Energet ics o f R e c A - m e d i a t e d R e c o m b i n a t i o n R e a c t i o n s
Without ATP Hydrolysis RecA Can Mediate Polar Strand Exchange But Is Unable to Recycle
W a l t e r R o s s e l l i a n d A n d r z e j Stas iakl -
Laboratoire d 'A nalyse Ultrastructurale Universitd de Lausanne, Bdt iment de Biologic
CH-1015 Lausanne-Dorigny Switzerland
(Received 23 March 1990; accepted 6 J u l y 1990)
We demonstrate that the step of DNA strand exchange during RecA-mediated recombination reaction can occur equally efficiently in the presence or absence of ATP hydrolysis. The polarity of strand exchange is the same when instead of ATP its non- hydrolyzable analog adenosine-5'-O-(3-thiotriphosphate) is used. We show that the ATP dependence of recombination reaction is limited to the post-exchange stages of the reactions. The low DNA affinity state of RecA protomers, induced after ATP hydrolysis, is necessary for the dissociation of RecA-DNA complexes at the end of the reaction. This dissociation of RecA from DNA is necessary for the release of recombinant DNA molecules from the complexes formed with RecA and for the recycling of RecA protomers for another round of the recombination reaction.
1. Introduction
Many molecular aspects of homologous recombi- nation have been elucidated in vitro using RecA protein from Escherichia coli. Purified RecA promotes in vitro, without the co-operation of other proteins, several crucial steps of the recombination reaction, i.e. the recognition of homology between interacting DNA molecules, followed by DNA strand exchange and the dissociation of joint DNA molecules. In the presence of ATP or ATPTS$, RecA binds to ssDNA in a co-operative fashion forming helical filamentous complexes in which about six RecA protomers and 18 nucleotides of ssDNA contribute to one helical repeat of the complex with a pitch of about 95A (1 A=0.1 nm: Egelman & Stasiak, 1986, 1988; Heuser & Griffith, 1989). Such complexes are called presynaptic, since their forma- tion is a prerequisite for the synapsis stage of the recombination reaction (FIory et al., 1984). Presynaptic RecA-ssDNA complexes are able to bind selectively double-stranded DNA homologous
Author to whom all correspondence should be addressed.
to the strand resident within the complex (Flory et al., 1984; Stasiak et al., 1984; Christiansen & Griffith, 1986; Miiller et al., 1990). The step of DNA strand exchange is thought to initiate within these synaptic complexes, which contain two interacting DNA molecules (Howard-Flanders et al., 1984, 1987; Register et al., 1987; Stasiak & Egelman, 1987, 1988; Miiller et at., 1990). During the recombination reac- tion, RecA is hydrolyzing ATP, suggesting that the ATPase activity of RecA is necessary to drive the step of DNA strand exchange {Riddles & Lehman, 1985; Honigberg et al., 1985). The process of breaking the original hydrogen bonds and the process of directional branch migration were thought of as the stages of the recombination reac- tion that might require a direct push (Cox & Lehman, 1981a). Experiments with the use of the non-hydrolyzable analog of ATP, ATPTS, showed that RecA in the absence of ATP hydrolysis is able to mediate joints formation between homologous DNA molecules (Cox & Lehman, 1981a; Riddles & Lehman, 1985; Honigberg et at., 1985; Miiller et al., 1990). However, these joint molecules formed in the presence of ATPTS were not converted by RecA into the final product of the recombination reaction and dissociated easily after removal of RecA, in contrast to the final reaction products formed in the presence of ATP. According to one proposal, ATP hydrolysis is required for RecA to drive branch migration,
which would extend the short and unstable initial heteroduplex into a long and stable heteroduplex (Cox & Lehman, 1981a). According to another pro- posal, RecA requires energy from ATP hydrolysis to convert unstable DNA-DNA homology recognition interaction (of unknown structure) into a qualita- tively different structure of regular heteroduplex regions composed of strands from two interacting DNA molecules (Honigberg et al., 1985; Riddles & Lehman, 1985).
With discoveries of recombination-promoting enzymes that do not require ATP hydrolysis to promote the strand exchange reaction (Hsieh et al., 1986), the question of RecA ATPase function has become controversial. In fact, in homologous recom- bination, for almost every base-pair that is broken in parental DNA molecules a new one is reformed in recombinant DNA molecules. Therefore, the strict process of strand exchange does not require energy input. Experiments with appropriately constructed branched DNA molecules demonstrated that in the absence of any protein, branch migration, i.e. strand exchange, can occur spontaneously at the rate of about 80,000 bp per second at 37 °C (Radding et al., 1977). However, such spontaneous branch migra- tion proceeds as a two-directional random walk and the effective speed by which the branch point can move in one direction decreases sharply with the distance to be traversed. In the RecA-promoted strand exchange reaction, the speed of branch migration is only of the order of l0 bp per second (Cox et al., 1983) but it proceeds unidirectionally, thus ensuring that branch migration can traverse kilobase-long stretches of DNA at a constant pace (Cox & Lehman, 1981b; Kahn et al., 1981; West et al., 1981). That is why the directionality of RecA-promoted strand exchange was seen as the stage of recombination reaction that might require ATP hydrolysis (Cox & Lehman, 1981a). However, as an ATP-independent recombinase from human teukocytes was shown to mediate limited but polar strand exchange (Hsieh et al., 1986) it became ques- tionable whether ATP hydrolysis is at all necessary even for unidirectional branch migration.
One of the consequences of ATP hydrolysis is lowering the RecA affinity to DNA (Menetski & Kowalczykowski, 1985). The concept of an ATP-dependent RecA cycle was introduced to explain the apparent paradox that RecA must have high affinity to DNA, in order to form stable presy- naptic complexes, and yet has to be able to effec- tively dissociate from the product DNA molecules so that it can participate in new rounds of reactions involving other DNA molecules (Shibata et al., 1982; Kowalczykowski, 1987). We show here that, in the presence of ATP~S, this RecA cycle is blocked, although the actual pairing and strand exchange between homologous DNA molecules is not inhibited. We demonstrate that only the release of ReeA protomers from the complexes they formed with DNA and the recycling of ReeA protein for the new round of reaction is blocked in the absence of ATP hydrolysis.
2. Materials and Methods
(a) RecA protein
RecA protein was isolated from the E. coil strain KM4104 transformed with the plasmid pD1%1453 (Sancar & Rupp, 1979). RecA protein was purified by the pro- cedure described by Cox et al. (1981) to fraction III (without the purification step involving a single-stranded DNA cellulose column). The concentration was deter- mined using E~7=6-33, according to Tsang et al. (1985).
(b) D N A substrates
Single and double-stranded ~bX174 DNA were purchased from Bethesda Research Laboratories. Linear double-stranded ¢X174 DNA was produced by PstI (Boehringer) cleavage of double-stranded circular ~bXl74 DNA. Single-stranded Ml3mpl0 and Ml3mpll con- structs containing the 902 nueleotide long complementary inserts of ¢X174 DNA were kindly provided by Dr B. Miiller. The 902 nucleotide long inserts correspond to complementary strands of the 902 bp PstI-StuI restric- tion fragment of ¢X174 DNA. The otigonucleotides with the sequences 5'-TACGTTAACAAAAAGTCAGATATGG- ACCTTGCTGCTAAAGGTCTAGGAGCTAAA-3' (a frag- ment of the (+) strand of ~bXl74 DNA) and 5'-AGCTCC~AGACCTTTAGCAGCAAGGTCCATATC~- GACTTTTTGTTAACGTATTT-3' (a fragment of the ( - ) strand of ¢X174 DNA) were synthesized on a Pharmacia Gene Assembler and purified by 12~/o denaturing poly- aerylamide gel electrophoresis. The double-stranded 54-mers were produced by annealing the 2 strands in 150 mM-NaC1, 15 mM-sodium citrate by heating to 55°C for 30 min followed by slow cooling to room temperature. Each strand was present in 0"2 mM concentration (of nucleotides), after annealing, no residual ssDNA frag- ments could be detected by non-denaturing polyacryl- amide gel eleetrophoresis.
dsDNA (24 bp) was produced by Sau96I (Boehringer) cleavage of the double-stranded 54-mer, followed by puri- fication on a 12°/o polyacrylamide gel. 5'-End labeling of the 54-mers was performed at the level of single-stranded DNA using phage T4 polynueleotide kinase (Boehringer) and [~-32P]ATP (Amersham). Labeled duplex 54-reefs contained only 1 strand labeled and was produced by annealing of the labeled strand with the complementary non-labeled strand.
Concentrations of DNA were determined spectro- photometrically by using l Az6 o unit=36 #g/ml for ssDNA and 50 #g/ml for dsDNA. DNA concentrations are expressed as concentration of DNA nucleotides.
(e) Reaction conditions
(i) Recombination reactions between double-stranded linear ~X174 D N A and single-stranded circular ~X174 or M13 constructs
Single-stranded circular DNA at a concentration of 16 ~M (of nucleotides) and RecA at a concentration of 8 ~M were preincubated together for 5 min at 37 °C in the reaction mixture containing 25 mM-triethanolamine-HC1 (TEA-C1), pH 7"6, 20 mM-phosphocreatine, 10 units of phosphocreatine kinase/ml (for ATP regeneration), 2 mM-Mg(CH3CO0)2 and 2"5 mM-ATP or ATPyS. After this preincubation, double-stranded linear ~bX174 DNA at a concentration of 16pM was added and the Mg(CH3COO)2 concentration was raised to 5 mM. Samples taken from progressing reaction were adjusted to 1 °/o
RecA Cycle 337
(w/v) SDS and placed on ice until they were loaded on the gel. Samples were analyzed on 1% agarose gels run at 4°C or 20°C.
(ii) Reaction between ds54-mer and ss54-mer
Presynaptic RecA-ssDNA complexes were formed by incubating a reaction mixture containing 25 mM-TEA-acetate (pH 6"8), 8/~M-RecA, 25/~M-ssDNA 54-mers (DNA concentration is given in total concentra- tion of nucleotides), 2 mM-magnesium acetate, 2 mM-ATP~S or ATP for 5 min at 37°C. After this pre- incubation, 12"5pM-32p-5'-end labeled dsDNA (54bp) was added and the Mg 2+ concentration was raised to 5 mM. P~eaction mixtures were further incubated and portions were stopped at determined time points by adding SDS up to 0"8 to 1% for analysis of deproteinized DNA or fixed with 0-2O/o glutaraldehyde (15 rain at 37°C) for gel analysis of nucleoprotein complexes (complete strand exchange was observed also at pH 7"6, but the reaction was more efficient at pH 6"8, presumably because of a stabilizing effect of lower pH on presynaptic complexes formed with short oligonucleotides; McEntee et al., 1981). The ratio of RecA to ssDNA in this reaction was l RecA/3 nucleotides and the ratio of dsDNA mole- cules to ssDNA molecules was I/4. Samples were run for 14 h on 12% polyacrylamide gels.
(iii) Second round of recombination reaction with ds24-mer
RecA-ssDNA-ATP or RecA-ssDNA-ATP~S presynaptic complexes were formed following the same protocol as for kinetics reactions. After pre-incubation, 50 mM-32p-5'-end labeled dsDNA (54 bp) was added, the Mg z+ concentra- tion was raised to 5 mM and the samples were further incubated at 37°C. After the indicated time points, portions from the reactions were mixed with 100mM-unlabeled ds24-mer and incubated again for 30 rain. The reactions were stopped by adjusting to 0"8% SDS. The ratio of ReeA to ssDNA was l RecA/3 nucleo- tides, that of ssDNA to [32p]dsDNA was 1/2 and that of ssDNA to unlabeled dsDNA was 1/4. Samples were run for 20 h on 12% polycacrylamide gels.
(d) Assays
(i) Agarose gel electrophoresis Agarose gels (1%) in TAE buffer (50mM-Tris base,
20 mM-CHaCOONa, 2 mM-EDTA adjusted to pH 7-8 with acetic acid) were run for 14 h at 2"5 V/cm in a cold room (4°C) or in the laboratory (20°C). Low voltage was used to eliminate current-induced heating of the gels. Gels were stained with ethidium bromide and photographed on an ultraviolet light transilluminator.
(ii) Polyacrylamide gel electrophoresis Native polyacrylamide gels (40 cm long) were run at
300 V at room temperature in TBE buffer (89 mM-Tris, 89 mM-boric acid, 2 mM EDTA (pH 8"0) for 14 or 20 h. Gels were dried for 2 h at 60°C in Bio-Rad gel dryer and used to expose Fuji RX films.
(iii) Electron microscopy
Portions from the recombination reactions were fixed by the addition of glutaraldehyde to a concentration of 0"2% (diluted 10 times from a 2% stock solution in 100 mM-triethanolamine chloride (pH 7"5)). After fixation (15 min at 37°C)), 1/~l of every portion was introduced into a 20-/~1 droplet of 5 mM-magnesium acetate and used for adsorbtion onto glow-discharged carbon supports as described by Stasiak el al. (1981). After adsorption,
washing and dehydration in ethanol, specimens were rotary shadowed with carbon/platinum at an angle of 7 ° .
3. Results
(a) Joint molecules formed in the presence of A T P or A T P y S resemble each other
To establish the function of the ATPase ac t iv i ty of RecA during sequential stages of DNA recombi- nation, we compared in vitro recombinat ion reac- tions performed in the presence of A T P or in the presence of its pract ical ly non-hydrolyzable analog, ATPyS. We decided to s t a r t with the s tandard type of in vitro recombinat ion reaction; namely, the s t rand exchange reaction between double-s t randed linear and single-stranded circular DNA molecules from phage ¢X174. We assayed the reaction by gel electrophoresis of deproteinized DNA. The charac- teristic gel migrat ion of the circular double-s t randed DNA molecules produced in the reaction and of the in termediates of the reaction allow them to be differentiated f rom the subs t ra te DNA molecules (West et al., 1982). We were aware tha t Honigberg et al. (1985) and Cox & Lehman (1981a) used similar reactions and similar assays to conclude tha t recom- bination intermediates t ha t form efficiently in the presence of ATP?S depend for their s tabi l i ty on the presence of RecA and could not be seen on the gels after deproteinization. However , during our pre- l iminary exper iments we established a simple method to stabilize the recombinat ion reaction intermediates formed in the presence of A T P or ATP?S. We noticed t ha t deproteinized DNA inter- mediates of the recombinat ion reaction, the joint molecules, tend to dissociate, unless the DNA samples, af ter SDS-induced deproteinization, are kept on ice and the gels are electrophoresed a t low current a t 4°C. Figure 1 shows two gels with iden- tical samples but run a t different t empera tu res (samples were kept on ice until loading on the gel). The upper gel was run at 4°C, under conditions t ha t stabilize the in termediates of the reaction. The lower gel was run a t room tempera ture , under conditions t ha t allow joint molecules to dissociate. The upper gel shows tha t a sharp DNA band of recombinat ion intermediates is produced af ter abou t five minutes of the ATP-s t imula ted reaction (2nd lane). These in termediates (joint molecules, jm) migrate slightly slower than the reaction products , which appear a t later t imes (3rd and 4th lane). The fact t ha t joint molecules composed of linear duplex and circular single-stranded DNA migrate only slightly slower than nicked double- s t randed circle produced in the reaction was described by Hsieh et al. (1986). A similar band of in termediates (6th lane) is also observed in the reaction performed in the presence of ATPyS (although at a later t ime point and not followed by the appearance of the DNA products of the reac- tion). Interest ingly, the DNA intermedia tes (from both the A T P and ATP?S reactions) are not visible on the gel run a t 20°C (lower gel). In contrast , the
338 W. Rosselli and A. StasiaIc
II.o-jp- I.o Id jm cd
(a)
M
A T P A T P ~
5' 20' ' "' 40' 5' 40' M
(b)
20°C
cd-
ld-
(c) Figure 1. Temperature effect on the stability of the
DNA recombination intermediates. (a) A drawing of the strand exchange reaction between double-stranded linear ~bXl74 DNA and single-stranded circular ¢X174 DNA. (b) and (c) Samples from the reactions (performed as described in Materials and Methods) were kept on ice for up to 35 min after deproteinization with SDS and then loaded on 1% agarose gels run at (b) 4°C or (c) 20°C, both gels were run slowly to eliminate current-induced heating. Indications ld, jm and cd mark the position of substrate linear double-stranded DNA or of joint molecules, which are intermediates of reaction or of product (or marker, M) circular double-stranded DNA, respectively. Single-stranded DNA, which migrates quicker, is not present on these gels.
end products of the reaction, the nicked circular duplexes (cd), as expected, are not visibly affected by the temperature shift from 4°C to 20°C (3rd and 4th lane). Apparently, the deproteinized joint DNA molecules obtained after 40 minutes of ATPTS-stimulated reaction (or after 5min of ATP-stimulated reaction) dissociate back to
substrates at room temperature. This may be the reason that Honigberg et al. (1985) and Cox & Lehman (1981a) did not detect them using the standard gel electrophoresis assay. This explains also why, in our previous studies of RecA activity in the presence of ATPTS (Miiller et al., 1990), we noticed that only a small proportion of joint mole- cules formed in the presence of ATP~,S stayed as such on the gels after deproteinization. The simi- larity of the electrophoretic migration and of the temperature sensitivity of the joint molecules produces after five minutes of ATP or after 40 minutes of ATP?S-stimulated reaction suggest that these intermediates are of the same nature.
(b) The polarity of strand exchange reaction is the same in the presence of A T P or A TP~,S
We decided to investigate the structure of the easily dissociating joint molecules formed in the recombination reaction in the presence of ATP~S. It is well established and documented that depro- teinized DNA intermediates from later stages of ATP-stimulated recombination reaction are composed of interacting DNA molecules connected by partially exchanged strands. Connecting strands leave regular original duplex regions and run into regular heteroduplex regions (DasGupta et al., 1980; Cox & Lehman, 1981b). In the case of the reaction between linear duplex and the single-stranded circular DNA molecule, only one strand of lineal" duplex is exchanged by RecA in the polar way. Progressing from its 3' end, this connecting strand separates fi'om its original partner strand in favor of duplex formation with the complementary region of the single-stranded circle, while toward its 5' end the connecting strand remains in the old pairing arrangement (Cox & Lehman, 1981b; Kahn et al., 1981). It is questionable, however, whether easily dissociating recombination intermediates formed in the presence of ATP~S are joined by polarly exchanged strands. If ATP~,S blocks the recombina- tion reaction during the step of homologous recogni- tion, then polar strand exchange should not be observed (Honigberg et al., 1985). I t is theoretically possible that deproteinized early intermediates can still be joined by the interactions that have been implicated in the initial homology recognition. These interactions, like the nascent heteroduplex regions (Wu et al., 1982), or the postulated para- nemic DNA structure (Bianchi et al., 1983) or the coaxial triple-stranded arrangement (Howard- Flanders et al., 1984, 1987; Sta~iak et at., 1984; Stasiak & Egelman, 1987, 1988) can, in principle, form anywhere along the homologously aligned DNA molecules. Therefore, if the joint molecules observed on the gel are stabilized due to polarly exchanged strands, they should be observable only when the single-stranded circle has a region comple- mentary to the one of the 3' ends of the linear duplex (Fig. 2(a)). On the other hand, if the cold- stabilized joint molecules are connected by inter- actions involved in initial homology recognition,
RecA Cycle 339
Good end 5 ' 3 '
Wrong end 51 31
(a)
Complete homology ATP ATP]G
M 5' 15' 45': 5' 45'
L'imited homology
ATP,, ATP~S Wrong Good Wrong Good
end end end end 5' 45' 5' 45' 5' 45' 5' 45'
(b) Figure 2. Polarities of the strand exchange reactions performed in the presence of ATP or ATP?S. (a) A drawing of the
limited homology reactions. In "good end" reactions the insert in the ssM13 DNA construct is identical to the 5' terminal portion of the 902 bp long terminal segment of the (+) strand of the linear ¢X174 DNA. In contrast, in "wrong end" reactions, the insert in the ssM13 DNA construct is identical to the 902 nucleotides long terminal segment of the 3'-terminal portion of the (+) strand of the linear ~bX174 DNA. Thick lines on the drawings indicate local identity of the DNA strands. Complete homology reaction is the same as described in Fig. l(a). (b) Samples from the ongoing reactions (performed as described in Materials and Methods) were loaded on 1% agarose gel after SDS-indueed deproteinization and run at 4°C. The appearance of DNA bands that migrate slower than linear ~bX174 DNA indicates the formation of joint molecules between the linear ¢X174 DNA and ssM13 construct. Indications ld and ed mark position of linear and circular ds ~bX174 DNA, respectively. Indications ¢-~b and ¢-M mark the position of joint molecules between ¢X174 double-stranded DNA molecule and ~bX174 single-stranded DNA or between ~bX174 double-stranded DNA molecule and M13 single-stranded construct, respectively.
such joint molecules should be observable irrespec- tive of the reciprocal location of homologous regions in the interacting DNA molecules. We used a pair of M13 ssDNA constructs containing complementary 902 base long inserts from phage ¢X174. When we mixed these constructs with PstI-linearized double- s t randed ¢X174 DNA, then the 902 bp long inserts in circular DNA .were complementary either to the 3'-terminal portion or to the 5'-terminal portion of the opposite strands of the linear duplex (Fig. 2(a)).
The gel run at 4°C (to stabilize the joint molecules) shows (Fig. 2(b)) tha t both ATP and ATP?S-st imulated reactions produced joint mole- cules only when the insert in the M13 construct was complementary to the 3'-terminal port ion of one of the strands of the linear duplex ¢X174 DNA (complete homology and good end reactions). In the complete homology reactions, the 3'-terminal portion (and the rest) of the ( - ) s t rand of the duplex ¢X174 DNA is of course complementary to
340 W. RosseUi and A. Stasiak
the (+) single-stranded circular ¢X174 DNA. As the "wrong end combinations" (Fig. 2) did not lead to the appearance of joint molecules on the gels, we conclude that the observable on gels, cold-stabilized early intermediates produced in ATP-stimulated reaction and those produced in ATP?S-stimulated reaction consist of classical branched molecules connected by partially exchanged strands. We also conclude that ATP and ATP~S-stimulated strand exchange reactions have the same polarities. The polarity we observed does not contradict the apolar nature of pairing reactions observed in the presence of ATP?S {Cox et al., 1981b; Honigberg & Radding, 1988) or ATP (Cox et al., 1981; Wu et al., 1982) but rather indicates that the joint molecules stabilized just by the interactions involved in pairing stage of reactions do not resist deproteinization followed by gel electrophoresis. What we can observe are the molecules stabilized by initiated strand exchange. The fact that cold-stabilized joint molecules observed on the gels dissociate at room temperature back to the substrates rather than to the products (Fig. l(b) and (c) indicates that only a short 3'- terminal portion of the exchanged strand is trans- ferred from the linear duplex to the recipient single- stranded circle. Spontaneous branch migration has then much higher probability to resolve the inter- acting molecules back to the substrates than to the products of the recombination reaction (Honigberg et al., 1985).
(c) Strand exchange reactions performed in the pre- sence of A T P or A T P ? S have similar e~ciencies
We were puzzled by the fact that, despite showing clear polarity, the strand exchange reaction in the presence of ATP~S did not lead to formation of the recombination products (nicked double- stranded circles and single-stranded linear DNA molecules), but only to the accumulation of recom- bination intermediates (Fig. 1, lane 6). I t seemed that the progressing strand exchange occurring in the presence of ATP?S encounters a block on its way. I t is established that presynaptic complexes have to contain ssDNA in an extended form devoid of paired secondary regions, in order to be fully active in the process of strand exchange (Muniyappa et al., 1984). Since RecA in the presence of ATP binds quicker to ssDNA than to dsDNA (Pugh & Cox, 1987a) this helps to completely unravel the ssDNA contained in the presynaptic complexes formed in the presence of ATP. On the other hand, in the presence of ATP?S, ReeA shows high affinity to ssDNA and to dsDNA, therefore it is likely that some regions of secondary structure may remain as such in this type of presynaptic complexes containing ¢X174 ssDNA (Honigberg et al., 1985). These duplex regions in presynaptic complexes may then block the ongoing strand exchange (Muniyappa et al., 1984).
To avoid this possible obstacle of strand exchange reaction performed in the presence of ATP~S, we decided to try reactions involving short palindrome-
free ssDNA molecules, which should therefore be devoid of duplex-type secondary structures.
We carried out strand exchange reactions between short linear dsDNA molecules and homolo- gous linear ssDNAs. We have chosen the length of slightly above 50 nucleotides, as this has been reported as the safe minimal length for DNA frag- ments to be homologously paired in vivo (Singer et al., 1982) or in vitro using RecA protein (Gonda & Radding, 1983). We chose a natural 54 nucleotide sequence from phage ~bX174 DNA, which is free of palindromes larger than six nucleotides but which contains six conveniently located restriction endo- nuclease sites, useful in further experiments (this sequence is given in Materials and Methods). To distinguish between substrates and products of the reactions, we end labeled either ssDNA entering the reaction or the strand of the duplex DNA that is displaced in the process of strand exchange (see Figs 3(a) and 4(a)),
Figure 3(b) shows the autoradiogram of poly- acrylamide gel electrophoresis analysis of in vitro strand exchange reactions performed in the presence of ATP (lanes g to k and o to q) or in the presence of ATP~S (lanes b to f and l to n). The single-stranded 54-mer entering the reaction was unlabeled, while double-stranded 54-mer was labeled on the 5' end of the strand, which is displaced in the process of reaction. Therefore, the signal at the position of the single-stranded 54-mer is that of the product of reaction, while the signal at the position of the double-stranded 54-mer is that of the substrate or of the product of subsequent rounds of reactions, as these would lead to the reformation of the origninal substrate. In the reactions analyzed, unlabeled single-stranded molecules were in fourfold excess over the number of labeled duplexes, therefore sub- sequent rounds of reaction could lead to an equili- brium-like situation where about one out of five duplex DNA molecules would have the labeled strand.
Samples of the reactions were taken at the indi- cated time points and immediately deproteinized with SDS, or fixed with glutaraldehyde. Both reac- tions were, therefore, analyzed at the level of depro- teinized DNA (left side of the gel) and at the level of nucleoprotein complexes (right side). On the left side of the gel (Fig. 3(b)) it is shown that the effi- ciency of the reaction performed in the presence of ATP?S seems to be even greater than that of the reaction performed in the presence of ATP. In the ATP?S-stimulated reaction, practically all substrate molecules are converted into the products after five minutes of reaction, the ATP-stimulated reaction levels off after about two minutes of reaction (reaching equilibrium or stopping), leaving a substantial part of the DNA molecules in the original arrangement. Comparisons of the kinetics of the early points of the reaction (20 and 40 s) suggest that the ATP reaction might be quicker, but two minutes of reaction are sufficient to convert the majority of substrate into products in both ATP and ATP?S-stimulated reactions. Since the amount
Figure 3. RecA-mediated strand exchange in the presence of ATP and ATP~S. (a) A drawing of the reaction; substrate ds54-mer was labeled at the strand that gets displaced in the reaction, this strand forms then the labeled single-stranded product of the reaction. (b) The reactions (R) were performed as described in Materials and Methods, samples from ongoing reactions were analyzed by electrophoresis on 12°/o polyacrylamide gel after deproteinization with SDS {left panel) or fixation with glutaraldehyde {right panel). The nucleotide cofactor for the reactions was ATP~S {lanes b to f and l to n) or ATP {lanes g to k and o to q). Time points are indicated. Lanes a and r: control reactions (C) run in the absence of RecA or nucleotide cofactor, respectively. The arrowhead indicates the positons of the gel slots, glutaraldehyde fixed RecA-DNA complexes do not enter 12% polyacrylamide gel and stay in the slots. Indications ds and ss mark the position of ds54-mer and ss54-mer.
(b) Figure 4. The dsDNA and ssDNA can be released from the R e c A - D N A - A T P complexes but not from the
RecA-DNA-ATPvS complexes. (a) A presentation of the reaction (analyzed in lanes b to g and i to n); ssDNA 54-mer entering the reaction was labeled and therefore the produced ds54-mer becomes labeled. In the reactions analyzed in lanes a, h and o to t duplex 54-mer was not added to preformed presynaptic RecA-ssDNA complexes to s tudy the sole effect of RecA-ssDNA interaction. (b) Reactions (R) were performed as described (see Materials and Methods) and the presynaptic complexes (P) were formed the same way as those part icipat ing in the reactions. Samples were prepared after the indicated time points. Left panel: SDS-deproteinized samples; right panel: glutaraldehyde-fixed samples. Lanes b to d and i to k: samples from the reaction in the presence of ATPvS, lanes e to g and t to n: reaction in the presence of ATP. Presynaptic complexes formed in the presence of ATP~,S or ATP, deproteinized after 5 min of incubation (lanes a and h, respectively), or fixed after different times of incubation (lanes o to q and r to t). The arrowhead indicates the positions of the gel slots. Indications ds and ss mark the positon of ds54-mer and ss54-mer.
RecA Cycle 343
of ATP~S hydrolysis is negligible after such a short time of reaction (Weinstock et al., 1981 ), this experi- ment indicates that ATP hydrolysis is not necessary for the strand exchange process to occur, although it might affect the kinetics and the final yield of the reaction.
Although deproteinization was used to analyze the efficiency of recombination reactions (left side of the gels of Figs 3 and 4), it can be assumed here that the deproteinization procedure simply liberates the DNA molecules from the complexes formed with RecA and does not trigger the strand exchange reaction between the DNA molecules that are only homologously aligned within RecA helical illa- ments. This assumption is supported by the observation that different ways of deproteinization (SDS treatment, extraction with phenol or sponta- neous dissociation of RecA protein during gel electrophoresis) did not change the outcome of the reactions performed in the presence of ATP~S or ATP (data not shown). It is possible, however, that the interacting strands within the postsynaptic complexes form an intermediate type of structure just poised to be converted to the DNA products of the reaction upon dissociation of RecA. This puta- tive poising toward products should be very strong, as we observe up to 100~o conversion to the products in the ATPTS-stimulated reaction. Formation of such intermediate structure being energetically closer to the products than to the substrates of the reaction would be formally equiva- lent to mediating DNA strand exchange.
(d) DNA products of recombination reactions performed in the presence of A TP~S remain stably bound by RecA, but appear as protein-free DNA in
the reactions performed in the presence of A TP
Analyzing the recombination reaction at the level of deproteinized DNA molecules (Fig. 3(b), left side of the gel), one might have the impression that ATP hydrolysis does not affect significantly the recombi- nation activity of RecA protein. However, the inspection of the reaction at the level of the nucleo- protein complexes (Fig. 3(b), right side of the gel) reveals significant differences between the reactions performed in the presence of ATP or ATP~S. In reactions performed in the presence of ATP~S (lanes 1 to n) ssDNA and dsDNA molecules become stably bound by RecA (strong signal in the gel slots, as complexes do not enter the gel, and no signal at position of protein-free DNA). RecA-DNA-ATP~S complexes do not dissociate, even after two hours of incubation (not shown). In contrast to this, in the reactions performed in the presence of ATP, a significant fraction of double-stranded 54-mers was detected as protein-free DNA during the reaction (lanes o to q), while after about 30 minutes single- stranded 54-mers also appear in the form of protein free DNA (lane q).
The fact that deproteinization reveals the pre- sence of single-stranded products of reaction after 20 seconds (lane g), while spontaneous appearance
of protein-free ss54-mer requires about 30 minutes (lane q), indicates that in ATP-stimulated reaction protein-free ssDNA molecules do not appear in the reaction medium as a direct result of the DNA strand exchange reaction. Dissociation of RecA-ssDNA-ATP complexes is rather a conse- quence of a general decrease of RecA affinity to DNA resulting from the accumulation of ADP in the reaction mixture (Menetski & Kowalczykowski, 1985). This was confirmed in our additional experi- ments (not shown), where the ATP regeneration extended the time needed to see protein-free ssDNA products in the reactions performed in the presence of ATP. Other control reactions showing that the presence of ds54-mer partner is not required for the reappearance of protein-free ss54-mer in the reac- tion mixture (Fig. 4, lanes s and t) also demon- strated that the ATPase activity of RecA, induced by incubation with ssDNA, and not the process of strand exchange is important for the release of ssDNA from the complexes it formed with RecA.
The observation that about l0 to 20~o of the labeled strands entering the reaction as duplex DNA can be detected through the reaction as pro- tein-free labeled duplexes, even before ADP accumulation causes complete dissociation of the RecA-DNA complexes, is rather difficult to inter- pret on the basis of Figure 3 alone. The labeling employed in the reactions analyzed in Figure 3 does not allow one to tell if the labeled protein-free duplex DNA molecules, observed in the ATP-stimulated reaction, originate from the substrate duplex DNA molecules that did not enter the reaction or from the labeled duplex created as result of the second or even further rounds of reac- tion. However, in the reactions where ssDNA entering the reactions was labeled (Fig. 4), the formation of labeled double-stranded products could be followed and these appeared in the reaction mixture as a protein-free dsDNA as soon as the actual DNA strand exchange took place (as judged from the comparison of glutaraldehyde and SDS-treated samples). Comparison of the reactions in which single-stranded or double-stranded 54-mer entering the reactions were labeled indicates that in ATP-stimulated reactions product duplex 54-met quickly leaves the postsynaptic complex it formed with RecA. In contrast, the single-stranded product of the reaction does not appear in the protein-free form after the recombination reaction. Probably the ssDNA product leaves the postsynaptic complex but is then immediately bound again by the free RecA protomers. Only after the accumulation of ADP lowers RecA affinity to ssDNA can this ssDNA be seen as protein-free DNA in the reaction mixture. In the reactions performed in the presence of ATP~S, synaptic complexes are active in the process of strand exchange, but the product DNA molecules (single and double-stranded) are stably trapped within the complexes they form with RecA (compare corresponding glutaraldehyde and SDS-treated samples analyzed on gels shown in Figs 3 and 4).
(a ) (b) (c )
(d) ( , ) ( t )
Figure $. ELectron micrographs of RecA-DNA complexes during in vitro recombination reactions performed in the presence of ATP or ATP?S. (a) Representative molecules characteristic for subsequent stages of the recombination reaction performed in the presence of ATP. (a) Early stage of pairing: protein-free duplex DNA gets enveloped into presynaptic RecA-ssDNA complex containing circular ssDNA. Part of duplex DNA is already enveloped into the RecA complex as the visible, protruding part is shorter than the second dsDNA molecule (top left), which does not yet interact with RecA-ssDNA complex. (b) Initiation of strand exchange: RecA starts to dissociate from the complexes beginning from the site where strand exchange initiates. Most likely, strand exchange is done and ReeA is not needed at this region (Stasiak et al., 1984). (e) Progressing strand exchange: the region where RecA dissociates becomes bigger. Notice that the whole duplex is taken into the complex (the protruding tail is not visible) and that the naked DNA region, visible where RecA dissociated, contains apparently all 3 DNA strands participating in the reaction. Coaxial arrangement of DNA strands is probably the reason why the displaced strand can not get separated from new duplex as long bound RecA limits swiveling of DNA at the nick site (Stasiak & Egelman, 1987). (d) to (f) Molecules characteristic for recombination reaction performed in the presence of ATP~S. Protein-free duplex DNA molecules get enveloped into presynaptic RecA-ssDNA-ATP~S complexes. The region of the complexes where duplex is enveloped resist the fixation procedure much better and retain thefr characteristic striated structure in contrast to regions that contain only ssDNA and that slightly collapse upon glutaraldehyde fixation. Even after extended incubation times (more than 60 min) there is no dissociation of RecA from the sites where strand exchange starts. Gel assays (Figs 4 and 5) demonstrate that there is strand exchange goining on in these reactions. The bar represents 100 rim.
RecA Cycle 345
We wanted to complement our gel data with direct electron microscopical observations of recom- bining molecules. Unfortunately, short oligo- nucleotides covered with RecA turned out to be difficult to distinguish from short self-polymers of RecA (DiCapua et al., 1990). Therefore we returned to observations of recombination reaction between full-size single-stranded circular and double- stranded linear ~X174 DNA molecules. Figure 5 shows comparison between joint molecules observed in reactions performed in the presence of ATP (Fig. 5(a) to (c)) and ATP~S (Fig. 5(d) to (f)). Both reactions start with the uptake of homologous pro- tein-free duplex DNA by the presynaptic complexes. This uptake seems to proceed by enve- lopment of protein-free duplex into helical RecA-ssDNA complexes, as shown and discussed for ATP (Stasiak et al., 1984; Register et al., 1987; Howard-Flanders et al., 1987; Stasiak & Egelman, 1987, 1988) and ATP?S reactions (Miiller et al., 1990). In the ATP reactions, after part of the duplex DNA has been enveloped in the complexes, RecA starts to dissociate from the synaptic complexes (Fig. 5(b) and (c)), beginning at the region corresponding to the location of the 5' end of the strand to be displaced in the reaction (see also Stasiak et al., 1984; Register et al., 1987; Stasiak & Egelman, 1987, 1988). The 5' end of the strand to be displaced is the site where the strand exchange starts, i.e. where synaptic pairing association begins to get converted into postsynaptic heteroduplex formation. In contrast to ATP reactions, in ATP~S reactions we did not observe any dissociation of RecA from the region corresponding to the location of the 5' end of the enveloped duplex (the region where the duplex is enveloped into ATP?S synaptic complexes is easily distinguishable from the rest of the complex due to its regular striated structure; see also Miiller et al., 1990). As the joint molecules obtained after deproteinization seem to be connected by partially exchanged strands (Figs 1 and 2), we conclude that ATP~S blocks RecA disso- ciation from the DNA regions where strand exchange has already occurred.
Thus both electron microscope and gel data lead to the conclusion that in the presence of ATP RecA dissociates from the DNA products of recombina- tion reaction, while in the ATP~S reaction RecA stays associated with the DNA products of recombi- nation reaction.
(e) The ATPase activity of RecA reactivates RecA protomers after each round of the recombination
reaction
It is well established that ATP hydrolysis modu- lates (lowers) RecA affinity to DNA (Menetski & Kowalczykowski, 1985). Kowalczykowski (1987) proposed that the detachment of RecA from DNA induced by ATP hydrolysis is necessary to over- come the seemingly paradoxical fact that RecA has to bind stably to the DNA substrates and has to be able to dissociate from the DNA products of recom-
bination. Such dissociation would allow RecA pro- tomers to participate in more than one round of the recombination reaction. A separate question is whether a certain ratio of ATP to ADP, in conjunc- tion with the ATPa~e activity of RecA, is sufficient to cause local RecA detachment from the products of recombination reaction and to support produc- tive binding of RecA protomers to another target DNA molecule. Alternatively, the massive accumu- lation of ADP might be necessary to induce the complete detachment of RecA from the DNA pro- ducts (like the release of protein-free ssDNA observed after extended time of incubation in the reactions analyzed in Figs 3(b) and 4(b)) which, when followed by a rise in the concentration of ATP, would allow RecA to bind to another DNA substrate and to perform another round of the reaction.
In order to evaluate how the ATPase activity of RecA contributes to RecA turnover in the recombi- nation reaction, we tested the ability of RecA to perform more than one round of the recombination in reactions performed in the presence of ATP~S (where the dissociation of post-exchange RecA-DNA complexes seems to be blocked) or of ATP (which allows transient or complete dissocia- tion of the post-exchange RecA-DNA complexes). In this assay, the DNA products of the first round of recombination reaction became substrates for the second round. The first round of recombination consisted of the standard strand exchange between unlabeled single-stranded 54-mer and homologous duplex 54-mer labeled on the strand that gets dis- placed in the process of reaction (reaction identical to that presented in Fig. 3(a) and (b)). To this ongoing reaction, unlabeled double-stranded 24-mer was added. This 24-mer was a truncated version of the double-stranded 54-mer and was therefore com- pletely homologous to the 5' "half" of the labeled strand displaced in the first round of the reaction. In the second round of the reaction (Fig. 6(a)), the labeled single-stranded 54-mer, produced in the first round of the reaction, can act as the acceptor for strand exchange with duplex 24-mer giving the recombination product with a characteristic, although somewhat surprising, slow migration on the gel (Fig. 6, lanes e to g). The labeled single- stranded 54-mer produced in the first round of recombination can also act as the acceptor for the strand exchange with double-stranded 54-mer pro- duced in the first round or present from the begin- ning in the reaction mixture. However, the product of such a second round of reaction, the labeled duplex 54-mer, could not be differentiated on the gel from the labeled duplex 54-mer that did not react at all in the setup reaction. I t is important to realize that the characteristic reaction product, the labeled 54-mer strand paired with 24-mer strand, can not arise in just one round of reaction between the substrate, labeled double-stranded 54-mer and added later duplex 24-mer. Duplex:duplex recom- bination requires a much higher concentration of Mg 2+ (20 to 25 mM-Mg 2+ instead of 5 mM, as used
346 W. Rosselli and A. Stasiak
II-I--I. IILi '-'.11 1 2
(a)
o3 co rt ~ ATPTS ATP ~" <
C R R C
3 0 ' 5' 30' 1' 5' 10' 30' 3 0 '
a b c d o f g h i j
"i I :.; i,
-hd
- d s
J -SS
(b) Figure 6. RecA is able to promote more than 1 round of
the recombination reaction in the presence of ATP but not in the presence of ATP~S. (a) A presentation of the reaction. Labeled ss54-mer produced in the 1st round of the reaction can react in the 2nd round with the added ds24-mer forming characteristic "heteroduplex". (b) Reactions were performed as described (Materials and Methods) in the presence of ATPTS (lanes c and d), in the presence ofATP (e to h). Lanes a, b, i and j: controls run in the absence of 24-mer dsDNA or of ssDNA, respect- ively. Time points indicate the time of addition of 24-mer to the ongoing " ls t round" of reaction. All samples from recombination reactions were stopped and deproteinized for 30 min after addition of 24-mer to the reaction. The indications ss, ds and hd mark the position of ss54-mer, ds54-mer and the "heteroduplex" 24-mer : 54-mer produced in the 2nd round of reaction. The positon of this heteroduplex recombination product on the gel was confirmed by observing migration of the annealing product between ss24-mer and ss54-mer (not shown).
here) and the presence of a single-stranded region in one of the par tner duplex DNA molecules (West et al., 1982). Our controls showed lack of the duplex : duplex reaction between duplex 54-mer and
duplex 24-mer under the conditions applied here (Fig. 6, lanes i and j). Therefore, the formation of the characteristic slowly migrating DNA product (labeled 54-mer s trand paired with 24-mer strand) is a good indication of whether the given reaction conditions permit RecA to perform more than one round of the recombinat ion reaction. As can be seen in Figure 6, in the reaction performed in the pre- sence of ATP~S (lanes c and d) the first round of recombination can occur very efficiently, while there are almost no traces of the second round (labeled, displaced 54-mer s trand appears, ss, but not the "heteroduplex" , hd). In the reactions performed in the presence of ATP, the second round of reaction could occur when the short duplex 24-mer was added early to the reaction mixture (Fig. 6, lanes e to g). When the short duplex was added later, af ter ADP accumulated in the reaction mixture, the second round of the recombination reaction could not occur (Fig. 6, lane h). The fact tha t ATP reac- tion did not need addition of fresh ATP to promote the second round of the recombination reaction suggests tha t the ATPase act ivi ty of RecA in con- junction with a certain ratio of ATP to ADP are sufficient to cause local RecA detachment from the products of recombination reaction and to support product ive binding to RecA protomers to another target DNA molecule. I t could indicate tha t in vivo one would not need any fluctuation of the ATP level to allow RecA to part icipate more than once in the recombination reaction.
In the reactions analyzed on the gel shown in Figure 6, we tried to create conditions where practi- cally all RecA protomers present in the reaction mixture had to be involved in the first round of recombination reaction. The presynaptic complexes with unlabeled single-stranded 54-mers were formed at 90~/o RecA saturat ion (taking as sa turat ion value 1 RecA/3 nucleotides: Egelman & Stasiak, 1986) so tha t there was no excess RecA in the reaction. We do not know whether all input RecA was bound to DNA in the first round of reaction, bu t as we observed efficient recombination reaction and the reported minimal RecA saturat ion tha t permits recombination reaction is about 70~o (Tsang et al., 1985), we conclude tha t practically all RecA pro- tomers were already bound to DNA during the first round of recombination reaction. I f there was a small fraction of unbound RecA during the first round of the reaction, this fraction could form only highly unsatura ted complexes (20% of saturat ion) with the ssDNA tha t served as substrate of the second round of the reaction. Such undersa tura ted complexes can not be active in the recombination reaction. Binding of additional RecA, which had part icipated already in one round of reaction thus would be required to observe a second round of the recombination reaction. Therefore, we conclude tha t most of the RecA molecules involved in the second round of reaction had already par t ic ipated in the first round.
The experiments analyzed in Figure 6 indicate tha t the ATPase act iv i ty of RecA is required to
RecA Cycle 347
allow RecA protomers to participate in more than one round of reaction. We propose that the main point of RecA ATPase activity is to allow RecA to dissociate from the DNA products of recombina- tion. The released RecA protomers could bind again to new DNA substrates and form active presynaptic complexes when there is enough ATP in the reaction mixture. The fact that RecA-DNA complexes formed in the presence of ATPyS are active in only one round of recombination and are subsequently stabilized in the form of RecA-DNA postsynaptic complexes supports this proposal.
4. Discussion
When this work was finished, we became aware that Menetski et al. (1990) had established that RecA can mediate DNA strand exchange in the absence of ATP hydrolysis. They demonstrated that joint molecules formed in the presence of ATPyS have the form of branched molecules with up to 3400 bases transferred from the original duplex into the recipient single strand. On the basis of this and of the knowledge about the stability of the RecA-DNA complexes formed in the presence of ATPyS, they postulated that ATP is necessary for the dissociation of the postsynaptic complexes but not for the pairing or the DNA strand exchange step of the recombination reaction. As our experiments confirm and extend the findings of Menetski et al. (1990) we feel that concept of ATP hydrolysis inde- pendence of the DNA strand exchange step of the recombination reaction is now well documented. The model of RecA action we present below is conceptually similar to the model presented by Menetski et al. (1990) but, arriving from a different experimental approach, it complements and confirms that proposed earlier.
(a) Energetic model of the RecA-mediated recombination reaction
We demonstrated here (similarly to the indepen- dent work of Menetski et al., 1990) that the RecA-mediated DNA strand exchange step of the recombination reaction can occur with almost equal efficiency in the absence of ATP hydrolysis as in the normal physiological conditions where ATP is hydrolyzed by RecA (Fig. 3). We noticed that the DNA products of the recombination reaction can be released from the complexes they formed with ReeA if the reaction is performed in the presence of ATP. In contrast, the DNA products remain stably bound by RecA if the reaction is performed in the presence of ATP~S (Figs 3 and 4). In addition, we demon- strated that RecA is able to perform more than one round of recombination reaction in the presence of ATP hydrolysis, while RecA action is limited to only one round in the absence of ATP hydrolysis (Fig. 6). These findings lead us to a refinement of the molecular model of single-stranded : double- stranded DNA recombination reaction (Howard- Flanders et al., 1984) with respect to the function of ATP hydrolysis (Fig. 7).
According to this refined model, binding of ATP or ATP?S by RecA protomers is needed to form functional presynaptic complexes with single- stranded DNA (Fig. 7, I). These complexes, which contain ssDNA in an extended and exposed con- figuration for pairing, have selective .ability to bind duplex DNA that is homologous to the ssDNA resident in the complex. After homologous recogni- tion (Fig. 7, II), the complexes contain all three DNA strands taking part in the recombination. Electron microscopy data presented here {Fig. 5) and elsewhere (Stasiak et al., 1984; Register et al., 1987; Stasiak & Egelman, 1987, 1988; Miiller et al., 1990) suggest that the actual step of DNA strand exchange {Fig. 7, III) occurs within these synaptic complexes containing three DNA strands partici- pating in the reaction. After strand exchange, when the objective of the reaction is achieved, ReeA is no longer needed and can dissociate from the post- exchange complexes it formed with the DNA. We demonstrated in this work that the dissociation of the post-exchange complexes {Fig. 7, IV) is the only stage of the reaction that requires ATP hydrolysis and therefore can not occur in the presence of ATP?S (see also Menetski et al., 1990). After disso- ciation of postsynaptic complexes, the DNA products of the reaction are freed and RecA protomers are also free to form new presynaptic complexes if enough ATP is present in the reaction mixture (Fig. 7, I).
(b) What drives the recombination reaction?
As homologous recognition and strand exchange during the recombination reaction can occur without the need for ATP hydrolysis, this leads to the question of what drives these steps of the reac- tion? From the experiments where the strand exchange was performed in the presence of ATP~S (Fig. 3), we know that the recombination reaction is unidirectional and not an equilibrium type of reac- tion, driven by differences of effective concentra- tions of substrates and products. Since in the reactions studied the substrates (single-stranded 54-mer and labeled double-stranded 54-mer) do not differ in structure from the products (double- stranded 54-mer and labeled single-stranded 54-mer), the equilibrium driven reaction can not be biased toward the products. Taking into account that RecA is able to perform only one round of recombination reaction in the presence of ATP?S, then even in the reactions with a fourfold excess of unlabeled single-stranded 54-mer over labeled double-stranded 54-mer, the maximum extent of the equilibrium driven reaction could amount to 50 °/o. This maximum could be achieved only ff all double-stranded 54-mers formed homology-depen- dent intermediates with single-stranded 54-mers. Unbiased dissociation of these intermediates would lead to the conversion of only 50~/o of labeled duplexes into labeled single-stranded DNA. Instead, we observed almost complete conversion of labeled double-stranded 54-mers into labeled single-
348 W. Rosselli and A. Stasialc
ATP
presynoptic complexes
) "IT. Homologous recognition
.~_~) ADP +
TY. ATP hydrolysis- dependent dissociation of post-exchange complexes
Figure 7. Model of RecA-mediated recombination reaction. Cycle of the RecA reaction. In this representation of the recombination reaction, DNA molecules and RecA-DNA helical filaments are viewed along their axes. 0nly a short segment corresponding to 1 base-pair step is shown. In the presence of ATP or ATPTS, the reaction can proceed through: (I) formation of presynaptic complexes, (II) homologous recognition and (III) DNA strand exchange. These 3 steps of the recombination reaction are driven by the RecA-DNA binding energy. Therefore, RecA-DNA complexes after each of these 3 steps become more and more stable and their free energy becomes lower (decrease of the free energy is illustrated by lowering the position of the RecA and DNA in the drawing). At the end of the reaction, it is necessary to dissociate the stable postsynaptic RecA-DNA complexes (IV), ATP hydrolysis is necessary for this dissociation, which brings all components (RecA and DNA) back to the starting energy level (top of the drawing) thus closing the cycle of the RecA reaction. ATPTS can not support this step of reaction.
s t randed 54-mers (Fig. 3, lanes b to f). Wh a t can drive this almost irreversible reaction in the absence of direct energy input?
We propose tha t the binding energy of RecA to
DNA is the driving force behind the processes of formation of presynaptic complexes (Fig. 7, I), homologous recognition (Fig. 7, II) and s t rand exchange (Fig. 7, I I I ) . The formation of presynapt ic
RecA Cycle 349
complexes with single-stranded DNA would be driven by the binding energy when the free energy of uncomplexed ssDNA and of ReeA protomers in solution is higher than the free energy of the ReeA-ssDNA complexes. The homologous recogni- tion, consisting of occupation of the second binding site within the helical RecA complexes by the duplex DNA that is homologous to the single-strand resident in the complex (Takahashi et al., 1989; Miiller et al., 1990), also can be driven by the RecA-DNA binding energy. The selectivity for homologous duplex could be achieved if, for example, the binding site for the duplex DNA was located in such close contact to already bound ssDNA that the McGavin additional hydrogen bonds between the two DNAs could be formed (McGavin, 1977; Howard-Flanders et al., 1984; Stasiak & Egelman, 1987, 1988). This homology- dependent specific hydrogen bonding could provide additional stability for the contacts between homo- logous DNAs. On the other hand, the impossibility to form the additional McGavin hydrogen bonds between the single-stranded DNA resident in the complex and interacting non-homologous dsDNA could create a steric clash between closely brought DNAs. This could make it impossible for the non- homologous duplex DNA to occupy the second DNA-binding site within the presynaptic RecA-ssDNA complexes (Miiller et al., 1990).
The actual process of strand exchange (Fig. 7, III) can be driven by the energy of RecA-DNA binding, too. The rotatory shift of DNA strands versus the DNA-binding sites within ReeA-DNA complexes caused by strand exchange (Fig. 7, II and III) can increase the affinity of RecA to the contained DNA by allowing for better fit between RecA and DNA. If that is the case, the process of strand exchange can be driven and directed by the RecA-DNA binding energy.
If, as we propose, the formation of presynaptic complexes, homologous recognition and strand exchange are driven by the RecA-DNA binding energy, the affinity of RecA to DNA in the process of these sequential reactions should, as a conse- quence, increase. Therefore, the RecA-DNA complexes should become more and more stable, progressing through sequential stages of the reac- tion. The objective of the recombination reaction is to exchange strands between recombining DNA molecules and then to allow the product DNA mole- cules to perform their biological functions. Stable RecA-DNA complexes, enclosing DNA products of the recombination reaction, would most likely inter- fere with DNA transcription or replication, there- fore it would be of advantage if RecA dissociated from the DNA after the recombination reaction. Our results suggest that RecA-mediated ATP hydrolysis is important for the dissociation of post- exchange ReeA-DNA complexes (Fig. 7, IV). I t seems that the energy input from hydrolyzed ATP is used to convert RecA protomers into a state with low affinity to DNA (conformational change of the protein). Therefore, the DNA in reactions performed
in the presence of ATP?S ends up in the stable post- exchange RecA-DNA complexes (Fig. 3), while in the reactions performed in the presence of ATP the post-exchange complexes dissociate and DNA and ReeA are free to participate in another round of reaction (Fig. 6).
Our experiments indicate that under physio- logical conditions (presence of ATP) RecA disso- ciates quickly from the product duplex DNA molecules but can be detected on product ssDNA molecules (Figs 3 and 4). These results may seem to contradict those of Pugh & Cox (1987b), who showed that product duplex DNA molecules can remain bound by RecA after strand exchange as long as the ADP accumulation does not cause RecA dissociation. However, Pugh & Cox (1987b) showed and discussed that RecA will quickly dissociate from duplex DNA if protein-free ssDNA is present. We believe that this may be exactly the case in our reactions performed in the presence of ATP. As our reactions were performed without excess of RecA, the product ssDNA leaving postsynaptic complexes would effectively compete for RecA with the product duplex DNA stripping the latter from complexed RecA. In newer experiments, Chow et al. (1988) showed that heteroduplex produced in the ATP-stimulated reaction remains coated with RecA after reaction when single-strand binding protein (SSB) is present in the reaction mixture. However, in the absence of SSB, single-strands produced in the reaction remain coated with RecA while hetero- duplex loses RecA (Chow et al., 1988). As our reac- tions were performed in the absence of SSB, our results are consistent with these obtained by Pugh & Cox (1987b) and by Chow et al. (1988).
In our ATP~S-stimulated reactions between double and single-stranded ~bX174 DNA, the formed joint molecules were very unstable. Such instability would be expected for branched mole- cules in which only a short stretch of the original duplex is transferred into the recipient single strand (Hsieh et al., 1986). Menetski et al. (1990) reported that up to 3400 bases can be transferred from the original duplex into the recipient single strand in the presence of ATP~S and the resulting joint mole- cules are stable. Probably, a reason for the much better efficiency of strand transfer observed by Menetski et al. (1990) is the fact that their reaction was supplemented with SSB, which is known to facilitate RecA strand transfer activity (Cox & Lehman, 1982).
(c) A T P hydrolysis may be required for some additional functions except for the dissociation of the
post-exchange R e c A - D N A complexes
In Figure 6 (I) we indicated that the binding of ATP or ATP?S to ReeA protomers is required for the formation of functional presynaptic RecA-ssDNA complexes. Although RecA can bind to ssDNA in the absence of nucleotide cofactor, the formed complexes are inactive in the process of recombination as they have a completely different
350 W. Rosselli and A. Stasiak
structure from the complexes formed in the presence of ATP or ATP?S (Williams & Spengler, 1986; Egelman & Stasiak, 1986). Complexes formed in the absence of nucleotide cofactor form very tight helical filaments with an average axial spacing of bases of complexed ssDNA amounting only to about 2 A (l A=0 ' l nm), while the complexes formed in the presence of ATP or ATP~,S form rather stretched helical filaments with an average axial spacing of bases of the complexed ssDNA amounting to about 5 A (Flory et al., 1984; Williams & Spengler, 1986; Egetman & Stasiak, 1986; Heuser & Griffith, 1989). The structural differences between the complexes formed with or without ATP or ATP~S demonstrate that ATP or ATP?S binding to RecA protomers has an allosteric effect on RecA and changes the overall structure of the formed complexes with ssDNA. This ATP-controlled alio- steric effect could have a relevant function in vivo. It may be important that, after each successful recombination reaction, when the DNA end- products and the RecA protomers are potentially free to participate in another round of reaction, this does not happen immediately, but the DNA remains for some time accessible, for example, to polymer- ases filling up the post-exchange gaps (West et al., 1982). Such a delay would eliminate the reversal of the recombination reaction as the filled gaps would not participate anymore in the recombination process. On the other hand, if a gap can not be filled, due to thymidine dimer or other defect on the template strand, another round of recombination reaction would be of advantage. The local level of ATP could control the delay for the second round of recombination reaction. During the recombination reaction and immediately after it, the DNA-dependent ATPase activity of RecA could decrease the local level of available ATP below the threshold level supporting ATP binding to RecA protomers. After the dissociation of post-exchange complexes, RecA loses its ATPase activity and the ATP level in the relevant location of the living cell can start rising up to the point where it would support binding of ATP to RecA protomers and allow initiation of another round of the recombina- tion reaction.
The recombination reactions we tested were occurring between DNA molecules with perfect homologies. The net energetic balance of strand exchange in such case is zero as the amount of reformed base-pairs is equal to the number of separ- ated base-pairs. The RecA-DNA binding energy could very welt be the only driving force behind the reaction between DNA molecules with perfect homologies. However, the reactions between partially homologous DNA molecules with negative net balance of strand exchange may require addi- tional energy input obtained from the ATP hydroly- sis. RecA is able to drive strand exchange reactions through non-homologous regions up to several hundreds of base-pairs (Bianchi et al., 1983). This requires that base-pairing energy of even several hundred base-pairs should be overcome by RecA in
the process of strand exchange. We plan to test if the strand exchange between partially homologous oligonucleotides can occur in the presence of ATP?S. If this is the case, this would indicate that binding energy of RecA to DNA is sufficient to melt duplex DNA (in the RecA-DNA complexes, every RecA protomer interacts with 3 base-pairs, so the binding energy of one protomer should be high enough to offset the melting of 3 base-pairs). If the strand exchange between partially homologous DNA depended on the presence of ATP, it would indicate that the energy of ATP hydrolysis is used by RecA to drive the strand exchange reaction through regions of non-homology.
The handicap of the ATP~,S reaction observed when longer DNA molecules were used was elimi- nated in the reactions where we used very short DNA molecules. The use of short DNA molecules reduced the hydrodynamic drag experienced by dsDNA molecules and RecA-ssDNA complexes that have to rotate each about their own axis in the process of strand exchange (Honigberg & Radding, 1988). It may be that the DNA strand exchange between longer DNA molecules would require energy obtained from ATP hydolysis to overcome hydrodynamic drag involved with relative rotation of interacting complexes and DNA molecules (Cox & Lehman, 1987).
(d) What dictates the polarity of the strand exchange reaction?
The ATPase activity of RecA was frequently invoked to explain the polar character of the strand exchange reaction. At first glance it seems necessary to have at disposal energy from ATP hydrolysis to explain non-equilibrium, non-symmetrical strand exchange reaction. What then causes the strand exchange reaction to be polar even in the reactions performed in the presence of ATP?S? Why does the exchanged strand beginning from its 3' end progres- sively switch partners even in the absence of ATP hydrolysis (Fig. 2)?
As is now known, RecA protomers form polar polymers on ssDNA (Egelman & Stasiak, 1986, 1988). The polarity of this arrangement is dictated by the 5' to 3' polarity of ssDNA (Stasiak et al., 1988). A homologous duplex DNA interacting with RecA-ssDNA complex is forced to occupy the second DNA-binding site within the helical RecA filament in such a way that the strand to be displaced is in a parallel and not antiparallel orien- tation in relation to the single-strand resident in the complex. As a result, the synaptic complex is a highly ordered polar structure. For the strand exchange to occur efficiently, it is necessary for the duplex DNA to have a double-stranded break where the 3' end of the strand to be exchanged can start pairing with the single-strand resident in the complex (West et al., 1982). It may be, for example, that the presence of the free 3' end, but not of the free 5' end, of the strand to be exchanged triggers the unidirectionally propagating change within the
RecA Cycle 351
polar complex. Such change may cause higher affi- n i ty of RecA to DNA in an ar rangement typical for the products but not the substrates of the DNA strand exchange (see Fig. 7, I I and III) , I f this change is propagated in the 5' to 3' direction, in relation to the initially complexed single strand, this would cause a polar process of s trand exchange. This polar exchange would be then driven by the RecA-DNA binding energy within polar RecA-DNA complexes.
(e) Concluding remarks
We demonstra ted tha t the actual DNA strand exchange in the RecA-mediated recombination reaction can occur in the absence of ATP hydrolysis. ATP hydrolysis is necessary only to dissociate the post-exchange RecA-DNA complexes. The released DNA products of the reaction and the RecA protomers are then free to part icipate in another round of the recombination reaction. RecA-DNA binding energy can drive the actual DNA strand exchange between completely homologous, short DNA molecules. However, it is possible tha t ATP hydrolysis is needed to drive DNA strand exchange through non-homologous regions of DNA, or to overcome hydrodynamic drag of long DNA mole- cules part icipat ing in the recombination reaction.
This work was supported by Swiss National Fund grants 31-25694.88 and 37-27146.89 (to J. Dubochet and A.S.)
We thank Professor Jacques Dubochet and Edward H. Egelman for discussions and suggestions leading to the development of this work; Professor Charles Radding, Dr Stephen West, Dr Grigorios Krey and Dr Moira Cockell for their helpful comments after critical reading of our manuscript; Dr Berndt Miiller for the generous gilt of M13 clones constructed by him and purified oligonucleotides used in this work; and Ms Corinne Cottier for excellent photographic service.
References
Bianchi, M., DasGupta, C. & Radding, C. M. (1983). Cell, 34, 93 !-939.
Chow, S. A., Rao, B. J. & Radding, C. M. (1988). J. Biol. Chem. 263, 200-209.
Christiansen, G. & Griffith, J. (1986). Proc. Nat. Acad. Sci., U.S.A. 83, 2066-2070.
Cox, M. M. & Lehman, I. R. (1981a). Proc. Nat. Acad. Sci., U.S.A. 78, 3433-3437.
Cox, M. M. & Lehman, I. R. (I981b). Proc. Nat. Acad. Sci., U.S.A. 78, 6018-6022.
Cox, M. M. & Lehman, I. R. (1982). J. Biol. Chem. 257, 8523-8532.
Cox, M. M. & Lehman, I. R. (1987). Annu. Rev. Biochem. 56, 226-262.
Cox, M. M., McEntee, K. & Lehman, I. R. (1981). J. Biol. Chem. 256, 4676-4678.
Cox, M. M., Soltis, D. A., Livneh, Z. & Lehman, I. R. (1983). J. Biol. Chem. 258, 2577-2585.
DasGupta, C. Shibata, T., Cunningham, R. P. & Radding, C. M. (1980). Cell, 22, 437-446.
DiCapua, E., Schnarr, M., Ruigrok, R. W. H., Lindner, P. & Timmins, P. A. (1990). J. Mol. Biol. 214, 557-570.
Egelman, E. H. & Stasiak, A. (1986). J. Mol. Biol. 191, 677-697.
Egelman, E. H. & Stasiak, A. (1988). J. Mol. Biol. 200, 329-349.
Flory, J., Tsang, S. S. & Muniyappa, K. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 7026-7030.
Gonda, D. K. & Radding, C. M. (1983). Cell, 34, 647-654. Heuser, J. & Griffith, J. (1989). J. Mol. Biol. 210,
473-484. Honigberg, S. M. & Radding, C. M. (1988). Cell, 54,
525-532. Honigberg, S. M., Gonda, D. K., Flory, J. & Radding,
C. M. (1985). J. Biol. Chem. 260, 11845-11851. Howard-Flanders, P., West, S. C. & Stasiak, A. (1984).
Nature (London), 309, 215-220. Howard-Flanders, P., West, S. C., Cassuto, E., Hahn,
T.-R., Egelman, E. H. & Stasiak, A. (1987). In DNA Replication and Recombination (Kelly, T. & McMacken, R., eds), pp. 609-617, Alan R. Liss, New York.
Hsieh, P., Meyn, M. S. & Camerini-Otero, R. D. (1986). Cell, 44, 885-894.
Kahn, R., Cunningham, R. P., DasGupta, C. & Radding, C. M. (1981). Proc. Nat. Acad. Sci., U.S.A. 78, 4786-4790.
Kowalczykowski, S. C. (1987). Trends Biochem. Sci. 12, 141-145.
McEntee, K., Weinstock, G. M. & Lehman, I. R. (1981). J. Biol. Chem. 255, 8835-8844.
McGavin, S. (1977). Heredity, 39, 15-25. Menetski, J. P. & Kowalczykowski, S. C. (1985). J. Mol.
Biol. 181,281-295. Menetski, J. P., Bear, D. G. & Kowalczykowski, S. C.
(1990). Proc. Nat. Acad. Sci., U.S.A. 87, 21-25. Miiller, B., Koller, Th. & Stasiak, A. (1990). J. Mol. Biol.
212, 97-112. Muniyappa, K., Shaner, S. L., Tsang, S. S. & Radding,
C.M. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 2757-2761.
Pugh, B. F. & Cox, M. M. (1987a). J. Biol. Chem. 262, 1326-1336.
Pugh, B. F. & Cox, M. M. (1987b). J. Biol. Chem. 252, 1337-1343.
FCadding, C. M., Beattie, K. L., Holloman, W. K. & Wiegand, R. C. (1977). J. Mol. Biol. 115, 825-839.
Register, J. C., III, Christiansen, G. & Griffith, J. (1987). J. Biol. Chem. 252, 12812-12820.
Riddles, P. W. & Lehman, I. R. (1985). J. Biol. Chem. 260, 170-173.
Sancar, A. & Rupp, W. D. (1979). Proc. Nat. Acad. Sei., U.S.A. 76, 3144-3148.
Shibata, T., Ohtani, T., Iwabuchi, M. & Ando, T. (1982). J. Biol. Chem. 257, 13981-13986.
Singer, B. S., Gold, L., Gauss, P. & Doherty, D. M. (1982). Cell, 31, 25-33.
Stasiak, A. & Egelman, E. H. (1987). In DNA Replication and Recombination (Kelly, T. & McMacken, R., eds), pp. 619-628, Alan R. Liss, New York.
Stasiak, A. & Egelman, E. H. (1988). In Genetic Recombination (Kucherlapati, R. & Smith, G., eds), pp. 265--307, Amer. Soc. Microbiol. Washington, D.C.
Stasiak, A., DiCapua, E. & Koller, Th. (1981). J. Mol. Biol. 151,557-564.
Stasiak, A., Stasiak, A. Z. & Koller, Th. (1984). Cold Spring Harbor Symp. Quant. Biol. 49, 561-570.
Stasiak, A., Egelman, E. H. & Howard-Flanders, P. (1988). J. Mol. Biol. 202, 659-662.
Takahashi, M., Kubista, M. & Nord~n, B. (1989). J. MoL Biol. 205, 137-147.
352 W. Rosselli and A. Stasiak
Tsang, S. S., Muniyappa, E., Azhderian, Gonda, D. K., Radding, C. M., Flory, J. & Chase, J. W. (1985). J. Mol. Biol. 185, 295-309.
Weinstock, G. M., McEntee, K. & Lehman, I. R. (1981). J. Biol. Chem. 256, 8845-8849.
West, S. C., Cassuto, E. & Howard-Flanders, P. (1981). Proc. Nat. Acad. Sci., U.S.A. 78, 6149-6t53.
West, S. C., Cassuto, E. & Howard-Flanders, P. (1982). Mol. Gen. Genet. 187, 209-217.
Williams, R. C. & Spengler, S. J. (1986). J. Mol. Biol. 187, 109-118.
Wu, A. M., Kahn, R., DasGupta, C. & Radding, C. M. (1982). Cell, 30, 37-44.
