Immunology 1993 78 513-519

Elimination of IgE regulatory rat CD8 + T cells in vivo differentiallymodulates interleukin-4 and interferon-y but not interleukin-2

production by splenic T cells

D. DIAZ-SANCHEZ, A. NOBLE, D. Z. STAYNOV, T. H. LEE & D. M. KEMENY Department of Allergy andAllied Respiratory Disorders, Division of Medicine, United Medical and Dental Schools of Guy's and St Thomas' Hospitals,

London

Acceptedfor publication 29 November 1992

SUMMARY

Intraperitoneal immunization of Hooded Lister rats with a soluble antigen such as bee venomphospholipase A2 (PLA2), or ovalbumin (OVA) together with the toxic lectin, ricin, eliminates apopulation of early-activated CD8+± T cells which regulate IgE production. These early-activatedCD8 + T cells are eliminated because they bear increased ricin-binding glycoproteins on their surface.This immunization regimen produces a vigorous and long-lived IgE response. The effect of thistreatment on the capacity of splenic T cells to secrete interferon-y (IFN-y), interleukin-2 (IL-2) and togenerate IL-4 RNA message was assessed. IFN-y production by phytohaemagglutinin (PHA)- orionomycin and phorbol myristate acetate (PMA)-stimulated splenocytes or purified splenic T cellsfrom animals immunized with antigen and ricin was substantially reduced as compared with animalswhich were given saline or antigen alone (P < 0-001 Student's t-test). At the height of the primary IgEresponse IFN-y production by PHA-stimulated splenocytes was positively correlated with thenumber of CD8+ T cells (r=0090, P<0-001) and inversely related to the level of serum IgE(r= - 0-77, P <0-020); serum IgE was inversely related to the number of CD8+ T cells (r= - 0-92,P<0 001). The reduced capacity of spleen cells from ricin and antigen immunized rats to produceIFN-y was first seen 7 days after immunization. The fall in the ability of splenocytes to secrete IFN-yclosely paralleled the rise in serum IgE. IL-2 was assayed using an IL-2-dependent cell line whichresponded to rat IL-2 but not IL-4. Production of IL-2 by splenocytes taken from rats immunizedwith ricin + antigen was not significantly different to that produced by comparable cells obtainedfrom animals immunized with antigen alone or saline. However, the levels of IL-4mRNA, detected inionomycin and PMA-stimulated splenocytes using a quantitative polymerase chain reaction (PCR)procedure, were three- to fourfold higher in ricin and antigen immunized animals as compared withcontrol animals. Following boosting with antigen and ricin the levels of IL-4 message detectedincreased a further three- to fourfold. These data show that the potentiated IgE response produced byimmunization with antigen+ ricin is associated with a decreased ability of splenocytes to produceIFN-y and an increased capacity to make IL-4.

INTRODUCTION

It is well established that subpopulations of CD4+ T cells,through the secretion of specific groups of cytokines, play animportant part in the regulation of the immune response.

Abbreviations: AP, alkaline phosphatase; PLA2, bee venom phos-pholipase A2; dNTP, deoxynucleotide triphosphate; ELISA, enzyme-linked immunosorbent assay; IFN-y, interferon-y; IL, interleukin;MNC, mononuclear cell; OVA, ovalbumin; PMA, phorbol myristateacetate; PBS, phosphate-buffered saline; PHA, phytohaemagglutinin.

Correspondence: Dr D. M. Kemeny, Dept. of Allergy and AlliedRespiratory Disorders, UMDS, Guy's Hospital, St Thomas St.,London SEI 9RT, U.K.

Murine CD4+ T-cell clones secrete a restricted spectrum ofcytokines and have been broadly classified into two categories,Thl and Th2.' Thl cells make larger amounts of interferon-y(IFN-y), interleukin-2 (IL-2), transforming growth factor-:(TGFf) and tumour necrosis factor-a (TNF-cx) while Th2 cellsmake more IL-4, 5, 6 and 10.2 Some cytokines are secreted insimilar amounts by both clones [IL-3 and granulocyte-macro-phage colony-stimulating factor (GM-CSF)]. Other CD4+ T-cell subtypes have since been identified, such as Thp (precursorcells), which secrete IL-2 alone and ThO, an intermediate cellwhich has an unrestricted cytokine profile. It is probable that aneven greater range offunctionally distinct T-cell subsets exists.2-3T cells which produce a Th2 repertoire ofcytokines are believed

513

D. Diaz-Sanchez et al.

to favour humoral immune responses and are implicated inallergic inflammatory processes,4 6 while Thl cells are thoughtto mediate delayed type hypersensitivity (DTH) and cell-mediated immunity (CMI).

The cytokines which have been shown to be most importantin IgE regulation are IL-4 and IFN-y. High levels of IL-4 inducelipopolysaccharide (LPS)-stimulated murine B cells to produceIgE in vitro7 9 and this is antagonized by IFN-y.8 In vivo bothanti-IL-4 antibody'0"' and IFN-y'2"3 have been shown tosuppress soluble antigen and Nippostrongylus braziliensis andHeligmosomoides polygyrus induced IgE production.'3 In man,an association between reduced IFN-y production andincreased IgE has been reported in patients with hyper-elevatedIgE levels whose peripheral blood lymphocytes have a reducedcapacity to produce IFN-y.'4"5 However, replacement therapyusing recombinant IFN-y has not reduced IgE in atopicdermatitis patients, although some clinical benefits wereobserved. 16

What remains unclear is the process which directs thedifferentiation of CD4+ T cells into the Th 1 and Th2 subtypes.The development of both IFN-y-producing Th I cells, and IL-4-producing Th2 cells in vivo requires antigenic stimulation.'7 Invitro, the presence of different cytokines in the culture mediumat the time of T-cell differentiation influences T-cell develop-ment-CD4+ T cells cloned in the presence of IFN-y preferen-tially develop a Thl phenotype'8 while addition of IL-4 toactivated CD4+ cell cultures induces the development of cellsthat secrete high levels of Th2 cytokines. 19 Furthermore, IFN-yinhibits the growth of Th2 cells20 and IL-4 is reported tosuppress IFN-y production2' and preferentially stimulate thegrowth of Th2 cells.22

We have previously established a model in which rats can beinduced to produce large amounts of IgE when immunized withthe toxic lectin ricin and a bystander antigen such as phospholi-pase A2 (PLA2) or ovalbumin (OVA).23'24 Immunization of ratswith ricin and antigen results in a potentiated IgE but not IgGresponse and the levels of IgE reached are similar to thoseassociated with nematode infection.25-27 The cause of theenhanced IgE response appears to be the elimination of aproportion (c. 50%) of CD8+ but not CD4+ T cells from thespleen.25 Following injection of antigen these CD8 + T cells areselectively targeted by ricin because they bear increasednumbers of ricin-binding glycoproteins on their surface. Byadoptive transfer it has been confirmed that some or all of themcan inhibit IgE production.28

In this study we have determined the capacity of ratsplenocytes to produce IFN-y, IL-2 and IL-4 in the ricin-potentiated IgE response and have shown that there is areduction in the ability ofT cells to produce IFN-y but not IL-2and an increase in their capacity to express mRNA for IL-4. Wepropose that early-activated CD8 + T cells play an importantrole in regulating the type ofcytokines that are produced duringan immune response and that the switch from Th 1 to Th2cytokines is responsible for the heightened IgE response which isseen.

MATERIALS AND METHODS

AnimalsHooded Lister rats (125-150 g) were purchased from Harlon-Olac Ltd (Bicester, U.K.). Groups of six age-, weight-, batch-and sex-matched animals were used in each experiment. In the

experiments where IL-4 mRNA was measured, one rat was usedat each time-point.

Materials tPurified bee venom PLA2 was a kind gift from Dr R. A.Shipolini (Imperial College, London, U.K.). Paper discs (6 mmin diameter) were cut from Whatman no. 541 filter paper(Whatman, Maidstone, U.K.). Tissue culture medium RPMI-1640 was purchased from Gibco Ltd (Paisley, U.K.) andadjusted to 310 mOsm which is optimal for rat lymphocytes.29Nunc maxisorb enzyme-linked immunosorbent assay (ELISA)plates were purchased from Nunc (Roskilde, Denmark).Twenty-four-well sterile tissue culture plates were purchasedfrom Costar (High Wycombe, U.K.) and 96-well sterile tissueculture plates from Nunc. Rat serum agarose, rat IgG agarose,p-nitrophenyl phosphate, phytohaemagglutinin (PHA) andphorbol myristate acetate (PMA) were purchased from Sigma(Poole, U.K.). Ionomycin was purchased from Novabiochem(Nottingham, U.K.). The IL-2-sensitive cell line, CTLL-M,(ECACC 87031904) was obtained from the National BiologicalServices (Porton Down, U.K.). Recombinant IL-2 was pur-chased from Euro-Cetus (Harefield, U.K.). Recombinant ratIL-4 and anti-mouse IL-2 receptor (IL-2R) antibody were kindgifts from Dr A. McKnight (MRC Cellular Immunology Unit,William Dunn School of Pathology, Oxford, U.K.). The IFN-yELISA kit was purchased from Holland Biotechnology(Amsterdam, The Netherlands) and used according to themanufacturer's instructions. Horse serum was purchased fromSera Lab (Crawley, U.K.). Polyclonal and monoclonal anti-ratIFN-y were kind gifts from Dr P. Van der Meide, (TNO,Rijswijk, The Netherlands) and Dr J. Tite (Wellcome Researchplc, Beckenham, U.K.). Anti-rat IgG, IgG subclasses and IgAwas purchased from The Binding Site (Birmingham, U.K.).Rabbit anti-rat IgE was a kind gift from the late Dr E. Jarrett(Glasgow, U.K.) and had been raised against the rat IgEmyeloma IR162. It was adsorbed, first against rat serumagarose, then against rat IgG agarose (Sigma, Poole, U.K.) andwas finally affinity purified over purified rat IgE myeloma IR2(kind gift from Professor H. Bazin, Brussels, Belgium) bound toSepharose 4B (Pharmacia LKB, Milton Keynes, U.K.). Therewas no cross-reactivity with rat IgG, IgA or IgM as assessed bygel diffusion and less than 1% cross-reactivity in ELISA with ratimmunoglobulin-coated microtitre plates. Purified intact ricinwas a kind gift from Dr P. Thorpe (ICRF, London, U.K.).Monoclonal antibodies to rat T cells were a kind gift from DrsD. Mason and N. Barclay (MRC Cellular Immunology Unit).The thermal cycler used was purchased from Coy LaboratoryProducts (Flowgen Instruments Ltd, Sittingbourne, U.K.).RNAguard, oligo dT, AMV reverse transcriptase, and dNTPwere all purchased from Pharmacia (Milton Keynes, U.K.).Perfect MatchTm and ¢XX174/Hinfl markers were purchasedfrom Stratagene Ltd (Cambridge, U.K.). Amplitaq polymerasewas purchased from ILS Ltd (London, U.K.). PCR primers forrat IL-4 and f,-actin were purchased from British BiotechnologyLtd (Oxford, U.K.) or the Molecular Medicine Unit (KingsCollege, London, U.K.). Photographs were taken under ultra-violet (UV) illumination on Agfa APX25 film and the negativesscanned on a Molecular Dynamics ImageQuantTm densitometer(Sunnyvale, CA). All other reagents were purchased from BDHLtd (Dagenham, U.K.).

514

IgE regulatory CD8+ T cells and modulation of cytokine production

Purification of T lymphocytesRat spleens were excised and pressed through stainless steelsieves into chilled phosphate-buffered saline (PBS) containing0-2% bovine serum albumin (BSA), then passed through sterilecotton wool in a 5-ml syringe barrel. The eluted cells were thenwashed twice with 0-2% BSA in PBS. Contaminating erythro-cytes were lysed by hypotonic treatment. One millilitre ofdistilled water was added to pelleted cells and mixed. Onemillilitre of 1-8% NaCI was then rapidly added to restoreosmolarity. The cells were then washed twice in 0-2% BSA inPBS and the number of viable cells determined by trypan blueexclusion. Spleen cell populations were depleted of macro-phages by adherence and pure T cells were obtained by rosettingas previously described.24 The cells were washed, counted andthe purity of all preparations checked by flow cytofluorographicanalysis in a FACScan (Becton Dickinson, Oxford, U.K.). Thecells were rejected if less than 99 0% stained positive with themonoclonal antibody OX52 which recognizes a pan T marker.MRC OX21 directed against human C3b inactivator but not ratcells30 and MRC OXI the anti-leucocyte common antigen,3'were used as negative and positive controls.

Immunization scheduleHooded Lister rats were immunized in groups of six i.p. witheither 10 pg of the antigen: PLA2 in 100 p1 of sterile saline or 10pg PLA2 and 50 ng ricin. On day 21 booster injections of 10 pg ofPLA2 in 100 p1 sterile saline were given. A control group was

injected with 100 pl of sterile saline alone. All rats were bledfrom the tail under Halothane anaesthetic on days 1, 12 and 24.The serum was separated and stored at -200.

Total and antigen-specific IgE antibody assays

Specific IgE antibody to PLA2 and total serum IgE were

measured using micro-radioallergosorbent and radioimmuno-sorbent tests, respectively, as previously described.32 The resultsfor the total serum IgE were expressed as ng/ml by reference tothe rat IgE myeloma protein IR2. The concentration of ratPLA2-specific IgE antibodies was expressed as arbitrary units/ml by reference to an in-house reference serum pool.

Cytokine secretionCytokine secretion from mononuclear cells (MNC) was deter-mined by culture of spleen cells (prepared as described above) intriplicate at I x 106 cells/ml in 24-well plates in 800 pl/well ofRPMI with either 1% PHA or 400 ng/ml ionomycin and 10 ng/ml of PMA. After 24 hr (optimal for secretion of IFN-y), thecultured cells were centrifuged, the supernatants harvested andfrozen at -20° until assayed for IFN-y and IL-2.

Cytokine secretion from purified T cells (prepared as

described above) was determined by culturing at 1 ml (1 x 106 Tcells/well) (10 replicates) in the presence of an equal number ofMNC, from the spleens of untreated age-, weight-, sex- andbatch-matched rats. These had previously been depleted of Tcells by negative selection by rosetting with the same mono-

clonal antibodies. No mixed lymphocyte reaction, as judged byproliferation in the absence of mitogen, was evident in theculture. The cells were cultured in the presence of 1% PHA.After 24 hr, the culture was centrifuged, the supernatantsharvested and frozen at - 20° until assayed for IFN-y and IL-2.For IL-4 mRNA determination, spleen cells were cultured incomplete medium with 10 ng/ml PMA and 400 ng/ml of

ionomycin at 3 x 106 cells/ml (10-ml cultures) for 6 hr (optimalfor IL-4 mRNA expression) at 370, 5% CO2 in 50-ml Falcontubes tilted onto their sides.

Cytokine measurementsIFN-y production from rat spleen cells was determined byELISA and the results expressed as U/ml where I U isapproximately equal to 250 pg. Maximal production of IFN-yoccurred after 18 hr of culture and declined after 36 hr. Abioassay with the IL-2 responsive cell line CTLL-M was used todetermine the quantity of IL-2 in the supernatants. The cell linewas maintained in RPMI-1640 10% foetal calf serum (FCS), 10U/ml IL-2 and 20% concanavalin (Con A)-stimulated ratconditioned medium. The CTLL-M cells were harvested 3 daysafter feeding with the above medium. The cells were washedtwice by centrifugation (300 g, 7 min) in RPMI-1640 andresuspended at 1 x 105 cells/ml in RPMI-1640 containing 10%foetal calf serum (FCS). The supernatants to be tested wereadded to 96-well sterile microtitre plates. The negative controlwas medium alone. Titrations of an IL-2 standard were alsoadded to the plate from which a standard curve was subse-quently produced. The final volume for each well was 50 p1. Toeach well was added 50 pi of the CTLL-M cell suspension atI x 105 cells/ml. The plates were then incubated at 37° and 5%CO2 for 18 hr. 0 5 pCi of [3H]thymidine was added to each welland the plates incubated for a further 4 hr. The cells wereharvested on an automated cell harvester (Ilacon, Tonbridge,U.K.) and the amount of IL-2 in each sample compared to astandard curve and expressed as U/mi. The lower limit ofdetection was 2 U/mi. The specificity of this assay wasconfirmed by the failure ofrecombinant rat IL-4 to stimulate theCTLL-M cells at any concentration. Overall homology betweenrat and mouse IL-4 protein sequences is relatively low (61 %)33and there is reportedly no functional homology. The addition ofanti-mouse IL-2R antibody blocked proliferation by over 85%,confirming that the effects were indeed due to IL-2.

IL-4 mRNA PCRTotal RNA samples were prepared from 20-90 x 106 cells byguanidine isothiocyanate Iysis.34 RNA pellets were washed twicewith 80% ethanol, air dried and dissolved in 0 5 U/pu RNA-guard and 5 mm dithiothreitol. The yield and quality of RNAisolated were determined by spectrophotometry and by agarosegel electrophoresis respectively. 4-0 ug RNA from each samplewere reverse transcribed in 40 p1 of reverse transcriptase (RT)buffer (50 mm Tris-HCl pH 8-0, 50 mm KCI, 5 mM MgCl2)containing 5 pg of oligo dT (12-18 mer), 20 U AMV reversetranscriptase, 2-25 mm dNTP, 0-1 mg/ml BSA, 10 mm dithio-threitol, and 40 U RNAguard. Tubes were incubated at roomtemperature for 20 and 30 min at 420 before storage at - 200.

PCR primers for rat IL-4 and fl-actin were designed from therat IL-4 and f,-actin cDNA sequences.33 The sequences of theprimers used were: 5'ACCTTGCTGTCACCCTGTTCTGC3'and 5'GTTGTGAGCGTGGACTCATTCACG3', whichamplify a 352 IL-4 base pair (bp) fragment and 5'AGAA-GAGCTATGAGCTGCCTGACG3' and 5'CTTCTGCATC-CTGTCAGCCTACG3', which produce a 236 bp f,-actinfragment. PCR reactions consisted of 5 p1 reverse-transcribedRNA in 40 p1 RT buffer containing 1-25 JM each primer, 0 3 p125 mM dNTP, 0-35 U Perfect MatchTm and 1-2 U Amplitaq.Reaction mixtures were overlaid with mineral oil and trans-

515

D. Diaz-Sanchez et al.

(a) (b)200

20

15

Saline 10A2 PLA2 + Saline PLA2 P +100

WiSpleen cells

E3 T cells

5

0 0-

Saline PLA? PLA2 + Saline PLA2 PLA2+

ricin ricin

Figure 1. The quantity of IFN-y secreted by (a) PHA- and (b) PMA andionomycin-stimulated splenocytes and splenic T cells from rats immu-nized 24 days earlier with saline, 10 pg PLA2 or 10 pg PLA2 + 50 ng ricin.Columns represent the mean + SD. I U of IFN-y is approximately equalto 250 pg.

ferred to a thermal cycler at 72°. Up to 32 PCR cycles were

performed (1 min 94°, 60° for 2 min or 15 min for the first fourcycles, 2 min 72°) and aliquots (6 il) were taken from eachsample after two or three different numbers of cycles. Aliquotswere run on 3-2% agarose gels in glycine buffer stained withethidium bromide. Photographs were taken under UV illumina-tion and the negatives were scanned on a densitometer.Densities of marker fragments (pUC18/HpaII or 4X174/Hinfldigests) were plotted against molecular weight and used to

estimate yields ofPCR target fragments as described previously.

(a)40,000

35,000

30,000

- 25,000I

= 20,000

OU 15,000

10,000

5000

(b)

0 0

0

r = -0-917P<0.001

0

0

0 0

50 60 70

% CD8+(C)

90

85

80

+ 75

= 70

e 65

60

55

50

0

0

80

0 0

0

r = -0-769P < 0-02

0

0

00 0

0

90 0 2 4 6

IFN-y(U/ml)8

0

0

0

0

0

0

0

0

r = 0-895P < 0.001

0 2 4 6 8

IFN-y(U/ml)

Figure 2. The relationship between serum IgE in ng/ml, the number ofsplenic CD81 spleen cells, expressed as a percentage of normal, andPHA-stimulated splenocyte IFN-y production by PHA-stimulatedsplenocytes from rats immunized 24 days earlier with 10 pg PLA2 +50ng ricin. (a) IgE versus per cent CD8 cells, (b) IgE versus IFN-y and (c)per cent CD8 cells and IFN-y. 1 U of IFN-y is approximately equal to

250 pg.

Statistical analysisAll analyses have been carried out on an Apple Macintoshcomputer using the statistical package STATVIEW 512 +. Groupswere compared using a Student's t-test where the data were

normally distributed and by Mann-Whitney U-test where thedistribution was skewed. Correlation coefficients were calcu-lated using Spearman's rank correlation test.

RESULTS

IFN-y production by MNC and T cells

Spleen cells from rats immunized 24 days earlier with PLA2,saline or PLA2 and ricin were cultured at 1 x 106 cells/ml in the

presence or absence of 1% PHA for a period of 24 hr. No

detectable IFN-y was produced when MNC from any of thethree groups were cultured in the absence of PHA. When

stimulated with PHA, MNC from saline control rats secreted a

mean of 13 U/ml of IFN-y, as compared to 16 U/ml from theMNC of rats immunized with PLA2 alone (Fig. la). Animalswhich received both ricin and antigen produced appreciably lessIFN-y (2-9 U/ml) which was significantly less than that pro-

duced by MNC from the saline control group (P <0-005,Mann-Whitney U-test) or rats immunized with antigen alone

0i

z

5 10 15 20

Day

100,000

10,000_

o

1000 E

100

10

Figure 3. The mean levels + SD of IFN-y secreted by PHA-stimulatedsplenocytes and serum IgE measured on different days followingimmunization with 10 pg PLA2 + 50 ng ricin.

516

517IgE regldatory CD8' T cells andmnodldation of cytokine production2

(a) (b)

c

- 300

Saline PLA2 PLA Saline PLA2 PLA2+

ricin ricin

* Spleen cells El T cells

Figure 4. The mean quantity + SD of IL-2 secreted by (a) PHA- and (b)PMA and ionomycin-stimulated splenocytes and splenic T cells fromrats immunized 24 days earlier with saline, 10 jig PLA2 or 10 jigPLA, + 50 ng ricin.

.R 5-0-<. 40-

30

2-0 -

2.0

0.028

0 4 8 12 16 20 24 28 32

Days after immunization

Figure 5. Expression of IL-4 mRNA in PMA+ionomycin-stimulatcdsplenocytes taken at various times from rats immunized with 10 pigPLA, + 50 ng ricin. The arrow indicates a booster injection with 10 pig

PLA, + 5 ng ricin given on day 21.

(P < 0 001. Mann-Whitney U'-test). Serum IgE levels were thesame as seen previously:2' rats immunized with PLA2 alonemade a modest IgE response at day 24 (484 ng ml), higher thanthe saline control group (58 6 ng/,lml), and rats immunized withricin and antigen made a response which was 33 times higherthan this (16,040 ng/'ml).

Purified T cells from treated rats and accessory cells fromnaive syngeneic rats were also cultured with PHA; these cellsconsisted of MNC which had previously been depleted of Tcells. The pattern of IFN-' production remained unchanged(Fig. I a) mean IFN-, titres were significantly lower (P < 0005.Mann-Whitney U-test) in the group with the potentiated IgEresponse (2 U,, ml) compared to either of the other two controlgroups: 13 U/ml for saline-treated and 14 U ml for antigen-

treated rats.The early stages of lymphocyte activation can be bypassed

by stimulation with ionomycin and PMA.36 These two stimuli

have a synergistic effect on T-cell activation negating the needfor accessory cells. Induction of IFN-; production by purified Tcells with ionomycin and PMA (Fig. lb) produced yields 10times higher than with PHA although the same trend as beforewas seen. Considerable amounts of IFN-; could be generatedfrom the T cells of saline-treated (127 U ml) or PLA, immunizedrats (150 U ml). Compared to these two groups, 1FN-;production was still significantly lower (51 U ml) in rats whichhad been given both toxin and antigen although higher than thatinduced by PHA (2 U ml) (P<0 001).

The relationship between IFN-y, CD8' T-cell number and IgEproduction

Total serum IgE and CD8+ T-cell numbers (expressed as apercentage of the normal splenic level) were compared in ratsimmunized with both ricin and PLA,. 24 days earlier. Theamount of IFN-;, produced following 24 hr of culture with 1%TPHA was measured and the relationship between IgE. CD8' T-cell number and IFN-;' determined (Fig. 2). There was a verystrong correlation between PHA-induced IFN--, productionand CD8' T-cell number and between CD85 T-cell numbersand serum IgE (Spearman's rank correlation, Fig. 2a, P < 0-001.Fig. 2c, P<0 001). There was a weaker, although still statisti-cally significant, correlation between IFN-; production andserum IgE (Fig. 2b. P < 0 02). The relationship between the totalserum IgE levels and the capacity of splenic MNC to produceIFN-; was determined at various times following immunization.Rats immunized with both ricin and PLA2 (Fig. 3) showed asignificant decline in the ability of cells to produce IFN-; 6 daysafter immunization (P<0 01. Mann--Whitney U-test). Thisdeclined even further and 21 days after immunization IFN-;production had fallen to 2 U ml. The decline in IFN-;production closely paralleled the increase in serum IgE fromresting levels of 66 ng ml to 12.040 ng ml. 24 days afterimmunization.

IL-2 production by MNC and T cells

The amount of IL-2 produced by PHA-stimulated MNC fromsaline control rats (329 U ml) did not differ significantly'(P > 0-05. Mann-Whitney U-test) from that secreted by animalsimmunized with PLA, alone (311 U ml) (Fig. 4a) or with bothricin and antigen (339 U ml). Nor was there any significantdifference in I L-2 production by purified T cells cultured with T-cell-depleted MNC from naive animals between the salinecontrol (395 U ml), the antigen immunized (326 U ml) group orthe ricin and antigen group (294 U ml) (P>0 05. Mann-Whitney L'-test). Induction of IL-2 by ionomycin and PMAproduced yields noticeably higher than that seen when cells werestimulated with PHA but did not alter the pattern of secretion(Fig. 4b). IL-2 was produced equally by T cells of saline-treated(765 U ml) and PLA,-immunized rats (725 U ml) as in ratsgiven both toxin and antigen (800 U ml). there was nosignificant difference between the immunized and the salinecontrol groups (P > 0-05, Mann Whitney U-test).

IL-4 production

The ability of splenocytes to produce IL-4 was assessed by PCRanalysis of reverse-transcribed RNA, since no assays are

518 D. Diaz-Sanchez et al.

available for rat IL-4 protein. This technique allows quantita-tive estimation of the number of cDNA copies of a specificmRNA/pg of total RNA.35 IL-4 cDNA copies were estimated inRNA samples from spleen cells stimulated for 6 hr withPMA + ionomycin. Results (Fig. 5) are expressed as a percent-age of /3-actin cDNA copies, which was determined for eachsample. The ability of splenocytes to express IL-4 increased upto four times 6 days afer immunization with PLA2 and ricin(0-71% /3-actin to 2-7% f3-actin). A further four-fold increasewas observed after a booster injection given on day 21 (5 3% JJ-actin at day 24). All spleen cells taken 4 days or more afterimmunization expressed higher levels of IL-4 than cells fromuntreated control animals (0-59 + 0 074, n = 6). IL-4 expressionin unstimulated spleen cells was barely detectable in bothimmunized and untreated animals (<0-003% f3-actin).

DISCUSSION

We have previously reported an animal model of IgE regulationthat we have developed, in which the IgE response of rats tobystander antigens was greatly enhanced by the toxic castorbean lectin, ricin.23-25 The unique features of the ricin-enhancedIgE response are: (1) that IgE responses can be induced in low aswell as high IgE responder strains of rat; (2) that these IgEresponses can be boosted; and (3) that the IgE response inducedin this way is long lived. Subsequent studies have shown that asubpopulation of CD8+ T cells are activated within 24 hr ofinjection of the rats with a soluble antigen such as PLA2 andOVA. These early-activated CD8+ T cells appear to be targetedby ricin because, in contrast to CD4+ T cells, they bear anincreased number ofricin-binding glycoproteins on their surfacefollowing immunization. When adoptively transferred to synge-neic recipients these cells were found to suppress the IgEresponse by over 90%.28 In this paper we describe the effect ofricin on the production of the IgE regulating cytokines IFN-yand IL-4 and a control cytokine, IL-2.

Spontaneous in vitro production of all three cytokines waslow and the cells required stimulation with PHA or PMA andionomycin. Depletion of early-activated rat CD8 + cells reducedby five-to 10-fold the amount of IFN-y that was produced, butincreased over 10-fold the amount of IL-4 that could beproduced and did not alter the amount of IL-2 produced. Thealtered capability to produce these cytokines is likely to be dueto the depletion of CD8+ T cells as: (1) CD8 + T cells have beenshown to be preferentially eliminated by ricin; (2) there is a closetemporal association between the fall in CD8+ T-cell numbersfollowing injection of ricin and antigen28 and the reduction inIFN-y production (Fig. 3); (3) there is a positive correlationbetween CD8+ T-cell numbers and IFN-y production; and (4)there is a negative correlation between both CD8 + T-cellnumbers and IFN-y production and the level of serum IgE (Fig.2). In unimmunized mice it is reported that CD8+ T cellscontribute more than 95% of all IFN-y production5 and in ratsinfected with the parasite Trypanosoma brucei depletion ofCD8+ T cells suppressed production of IFN-y38-supportingthe view that CD8 + T cells are the main source of IFN-y in vivo.Thus one explanation of the results presented here is that thedepletion of IFN-y-producing CD8+ T cells causes an increasein Th2 cells as it is known that IFN-y normally inhibits thegrowth of Th2 cells.39 In this way CD8+ T cells may play a partin the regulation of Thl/Th2 cell differentiation.

An alternative possibility is that the effects of ricin oncytokine production are the result of altered accessory cellfunction and decreased monocyte production of IL-1, forexample, as has been observed in atopic dermatitis patients.40However, the addition of accessory cells from untreated rats topurified T cells from test animals did not alter the pattern ofIFN-y production (Fig. 1) and IFN-y was also induced bypurified T cells using PMA and ionomycin which bypasses theneed for accessory cells.36'37

The finding that rats treated with ricin and antigen wereunable to produce normal levels of IFN-y raises the question ofwhether this is due to the loss of IFN-y-secreting cells or a moregeneral effect on T cells. PMA and ionomycin activate PKC andraise cytosolic Ca2+, respectively, resulting in cytokine geneinduction.4' The fact that IL-2 production was unaltered, andIL-4 mRNA expression was increased, makes it unlikely that adefect in secondary messenger expression was responsible. Thereduction in IFN-y production could also be the result ofincreased IL-4 production. IL-4 is reported to suppress IFN-yproduction by human lymphocytes,2' probably by inhibitingIFN-y gene transcription.42

The increased capacity of ricin and antigen-treated rats toexpress IL-4 mRNA that we observed here agrees with previousreports of increased IL-4 production by mice induced toproduce IgE by immunization with anti-IgD.43 The increase weobserved in IL-4 mRNA expression after boosting with ricinand antigen supports the view that IL-4 is important in thesecondary as well as the primary IgE response.'3 The increase inIL-4 mRNA expression that was seen is probably due to thegreatly reduced levels of IFN-y that could be produced by thesplenic T cells. Studies aimed at determining the source of eachcytokine before and after the IgE response and at identifying thedirect effects ofCD8+ T cells on the development ofThl or Th2responses are currently in progress.

ACKNOWLEDGMENTS

This work is supported by grants from the Wellcome Trust, the MedicalResearch Council and the Special Trustees of Guy's Hospital.

REFERENCES

1. MOSMANN T.R., CHERWINSKI H., BOND M.W., GIEDLIN M.A. &COFFMAN R.L. (1986) Two types of murine helper T cell clones. 1.Definition according to profiles of lymphokine activities andsecreted proteins. J. Immunol. 135, 2348.

2. MOSMANN T.R., COFFMAN R.L. (1989) THl and TH2 cells: differentpatterns of lymphokine secretion lead to different functionalproperties. Annu. Rev. Immunol. 7, 145.

3. MOSMANN T.R. & MOORE K.W. (1991) The role of IL1O incrossregulation ofTh I and Th2 responses. Immunol. Today, 12, 49.

4. KAY A.B., YING S., VARNEY V., GAGA M., DURHAM S.R., MOQBELR., WARDLAw A.J. & HAMID Q. (1991) Messenger RNA expressionof the cytokine gene cluster, interleukin 3 (IL-3), IL-4, IL-5, andgranulocyte/macrophage colony-stimulating factor, in allergen-induced late-phase cutaneous reactions in atopic subjects. J. exp.Med. 173, 775.

5. STREET N.E. & MOSMANN T.R. (1991) Functional diversity of Tlymphocytes due to secretion of different cytokine patterns. FASEBJ. 5, 171.

6. DEL PRETE G.F., DE CARLI M., MASTROMAURO C., BIAGGOTTI R.,MACCHIA D., FALAGIANI P., Ricci M. & ROMAGNANI S. (1991)Purified protein derivative of Mycobacterium tuberculosis and

IgE regulatory CD8+ T cells and modulation of cytokine production 519

excretory-secretory antigen(s) of Toxocara canis expand in vitrohuman T cells with stable and opposite (type 1 T helper or type 2 Thelper) profile of cytokine production. J. cdin. Invest. 88, 346.

7. COFFMAN R.L. & CARTY J.A. (1986) A T cell activity that enhancesIgE production and its inhibition by interferon y. J. Immunol.136,949.

8. SNAPPER C.M. & PAUL W.E. (1987) Interferon-y and B cellstimulatory factor-i reciprocally regulate Ig isotype production.Science, 236, 944.

9. SNAPPER C.M., FINKELMAN F.D. & PAUL W.E. (1988) Differentialregulation of IgGl and IgE synthesis by interleukin 4. J. exp. Med.167, 183.

10. FINKELMAN F.D., KATONA I.M., URBAN J.F., SNAPPER C.M.,OHARA J. & PAUL W.E. (1986) Suppression of in vivo polyclonal IgEresponses to the lymphokine B-cell stimulatory factor 1. Proc. natl.Acad. Sci. U.S.A. 83,9675.

11. FINKELMAN F.D., KATONA I.M., URBAN J.F., HOLMES J., OHARA J.,TUNG A.S., SAMPLE Jv. & PAUL W.E. (1988) IL4 is required togenerate and sustain in vivo IgE responses. J. Immunol. 141, 2335.

12. FINKELMAN F.D., KATONA I.M., MOSMANN T.R. & COFFMAN R.L.(1988) IFN-y regulates the isotypes of Ig secreted during in vivohumoral immune responses. J. Immunol. 140, 1022.

13. FINKELMAN F.D., HOLMES J., KATONA I.M., URBAN J.F. JR,BECKMANN M.P., PARK L.S., SCHOOLEY K.A., COFFMAN R.L.,MOSMANN T.R. & PAUL W.E. (1990) Lymphokine control of in vivoimmunoglobulin isotype selection. Annu. Rev. Immunol. 8, 303.

14. PAGANELLI R., SCALA E., CAPOBIANCHI M.R., FANALES-BELASIO E.,D'OFFizi G., FIORILLI M. & AIUTI F. (1991) Selective deficiency ofinterferon-gamma production in the hyper-IgE syndrome. Rela-tionship to in vitro IgE synthesis. Clin. exp. Immunol. 84, 28.

15. REINHOLD U., WEHRMANN W., KUKEL S. & KREYSEL H.W. (1990)Evidence that defective interferon-gamma production in atopicdermatitis patients is due to intrinsic abnormalities. Clin. exp.

Immunol. 79, 374.16. BOGUNIEWICZ M., JAFFE H.S., IZU A., SULLIVAN M.J., YORK D.,

GEHA R.S. & LEUNG D.Y. (1990) Recombinant gamma interferonin treatment of patients with atopic dermatitis and elevated IgElevels. Am. J. Med. 88, 365.

17. MOSMANN T., SCHUMACHER J., STREET N., BUDD R., O'GARRA A.,FONG T., BOND M., MOORE K., SHER A. & FIRENTINO D. (1991)Diversity ofcytokine synthesis and function ofmouse CD4+ T cells.Immunol. Rev. 123,209.

18. GAJEWSKI T.F., JOYCE J. & FITCH F.W. (1989) Antiproliferativeeffect of IFN-gamma in immune regulation. III. Differentialselection ofTH 1 and TH2 murine helper T lymphocyte clones usingrecombinant IL-2 and recombinant IFN-gamma. J. Immunol.143, 15.

19. SWAIN S.L., WEINBERG A.D., ENGLISH M. & HUSTON G. (1990) IL-4directs the development of Th2-like helper effectors. J. Immunol.145, 3796.

20. FERNANDEZ-BOTRAN R., SANDERS V.M., MOSMANN T. R. & VITTETAE.S. (1988) Lymphocyte-mediated regulation of the proliferativeresponse ofclones of the T helper 1 and T helper 2 cells. J. exp. Med.168, 543.

21. PELEMAN R., WU J., EARGENE C. & DELESPESSE G. (1989) Recombi-nant interleukin 4 suppresses the production of interferon y byhuman mononuclear cells. J. exp. Med. 170, 1751.

22. GREENBAUM L.A., HOROWITZ J.B., WOODS A., PASQUALI T., REICHE.-P. & BOTrOMLY K. (1988) Autocrine growth of CD4+ T cells.Differential effects of IL-1 on helper and inflammatory T cells. J.Immunol. 140, 1555.

23. THORPE S.C., MURDOCH R.D. & KEMENY D.M. (1989) The effect ofthe castor bean toxin, ricin, on rat IgE and IgG responses.

Immunology, 68, 307.

24. DIAZ-SANCHEZ D. & KEMENY D.M. (1990) The sensitivity of ratCD8+ and CD4+ T cells to ricin in vivo and in vitro and theirrelationship to IgE regulation. Immunology, 69, 71.

25. DIAZ-SANCHEZ D. & KEMENY D.M. (1991) Generation of a long-lived IgE response in high and low responder strains of rat by co-administration of ricin and antigen. Immunology, 72, 297.

26. JARRETT E.E.E. (1978) Stimuli for the production and control ofIgEin rats. Immunol. Rev. 41, 52.

27. JARRETT E.E.E. & HALL E. (1981) Regulation of ongoing IgEantibody responses with minute doses of antigen. Eur. J. Immunol.11, 520.

28. DIAZ-SANCHEZ D., KEMENY D.M. & LEE T.H. (1993) Ricinenhances IgE responses by inhibiting a subpopulation of early-activated IgE regulatory CD8I T cells. Immunology, 78, 226.

29. BRIDEAU R.J., CARTER P.B., MCMASTER W.R., MASON D.W. &WILLIAMS A.F. (1980) Two subsets of rat T lymphocytes definedwith monoclonal antibodies. Eur. J. Immunol. 10, 609.

30. HSIUNG L.-M., BARCLAY A.N., BRANDON M.R., SIM E. & PORTERR.R. (1982) Purification of human C3b inactivator by monoclonalantibody affinity chromatography. Biochem. J. 203, 293.

31. WOOLLETT G.R., BARCLAY A.N., PUKLAVEC M. & WILLIAMS A.F.(1985) Molecular and antigenic heterogeneity of the rat leukocyte-common antigen from thymocytes and T and B lymphocytes. Eur.J. Immunol. 15, 168.

32. KEMENY D.M. & RICHARDS D. (1988) Increased speed and sensiti-vity, and reduced sample size of a micro-radioallergosorbent test(MRAST). J. immunol. Meth. 108, 105.

33. MCKNIGHT A.J., BARCLAY A.N. & MASON D.W. (1991) Molecularcloning of rat interleukin 4 cDNA and analysis of the cytokinerepertoire of subsets of CD4+ T cells. Eur. J. Immunol. 21, 1187.

34. CHOMCZYNSKI P. & SACCHI N. (1987) Single step method of RNAisolation by acid Guanidinium Thiocyanate-Phenol-chloroformextraction. Analyt. Biochem. 162, 156.

35. STAYNOV D.Z. & LEE T.H. (1992) Expression of interleukin-5 andgranulocyte-macrophage colony-stimulating factor in humanperipheral blood mononuclear cells after activation with phorbolmyristate acetate. Immunology, 75, 196.

36. TRUNEH A., ALBERT F., GOLSTEIN P., SCHMITT-VERHULST A.M.(1985) Early steps of lymphocyte activation bypassed by synergybetween calcium ionophores and phorbol ester. Nature, 313, 318.

37. TRUNEH A., ALBERT F., GOLSTEIN P. & SCHMITT-VERHULST A.M.(1985) Calcium ionophore plus phorbol ester can substitute forantigen in the induction of cytolytic T lymphocytes form specificallyprimed precursors. J. Immunol. 135, 2262.

38. BAKHIET M., OLSSON T., VAN DER MEIDE P. & KRISTENSSON K.(1990) Depletion of CD8+ T cells suppresses growth of Trypano-soma brucei brucei and interferon-gamma production in infectedrats. Clin. exp. Immunol. 81, 195.

39. GAJEWSKI T.F., SCHELL S.R., NAU G. & FITCH F.W. (1989)Regulation of T-cell activation: differences among T-cell subsets.Immunol. Rev. 111, 79.

40. RASANEN L., LEHTO M., REUNALA T., JANSEN C. & LEINIKKI P.(1987) Decreased monocyte production of interleukin-l andimpaired lymphocyte proliferation in atopic dermatitis. Arch.Dermatol. Res. 279, 215.

41. HARDY K.J., MANGER B., NEWTON M. & STOBO J.D. (1987)Molecular events involved in regulating human interferon-gammagene expression during T cell activation. J. Immunol. 138, 2353.

42. DELESPESSE G., SARFATI M. & HEUSSER C. (1990) IgE synthesis.Curr. Opin. Immunol. 2, 506.

43. FINKELMAN F.D., HOLMES J., URBAN J.F. JR, PAUL W.E. & KATONAI.M. (1989) T help requirements for the generation ofan in vivo IgEresponse: a late acting form ofT cell help other than IL-4 is requiredfor IgE but not for IgGl production. J. Immunol. 142, 403.