Chemokine receptor 5 (CCR5) is one of the twocoreceptors that are utilized by the human immuno�deficiency virus (HIV) to enter the cell. ССR5Δ32 adeletion variant of the CCR5 gene, has been found inthe Caucasian population and codes for a nonfunc�tional protein [1, 2]. Homozygous carriers ofССR5Δ32 are resistant to infection with the R5�tropicvirus, and heterozygosity for the variant correlateswith a slower disease progression in HIV�infectedpatients [1, 3–5], while no pathology associated withthe CCR5 mutation has been observed in its carriers.The findings provide a basis for developing drugs toinhibit CCR5, in particular, via gene therapy.
The efficacy and safety of CCR5 gene silencing hasbeen demonstrated upon bone marrow transplanta�tion from a ССR5Δ32/Δ32 donor to a HIV�infectedpatient. The patient did not display any clinical orvirological evidence of HIV infection for more than3.5 years after the transplantation had been performedand highly active antiretroviral therapy terminated [6].This first case of a documented cure of the disease [6]has given new impetus to developing methods of HIVtreatment based on the silencing of the CCR5 gene.
Various technologies have been utilized over thepast years to inhibit the CCR5 expression at various
Abbreviations: HIV, human immunodeficiency virus; amiRNA,artificial microRNA; miRNA, microRNA; shRNA, short hair�pin RNA; siRNA, short interfering RNA.
steps from the gene to the protein. In particular, thetechnologies include RNA interference, mRNAcleavage with ribozymes, CCR5 neutralization withintracellular antibodies, and gene inactivation viadeletions introduced using site�specific nucleases [7].Short interfering RNAs (siRNAs) provide one of themost efficient tools for gene silencing. Stable siRNAsynthesis in the cell can be achieved via integrationinto the chromosome and subsequent expression ofshort hairpin RNAs (shRNAs) whose processingyields siRNAs. Expression of shRNAs directed toCCR5 was shown to substantially decrease the CCR5amount on the cell surface and to confer HIV resis�tance on cells [8–11].
Gene silencing requires high�level shRNA expres�sion, which can be achieved with RNA polymerase IIIpromoters. However, an excess of shRNAs or theirprecursors is toxic for the cell. The cytotoxicity possi�bly occurs because protein complexes involved inRNA interference are saturated and because shRNAscompete with endogenous miRNAs, distorting theregulation of genes [12, 13]. A decrease in shRNAexpression level, for instance, by using a weak pro�moter alleviates the toxicity, but the efficiency of inhi�bition also decreases in this case [10].
An alternative way to reduce the cytotoxicity is touse the so�called artificial microRNAs (amiRNAs),which are structurally similar to endogenous primarymicroRNAs (pri�miRNAs), but have a siRNAdirected to the target gene in place of the native hair�
Downregulation of Human CCR5 Gene Expression with Artificial microRNAs
D. V. Glazkovaa, A. S. Vetchinovaa, E. V. Bogoslovskayaa, Y. A. Zhoginaa, M. L. Markelovb, and G. A. Shipulina
a Central Research Institute for Epidemiology, Moscow, 111123 Russia;e�mail: [email protected]
b Institute of Occupational Health, Russian Academy of Medical Sciences, Moscow, 105275 RussiaReceived November 21, 2012; in final form, December 27, 2012
Abstract—Chemokine receptor 5 (CCR5) is one of the two coreceptors that are utilized by the human immu�nodeficiency virus (HIV) to enter the cell. CCR5 inactivation is considered to be a promising approach toHIV therapy, including gene therapy. RNA interference provides a powerful tool to regulate gene expressionand may be utilized to knockdown the CCR5 gene. Three artificial microRNAs (amiRNAs) directed to thehuman CCR5 gene were constructed, and their silencing activity was tested in indicator cells, which werederived from the HT1080 human cell line. A multiplexing of two or more amiRNAs in one transcript wasshown to enhance the CCR5 gene silencing. A 95% reduction of CCR5 expression was achieved with the mostefficient amiRNA combination.
DOI: 10.1134/S0026893313030035
Keywords: human CCR5, microRNA, RNA interference, HIV infection, lentiviral vectors, HT1080, indica�tor cells
UDC 577.218;57.085.23
CELL MOLECULAR BIOLOGY
420
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
GLAZKOVA et al.
pin. Like with cellular miRNAs, a processing of theprimary amiRNA transcript starts in the nucleus andinvolves cleavage by the Drosha endonuclease, leadingto miRNA precursors with a hairpin structure. Thehairpin is transferred into the cytoplasm, affected byDicer, and included into the RNA�induced silencingcomplex (RISC) [14–16]. Drosha�dependent cleav�age is bypassed in the case of shRNA, and this circum�stance is the main difference between shRNA andamiRNA processing. Another important difference isthat amiRNA expression in the cell leads to low, ifdetectable, toxicity, as was demonstrated in manyexperiments, including those in vivo [17, 18]. Toexplain the lack of toxicity, Drosha has been assumedto limit the hairpin RNA production, thus preventingthe competition between amiRNA and endogenousmiRNAs for export from nucleus, and to increase theprocessing efficiency [13].
Like with endogenous miRNAs, amiRNA expres�sion can be regulated by RNA polymerase II promot�ers; i.e., it is possible to employ tissue�specific or reg�ulated promoters and thereby to improve the safety ofthe constructs [19, 20]. Several amiRNAs can bearranged consecutively under the control of one pro�moter; these polycistronic amiRNAs resemblemiRNA clusters, which are common in the humangenome. A combination of several amiRNAs in onetranscript has been shown to improve their function[21, 22].
The objectives of this work were to constructamiRNAs directed to the CCR5 gene and to comparetheir efficiency with known shRNAs in a continuouscell line.
EXPERIMENTAL
Plasmid construction. To obtain a shRNA�codingDNA sequence, the oligonucleotides TTTCAGATCT�GTGTCAAGTCCAATCTATGACATCAATTATAT�GTGAATTGATGTCAT and CAACAAGCTTCTA�GAAAAAAAGTGTCAAGTCCAATCTATGACATC�AATTCACATATA were annealed with each other,and the ends were filled in with Taq DNA polymerase(Fermentas, Lithuania). The product was cloned inpGEM�T (Promega, United States). The shRNA�coding fragment was excised from the vector at theBglII–HindIII sites and subcloned in pRNA�U6.1/Neo and pRNA�H1/Neo (Genscreen, Australia).The EcoRI–XbaI fragments, which contained thepromoter and the shRNA gene, were excised from theresulting plasmids pU6�CCR5 shRNA and pH1�CCR5 shRNA and inserted in the pLVX�Puro lentivi�ral vector (Clontech, United States). The resultingvectors U6�sh13lg and H1�sh13lg contained theexpression cassettes in a direct orientation. To obtainthe U6�sh13lg rev and H1�sh13lg rev vectors with theopposite cassette orientation, the fragments contain�ing the promoter and the shRNA gene were excised at
the XbaI–BglII sites and cloned into the BamHI–ClaI sites of pLVX�Puro.
Constructs coding for amiRNAs were obtainedusing a BLOCK�iT polII miR RNAi kit (Invitrogen).Oligonucleotides were designed according to theamiRNA sequences shown in Fig. 1 as recommendedby the manufacturer. To obtain mic13, mic13lg, andmic909, the oligonucleotides were annealed with eachother in a pairwise manner. The resulting double�strandedDNA fragments were cloned in pcDNA 6.2�GW/miR(Invitrogen). To combine several miRNAs in tandem,the DNA fragments coding for individual amiRNAswere obtained as the BglII–SalI fragments of the vec�tors and ligated into the BamHI–SalI sites of pcDNA6.2�GW/miR+micX, which contained a micXsequence coding for one or more amiRNAs. Theresulting plasmids expressed various combinations oftwo, three, or four amiRNAs (Fig. 2). To transfer theconstructs into a lentiviral vector, the plasmids weredigested with BglII–SalI, and the fragments codingfor individual amiRNAs or their combinations werecloned into the BamHI–XhoI sites of pLVX�Puro.The resulting plasmids were designated as mic13,mic13lg, mic909, mic13×2, mic13lg×2, mic13lg×3,mic13+909, and mic(13+909)×2 (Fig. 2). The origi�nal empty vector pLVX�Puro was used as a control inall experiments.
To obtain plasmids expressing the CCR5 gene or therecombinant CCR5�EGFP gene, the CCR5 sequencewas amplified using the primers 5'�GAACAAGATG�GATTATCAAGTGTCAAGTCC�3' and 5'�CACT�TGAGTCCGTGTCACAAGCCC�3' from human DNA.After reamplification with the primers 5'�TTTTA�AGCTTCGCCACCATGGATTATCAAGTGTCAAG�TC�3' and 5'�ATATGCGGCCGTCCGTGTCA�CAAGCCCACAG�3' or 5'�TTTTAAGCTTCGC�CACCATGGATTATCAAGTGTCAAGTC�3' and 5'�ATATGGATCCAAGCCCACAGATATTTCC�3', theproducts were inserted into the HindIII–BamHI orHindIII–NotI sites of pEGFP�N1 (Clontech). Theresulting plasmids were designated as pCMV�CCR5�EGFP and pCMV�CCR5, respectively. Synonymousnucleotide substitutions were introduced into thesequence of CCR5 gene so that they affected the targetsequence of two amiRNA, mic13 and mic13lg. Forthis purpose, we introduced two mutations in the posi�tions 21 (Т → С) and 24 (А → G) of the CCR5 codingregion of pCMV�CCR5 (Fig. 3). The resulting plas�mid was designated as pCMV�CCR5mut. The muta�tions were introduced using a QuickChange II XL kitas recommended by Stratagene.
The structures of all of the sequences constructedwere verified by sequencing. Plasmids intended for celltransfection were isolated using a QIAGEN PlasmidMaxi kit.
Cell lines. HT1080 human fibrosarcoma cells weregrown in MEM supplemented with 10% fetal bovineserum (FBS), 100 units/mL penicillin, and 100 μg/mLstreptomycin. HEK 293T human embryonic kidney
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
DOWNREGULATION OF HUMAN CCR5 GENE EXPRESSION 421
cells were cultured in DMEM supplemented with 10%FBS, 100 units/mL penicillin, 100 μg/mL streptomy�cin, and 1% nonessential amino acids (Invitrogen).
Construction of indicator cell lines expressing CCR5or CCR5�EGFP. HT1080 cells were transfected withpCMV�CCR5�EGFP, pCMV�CCR5, or pCMV�CCR5mut and LentiphosTMHT (Clontech). The plas�mids were linearized before transfection. Cells withstable CCR5 expression were selected in the presenceof 400 μg/mL G418.
Lentiviral vector production. Lentiviral particleswere obtained using HEK 293T cells. Cells were grownin 75�cm2 culture flasks. Cell transfection was carriedout using 4.5 μg of a lentiviral vector, 22 μL of a Lenti�X HT packaging mixture (Clontech), and the Turbo�fect transfection reagent (Fermentas). Cells were cul�tured in serum�free OptiMEM (Invitrogen) duringand after transfection. The medium was replaced witha fresh portion one day after transfection. The mediumcontaining vector particles was collected 60 h after
(a)
(b)
sh13
sh13lg
sh909
5'3'
mic13lg
mic13
mic909
miR155
5'� and 3'�flanking regions of amiRNAs and miR155 Stem regioncontaining siRNA
5'
3'
5'
3'
Fig. 1. Structures and sequences of shRNA and miRNAs. (a) The shRNA sequences used as a basis for amiRNA design [11]. ThesiRNA region complementary to CCR5 is shadowed. (b) Structures and sequences of the amiRNA constructed and the originalmouse miR155. Sequences complementary to the target genes are shadowed.
422
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
GLAZKOVA et al.
transfection and centrifuged at 3000 × g for 15 min toremove cell debris. The supernatant was filteredthrough a 0.45�μm membrane and frozen at –70°С.To measure the titer of lentiviral particles, tenfolddilutions of a preparation were used for transductionof HT1080 cells, and colony�forming units (CFUs)were counted after selection in the presence of an anti�biotic.
Cell transduction with lentiviral particles. HT1080cells expressing pCMV�CCR5�EGFP, pCMV�CCR5,or pCMV�CCR5mut were plated onto a 24�well plate1 day before transduction. On the transduction day(day 1), the wells were supplemented with vector par�ticles in the amount corresponding to a multiplicity ofinfection of 10–1 particles per cell. Cells were culturedwith lentiviral vectors in the presence of polybreneovernight. The culture medium was replaced with afresh portion on day 2, and the medium was supple�mented with 1.5 μg/mL puromycin on day 3. After14 days of selection, cells were tested for chimericCCR5�EGFP amount by flow cytometry or for thelevel of CCR5�EGFP, CCR5mut, or CCR5 mRNA byquantitative RT–PCR. Experiments were performed
in duplicate or triplicate, as indicated in figure cap�tions.
Flow cytometry. Cells were washed twice with PBSand fixed with 2% formamide. The mean fluorescenceintensity (MFI), hereafter referred to as fluorescenceintensity, of CCR5�EGFP was measured using aCounter EPICSXL�MCL flow cytometer (BeckmanCoulter).
Quantitative RT–PCR. To measure the CCR5mRNA level, nucleic acids were extracted from a cellsuspension as described by Boom et al. [23]. Theextract was digested with DNase (Fermentas) andused for one�round reverse transcription and subse�quent real�time PCR, which were run on a RotorGene3000 instrument (Corbett Research, Australia). Theβ�glucuronidase gene was used as an internal controland as a reference to normalize the quantitativeresults.
Statistical analysis. Each experiment was carriedout at least in duplicate. The results are given as anarithmetic mean with a standard error. The signifi�cance of difference was assessed using Student’s inde�
U6�sh13lg sh13lg
sh13lg
LTR ψ RRE cPPT MCS pPGK Puro wpre
U6
H1
CMV
mic13lg
mic909
H1�sh13lg
U6�sh13lg rev
H1�sh13lg rev
mic13 + 909
mic13 × 2
mic13lg × 2
mic13lg × 3
mic(13 + 909) × 2
LTR
U6
H1
CMV
CMV
CMV
CMV
CMV
CMV
CMV
mic13 mic13
mic13
mic13 mic13
mic13 mic13
mic13lg
mic13lg
mic13lg mic13lg
mic13lg
mic13lg
mic909
mic909
mic909 mic909
sh13lg
sh13lg
Fig. 2. Lentiviral vectors expressing amiRNAs and shRNA. A cassette containing the U6 or H1 RNA polymerase III promoterand sh13lg was inserted in the pLVX�Puro lentiviral vector in a direct or reverse orientation. We constructed three vectors express�ing individual amiRNAs and five vectors expressing amiRNA combinations.
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
DOWNREGULATION OF HUMAN CCR5 GENE EXPRESSION 423
pendent t�test. The difference was considered signifi�cant at p < 0.05.
RESULTS AND DISCUSSION
Construction of Vectors Coding for shRNA or amiRNA
The siRNAs against the CCR5 gene have beendesigned in several studies [8, 9, 11, 24]. Some of thesiRNAs have been designed also as shRNA genes,whose expression yields the siRNAs in the cell. Basedon the published data, we chose three siRNAs—CAUAGAUUGGACUUGACAC, AAUUGAUGU�CAUAGAUUGGACUUGACAC, and UAAGAG�GUAGUUUCUGAAC—whose efficiency had beendemonstrated both in the experiments with siRNAsand with corresponding shRNA [11]. Then, wedesigned the amiRNAs directed to the same generegions as the original siRNAs. The design was basedon the MiR155 mouse endogenous miRNA sequence(GenBank accession no. NR_029565.1). We gener�ated three amiRNAs whose 5', 3', and loop regionswere identical to those in MiR155, while the stemregion was formed by a siRNA of interest and its com�plementary sequence (Fig. 1). A 2�nt deletion was
introduced in the complementary sequence to pro�duce a hairpin similar in secondary structure toMiR155. The resulting amiRNAs were designated asmic13, mic13lg, and mic909 according to the comple�mentary nucleotide numbering in the CCR5 genesequence (Fig. 3). Two of the amiRNAs, mic13 andmic13lg, were directed to the same gene region anddiffered in length (22 and 29 bp) (Figs. 1, 3). Thisallowed us to estimate the effect of the hairpin lengthon the efficiency of gene silencing. The resultingamiRNA�coding sequences were cloned in the pLVX�Puro lentiviral vector (Clontech) under the control ofthe CMV promoter.
As a positive control, we used the shRNA (sh13lg)described in [11] and directed to the same CCR5region as mic13lg. The U6�sh13lg and H1�sh13lgexpression cassettes were constructed so that theshRNA�coding sequence was under the control of theU6 or H1 human RNA polymerase III promoter,respectively. The cassettes were cloned in a direct orreverse orientation in pLVX�Puro, whose CMV pro�moter was preliminarily deleted (Fig. 2).
mic13 target seq
mic13lg, sh13lg target seqMet Asp Tyr
1
61121131241301361421481541601661721781841
901961
1021
mic909 target seq
~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~
Fig. 3. Human CCR5 coding sequence with the shRNA and amiRNA targets. The three first CCR5 codons and the correspondingamino acid residues are indicated. The target sequences of mic13lg and mic909 are shadowed. The mic13 target is shown in boldand underlined. The two nucleotides mutated in CCR5mut are framed; the new nucleotides are shown at the bottom.
424
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
GLAZKOVA et al.
Construction of Indicator Cell Lines
To study the effect of shRNAs and amiRNAs onCCR5 expression, we constructed the indicator cellline HT1080�CCR5�EGFP, which expressed chi�meric CCR5�EGFP. HT1080 cells were transfectedwith a plasmid carrying the CCR5�EGFP sequence andthe G418 resistance gene. After 2�week culturing inthe presence of G418, individual cell clones with sta�ble expression of the chimeric protein were isolatedand tested for CCR5�EGFP expression level by quanti�tative RT�PCR and flow cytometry. Clones with thehighest gene expression levels were chosen for furtherexperiments.
The use of a continuous cell line in place of primaryperipheral blood mononuclear cells simplified theactivity assays for our constructs. The CCR5 expres�sion level was estimated by measuring the fluorescenceintensity of EGFP fused with CCR5 that enabled us toavoid the use of expensive fluorescently labeled anti�bodies.
Activity Comparisons for shRNAand Individual amiRNAs
Lentiviral particles coding for shRNA or amiRNAwere used for transduction of indicator HT1080�CCR5�EGFP cells. Cells containing the integratedvector were selected in the presence of the antibiotic.Transduction was carried out at a low multiplicity ofinfection (MOI = 0.1) so that the resulting cells car�ried one vector copy per cell after selection. Thus,RNA interference was ensured by one vector copy inall cases, allowing correct comparisons of the con�structs. The silencing effect was studied by measuringthe CCR5�EGFP mRNA level and CCR5�EGFP flu�orescence intensity. Cells obtained via transductionwith the empty vector were used as a negative control.
As expected, transduction with the genetic con�structs coding for sh13lg led to a distinct CCR5�EGFPsilencing (Figs. 4a, 4b). Vectors carrying the U6�sh13lgcassette inhibited the chimeric gene expression to agreater extent as compared with vectors carrying H1�sh13lg, which was explained by a higher activity of theU6 promoter [10, 25]. The H1�sh13lg cassette insertedin the lentiviral vector in the reverse orientation (H1�sh13lg rev) tended to be more active than the samecassette in the direct orientation (H1�sh13lg),although the difference was nonsignificant.
The effect of mic13 and mic13lg on CCR5 expres�sion was lower than that of sh13lg (Figs. 4a, 4b).Longer mic13lg was more efficient than its shorteranalog mic13 (the extent of silencing was 80 vs 50%,respectively). No CCR5 silencing was observed withmic909, which is in contrast with the high efficiencyreported for the analogous shRNA. The discrepancymight be explained by an inefficient or incorrect pro�cessing of mic909. An alternative explanation consid�ers the difference between the CCR5�EGFP and
CCR5 mRNAs. Their secondary structures may hypo�thetically differ so that the target sequence is inacces�sible for RNA interference in the chimeric mRNA.However, this hypothesis was rejected by the result ofthe experiment described below.
Fluorescence intensity reflected the cell amount ofthe chimeric protein in our experiments. As is seen,amiRNAs changed the amount of CCR5�EGFPfusion protein to a greater extent then the amount ofthe corresponding mRNAs, suggesting additionalposttranscriptional inhibition of gene expression.Since the leading siRNA strand was perfectly comple�mentary to the target mRNA in our amiRNA con�structs, we assumed that mRNA degradation, ratherthan translational suppression as in the case of par�tially complementary sequences, would be a mainmechanism of gene silencing. The results indicate thatCCR5 expression was inhibited at both transcriptionaland translational levels.
Activity Testing for Combinations of Several amiRNAs
A combination of several miRNAs in one transcriptprovides a means to increase the miRNA inhibitoryeffect. It has been demonstrated that a combination ofseveral identical amiRNAs or amiRNAs directed todifferent regions of one gene improves the efficiency oftarget gene silencing [26–28]. We constructed severalcombinations of the above amiRNAs and comparedthe efficiency of CCR5 silencing for particular combi�nations and individual amiRNAs and shRNA.
Combined expression of two mic13 or two mic13lgcopies in one transcript increased the inhibitory effectby a factor of 2.5–3 as compared with individualamiRNAs (Figs. 4c, 4d). A third mic13lg copy furtherincreased RNA interference, but the differencebetween the constructs with two or three copies wasnonsignificant. The CCR5 silencing level achievedwith the three�copy construct (74% by mRNA and95% by protein) was comparable with the silencinglevel ensured by sh13lg expression controlled by theU6 promoter (71% by mRNA and 95% by protein) inthree independent experiments.
Interesting results were obtained for the combina�tions including mic909. This amiRNA did not changethe CCR5 expression when used alone, but signifi�cantly increased the inhibitory effect when combinedwith mic13 (mic13, 51% by protein and mic13 + 909,78%). The four�amiRNA combination mic(13 + 909) × 2was somewhat more efficient than mic13 + mic909and less efficient than mic13 × 2. The findings indicatethat the amiRNA arrangement in a polycistronic tran�script may affect the inhibitory properties of the cas�sette.
A combination of two amiRNAs in one transcriptsubstantially increased their activity in all of the com�binations tested. The effect was most likely due to amore stable secondary structure of the combinedamiRNA, which included two RNA hairpins, and a
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
DOWNREGULATION OF HUMAN CCR5 GENE EXPRESSION 425
mic
13lg
mic
909
H1�
sh13
lg r
ev
mic
13 +
909
mic
13 ×
2
mic
13lg
× 2
mic
13lg
× 3
mic
(13
+ 9
09) ×
2
mic
13
Relative fluorescence intensity, %120
100
80
60
40
20
0
Em
pty
vect
or
(c)
(d)
mic
13lg
mic
909
H1�
sh13
lg r
ev
mic
13 +
909
mic
13 ×
2
mic
13lg
× 2
mic
13lg
× 3
mic
(13
+ 9
09) ×
2
mic
13
Relative mRNA level, %120
100
80
60
40
20
0
Em
pty
vect
or
(a)
mic
909
H1�
sh13
lg
U6�
sh13
lg
mic
13
mic
13lg
H1�
sh13
1g
Relative mRNA level, %120
100
80
60
40
20
0
Em
pty
vect
or rev
rev
U6�
sh13
lg
(b)
mic
909
H1�
sh13
lg
U6�
sh13
lg
mic
13
mic
13lg
H1�
sh13
1g
Relative fluorescence intensity, %120
100
80
60
40
20
0
Em
pty
vect
or rev
rev
U6�
sh13
lg
Fig. 4. Activity comparisons for individual amiRNAs and their combinations. HT1080�CCR5�EGFP indicator cells were trans�duced with lentiviral particles containing a shRNA� or amiRNA�coding sequence, and modified cells were selected and testedfor CCR5�EGFP mRNA level and fluorescence intensity of the chimeric protein. The results were averaged over three indepen�dent experiments. (a, c) CCR5�EGFP mRNA level in cells containing the constructs as indicated was measured relative to thatin cells containing the empty vector. (b, d) Fluorescence intensity in cells containing the constructs as indicated was normalizedby that in cells containing the empty vector.
more efficient processing of the tandem transcript[26–28]. A third and a fourth amiRNAs did notincrease the activity significantly. Sun et al. [27] havedescribed a similar effect for amiRNAs based on miR�30.A combination of two hairpins has been more activethan an individual amiRNA, while a third hairpin hasonly slightly improved the inhibitory effect. On the
other hand, Chung et al. [26] have observed a gradualincrease in RNA interference with luciferase reportergene expression when adding consecutively up to 8identical amiRNA copies. There are data that a singleamiRNA may be more efficient than a tandem of itstwo copies [29]. Thus, the effect of amiRNA multipli�cation on target gene silencing may differ in different
426
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
GLAZKOVA et al.
model systems, which is likely explained, first, bystructural differences among the amiRNAs and, sec�ond, by systemic factors, which are still poorly under�stood.
In our experiments, a combination of amiRNAssubstantially improved the efficiency of RNA interfer�
ence in CCR5 silencing. The finding may be of crucialimportance for generating HIV�resistant cells.
Test for Specificity of RNA Interference
It is essential for RNA interference that the siRNAnucleotide sequence perfectly matches its binding site.To verify that RNA interference was indeed responsi�ble for gene silencing in our experiments, we con�structed HT1080�CCR5mut cells, which expressedCCR5mut with two synonymous nucleotide substitu�tions in the target sequence (Fig. 2).
To estimate the amiRNA and shRNA effects onCCR5mut expression, HT1080�CCR5mut cells wereinfected with lentiviral particles coding for H1�sh13lg,mic13, or mic13lg. Both amiRNAs and shRNA failedto affect CCR5mut expression (Fig. 5). Thus, theobserved inhibition of CCR5 expression was due to adirect interaction of the RNA�interference agentswith the CCR5 mRNA rather than with other cellcomponents.
Effects of amiRNAs and shRNA on the Expression of CCR5 and Recombinant CCR5�EGFP
Recombinant CCR5�EGFP, whose product isdetectable by fluorescence, was used in place of thewild�type CCR5 to simplify the experiments and tomake them less expensive. Further experiments wereperformed to exclude a possible effect of the structuraldifference between the chimeric CCR5�EGFP
mic13lgH1�sh13lg rev mic13
Relative mRNA level, %120
100
80
60
40
20
0Emptyvector
Fig. 5. Both amiRNAs and shRNA lack an effect onmutant CCR5mut expression. HT1080 cells expressingCCR5 with synonymous nucleotide substitutions(CCR5mut) were infected with lentiviral particles codingfor shRNA or amiRNA. Cells were selected in the presenceof the antibiotic, and the CCR5mut mRNA level was mea�sured by quantitative RT�PCR. The results are shown rel�ative to the same mRNA level in cells carrying the controlempty vector. The results were averaged over two indepen�dent experiments.
mic13lgH1�sh13lg rev mic13
Relative mRNA level, %120
100
80
60
40
20
0Emptyvector
CCR5 CCR5�EGFP
mic13lg × 3 mic909
Fig. 6. EGFP sequence contained in the recombinant CCR5�EGFP does not affect the efficiency of CCR5 silencing induced by theamiRNAs. HT1080�CCR5�EGFP and HT1080�CCR5 cells were infected with lentiviral particles expressing shRNA, an indi�vidual amiRNA, or an amiRNA combination. Cells were selected in the presence of puromycin, and the CCR5 mRNA or CCR5�EGFP mRNA levels were measured by quantitative RT�PCR. The results are shown relative to expression of the same gene incells carrying the control empty vector. The results were averaged over two independent experiments.
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
DOWNREGULATION OF HUMAN CCR5 GENE EXPRESSION 427
mRNA and CCR5 mRNA on the efficiency of theirinteractions with amiRNAs and shRNA. We con�structed HT1080�CCR5 cells with stable expression ofthe intact human CCR5 gene in addition to HT1080�CCR5�EGFP cells. Cells of the two lines were modi�fied in parallel with H1�sh13lg, mic13, mic13lg,mic909, a combination of three mic13lg copies, or thecontrol vector and tested for CCR5 mRNA level. Witheach construct, a similar decrease in target mRNAlevel was observed in the two cell lines (Fig. 6). Thefinding indicates that the results obtained withHT1080�CCR5�EGFP cells adequately reflect theeffects of the amiRNAs and shRNA under study onCCR5 expression.
CONCLUSIONS
To summarize, we obtained miRNA�based geneticconstructs to silence human CCR5. Combinations ofseveral amiRNAs proved to be the most efficient; theirefficiency in a model system (an indicator cell line)was comparable with the efficiency reported forshRNA�based constructs. The indicator cell linesconstructed in this work provided a convenient ade�quate model for rapidly assessing the CCR5 expressionlevel.
We intend to study the cytotoxicity of our amiRNAsand their effect on cell resistance to HIV infection.Such studies will report whether the miRNA combi�nations are suitable as gene�therapeutic agents fortreating HIV infection.
ACKNOWLEDGMENTS
We are grateful to L.V. Serebrovskaya for help in flowcytometry and G.M. Tsyganova for help in RT�PCR.
REFERENCES
1. Samson M., Libert F., Doranz B.J., Rucker J., Liesnard C.,Farber C.M., Saragosti S., Lapoumeroulie C.,Cognaux J., Forceille C., Muyldermans G., Verhofst�ede C., Burtonboy G., Georges M., Imai T., Rana S.,Yi Y., Smyth R.J., Collman R.G., Doms R.W., Vassart G.,Parmentier M. 1996. Resistance to HIV�1 infection incaucasian individuals bearing mutant alleles of theCCR�5 chemokine receptor gene. Nature. 382, 722–725.
2. Lucotte G. 2002. Frequencies of 32 base pair deletionof the (Delta 32) allele of the CCR5 HIV�1 co�receptorgene in Caucasians: A comparative analysis. Infect.Genet. Evol. 1, 201–205.
3. Biti R., Ffrench R., Young J., Bennetts B., Stewart G.,Liang T. 1997. HIV�1 infection in an individualhomozygous for the CCR5 deletion allele. Nature Med.3, 252–253.
4. O’Brien S.J., Moore J.P. 2000. The effect of geneticvariation in chemokines and their receptors on HIVtransmission and progression to AIDS. Immunol. Rev.177, 99–111.
5. Zimmerman P.A., Buckler�White A., Alkhatib G.,Spalding T., Kubofcik J., Combadiere C., Weissman D.,Cohen O., Rubbert A., Lam G., Vaccarezza M.,Kennedy P.E., Kumaraswami V., Giorgi J.V., Detels R.,Hunter J., Chopek M., Berger E.A., Fauci A.S., Nut�man T.B., Murphy P.M. 1997. Inherited resistance toHIV�1 conferred by an inactivating mutation in CCchemokine receptor 5: studies in populations with con�trasting clinical phenotypes, defined racial background,and quantified risk. Mol. Med. 3, 23–36.
6. Allers K., Hütter G., Hofmann J., Loddenkemper C.,Rieger K., Thiel E., Schneider T. 2011. Evidence for thecure of HIV infection by CCR5Δ32/Δ32 stem celltransplantation. Blood. 117, 2791–2799.
7. Cannon P., June C. 2011. Chemokine receptor 5knockout strategies. Curr. Opin. HIV AIDS. 6, 74–79.
8. Butticaz C., Ciuffi A., Muñoz M., Thomas J., Bridge A.,Pebernard S., Iggo R., Meylan P., Telenti A. 2003. Pro�tection from HIV�1 infection of primary CD4 T cells byCCR5 silencing is effective for the full spectrum ofCCR5 expression. Antivir. Ther. 8, 373–377.
9. Shimizu S., Hong P., Arumugam B., Pokomo L., Boyer J.,Koizumi N., Kittipongdaja P., Chen A., Bristol G.,Galic Z., Zack J.A., Yang O., Chen I.S., Lee B., An D.S.2010. A highly efficient short hairpin RNA potentlydown�regulates CCR5 expression in systemic lymphoidorgans in the hu�BLT mouse model. Blood. 115, 1534–1544.
10. An D.S., Qin F.X., Auyeung V.C., Mao S.H., Kung S.K.2006. Optimization and functional effects of stableshort hairpin RNA expression in primary human lym�phocytes via lentiviral vectors. Mol. Ther. 14, 494–504.
11. Anderson J., Akkina R. 2007. Complete knockdown ofCCR5 by lentiviral vector�expressed siRNAs and pro�tection of transgenic macrophages against HIV�1 infec�tion. Gene Ther. 14, 1287–1297.
12. Grimm D., Streetz K.L., Jopling C.L., Storm T.A.,Pandey K., Davis C.R., Marion P., Salazar F., Kay M.A.2006. Fatality in mice due to oversaturation of cellularmicroRNA/short hairpin RNA pathways. Nature. 441,537–541.
13. Castanotto D., Sakurai K., Lingeman R., Li H.,Shively L., Aagaard L., Soifer H., Gatignol A., Riggs A.,Rossi J.,2007. Combinatorial delivery of small interfer�ing RNAs reduces RNAi efficacy by selective incorpo�ration into RISC. Nucleic Acids Res. 35, 5154–5164.
14. Scherr M., Eder M. 2007. Gene silencing by small reg�ulatory RNAs in mammalian cells. Cell Cycle. 6, 444–449.
17. McBride J., Boudreau R.L., Harper S.Q., Staber S.Q.,Monteys A.M., Martins I., Gilmore B.L., Burstein H.,Peluso R.W., Polisky B., Carter B., Davidson B.L.2008. Artificial miRNAs mitigate shRNA�mediatedtoxicity in the brain: implications for the therapeuticdevelopment of RNAi. Proc. Natl. Acad. Sci. U. S. A.105, 5868–5873.
428
MOLECULAR BIOLOGY Vol. 47 No. 3 2013
GLAZKOVA et al.
18. Boudreau R.L., Martins I., Davidson B.L. 2009. Artifi�cial microRNAs as siRNA shuttles: Improved safety ascompared to shRNAs in vitro and in vivo. Mol. Ther.17 (1), 169–175.
19. Nielsen T.T., Marion I., Hasholt L., Lundberg. C. 2009.Neuron�specific RNA interference using lentiviral vec�tors. J. Gene Med. 11, 559–569.
20. Shin K.J., Wall E.A., Zavzavadjian J.R., Santat L.A.,Liu J., Hwang J., Rebres R., Roach T., Seaman W.,Simon M., Fraser I. 2006. A single lentiviral vectorplatform for microRNA�based conditional RNA inter�ference and coordinated transgene expression. Proc.Natl. Acad. Sci. U. S. A. 103, 13759–13864.
21. Liu Y.P., Haasnoot J., ter Brake O., Berkhout B., Kon�stantinova P. 2008. Inhibition of HIV�1 by multiplesiRNAs expressed from a single microRNA polycis�tron. Nucleic Acids Res. 36, 2811–2824.
22. Aagaard L.A., Zhang J., von Eije K. J., Li H., Sætrom P.,Amarzguioui M., Rossi J. 2008. Engineering and opti�mization of the miR�106b cluster for ectopic expressionof multiplexed anti�HIV RNAs. Gene Ther. 15, 1536–1549.
23. Boom R., Sol C.J., Salimans M.M., Jansen C.L., Wer�theim�van Dillen P.M. 1990. Rapid and simple methodfor purification of nucleic acids. J. Clin. Microbiol. 28,495–503.
24. Kim S.S., Peer D., Kumar P., Subramanya S., Wu H.,Asthana D., Habiro K., Yang C., Manjunath N., Shi�maoka M., Shankar P. 2010. RNAi�mediated CCR5
silencing by LFA�1�targeted nanoparticles preventsHIV infection in BLT mice. Mol. Ther. 18, 370–376
25. Mäkinen P.I., Koponen J.I., Kärkkäinen A.M.,Malm T.M., Pulkkinen K.H., Koistinaho J.,Turunen M.P., Ylä�Herttuala S. 2006. Stable RNAinterference: Comparison of U6 and H1 promoters inendothelial cells and in mouse brain. J. Gene Med. 8,433–441.
26. Chung K.H., Hart C.C., Al�Bassam S., Avery A., Tay�lor J., Patel P. D., Vojtek A.B., Turner D.L. 2006. Poly�cistronic RNA polymerase II expression vectors forRNA interference based on BIC/miR�155. NucleicAcids Res. 34 (7), e53.
27. Sun D., Melegari M., Sridhar S., Rogler C.E., Zhu L.2006. Multi�miRNA hairpin method that improvesgene knockdown efficiency and provides linked multi�gene knockdown. Biotechniques. 41, 59–63.
28. McLaughlin J., Cheng D., Singer O., Lukacs R.U.,Radu C.G., Verma I.M., Witte O.N. 2007. Sustainedsuppression of Bcr�Abl�driven lymphoid leukemia bymicroRNA mimics. Proc. Natl. Acad. Sci. U. S. A. 104,20501–20506.
29. Zhou H., Xia X.G., Xu Z. 2005. An RNA polymerase IIconstruct synthesizes short�hairpin RNA with a quan�titative indicator and mediates highly efficient RNAi.Nucleic Acids Res. 33 (6), e62.
![[Downregulation of human CCR5 receptor gene expression using artificial microRNAs]](https://static.documents.pub/doc/80x56/63522a290e796dacc0005d3d/downregulation-of-human-ccr5-receptor-gene-expression-using-artificial-micrornas.jpg)
