1 23

Environmental Monitoring andAssessmentAn International Journal Devoted toProgress in the Use of Monitoring Datain Assessing Environmental Risks toMan and the Environment ISSN 0167-6369 Environ Monit AssessDOI 10.1007/s10661-014-3919-y

Assessment of imidacloprid degradation bysoil-isolated Bacillus alkalinitrilicus

Smriti Sharma, Balwinder Singh &V. K. Gupta

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer

International Publishing Switzerland. This e-

offprint is for personal use only and shall not

be self-archived in electronic repositories. If

you wish to self-archive your article, please

use the accepted manuscript version for

posting on your own website. You may

further deposit the accepted manuscript

version in any repository, provided it is only

made publicly available 12 months after

official publication or later and provided

acknowledgement is given to the original

source of publication and a link is inserted

to the published article on Springer's

website. The link must be accompanied by

the following text: "The final publication is

available at link.springer.com”.

Assessment of imidacloprid degradation by soil-isolatedBacillus alkalinitrilicus

Smriti Sharma & Balwinder Singh & V. K. Gupta

Received: 27 December 2013 /Accepted: 30 June 2014# Springer International Publishing Switzerland 2014

Abstract Imidacloprid is extensively used on a broadrange of crops worldwide as seed dressing, soil treat-ment, and foliar application. Hence, the degradationpotential of bacterial strains from sugarcane-growingsoils was studied in liquid medium for subsequent usein bioremediation of contaminated soils. The microbecultures degrading imidacloprid were isolated andenriched on Dorn’s broth containing imidacloprid assole carbon source maintained at 28 °C and Bacillusalkalinitrilicus showed maximum potential to degradeimidacloprid. Clay loam soil samples were fortified withimidacloprid at 50, 100, and 150mg kg−1 along with 45×107 microbe cells under two opposing sets of conditions,viz., autoclaved and unautoclaved. To study degradationand metabolism of imidacloprid under these two condi-tions, samples were drawn at regular intervals of 7, 14,28, 35, 42, 49, and 56 days. Among metabolites, threemetabolites were detected, viz., 6-chloronicotinic acid,nitrosimine followed by imidacloprid-NTG under boththe conditions. Total imidacloprid residues were notfound to follow the first-order kinetics in both types ofconditions. This paper reports for the first time thepotential use of pure cultures of soil-isolated native

bacterium B. alkalinitrilicus and also its use along withnatural soil microflora for remediation of imidacloprid-contaminated soils.

Keywords Imidacloprid . Degradation . Bacillusalkalinitrilicus . Soil . Residues .Metabolism

Introduction

Pesticide development and utilization is an incessantprocess which has become an integral component ofagricultural systems globally. This has drawn extensiveapprehension of environmental contamination and ad-verse effect on non-targets (Zhu et al. 2004). Eventhough neonicotinoids have led to reduction in theamount of pesticide use, an ideal pesticide needs to bebiodegradable after exerting its action and should ex-empt non-targets. Understanding pesticide metabolismin plants and microorganisms is necessary for develop-ment and safe use of any pesticide, as well as forformulating bioremediation strategies. The metabolicfate of pesticides is dependent on pesticide characteris-tics, abiotic environmental conditions, and biotic factorslike microbial diversity and/or plant species. Microbesplay an imperative role in eliminating toxic substancesfrom environment; furthermore, microbial bioremedia-tion is considered to be a cost-effective tool for thedetoxification of xenobiotics (Li et al. 2012).

The diversity of microorganisms provides a potentialwealth in biodegradation. Although microbes arecapable of catalyzing similar metabolic reactions as

Environ Monit AssessDOI 10.1007/s10661-014-3919-y

S. Sharma (*) :B. SinghPesticide Residue Analysis Laboratory, Department ofEntomology, Punjab Agricultural University,Ludhiana 141004 Punjab, Indiae-mail: smritisharma80@pau.edu

V. K. GuptaInsect Molecular Biology Laboratory, Department ofEntomology, Punjab Agricultural University,Ludhiana 141004 Punjab, India

Author's personal copy

mammals and plants, they possess the unique ability tocompletely mineralize many aliphatic, aromatic, andheterocyclic compounds (Meyers et al. 1976). Thus,the identification of indigenous microbes that are capa-ble of metabolizing pesticides can be helpful to developenvironment friendly bioremediation methods. Manynative microorganisms develop complex and effectivemetabolic pathways that permit the biodegradation oftoxic substances that are released into the environment(Porto et al. 2011). The ability of these organisms todegrade any xenobiotic is directly linked to their long-term adaptation to indigenous environments.Microorganisms that brought about the aerobic transfor-mation of imidacloprid were isolated and screened by Daiet al. (2006) and reported that Stenotrophomonasmaltophilia CGMCC 1.1788 resting cells transformedimidacloprid into 5-hydroxyl imidacloprid at the highestconversion rate. Ge et al. (2006) isolated a strain NJ2from soil whose resting cells transformed imidaclopridinto polar metabolites which was also identified asS. maltophilia. Many bacterial genera like Bacillus,Flavobacterium , Arthrobacter, Xanthobacter,Brevundimonas, Stenotrophomonas, and Pigmentiphagahave been reported to have the ability to degrade pesti-cides (Mandal 2012; Gossel and Bricker 1994; Greer andRobinson 1992; Ishaq and Khan 1994; Shetti andKaliwal 2012; Tang et al. 2012; Wang et al. 2013), butno reports are available on the role of Bacillusalkalinitrilicus for bioremediation of imidacloprid.Therefore, the present studies were undertaken to identifythe bioremediation potential of B. alkalinitrilicus. Soilsamples collected from different sugarcane fields withknown history of extensive pesticide usage and locatedin Ludhiana and Gurdaspur districts of Punjab State,India, served as source of pesticide degrading microbes.This paper highlights the prospective use of pure cultureof this soil-isolated native bacterium or even its use alongwith natural soil microflora for remediation ofimidacloprid-contaminated soils.

Materials and methods

Media for isolation and microbe cultures

Master cultures of 12 strains belonging to five differentspecies of Bacillus, Pseudomonas, and two otherbacterial genera isolated by enrichment technique fromsugarcane field soils and known to cause active

metabolization of phorate (Jariyal 2013) were acquiredfrom microbial culture collection of Insect MolecularBiology Lab of Department of Entomology, PunjabAgricultural University, Ludhiana (Table 1). All thebacterial strains were maintained by regularsubculturing of respective master culture on LuriaBroth (LB) agar at 37 °C as given by Gerhardt et al.(1994). When needed LB medium was solidified byadding agar at 1.6 % before its sterilization at 15 psi ofsteam. Imidacloprid metabolization by different bacteri-al species was studied in Dorn’s broth—a minimal me-dium with the composition of Na2HPO412·H2O—3.0 g,KH2PO4—1.0 g, (NH4)2SO4—1.0 g, MgSO4·7H2O—10.0 g, CaCl2·2H2O—2.0 g, MnSo4·H2O—3.0 g,FeSO4·7H2O—0.2 g, ammonium ferric citrate—0.01 g, yeast extract—0.1 g, and distilled water to make1.0 l, pH of 7.0. Themediumwas completed by additionof trace element solution (10 ml l−1) which consisted(g l−1) of MgSO4·7H2O—10.0, CaCl2·2H2O—2.0, andMnSO4·H2O—3.0 and FeSO4·7H2O—0.2 in distilledwater. After adjusting the initial pH of complete mediumto 7.0±0.2, the medium distributed in appropriate lotswas sterilized at 15 psi of steam. Standard inoculum ofindividual bacterial strain was derived by diluting the24-h growth of a single bacterial clone (in 10ml of LB at37 °C, 120 rpm) with sterile distilled water to provide108 cells ml−1.

Degradation of imidacloprid by isolated strains in liquidculture

For estimating imidacloprid degradation, 50 ml ofDorn’s medium in 250 ml Erlenmeyer flask was forti-fied with imidacloprid (50 μg ml−1), inoculated with1 ml of standard inoculum of a particular strain, andallowed to grow at 37±1 °C on shaker at 120 rpm. Forthis purpose, a 5-ml aliquot of growing culture brothwas drawn at a specific interval (3, 7, 15 days) andtransferred into 1 l separatory funnel along with rinsingof acetonitrile (Mandal et al. 2013). The sample wasdiluted with 600 ml saturated brine solution and thecontents were partitioned three times with 100, 80, and50 ml volumes of dichloromethane. The combinedlayers were passed through anhydrous sodium sulfateand then cleaned up of any pigment with 0.5 g ofactivated charcoal for 15 min on a rotary shaker(120 rpm). After filtering through Whatman filter paperno.1, the clear extract was concentrated to near drynessin a rotary vacuum evaporator at <40 °C, redissolved in

Environ Monit Assess

Author's personal copy

Table 1 Degradation of imidacloprid by different bacterial cultures in Dorn’s media fortified with 50 mg ml−1 after 15 days of incubation

Culture Days Residues of imidacloprid and its metabolites (mg kg−1)a Reduction (%)

Imidacloprid 6-Chloronicotinic acid Imidacloprid-NTG Nitrosimine Total

Bacillus aerophilus 1 3 48.94 0.22 0.08 0.54 49.78 2.00

7 46.61 1.57 BDL 0.7 48.88 6.67

15 44.28 1.72 BDL 1.41 47.41 11.33

Bacillus aerophilus 2 3 46.11 0.99 0.10 0.62 47.8 7.67

7 44.05 1.83 BDL BDL 45.88 11.79

15 42.86 1.06 BDL 0.39 44.31 14.18

Bacillus alkalinitrilicus 3 41.58 0.27 0.06 0.67 42.59 16.74

7 33.60 0.50 0.06 4.49 38.64 32.72

15 31.77 1.05 BDL 1.44 34.26 36.38

Bacillus firmus 2 3 38.48 0.24 BDL BDL 38.72 22.95

7 37.07 0.57 0.01 0.53 38.18 25.77

15 35.8 0.73 0.03 0.95 35.80 28.31

Bacillus firmus1 3 42.58 0.37 0.09 1.10 44.14 14.74

7 40.50 1.74 0.11 0.83 43.18 18.90

15 39.55 0.89 BDL 2.35 42.80 20.80

Bacillus frexus 3 43.23 0.30 BDL 0.47 44.01 13.44

7 41.84 1.25 BDL 0.19 43.27 16.22

15 37.26 0.43 0.01 0.19 37.88 25.39

Bacillus thuringiensis 3 36.70 0.32 0.05 0.59 37.65 26.51

7 34.79 1.25 BDL BDL 36.04 30.34

15 33.11 0.78 BDL 0.92 34.81 33.70

Brevibacterium frigoritolerans 3 46.85 0.33 0.13 0.51 47.82 6.19

7 43.40 1.06 BDL BDL 44.46 13.10

15 35.56 0.96 BDL 2.26 38.79 28.79

Pseudomonas fulva 3 39.56 0.13 BDL 2.95 42.64 20.78

7 38.81 0.33 0.03 1.83 40.99 22.29

15 34.56 0.85 0.01 2.17 37.59 30.80

Pseudomonas monteilii 3 40.06 0.27 BDL 1.00 41.32 19.78

7 38.77 0.98 0.09 0.76 40.60 22.37

15 34.96 0.51 0.01 2.17 37.59 30.00

Pseudomonas moraviensis 3 43.44 0.58 0.11 1.88 46.01 13.02

7 41.82 0.89 0.02 1.56 44.28 16.26

15 39.95 0.95 0.01 2.39 43.31 20.00

Staphylococcus aureus 3 44.21 0.27 BDL 0.18 44.67 11.47

7 41.95 0.76 BDL 0.09 42.81 16.00

15 38.17 0.35 BDL 1.54 40.06 23.57

Control 3 47.66 1.32 BDL 0.95 49.93 –

7 46.78 0.22 0.02 BDL 47.02 –

15 44.71 0.76 0.01 1.26 46.74 –

Residues of imidacloprid urea, olefin, and 5-hydroxy metabolites remained BDL

BDL below the detectable limit of 0.01 mg kg−1

aMean of three replications

Environ Monit Assess

Author's personal copy

20 ml acetonitrile. The final extract was concentratedand reconstituted to 2.5 ml using acetonitrile and quan-tified using high-performance liquid chromatograph(HPLC) as described later.

Imidacloprid degradation in amended soil by selectedmicrobe

The physical characteristics, viz., nature of soil, organicmatter, pH, electrical conductivity, and anion exchangecapacity, of soil collected from Sadhugarh village (DisttPatiala) were ascertained before initiating the experi-ment to be clay loam soil (organic carbon=0.885 %,pH=7.91, and electrical conductivity=0.1163 dsm−1).The sample was mixed well and sieved, and extraneousmatter including stones/pebbles was removed and driedunder shade. A set of soil was autoclaved at 120 °C,15 psi for 15 min to destroy the microbes (bacteria,actinomycetes, fungi, protozoa, etc.) responsible forthe degradation of pesticides before initiating the exper-iment. Another set of soil was not autoclaved to ascer-tain the potential of pure culture of bacteria and theeffect of natural microbes in soil. Soil samples (400 g)of each treatment in three replications for bothconditions were fortified using three doses ofimidacloprid at 50, 100, and 150 mg kg−1 andinoculated with bacterial cells (45×107). From eachfortified (insecticide + microbes) sample, 50 g soilsample was taken and filled in plastic cups. Thecups were moistened with water at 7 days intervaland kept in incubator at 25±2 °C. Soil samples (10 g)were drawn along with control samples at 7, 14, 21, 28,35, 42, 49, and 56 days after inoculation to assessimidacloprid degradation.

Residue analysis

The extraction and estimation of residues ofimidacloprid and its metabolites from 10 g soil samplewere carried out as per Sharma et al. (2013). The esti-mation of imidacloprid residues was carried out usingHPLC equipped with mobile-phase acetonitrile/water(40:60 v/v), 0.30 ml min−1 pump flow, with a PDAdetector set at 270 nm wavelength. Under these condi-tions, imidacloprid and its metabolites eluted with re-tention times of 5.7 min (6-chloronicotinic acid),8.0 min (imidacloprid-NTG), 10.7 min (olefin),11.3 min (nitrosimine), 11.8 min (urea), 13.1 min( 5 - hyd r oxy im id a c l op r i d ) , a nd 17 . 2 m in

(imidacloprid).When 10 g of soil was extracted, cleanedup, and final volume made to 2 mL, out of which,20 μL sample (equivalent 100 mg sample material)when injected did not produce any background in-terferences. Thus, the limit of quantification (LOQ)was found to be 0.01 mg kg−1 and limit of detection(LOD) is 0.003 mg kg−1 (Sharma et al. 2013).

Results and discussion

Identification of imidacloprid degrading soil microbes

Taxonomic identification of bacteria was based uponnucleotide sequence-based homology of 16S rDNAwith GenBank database after amplification of totalDNA from these bacterial species with 16S rDNAsequence-specific primers (QUGP-F4-CCGCCTGGGGAGTACG and QUGP-Rn2-TGACGGGCGGTGTGTACAAG, Barghouthi 2011) resulted in amplifica-tion of single DNA fragments of expected size of around530 bp. The edited nucleotide sequences of the respec-tive PCR-amplified DNA fragments as determined bycustom sequencing (M/S Xcelris Labs Limited,Ahmedabad) are given in Fig. 1. In the present investi-gations, it was observed that the pure culture of 12bacterial species could degrade imidacloprid to 6-chloronicotinic acid, imidacloprid-NTG, andnitrosimine as its three main metabolites. Four bacterialspecies, viz., Bacillus thuringiensis, B. alkalinitrilicus,and Pseudomonas monteilii and Pseudomonas fulvadegraded ≥30 % imidacloprid as compared to control(Table 1). Based upon relative imidacloprid reduction,two bacterial species namely B. alkalinitrilicus(36.38 %) and B. thuringiensis (33.70 %) could belabeled as potential degrader of imidacloprid. Amongthese two bacterial species, B. alkalinitrilicus exhibitingmaximum degradation in addition to multiple capacities(phorate and imidacloprid) for degradation was furtherinvestigated in the present study for imidaclopridmetabolization potential in soil. The bacterial specieswas gram negative in reaction and formed tiny yellow-ish colonies with shining surface and entire colonymargin. Based upon maximum homology score throughBlast function (Taxonomy Report) of National Centerfor Biotechnology Information (NCBI) with GenBankdatabase (Jariyal 2013), selected bacterial species wasidentified as B. alkalinitrilicus belonging to Kingdom

Environ Monit Assess

Author's personal copy

Bacteria and Phylum Firmicutes, Order Bacillales,Family Bacillaceae, and Genus Bacillus.

Metabolism and persistence of imidacloprid in clayloam soil amended with bacteria

Degradation studies are essential for evaluating the per-sistence of any pesticide along with its breakdown prod-ucts, and the rate of degradation is extremely importantto predict the potential risk of its use (Cheah et al. 1998).Emphasis is needed on the research on toxicologicallysignificant metabolites, which if insecticidal could bebeneficial. But metabolites exhibiting mammalian tox-icity could be of serious concerns. As earlier stated, tostudy the degradation of imidacloprid and its metabo-lites by pure culture, clay loam soil was autoclaved todestroy the microbes responsible for degradation ofpesticides. In another set, clay loam soil was notautoclaved to study the persistence and degradation ofimidacloprid under natural conditions.

Degradation in autoclaved clay loam soil

Investigations under autoclaved and bacteria-fortifiedconditions revealed that the total residues ofimidacloprid and its metabolites were 36.96, 82.88,and 130.16 mg kg−1 7 days after the application ofimidacloprid at 50, 100, and 150 mg kg−1, respectively.These residues degraded to 0.73, 1.95, and 3.29mg kg−1

(Table 2), thus demonstrating 98.02, 97.65, and 97.47 %

degradation after 56 days of application of respectivedoses of imidacloprid (Table 4). Among the metabolites,three main metabolites were detected, viz., 6-chloronicotinic acid, nitrosimine followed by lesseramounts of imidacloprid-NTG. Another hydroxylationproduct, 5-hydroxymetabolite, was detected till 14 days,but during later samplings, it remained below the de-tectable limit and olefin and urea metabolites were notdetected in any of the samples under study (Table 2).These results showed that the bacterium has great pro-spective for bioremediation of imidacloprid in the con-taminated soils as the end product of these metabolites isCO2 (Fossen 2006). Furthermore, the bacterium seemsto cause reduction of imidacloprid to nitrosimine andimidacloprid-NTG metabolites besides oxidation to 6-chloronicotinic acid which is finally converted to CO2

(Fig. 2). While a lesser amount of 5-hydroxy metabolitesuggest that the hydroxylation of imidacloprid occurredinitially, but this pathway was not a preferred one as themetabolite was not detected after 14 days and conse-quently olefin metabolite (formed from hydroxy metab-olite) of imidacloprid was also not detected. The bio-degradation of imidacloprid by B. alkalinitrilicus didnot lead to the formation of imidacloprid-urea in thepresent study. In addition, this study clearly demon-strates the role of microbes in degradation as the persis-tence of imidacloprid was found to be very less inbacteria amended in contrast to unammended soil inwhich the total residues were found to persist in muchhigher amounts till 56 days, i.e., 66.99 mg kg−1

Nucleotide sequence of bacterial species B. alkalinitricus

AAAGACAGGGTGGAGTCATCGTGGTTTAATTCGAAGCAACGCGAGAACCTTACCAGGTCTTG

ACATCCCTTTAAAACTCTTGAAATTGAGGGTTGCCCTTCGGGGGACAGAGAGACGGGGGGTA

CGGGGTTGTCCTCATCTTGTGTTGAGAGGTTTTGGGTTATCTCCCACCACGAGCGCCCCCCTAG

TTTTTTTTTGCCCACTTTTTGTGGGGCCCTTTAAAGAGACGGCCGGTAACAAACCGGAAAAAG

GGGGGGAAGACCTCAAATCATCAGGCCCCTTAAAACCGGGGCTACACCCGTTCTACAATGGG

GGGTACAAAGGGGTGCAAAACCCCGGGGTGAACCCAATCCCATAAAACCCTTCTCATTTTGG

ATTGGAGGCCGCAACTCCCCCACATAAAACTGGAATTTCTTGTAATCGCGGAACAACACGCCC

CGGTAAAAACTTTCCCGGGTCTTGTACACCCCCCCCCCTTAAAAA

Fig. 1 NCBI Genbank-based nucleotide homology sequence of B. alkalinitricus

Environ Monit Assess

Author's personal copy

(Table 2), after addition of imidacloprid at 100 mg kg−1

resulting in only 30.33 % reduction (Table 4). Theseresults are in consistency with the earlier study in which

imidacloprid urea, 6-chloronicotinic acid, and 6-hydroxynicotinic acid were reported in soil producedas a result of co-metabolism by bacterial communities

Table 2 Residues of imidacloprid and its metabolites (mg kg−1) in autoclaved clay loam soil amended with B. alkalinitrilicus

Days after treatment Imidacloprid Metabolites Total residues

6-Chloronicotinic acid Imidacloprid-NTG Nitrosimine 5-Hydroxy

Imidacloprid at 50 mg kg−1

7 35.60±0.71a 0.82±0.27 BDL 0.45±0.05 0.10±0.01 36.96±0.21

14 22.59±0.30 0.41±0.03 0.12±0.02 0.22±0.00 0.03±0.00 23.28±0.07

21 16.26±0.48 0.88±0.02 BDL 1.91±0.26 BDL 19.05±0.19

28 13.40±0.68 0.60±0.04 BDL 1.49±0.17 BDL 15.49±0.22

35 10.92±0.81 1.10±0.01 BDL 1.25±0.07 BDL 13.28±0.22

42 8.32±0.44 0.48±0.06 BDL 2.25±0.58 BDL 11.04±0.27

49 5.59±0.19 0.22±0.02 0.05±0.01 0.93±0.10 BDL 6.93±0.08

56 0.49±0.01 0.16±0.02 0.05±0.01 0.02±0.00 BDL 0.73±0.04

Imidacloprid at 100 mg kg−1

7 82.06±2.59a 0.57±0.05 BDL 0.14±0.02 0.10±0.02 82.88±0.54

14 50.22±0.51 1.07±0.14 0.15±0.05 0.37±0.00 0.50±0.01 52.31±0.15

21 35.50±1.62 0.85±0.19 BDL 2.80±0.66 BDL 39.14±0.62

28 23.62±0.52 0.53±0.04 BDL 1.43±0.02 BDL 25.58±0.14

35 15.76±0.32 0.35±0.05 BDL 1.68±0.42 BDL 17.80±0.20

42 12.71±0.37 0.38±0.03 BDL 1.67±0.30 BDL 14.77±0.17

49 11.22±0.31 0.21±0.04 0.01±0.00 0.22±0.07 BDL 11.66±0.09

56 1.65±0.37 0.22±0.03 0.04±0.01 0.03±0.00 BDL 1.95±0.10

Imidacloprid at 150 mg kg−1

7 128.38±0.21a 1.24±0.42 0.02±0.01 0.41±0.01 0.11±0.07 130.16±0.14

14 78.08±0.32 1.75±0.02 0.05±0.00 1.07±0.02 1.94±0.02 82.89±0.08

21 50.21±0.85 1.63±0.08 0.44±0.03 1.11±0.04 BDL 53.38±0.25

28 35.72±0.87 1.42±0.09 BDL 2.63±0.98 BDL 39.78±0.49

35 30.51±1.16 0.43±0.15 BDL 2.11±0.76 BDL 33.06±0.52

42 23.10±0.15 0.31±0.02 BDL 2.28±0.09 BDL 25.69±0.07

49 14.97±0.50 0.19±0.05 0.10±0.01 0.08±0.00 BDL 15.49±0.11

56 3.09±0.10 0.09±0.00 0.03±0.01 0.08±0.00 BDL 3.29±0.03

Unamended control at 100 mg kg−1

7 94.51±1.31a 1.21±0.05 0.01±0.00 0.39±0.07 0.04±0.01 96.15±1.91

14 89.65±0.26 0.44±0.10 BDL 0.46±0.05 0.07±0.01 90.62±1.40

21 86.80±1.26 BDL BDL 0.87±0.02 BDL 87.67±1.82

28 82.76±1.20 BDL BDL 3.36±1.00 BDL 86.12±2.72

35 80.24±2.13 0.45±0.15 BDL 2.48±1.11 BDL 83.17±2.29

42 75.69±1.70 0.43±0.05 BDL 3.08±0.98 BDL 79.20±1.57

49 72.20±2.10 0.22±0.08 BDL 0.26±0.05 BDL 72.67±0.59

56 66.56±1.96 0.13±0.04 0.03±0.01 0.27±0.05 BDL 66.99±0.84

Residues of olefin and imidacloprid urea metabolite were BDL at all the days of sampling

BDL below the detectable limit of 0.01 mg kg−1

aMean±standard deviation of three replications

Environ Monit Assess

Author's personal copy

(Sarkar et al. 2001). These results are also in coherencewith Pandey et al. (2009) who observed that 70 % of50 mg kg−1 imidacloprid was degraded within 14 daysby three strains namely 1G, 1W, and GP2 undermicroaerophilic conditions. They further suggestedthat the nitro group of imidacloprid was transformed toproduce nitrosoguanidine metabolite and the parentmolecule along with the nitrosoguanidine would befurther converted to a nontoxic urea metabolite via amore toxic desnitro/guanidine intermediate. The resultsare also similar to Ge et al. (2006) and Dai et al. (2006)using strains of S. maltophilia, which transformedimidacloprid into polar hydroxyl metabolites, but thestudy conducted by Pandey et al. (2009) did not impli-cate transformation of the nitro group. In yet anotherstudy, guanidine and urea metabolites were recov-ered from imidacloprid metabolism by Leifsonia sp.strain PC-21 (Anhalt et al. 2007) which degraded 37to 58 % of 25 mg l−1 imidacloprid in 3 weeks. Inanother study, Dai et al. (2010) reported that carbon atomthat neighbors the tertiary amine attached to the 6-chloro-3-pyridinylmethyl moiety of imidacloprid was the keyactive site in the hydroxylation by S. maltophiliaCGMCC 1.1788. In an earlier study also, imidacloprid-degrading bacteria were isolated from soil enrichment

cultures, which could degrade 38 and 69 % ofimidacloprid in 4 weeks. Soil isolate SP-01 was identifiedas Brevundimonas sp. MJ 15 showed 14.80 % degrada-tion (Shetti and Kaliwal 2012).

Degradation in unautoclaved clay loam soil

On the other hand, in case of unautoclaved soilammended with bacteria, total residues of imidaclopridand its metabolites were found to be 46.44, 92.64, and140.93 mg kg−1 after 7 days of application ofimidacloprid at 50, 100, and 150 mg kg−1, respectively.These residues degraded to 7.47, 10.93, and19.43 mg kg−1 at 56 days after application ofimidacloprid at 50, 100, and 150 mg kg−1, respectively(Table 3). Under these conditions, B. alkalinitrilicuscould degrade 83.91, 88.20, and 86.21 % imidaclopridafter 56 days of application at 50, 100, and 150 mg kg−1,respectively (Table 4). Among the metabolites, threemetabolites were detected, viz., 6-chloronicotinic acid,nitrosimine, and imidacloprid-NTG. Under these condi-tions also, 5-hydroxy metabolite was detected till 7 daysof treatment, but during later samplings, it remainedbelow the detectable limit. As earlier stated, olefin andurea metabolites were not detected in any of the samples

Fig. 2 Metabolites of imidacloprid formed during degradation by B. alkalinitrilicus

Environ Monit Assess

Author's personal copy

under unautoclaved conditions. The present investiga-tion under the both sets of opposing conditions clearlydemonstrate the role these microbes play, as the

persistence of imidacloprid was found to be very lessas compared to unamended soils (Table 3). Moreover,under unautoclaved conditions also, the bacterium

Table 3 Residues of imidacloprid and its metabolites (mg kg−1) in unautoclaved clay loam soil amended with B. alkalinitrilicus

Days after treatment Imidacloprid Metabolites Total residues

6-Chloronicotinic acid Imidacloprid-NTG Nitrosimine 5-Hydroxy

Imidacloprid at 50 mg kg−1

7 43.94±0.83a 1.85±0.26 BDL 0.23±0.04 0.42±0.01 46.44±0.23

14 39.30±0.91 0.38±0.07 BDL 1.22±0.16 BDL 40.90±0.28

21 26.43±1.72 2.63±0.27 0.07±0.01 2.17±0.78 BDL 31.30±0.70

28 21.30±1.35 1.62±0.10 0.12±0.05 1.54±0.33 BDL 24.58±0.46

35 15.57±0.67 0.66±0.09 0.06±0.02 1.13±0.33 BDL 17.41±0.28

42 12.15±0.52 0.16±0.03 0.08±0.01 0.91±0.03 BDL 13.30±0.15

49 7.82±0.35 0.36±0.01 0.03±0.01 0.75±0.02 BDL 8.96±0.10

56 5.91±0.28 0.05±0.01 0.03±0.01 1.48±0.22 BDL 7.47±0.13

Imidacloprid at 100 mg kg−1

7 89.29±0.58a 1.64±0.25 0.24±0.01 0.56±0.15 0.91±0.11 92.64±0.22

14 78.67±2.77 1.66±0.06 BDL 1.76±0.04 BDL 82.08±0.70

21 56.70±2.35 1.04±0.06 0.06±0.00 2.07±0.07 BDL 59.87±0.62

28 46.56±0.42 1.98±0.14 0.18±0.00 1.14±0.22 BDL 49.86±0.19

35 23.96±0.24 0.53±0.14 0.11±0.00 2.63±0.52 BDL 27.23±0.22

42 17.82±0.09 0.56±0.07 0.06±0.01 2.27±0.06 BDL 20.71±0.06

49 12.45±1.03 0.30±0.02 0.06±0.01 1.78±0.80 BDL 14.58±0.39

56 8.01±0.17 0.23±0.02 0.02±0.00 2.66±0.59 BDL 10.93±0.20

Imidacloprid at 150 mg kg−1

7 137.84±2.09a 1.63±0.12 0.07±0.00 0.57±0.10 0.81±0.11 140.93±0.49

14 126.39±2.92 0.61±0.05 BDL 1.05±0.14 BDL 128.05±0.78

21 88.74±1.84 1.28±0.44 0.22±0.04 2.63±0.64 BDL 92.87±0.74

28 66.63±0.88 1.46±0.13 0.04±0.00 2.93±0.07 BDL 71.05±0.27

35 37.00±1.46 0.85±0.18 0.14±0.05 2.21±0.35 BDL 40.20±0.51

42 23.71±0.98 0.58±0.05 0.13±0.04 1.11±0.05 BDL 25.52±0.28

49 19.64±0.28 1.01±0.14 0.16±0.02 3.39±0.28 BDL 24.20±0.30

56 17.03±0.45 0.06±0.02 0.03±0.00 2.32±0.36 BDL 19.43±0.21

Unamended control at 100 mg kg−1

7 90.30±2.11a 4.07±0.14 BDL 0.87±0.12 1.24±0.08 96.48±2.44

14 83.73±1.98 2.39±0.42 BDL 1.97±0.06 BDL 88.09±1.65

21 79.53±2.76 1.50±0.25 0.47±0.11 5.41±1.25 BDL 86.91±1.45

28 76.70±2.97 0.75±0.18 0.58±0.09 4.62±1.01 BDL 82.65±2.26

35 75.66±1.17 2.16±0.46 0.12±0.05 3.82±0.98 BDL 81.76±1.49

42 72.87±1.42 0.37±0.12 0.06±0.01 6.21±1.21 BDL 79.51±1.37

49 70.14±2.50 2.32±0.84 0.42±0.13 3.55±0.99 BDL 76.43±2.01

56 68.33±1.85 0.20±0.04 0.12±0.03 2.43±0.83 BDL 71.08±1.57

Residues of olefin and imidacloprid urea metabolite were BDL at all the days of samplingaMean±standard deviation of three replications

Environ Monit Assess

Author's personal copy

Table 4 Reduction in theresidues of imidacloprid and itsmetabolites in clay loam soilamended with B. alkalinitrilicus

Mean of three replicationsaPercent reduction from 7 daysafter treatment

Days aftertreatment

Reductiona in total imidacloprid residues (%) fortified at 50, 100, and 150 mg kg−1

Autoclaved Unautoclaved

50 100 150 Control 50 100 150 Control

14 37.01 36.88 36.32 5.75 11.93 11.40 9.14 8.70

21 48.46 52.78 58.99 8.82 32.60 35.37 34.10 9.92

28 58.09 69.14 69.44 10.43 47.07 46.18 49.58 14.33

35 64.07 78.52 74.60 13.50 62.51 70.61 71.48 15.26

42 70.13 82.18 80.26 17.63 71.36 77.64 81.89 17.59

49 81.25 85.93 88.10 24.42 80.71 84.26 82.83 20.78

56 98.02 97.65 97.47 30.33 83.91 88.20 86.21 26.33

a)

b)

0.00

1.00

2.00

3.00

4.00

5.00

7 14 21 28 35 42 49 56

log(

resi

dues

x 1

00) m

g/kg

Days after treatment

imidacloprid @ 50mg/kg imidacloprid @ 100mg/kgimidacloprid @ 150mg/kg Linear (imidacloprid @ 50mg/kg)Linear (imidacloprid @ 100mg/kg) Linear (imidacloprid @ 150mg/kg)

0.00

1.00

2.00

3.00

4.00

5.00

7 14 21 28 35 42 49 56

log(

resi

dues

x 1

00) m

g/kg

Days after treatment

imidacloprid @ 50mg/kg imidacloprid @ 100mg/kgimidacloprid @ 150mg/kg Linear (imidacloprid @ 50mg/kg)Linear (imidacloprid @ 100mg/kg) Linear (imidacloprid @ 150mg/kg)

Fig. 3 Persistence of total imidacloprid residues in clay loam soil fortified with B. alkalinitrilicus a autoclaved soil; b unautoclaved soil

Environ Monit Assess

Author's personal copy

seems to cause reduction of imidacloprid to nitrosimineand imidacloprid-NTGmetabolites in addition to oxida-tion of imidacloprid to 6-chloronicotinic acid which isfinally converted to carbon dioxide. But in contrast tothe autoclaved conditions, lesser amount ofimidacloprid-NTG metabolite was formed and more ofnitrosimine metabolite was formed. Comparable toautoclaved conditions, a lesser amount of 5-hydroxymetabolite detected indicates that the hydroxylation ofimidacloprid occurred initially but the pathway was nota preferred one as the metabolite was not detected after7 days of treatment. The results are roughly comparableto the study conducted by Liu et al. (2011) who evalu-ated the degradation of different neonicotinoids in un-sterilized and sterilized soils and reported that underunsterilized conditions, 94 % of acetamiprid and98.8 % of thiacloprid were degraded within 15 days,while only 22.5 % of imidacloprid and 25.1 % ofimidaclothiz were degraded over a longer period of25 days. In contrast, in sterilized soils, the degra-dation rates of acetamiprid and thiacloprid were21.4 and 27.6 %, respectively, and the degradationproducts of imidacloprid and imidaclothiz wereidentified as olefin, nitroso, or guanidine metabo-lites. Likewise, three soil microbes, viz., Bacillusfirmus, Bacillus aerophilus, and B. thuringiensis,were isolated and identified from sugarcane fieldsand were found to be very effective in degradationof fipronil (Mandal 2012).

Degradation kinetics of total imidacloprid residuesin autoclaved and unautoclaved soil

The degradation kinetics of the imidacloprid and its me-tabolites in soils were determined by plotting residueconcentration against time, and the maximum squares ofcorrelation coefficients were used to determine the equa-tions of best fit curves. Confirmation of the kinetics orderwas further made graphically from the linearity of theplots of logC against time. None of the compounds andhence total imidacloprid residues followed the first-orderkinetics. Instead, total imidacloprid residues followed thepseudo first-order kinetics with R2 value of 0.738, 0.880,and 0.888 under autoclaved conditions for treatment ofimidacloprid at 50, 100, and 150 mg kg−1, respectively.The regression equation for the same was y=−0.026x+3.856, y=−0.027x+4.163, and y=−0.027x+4.349 for thetreatment of imidacloprid at 50, 100, and 150 mg kg−1,respectively. Similarly, in unautoclaved conditions also,

the R2 value was 0.989, 0.982, and 0.967 for totalimidacloprid residues at 50, 100, and 150 mg kg−1, re-spectively. The regression equation for the same was y=−0.017x+3.836, y=−0.020x+4.176, and y=−0.019x+4.339 for the treatment of imidacloprid at 50, 100, and150 mg kg−1, respectively (Fig. 3).

In view of the fact that soil is the ultimate sink foragrochemicals and supports a multitude of microfloraand fauna, so microbial degradation can act as an im-portant route for the elimination of these xenobiotics.This biodegradation of pesticides is complex involvingmultitude of biochemical reactions (Porto et al. 2011)but the detailed understanding of biodegradationoften requires continuous investigations. A goodnumber of these microbes act in natural environ-ment but a few amendments could be broughtabout to utilize their efficiency at a faster rate ina limited time. Hence, better understanding ofphysiology, biochemistry, and genetics of thesebacterial species can provide new prospects forenhancing their bioremediation potential.

Conclusions

Genus Bacillus is commonly found in soil and has theability to act upon pesticides and convert them intosimpler compounds. In present study, it was observedthat under autoclaved conditions, B. alkalinitrilicuscould degrade imidacloprid up to 98.02, 97.65, and97.47 % after 56 days of application of imidacloprid at50, 100, and 150 mg kg−1, respectively. While underunautoclaved conditions, the amendment withB. alkalinitrilicus could degrade imidacloprid up to83.91, 88.20, and 86.21% after 56 days after applicationof imidacloprid at 50, 100, and 150 mg kg−1, respec-tively. Among the metabolites, 6-chloronicotinic acid,nitrosimine followed by imidacloprid-NTGwere detect-ed. 5-Hydroxy metabolite was detected up to 7 days inunautoclaved and 15 days in autoclaved conditions, butduring later samplings, it remained below the detectablelimit. These residues did not follow the first-orderkinetics with R2 value of 0.738, 0.880, and 0.888under autoclaved and 0.989, 0.982, and 0.967 inunau toc l aved cond i t i on fo r t r ea tmen t o fimidacloprid at 50, 100, and 150 mg kg−1, respec-tively. These results showed that the potential ofB. alkalinitrilicus could be used for bioremediationof imidacloprid-contaminated soils.

Environ Monit Assess

Author's personal copy

Acknowledgments The authors are thankful to the Professorand Head, Department of Entomology, PAU, Ludhiana, forproviding the necessary research facilities.

References

Anhalt, J. C., Moorman, T. B., & Koskinen, W. C. (2007).Biodegradation of imidacloprid by an isolated soil microor-ganism. Journal of Environmental Science and Health. Part.B, 42, 509–514.

Barghouthi, S. A. (2011). A universal method for the identificationof bacteria based on general PCR primers. Indian Journal ofMicrobiology, 51, 430–444.

Cheah, U. B., Kirkwood, R. C., &Lum,K.Y. (1998). Degradation offour commonly used pesticides in Malaysian agricultural soils.Journal of Agricultural and Food Chemistry, 46, 1217–1223.

Dai, Y. J., Yuan, S., Ge, F., Chen, T., Xu, S. C., & Ni, J. P. (2006).Microbial hydroxylation of imidacloprid for the synthesis ofhighly insecticidal olefin imidacloprid.AppliedMicrobiologyand Biotechnology, 71, 927–934.

Dai, Y. J., Zhao, Y., Zhang, W., Yu, C., Ji, W., Xu, W., Ni, J. P., &Yuan, S. (2010). Biotransformation of thianicotinylneonicotinoid insecticides: diverse molecular substituent re-sponse to metabolism by bacterium Stenotrophomonasmaltophilia CGMCC 11788. Bioresource Technology, 10,3838–3843.

Fossen, M. (2006). Environmental fate of imidacloprid. http://www.cdpr.ca.gov/docs/emon/pubs/fatememo/Imidclprdfate2.pdf. Accessed December 2011.

Ge, F., Dai, Y. J., & Chen, T. (2006). Identification of a strain NJ2hydroxylating imidacloprid and the transformed product.WeiSheng Wu Xue Bao, 46, 557–560.

Gerhardt, P., Murray, R. G. E., Wood, W. A., & Krieg, N. R.(1994). Methods for general and molecular bacteriology.Washington, DC: ASM Press.

Gossel, A. T., & Bricker, J. D. (1994). Principle of clinical toxi-cology (3rd edn.). New York: Raven.

Greer, L. E., & Robinson, J. A. (1992). Kinetic comparison ofseven strains of 2,4-dichlorophenoxyacetic acid degradingbacteria. Applied and Environmental Microbiology, 58,1459–1461.

Ishaq, A., & Khan, J. A. (1994). Biodegradation of a pesticidealpha-cyno-3-phenoxy benzyl-2,2-dimenthyl-3 (2-2-dichlorophenyl) by Pseudomonas aeruginosa. PakistanJournal of Agricultural Research, 15, 242–250.

Jariyal, M. (2013). Elucidation of phorate metabolism by bacterialisolates from agricultural soil for bioremediation. Ph.D.Dissertation, Punjab Agricultural University

Li, C., Zhang, J., Wu, Z. G., Cao, L., Yan, X., & Li, S. P. (2012).Biodegradation of buprofezin by Rhodococcus sp. strain YL-1 isolated from rice field soil. Journal of Agricultural andFood Chemistry, 60, 2531–2537.

Liu, Z., Dai, Y., Huang, G., Gu, Y., Ni, J., Wei, H., & Yuan, S.(2011). Soil microbial degradation of neonicotinoid insecti-cides imidacloprid, acetamiprid, thiacloprid and imidaclothizand its effect on the persistence of bioefficacy against horsebean aphid Aphis craccivoraKoch after soil application. PestManagement Science, 67, 1245–1252.

Mandal, K. (2012). Absorption and metabolism of fipronil insugarcane and its persistence in soil. Ph.D. Dissertation,Punjab Agricultural University

Mandal, K., Singh, B., Jariyal, M., & Gupta, V. K. (2013).Microbial degradation of fipronil by Bacillus thuringiensis.Ecotoxicology and Environmental Safety, 93, 87–92.

Meyers, J. A., Sanchez, D., Elwell, L. P., & Falkow, S. (1976).Simple agarose gel electrophoretic method for the identifica-tion and characterization of plasmid deoxyribonucleic acid.Journal of Bacteriology, 127, 1529–1537.

Pandey, G., Dorrian, S. J., Russell, R. J., & Oakeshott, J. G.(2009). Biotransformation of the neonicotinoid insecticidesimidacloprid and thiamethoxam by Pseudomonas sp1G.Biochemical and Biophysical Research Communications,380, 710–714.

Porto, A. L. M., Melgar, G.Z., Kasemodel, M.C., & Nitschke, M.(2011). Biodegradation of Pesticides. In M. Stoytcheva (Ed.),Pesticides in the modern world—pesticides use and manage-ment. doi:10.5772/17686.

Sarkar, M., Roy, S., Kole, R., & Chowdhury, A. (2001).Persistence and metabolism of imidacloprid in different soilsof West Bengal. Pest Management Science, 57, 598–602.

Sharma, S., Mandal, K., & Singh, B. (2013). Sensitive methodol-ogy for simultaneous determination of residues ofimidacloprid and its metabolites in sugarcane leaves and soil.Journal of AOAC International (accepted)

Shetti, A. A., & Kaliwal, B. B. (2012). Biodegradation ofimidacloprid by soil isolate Brevundimonas sp. MJ15.International Journal of Current Research, 4, 100–106.

Tang, H. Z., Li, J., Hu, H. Y., & Xu, P. (2012). A newly isolatedstrain of Stenotrophomonas sp. hydrolyzes acetamiprid,a synthetic insecticide. Process Biochemistry, 47,1820–1825.

Wang, G., Yue, W., Liu, Y., Li, F., Xiong, M., & Zhang, H. (2013).Biodegradation of the neonicotinoid insecticides acetamipridby bacterium Pigmentiphaga sp. strain AAP-1 isolated fromsoil. Bioresource Technology. doi:10.1016/j.biortech.2013.03.193.

Zhu, G., Wu, H., & Guo, J. (2004). Microbial degradation offipronil in clay loam soil. Water, Air, and Soil Pollution,153, 35–44.

Environ Monit Assess

Author's personal copy