellets werefrozen in liquid nitrogen and stored at −80 ◦C until use.

RNA isolation, RT-PCR and gene identification

The total RNA was isolated using Trizol reagent (Invitrogen,Carlsbad, CA, USA) from the cell pellet following the man-ufacturer’s instructions. Five micrograms of total RNA werereverse-transcribed by SuperScript III Reverse Transcriptase(Invitrogen), according to the manufacturer’s instructions.Gene-specific primers were designed to amplify fragments ofapproximately 100–350 bp in length for the C. reinhardtii dxs,dxr , ipi, ggps, psy, pds, lcyb, and bchy genes in the carotenoidmetabolic pathway, for CrFtsZ1 (Wang et al. 2003) and CrOr(Lu et al. 2006) for plastid development and carotenoid accu-mulation, and for actin (Sangiorgio et al. 2004; Yehudai-Resheffet al. 2007), α-tubulin (Balczun et al. 2005), RACK1 (Muset al. 2007), and yptC1 (Lake and Willows 2003) as candidatereference genes. A list of genes, GenBank accession numbers,and forward and reverse primers is provided in Table 1. ThePCR system used was that recommended by TaKaRa (Dalian,China) for rTaq with 2 µL of the first strand cDNA as thetemplate for each sample. The thermal profile was one cycle at95 ◦C for 5 min, followed by 35 cycles at 94 ◦C for 1 min, 60 ◦Cfor 45 s, and 72 ◦C for 45 s, and a further cycle at 72 ◦C for

876 Journal of Integrative Plant Biology Vol. 52 No. 10 2010

5 min. Dimethylsulfoxide (DMSO) was added to the reactionsystem to a final concentration of 5% (v/v) to overcome thehigh GC content of the templates. The fragments amplifiedwere resolved on a 2% agarose gel, recovered, and thensubcloned into pGEM-T vectors (Promega, Madison, WI, USA)and sequenced to prove the correctness of the amplificationtargets, following common protocols (Sambrook et al. 1989).

Quantification of transcript abundance

Reverse transcription-polymerase chain reaction was used topreliminarily estimate the diurnal variation of the steady-statetranscript abundances of the genes mentioned above. Thereaction system was as described above, and the numberof amplification cycles varied with different genes to keep theamplification in the linear phase. Equal loading of the templateswas normalized using actin as a reference.

For the accurate quantification of gene expression, qPCRwas carried out on a TP800 PCR Thermal Cycler Dice(TaKaRa) using EvaGreen (Biotium, Hayward, CA, USA) (Ihriget al. 2006). The reaction system contained 2 µL of 2.5 mmol/LdNTPs, 1 µL DMSO, 1 µL of each of the primers at 10 µmol/L,1 µL 20 × EvaGreen, 2.5 units of rTaq (TaKaRa), and 1 µL ofcDNA, which represented 50 ng of total RNA, in a final volumeof 20 µL. The thermal profile was 95 ◦C for 3 min, followedby 40 cycles of 94 ◦C for 20 s and 60 ◦C for 30 s. For everytreatment, the PCR assay was carried out in triplicate for eachof the triplicate samples. A melting curve program was used toconfirm the presence of only the specific amplicon according tothe Tm expected for each gene amplification.

The results were analyzed by a TP800 Thermal CyclerDice Real Time System (TaKaRa). The threshold cycle (CT)values were automatically determined by the TP800 software(TaKaRa).

Data analysis

For gene expression analysis by qPCR, it is critical to adopt areference gene for normalization, which should be constitutivelyexpressed. However, such a gene might not exist, especiallyfor unicellular algae, in which the expression of most geneskeeps changing. Thus, we followed the strategy described byVandesompele et al. (2002). Briefly, four candidate housekeep-ing genes were selected from previous reports; these genespreviously served as internal controls for the quantificationassays in C. reinhardtii: actin, α-tubulin, RACK1, and yptC1.The normalization factor (NF) was calculated by taking thegeometric mean of the two least variable reference genes asdetermined by GeNorm script (Version 3.5) (Vandesompeleet al. 2002) and served as a reference in our study. Theexpression values were calculated according to the 2−�CT

method (for each gene, �CT = CT,Gene − CT,NF) (Livak andSchmittgen 2001).

The relative gene expression under different treatmentswas analyzed by the nonparametric Wilcoxon test to deter-mine whether apparent differences were statistically significant(Yuan et al. 2006).

Acknowledgements

The authors are grateful to Dr Shu-Wen Wan for help withthe statistic analysis. This project was supported by theState Key Basic Research and Development Plan of China(2007CB108800) and the National Natural Science Foundationof China (30771167 and 90817002). TH Sun was also supportedby the National Undergraduate Innovation Program and theNational Natural Science Foundation of China (J0730641).

Received 11 Apr. 2010 Accepted 18 Aug. 2010

References

Adams S, Maple J, Møller S (2008) Functional conservation of the MIN

plastid division homologues of Chlamydomonas reinhardtii. Planta

227, 1199–1211.

Albrecht M, Sandmann G (1994) Light-stimulated carotenoid biosyn-

thesis during transformation of maize etioplasts is regulated by

increased activity of isopentenyl pyrophosphate isomerase. Plant

Physiol. 105, 529–534.

Balczun C, Bunse A, Nowrousian M, Korbel A, Glanz S, Kuck

U (2005) DNA macroarray and real-time PCR analysis of two

nuclear photosystem I mutants from Chlamydomonas reinhardtii

reveal downregulation of Lhcb genes but different regulation of Lhca

genes. Biochim. Biophys. Acta 1732, 62–68.

Bohne F, Linden H (2002) Regulation of carotenoid biosynthesis

genes in response to light in Chlamydomonas reinhardtii. Biochim.

Biophys. Acta 1579, 26–34.

Cazzonelli CI, Pogson BJ (2010) Source to sink: regulation of

carotenoid biosynthesis in plants. Trends Plant Sci. 15, 266–274.

Chamovitz D, Sandmann G, Hirschberg J (1993) Molecular and

biochemical characterization of herbicide-resistant mutants of

cyanobacteria reveals that phytoene desaturation is a rate-limiting

step in carotenoid biosynthesis. J. Biol. Chem. 268, 17348–17353.

Cunningham FX (2002) Regulation of carotenoid synthesis and accu-

mulation in plants. Pure Appl. Chem. 74, 1409–1417.

Cunningham FX, Gantt E (1998) Genes and enzymes of carotenoid

biosynthesis in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49,

557–583.

Disch A, Schwender J, Muller C, Lichtenthaler HK, Rohmer M

(1998) Distribution of the mevalonate and glyceraldehyde phos-

phate/pyruvate pathways for isoprenoid biosynthesis in unicellular

Carotenoid Metabolism in Chlamydomonas 877

algae and the cyanobacterium Synechocystis PCC 6714. Biochem.

J. 333, 381–388.

Estevez JM, Cantero A, Reindl A, Reichler S, Leon P (2001)

1-Deoxy-D-xylulose-5-phosphate synthase, a limiting enzyme for

plastidic isoprenoid biosynthesis in plants. J. Biol. Chem. 276,

22901–22909.

Francis GW, Strand LP, Lien T, Knutsen G (1975) Variations in the

carotenoid content of Chlamydomonas reinhardii throughout the cell

cycle. Arch. Microbiol. 104, 249–254.

Frank HA, Cogdell RJ (1996) Carotenoids in photosynthesis. Pho-

tochem. Photobiol. 63, 257–264.

Fraser PD, Truesdale MR, Bird CR, Schuch W, Bramley PM (1994)

Carotenoid biosynthesis during tomato fruit development. Evi-

dence for tissue-specific gene expression. Plant Physiol. 105, 405–

413.

Giuliano G, Diretto G (2007) Of chromoplasts and chaperones. Trends

Plant Sci. 12, 529–531.

Harris EH (1989) The Chlamydomonas Sourcebook. Academic Press,

San Diego, CA.

Harris EH (2001) Chlamydomonas as a model system. Annu. Rev.

Plant Physiol. Plant Mol. Biol. 52, 363–406.

Hu Y, Chen ZW, Liu WZ, Liu XL, He YK (2008) Chloroplast divi-

sion is regulated by the circadian expression of FTSZ and MIN

genes in Chlamydomonas reinhardtii. Eur. J. Phycol. 43, 207–

215.

Hwang S, Herrin DL (1994) Control of lhc gene transcription by the

circadian clock in Chlamydomonas reinhardtii. Plant Mol. Biol. 26,

557–569.

Ihrig J, Lill R, Muhlenhoff U (2006) Application of the DNA-specific

dye EvaGreen for the routine quantification of DNA in microplates.

Anal. Biochem. 359, 265–267.

Jacobshagen S, Johnson CH (1994) Circadian rhythms of gene ex-

presison in Chlamydomonas reinhardtii: circadian cycling of mRNA

abundance of cab II, and possibly of β-tubulin and cytochrome c.

Eur. J. Cell Biol. 64, 142–152.

Jung KH, Dardick C, Bartley LE, Cao P, Phetsom J, Canlas P, Seo

YS, Shultz M, Ouyang S, Yuan Q, Frank BC, Ly E, Zheng L, Jia

Y, Hsia AP, An K, Chou HH, Rocke D, Lee GC, Schnable PS,

An G, Buell CR, Ronald PC (2008) Refinement of light-responsive

transcript lists using rice oligonucleotide arrays: evaluation of gene-

redundancy. PLoS ONE 3, e3337.

Keller Y, Bouvier F, D’Harlingue A, Camara B (1998) Metabolic

compartmentation of plastid prenyllipid biosynthesis. Evidence for

the involvement of a multifunctional geranylgeranyl reductase. Eur.

J. Biochem. 251, 413–417.

Lake V, Willows RD (2003) Rapid extraction of RNA and analysis of

transcript levels in Chlamydomonas reinhardtii using real-time RT-

PCR: magnesium chelatase chlH, chlD and chlI gene expression.

Photosynth. Res. 77, 69–76.

Lange BM, Ghassemian M (2003) Genome organization in Ara-

bidopsis thaliana: a survey for genes involved in isoprenoid and

chlorophyll metabolism. Plant Mol. Biol. 51, 925–948.

Lemaire SD, Stein M, Issakidis-Bourguet E, Keryer E, Benoit VV,

Pineau B, Gerard-Hirne C, Miginiac-Maslow M, Jacquot JP

(1999) The complex regulation of ferredoxin/thioredoxin-related

genes by light and the circadian clock. Planta 209, 221–229.

Lichtenthaler HK (1999) The 1-deoxy-D-xylulose-5-phosphate path-

way of isoprenoid biosynthesis in plants. Annu. Rev. Plant Physiol.

Plant Mol. Biol. 50, 47–65.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2−�CT method.

Methods 25, 402–408.

Lohr M, Im CS, Grossman AR (2005) Genome-based examination

of chlorophyll and carotenoid biosynthesis in Chlamydomonas rein-

hardtii. Plant Physiol. 138, 490–515.

Lu S, Li L (2008) Carotenoid metabolism: biosynthesis, regulation, and

beyond. J. Integr. Plant Biol. 50, 778–785.

Lu S, Van Eck J, Zhou X, Lopez AB, O’Halloran DM, Cosman

KM, Conlin BJ, Paolillo DJ, Garvin DF, Vrebalov J, Kochian

LV, Kupper H, Earle ED, Cao J, Li L (2006) The cauliflower or

gene encodes a DnaJ cysteine-rich domain-containing protein that

mediates high levels of β-carotene accumulation. Plant Cell 18,

3594–3605.

Matsuo T, Okamoto K, Onai K, Niwa Y, Shimogawara K, Ishiura M

(2008) A systematic forward genetic analysis identified components

of the Chlamydomonas circadian system. Genes Dev. 22, 918–

930.

Moehs CP, Tian L, Osteryoung KW, DellaPenna D (2001) Analysis

of carotenoid biosynthetic gene expression during marigold petal

development. Plant Mol. Biol. 45, 281–293.

Mus F, Dubini A, Seibert M, Posewitz MC, Grossman AR (2007)

Anaerobic acclimation in Chlamydomonas reinhardtii: anoxic gene

expression, hydrogenase induction, and metabolic pathways. J.

Biol. Chem. 282, 25475–25486.

Okada K, Saito T, Nakagawa T, Kawamukai M, Kamiya Y (2000)

Five geranylgeranyl diphosphate synthases expressed in different

organs are localized into three subcellular compartments in Ara-

bidopsis. Plant Physiol. 122, 1045–1056.

Quail PH (2007) Phytochrome-regulated gene expression. J. Integr.

Plant Biol. 49, 11–20.

Rabbani S, Beyer P, von Lintig J, Hugueney P, Kleinig H (1998)

Induced β-carotene synthesis driven by triacylglycerol deposition in

the unicellular alga Dunaliella bardawil. Plant Physiol. 116, 1239–

1248.

Sager R, Zalokar M (1958) Pigments and photosynthesis in a

carotenoid-deficient mutant of Chlamydomonas. Nature 182, 98–

100.

Sambrook J, Fritsch EE, Maniatis T (1989) Molecular Cloning, A

Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press,

New York.

Sangiorgio L, Strumbo B, Tenchini ML, Malcovati M, Ronchi S, Si-

moni T (2004) A novel Chlamydomonas reinhardtii gene potentially

encoding a proline-, glycine-, and tyrosine-rich protein (PGYRP).

Plant Sci. 167, 519–526.

878 Journal of Integrative Plant Biology Vol. 52 No. 10 2010

Schwender J, Gemunden C, Lichtenthaler HK (2001) Chloro-

phyta exclusively use the 1-deoxyxylulose 5-phosphate/2-C-

methylerythritol 4-phosphate pathway for the biosynthesis of iso-

prenoids. Planta 212, 416–423.

Simkin AJ, Underwood BA, Auldridge M, Loucas HM, Shibuya K,

Schmelz E, Clark DG, Klee HJ (2004) Circadian regulation of the

PhCCD1 carotenoid cleavage dioxygenase controls emission of β-

ionone, a fragrance volatile of petunia flowers. Plant Physiol. 136,

3504–3514.

Simkin AJ, Zhu C, Kuntz M, Sandmann G (2003) Light-dark regu-

lation of carotenoid biosynthesis in pepper (Capsicum annuum)

leaves. J. Plant Physiol. 160, 439–443.

Sun Z, Cunningham FX, Gantt E (1998) Differential expression of two

isopentenyl pyrophosphate isomerases and enhanced carotenoid

accumulation in a unicellular chlorophyte. Proc. Natl. Acad. Sci.

USA 95, 11482–11488.

Takahashi S, Kuzuyama T, Watanabe H, Seto H (1998) A 1-deoxy-

D-xylulose 5-phosphate reductoisomerase catalyzing the formation

of 2-C-methyl-D-elythritol 4-phosphate in an alternative nonmeval-

onate pathway for terpenoid biosynthesis. Proc. Natl. Acad. Sci.

USA 95, 9879–9884.

Tanaka Y, Sasaki N, Ohmiya A (2008) Biosynthesis of plant pig-

ments: anthocyanins, betalains and carotenoids. Plant J. 54, 733–

749.

Tran D, Haven J, Qiu WG, Polle J (2009) An update on carotenoid

biosynthesis in algae: phylogenetic evidence for the existence of

two classes of phytoene synthase. Planta 229, 723–729.

Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N,

De Paepe A, Speleman F (2002) Accurate normalization of real-

time quantitative RT-PCR data by geometric averaging of multiple

internal control genes. Genome Biol. 3, research0034.0031-0034.

0011.

von Lintig J, Welsch R, Bonk M, Giuliano G, Batschauer A, Hans

K (1997) Light-dependent regulation of carotenoid biosynthesis

occurs at the level of phytoene synthase expression and is mediated

by phytochrome in Sinapis alba and Arabidopsis thaliana seedlings.

Plant J. 12, 625–634.

Wang D, Kong D, Wang Y, Hu Y, He Y, Sun J (2003) Isolation of two

plastid division ftsZ genes from Chlamydomonas reinhardtii and its

evolutionary implication for the role of FtsZ in plastid division. J.

Exp. Bot. 54, 1115–1116.

Wetzel CM, Rodermel SR (1998) Regulation of phytoene desaturase

expression is independent of leaf pigment content in Arabidopsis

thaliana. Plant Mol. Biol. 37, 1045–1053.

Wijnen H, Young MW (2006) Interplay of circadian clocks and

metabolic rhythms. Annu. Rev. Genet. 40, 409–448.

Yehudai-Resheff S, Zimmer SL, Komine Y, Stern DB (2007) Inte-

gration of chloroplast nucleic acid metabolism into the phosphate

deprivation response in Chlamydomonas reinhardtii. Plant Cell 19,

1023–1038.

Yeum KJ, Russell RM (2002) Carotenoid bioavailability and biocon-

version. Annu. Rev. Nutr. 22, 483–504.

Yuan JS, Reed A, Chen F, Stewart CN (2006) Statistical analysis of

real-time PCR data. BMC Bioinformatics 7, 85.

Zulak KG, Bohlmann J (2010) Terpenoid biosynthesis and specialized

vascular cells of conifer defense. J. Integr. Plant Biol. 52, 86–97.

(Co-Editor: Dean DellaPenna)