FEMS Microbiology Ecology 49 (2004) 181–190

www.fems-microbiology.org

Genetic diversity and distribution of periphytic Synechococcus spp.in biofilms and picoplankton of Lake Constance

Sven Becker a,*, Arvind Kumar Singh b, Christine Postius a, Peter B€oger a,Anneliese Ernst c

a Lehrstuhl f€ur Physiologie und Biochemie der Pflanzen, Universit€at Konstanz, Konstanz, Germanyb Department of Biochemistry, North-Eastern Hill University, Shillong 793022, India

c Netherlands Institute of Ecology, Centre for Estuarine and Marine Ecology, NL-4400 AC Yerseke, The Netherlands

Received 18 December 2003; received in revised form 24 February 2004; accepted 4 March 2004

First published online 26 March 2004

Abstract

In various water depths of the littoral zone of Lake Constance (Bodensee) cyanobacteria of the Synechococcus-type were isolated

from biofilms (periphyton) on three natural substrates and an artificial one (unglazed tiles). From one tile three strains of phyco-

erythrin (PE)-rich Synechococcus spp. were isolated, the first examples of these organisms in the epibenthos. Phylogenetic inference

based on the 16S–23S rRNA intergenic spacer (ITS-1) assigned all periphytic isolates to two clusters of the picophytoplankton clade

(evolutionary lineage VI of cyanobacteria). The sequence divergence in the ITS-1 was used to design specific PCR primers to allow

direct, culture-independent detection and quantification of isolated Synechococcus strains in natural periphytic and pelagic samples.

Denaturing gradient gel electrophoresis (DGGE) analysis revealed depth-related differences of Synechococcus spp. distribution on

tiles placed in the littoral zone. Synechococcus genotypes were observed which occurred in both the periphyton (on tiles) and in the

pelagic picoplankton. A strain with one of these genotypes, Synechococcus sp. BO 8805, was isolated from the pelagic zone in 1988.

Its genotype was found on tiles that had been exposed at different water depths in the littoral zone in spring and autumn of the year

2000. Quantitative analysis with a genotype-specific TaqMan probe and real-time Taq nuclease assays (TNA) confirmed its presence

in the pelagic zone, although appearance of this and related genotypes was highly irregular and exhibited strong differences between

consecutive years. Our results show that the ability to form significant subpopulations in pelagic and periphytic communities exists

in three out of four phylogenetic clusters of Synechococcus spp. in Lake Constance. This versatility may be a key feature in the

ubiquity of the evolutionary lineage VI of cyanobacteria.

� 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Synechococcus-type picocyanobacteria; Periphyton; Denaturing gradient gel electrophoresis; Phylogenetic analysis; Quantitative Taq

nuclease assay

1. Introduction

Synechococcus spp. are coccoid unicellular picocy-

anobacteria that are ubiquitous and occur in marine and

freshwater habitats. They contribute significantly to the

overall primary production in ecosystems of all climatic

zones [1,2]. According to the chromophores associated

* Corresponding author. Present address: University of Bristol,

School of Biosciences, Woodland Road, Bristol BS8 1UG, UK. Tel.:

+44-117-9288254; fax: +44-117-9257374.

E-mail address: SvenBecker@gmx.ch (S. Becker).

0168-6496/$22.00 � 2004 Federation of European Microbiological Societies

doi:10.1016/j.femsec.2004.03.003

with the phycobiliproteins, two major pigment types of

Synechococcus spp. are distinguished, red-pigmented

phycoerythrin (PE)-rich strains, and blue-green phyco-

cyanin (PC)-rich strains devoid of phycoerythrin. Light

quality, through its effect on growth rate, is important in

controlling the occurrence of picocyanobacteria with

different accessory pigments [3–6].The pelagic zone of Lake Constance (47� 410N 09�

070E, 476 km2, maximal depth 254 m) is a typical habitat

for PE-rich Synechococcus spp., because the ecosystem

has been developing during the last 20 years from meso-

eutrophic to meso-oligotrophic nutrient conditions [7]

. Published by Elsevier B.V. All rights reserved.

182 S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190

and blue/green light can penetrate the water column

deeply. Epifluorescence microscopy revealed that the

autotrophic picoplankton of this lake is dominated by

PE-rich picocyanobacteria throughout the year [8],

whereas PC-rich forms represent less than 5% of the pe-lagic population [9].

Picocyanobacteria have also been observed in mats

and biofilms in hot springs [10–12] and hypersaline

ponds [13]. In a study on picocyanobacteria in hypers-

aline microbial mats, Abed et al. [14] suggested use of

the terms picoplankton and picobenthos, in order to

distinguish between freely suspended and sessile organ-

isms in the corresponding habitats. In all these ecosys-tems, gradients of light, temperature and nutrients may

provide niches that can be occupied by different ecotypes

of photoautotrophic bacteria (for review, see [11,15]).

The littoral zone of Lake Constance (fringing region

within the euphotic zone, down to a water depth of 10

m) represents about 15% of the surface area of this

freshwater ecosystem. Cyanobacteria often have been

observed in mats and biofilms (periphyton) in the upperlittoral zone [16], but a study of the diversity and dis-

tribution of picocyanobacteria in periphyton in Lake

Constance has not been performed. Here we describe the

isolation and characterisation of PE- and PC-rich Syn-

echococcus-type picocyanobacteria from biofilms that

cover various natural and artificial substrates in the lit-

toral zone of this ecosystem. We refer to them as peri-

phytic isolates in order to distinguish them from pelagicones, or use the terms epiphytic (from macrophytes),

epilithic (from stones) and epibenthic (from tiles), to

specify the origin of isolates.

16S rRNA-inferred phylogenetic analyses showed

that Synechococcus-type cyanobacteria are polyphyletic

[17,18]. However, strains isolated from the pelagic zone

of Lake Constance and other temperate zone lakes

[19,20] as well as marine genotypes, which dominate thewater column in the Red Sea [21], all belong to one

phylogenetic lineage, referred to as either the pic-

ophytoplankton clade [22] or evolutionary lineage VI of

cyanobacteria [17]. In pelagic Synechococcus spp. from

Lake Constance the 16S rRNA was too conserved (se-

quence divergence 0–4%) to permit discrimination of

different strains, but mutations in the long 16S–23S in-

ternal transcribed spacer (ITS-1) were correlated withphenotypes [20], which have been revealed in growth

and predation studies (for review, see [15]). Extensive

variability in the ITS-1 also allowed pelagic Synecho-

coccus isolates from Lake Constance to be assigned to

one of three distinct phylogenetic clusters, the Subalpine

Clusters I and II as well as strains similar to the type

strain Cyanobium gracile PCC 6307 [20].

In order to study the diversity and distribution ofperiphytic and pelagic genotypes of picocyanobacteria in

natural samples, we used two PCR-based techniques:

denaturing gradient gel electrophoresis (DGGE, [23]) and

real-time Taq nuclease assays (TNA, [24]). We selected

PCR primers that target ITS-1 sequences of particular

phylogenetic groups of Synechococcus strains that had

been isolated from Lake Constance [20] and used DGGE

to separate the amplicons on the basis of their sequence-dependent melting properties. Genotypes were identified

by comparing the Rf values of fragments produced by

DNA of isolated strains and of natural samples, followed

by excision, reamplification and sequencing of the re-

spective bands to confirm their identity. Since DGGE has

a limited sensitivity and provides only semiquantitative

information, we applied Taq nuclease assays, which have

allowed the quantification of a Synechococcus ecotype insitu in the presence of a high background of closely re-

lated DNA [24,25]. Thus, the abundance of genotype

Synechococcus sp. BO 8805, which frequently was de-

tected byDGGE in periphyton, could bemonitored in the

picoplankton throughout the seasons.

2. Materials and methods

2.1. Sampling, strain isolation and culture conditions

All periphytic Synechococcus strains were obtained

from the northwest basin (‘ €Uberlinger See’) of Lake

Constance. PC-rich isolates from three natural sub-

strates located within a small area of the littoral zone

were collected in early summer 1998. Stones (for epi-lithic isolates) were taken from the surf zone, Phragmites

australis (for epiphytic isolates), grew nearby, and the

submerged macrophyte Chara sp. was found deeper in

the same segment of the lake. Epiphytic Synechococcus

spp. were isolated by scraping off a small area of pe-

riphyton from P. australis and Chara sp., respectively,

followed by culturing the obtained cell suspension on

agar amended with BG11 [26]. Picocyanobacterial col-onies, identified by fluorescence microscopy [27], were

picked and repeatedly re-streaked. Finally, single colo-

nies were transferred to liquid BG11 medium and since

then strains have been maintained at 21 �C under white

light, our standard culture conditions [28]. For isolation

of epilithic picocyanobacteria, about 0.5 cm2 of the

calcium carbonate crust of stones was homogenised in

BG11 medium and spread on agar plates amended withBG11. The epilithic Synechococcus spp. were maintained

as described for the epiphytic isolates.

In order to obtain samples of freshly formed pe-

riphyton, in the year 2000 unglazed tiles were deposited

for six weeks at different water depths of the littoral

zone, 8 km distant from the routine pelagic sampling site

of this area of the lake (‘ €Uberlinger See’). Two series of

tiles were used, the first in early spring from the begin-ning of March to mid of April (0.5, 3, 5 and 7 m depth),

the second from end of August to mid of October (0.5, 1,

3 and 7 m depth). After collection, each tile was rinsed

S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190 183

briefly with 1 litre of sterile distilled water in order to

remove sediment particles and cells not embedded in the

biofilm, which then was brushed off and collected as a

cell suspension. A small portion (50 ll) of the cell sus-

pension from each tile in the spring was spread on agarplates without combined nitrogen (BG110) and cultured

under our standard conditions (see above) for three

months. Single red and green colonies from these plates

were then transferred to agar plates amended with BG11

and were cultured for another two months under com-

plementary light (green and red, respectively) in order to

promote growth of strains with the desired pigment

type. Distinct red and green colonies were picked andtransferred to liquid BG11. Additionally, 50 ll of the

cell suspensions from tiles in the spring was spread on

agar plates with combined nitrogen (solidified BG11)

and cultured under our standard conditions (white light

only). After 12 weeks, these plates were divided in four

segments and all colonies from each segment were

scraped off and pooled for DGGE analysis (see below).

In order to identify isolated Synechococcus strains inpelagic samples by DGGE, water from the routine pe-

lagic sampling site of ‘ €Uberlinger See’ was obtained

during the growth seasons (May–October) 1999 and

2000 and the picoplankton was collected on filters as

described previously [25].

2.2. DNA preparation

Three weeks after inoculation in BG11, batch cultures

(40 ml) of picocyanobacteria were harvested by centri-

fugation (7 min, 7000g), frozen in liquid nitrogen and

stored at )20 �C. Genomic DNA was extracted as de-

scribed [29]. DNA from filters with pelagic picoplankton

was extracted according to Becker et al. [25]. For DNA

extraction from periphytic biofilms, 50 ll of the cell

suspension obtained from the tiles was incubated with350 ll of 5% (wt/vol) aqueous suspension of Chelex-100

(sodium form, 100–200 mesh, BioRad, M€unchen, Ger-

many) and processed as described [25]. Cells pooled

from colonies on BG11 plates and filter pieces with

picocyanobacteria were treated accordingly in 300 and

400 ll, respectively, of 5% (wt/vol) Chelex-100.

2.3. ITS-1 sequencing and phylogenetic analysis

For genetic characterisation of new periphytic Syn-

echococcus strains from the littoral zone, the ITS-1 in

the ribosomal operon was amplified with primers PIT-

SANF and PITSEND [24]. The amplified DNA was

purified by passage through ion exchange columns

(Boehringer, Mannheim, Germany) and resuspended in

50 ll sterile distilled H2O. Double-stranded sequencingwas performed at GATC GmbH (Konstanz, Germany)

by applying various primers that target internal se-

quences of ITS-1 [20]. For phylogenetic analyses, the

complete sequences of the ITS-1 of isolated strains or

the partial ITS-1 sequences of isolated strains and ge-

notypes identified in DGGE bands (157–194 bp, de-

pending on the cluster) were aligned (with manual

corrections) by using the program ClustalX [30]. Thephylogenetic trees were constructed with a distance

matrix function [31] and the neighbour joining method

[32] as provided by the software package TREECON

[33].

2.4. Denaturing gradient gel electrophoresis (DGGE)

GC-clamped PCR products were synthesised bynested PCR as described [25], with DNA from isolated

strains and natural periphyton samples. Three primer

pairs were used: PITSGCANF/PITSGC [25] or PPCG-

CANF (50CGCAACTGATCGTGATGTCTG, Tm

55 �C)/PTRNAGC (50GCCGCGCCCGCCGGCCGCC

CGCGCGCCCGCCGCCGCGCCCGCCGCCGCCC

GGCGGGCGCTCTAACCACCTGAGCTAAT, Tm

57 �C, without 55 bp GC-tail taken into consideration)and PLITCLUST (50TGTGATGTCTGGCTAAATTA

TTGCT, Tm 55 �C)/PTRNAGC (see above). The Tm of

the primers was calculated by using the programme

PCRplan from software PCGene, version 6.7. They were

synthesised by MWG (Ebersberg, Germany), Interac-

tiva (Ulm, Germany) or Genaxis (Spechbach, Ger-

many). For DGGE, 0.8 mm polyacrylamide gels (10%

acrylamide-N,N0-methylene-bisacrylamide, 37.5:1) wereprepared with 10–40% or 30–70% denaturing gradient,

respectively. 100% is defined as 7 M urea and 40% (vol/

vol) formamide. Electrophoresis was performed at 60 �Cfor 4 h (10–40% denaturing gradient) or 12–15 h (30–

70% denaturing gradient) at 200 or 100 V, respectively.

1�TBE running buffer (pH 8) contained 88 mM Tris,

88 mM boric acid and 2 mM Na2–EDTA. For strain

identification, marker slots were loaded with mixtures,including 1 ll PCR product of the isolated strains as

indicated in the figures, and run next to samples of the

amplified natural DNA (5 ll of the second reaction of

nested PCR). The gels were stained 30 min with Sy br�Gold nucleic acidgel stain (Molecular probes) and

photographed under UV illumination. For confirmation

of the identity of DGGE bands, they were excised, ex-

tracted from the gel and the fragments obtained ream-plified as described [25]. The migration behaviour of the

reamplified fragments was checked in corresponding

gradient gels before sequences of both strands were

obtained (GATC GmbH, Konstanz, Germany).

2.5. Quantitative Taq nuclease assays (TNA)

For quantitative detection of Synechococcus sp. BO8805 in natural samples by TNA, the primer pair

PS8805F (50TTTCATCTCATGGTTAGCCCAATC,

Tm 57 �C)/PS8805RA (50ATCACAAACATCAACCT

184 S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190

CGCG, Tm 56 �C) and fluorescent TaqMan probe

S8805 (50VIC-AACAGATTCAGGTGTCAGCCATG

ATTGAAA-TAMRA, Tm 65 �C) were developed on

basis of the aligned ITS-1 sequences of closely related

Synechococcus strains from Lake Constance [20]. ForTaq nuclease assays, we used the assay chemistry and

the thermal program described previously [25]. Dupli-

cate reactions with DNA from three filter pieces were

performed in a model ABI PRISM� 7700 Sequence

Detection System (PE Biosystems, Foster City, CA,

USA). For calibration, a standard was prepared for

strain BO 8805 and the stability of the assay was tested

by adding DNA of the phylogenetically related PE-richstrain Synechococcus sp. BO 0014 as competing target.

For quantification, a genome size of 3� 106 bp was

assumed for both strains (for details, see [24]). The

threshold cycle method [34] was used for the construc-

tion of the calibration curve. The amplification efficiency

at the threshold cycle (CT) was calculated for genomic

and natural DNA as described previously [24].

2.6. Nucleotide sequence data

The nucleotide sequence data generated in this study

can be found in EMBL nucleotide sequence database

under the accession numbers AJ519813 to AJ519817

and AJ519820 to AJ519834.

3. Results

3.1. Isolation and characterisation of periphytic picocy-

anobacteria

A number of unialgal Synechococcus cultures were

established from biofilms of natural and artificial sub-

strates in the littoral zone of Lake Constance. The epi-phytic, epilithic and epibenthic strains showed

unambiguous ITS-1 sequences, which were obtained

from direct double-stranded sequencing of the PCR

products. Because in all picocyanobacterial strain clus-

ters of Lake Constance known to date the non-coding

sequences in the ribosomal operon reflect the genetic

Table 1

Periphytic Synechococcus genotypes from Lake Constance

Strain Sampling date (day/month/year)

BO 0014 15/04/2000

BO 00410 ’’

BO 005022 ’’

BO 00521 ’’

BO 00545 ’’

BO 00703 ’’

BO 00715 ’’

BO 981502 09/06/1998

BO 983115 07/07/1998

BO 984127 09/06/1998

diversity of the genomic RFLP of psbA genes [20], the

sequence polymorphism in the ITS-1 was used to es-

tablish new periphytic Synechococcus genotypes.

Four different PC-rich Synechococcus isolates were

obtained from the periphyton of roots and leaves of asingle stem of reed (P. australis), three from the sub-

merged macrophyte Chara sp. from the supralittoral

zone and three from the calcium carbonate crust of a

single stone. Among these PC-rich isolates three new

genotypes was established, one for each of the substrates

(Table 1). The epiphytic and epilithic Synechococcus

isolates showed no significant differences in size and

photoautotrophic growth (data not shown) from PC-rich pelagic strains [28] when grown under our standard

culture conditions.

In the spring of the year 2000, we isolated epibenthic

Synechococcus spp. from biofilms on tiles that had been

left for six weeks at different water depths. Suspensions

of cells recovered from biofilms were spread on solidified

BG11 (with nitrate) and BG110, a medium with a low

concentration of combined nitrogen due to the omissionof nitrate. On BG11 media, numerous and exclusively

blue-green colonies of picocyanobacteria were observed.

The absence of combined nitrogen, however, reduced

growth of blue-green colonies and the development of

red-pigmented colonies was favoured. Some of the pic-

ocyanobacterial colonies from BG110 were transferred

to BG11 plates for strain isolation. These plates were

incubated under light of complementary colour (i.e., redlight for green PC-rich isolates, green light for red PE-

rich isolates) to maintain a selective pressure for cells of

the different pigment types. We isolated three PE-rich

Synechococcus spp. from a tile left at a depth of 7 m and

four PC-rich strains from tiles at depths of 0.5 and 1 m;

each of these epibenthic isolates represented a new ge-

notype (Table 1).

The alignment of the complete ITS-1 sequences of the10 new periphytic and 12 pelagic Synechococcus geno-

types of Lake Constance revealed a phylogenetic tree

with closely related periphytic strains which can be

found in two out of three clusters (data not shown).

These phylogenetic relationships are reflected in a tree

that is based on 157–194 bp (depending on the cluster)

Pigment type Substrate

PE Tile at 7 m depth

’’ ’’

’’ ’’

PC Tile at 1 m depth

’’ ’’

’’ Tile at 0.5 m depth

’’ ’’

’’ Stone

’’ Chara sp.

’’ Phragmites australis

Fig. 1. Phylogenetic relationships of periphytic and pelagic Synechococcus spp. from Lake Constance, based on the comparison of 157–194 bp

(depending on the cluster) of the ribosomal ITS-1 of isolated strains and of genotypes identified by DGGE in natural samples. Sequences designated

as ‘‘BO’’ plus four to six digits represent isolated strains from Lake Constance; numbers with five digits: sequences derived from excised DGGE

bands. Sequence accession numbers and figure numbers of this study (in brackets) are shown after the sequence identity. Site of isolation: T, tiles

deposited in spring and autumn in the littoral zone for six weeks (year 2000); P, pelagic zone; M, surface of a macrophyte (BO 984127 from

Phragmites australis, BO 983115 from Chara sp.); S, stone from the surf zone. See Section 2 for details on the construction of the phylogenetic tree.

Bootstrap values were calculated for 100 analyses and are shown for main nodes only. C. gracile: Cyanobium gracile (type strain). Outgroup:

Synechococcus sp. LB P1 (Lake Biwa, Japan).

S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190 185

of a variable region in ITS-1 (Fig. 1). This tree was

constructed to assign genotypes identified by DGGE in

natural samples (see below). One out of the four epi-

benthic PC-rich genotypes from tiles, strain BO 00715,

was assigned to the C. gracile Cluster, which also com-

prises the epiphytic strains BO 984127 and BO 983115,

the epilithic strain BO 981502 as well as the pelagicstrains BO 8801, BO 8806 and BO 9301. Six epibenthic

strains BO 00521, BO 00545, BO 00703 (PC-rich) and

BO 0014, BO 00410, BO 005022 (PE-rich) were assigned

to Subalpine Cluster II, which also holds PC-rich strain

BO 8805 that was isolated in 1988 from the pelagic zone

of Lake Constance. None of the periphytic genotypes

exhibited an ITS-1 sequence that is closely related to

that of eight pelagic PE-rich genotypes known to date[29], which belong to Subalpine Cluster I [20].

3.2. Diversity, distribution and abundance of Synecho-

coccus spp. in natural samples

We were interested in the diversity of Synechococcus

genotypes from the C. gracile Cluster and the Subalpine

Cluster II (compare Fig. 1) in natural samples from

Lake Constance and we wanted to find out whether

genotypes of isolated strains of these two clusters could

be traced in the original habitat. For DGGE analysis,

we selected primer pair PPCGCANF/PTRNAGC in

order to recognise genotypes of both clusters. Due to

length variation of the ITS-1 between these two clusters[20], the GC-clamped amplicons comprised 424 and 261

bp for genotypes of the C. gracile Cluster and the Sub-

alpine Cluster II, respectively. After DGGE conditions

for the selected primer pair and a marker that consists of

three periphytic and three pelagic strains from both

clusters, had been established (Fig. 2A), we detected

target sequences in pelagic water samples from the

growth seasons (mid of May–mid of October) of theyears 1999 and 2000. High genetic diversity and re-

markably different patterns of genotype succession were

observed in the picoplankton in these two years (Figs.

2B and C). However, only few bands were detected that

exhibited similar Rf values as the marker amplicons of

isolated strains. These bands were excised from the gels,

reamplified and sequenced. No genotype of the C.

Fig. 2. Identification of Synechococcus genotypes from the Cyanobium

gracile Cluster and Subalpine Cluster II in pelagic water samples by

DGGE. Primer pair PPCGCANF/PTRNAGC and 30–70% denatur-

ing gradients were used, for details see Section 2. A: Six PC-rich pelagic

and periphytic strains from Lake Constance used in the marker lanes

(M). B and C: Analysis of pelagic water samples (integrated from 0 to 8

m depth) of the growth periods 1999 and 2000 (May–October), see

sampling dates above the lanes. 1 ll of PCR assays with DNA from

isolated strains (panel A and each strain in the marker lanes) and 5 llof assays with amplified natural DNA (from the second reaction of

nested PCR) were applied per lane. White arrowheads indicate bands

that were excised, reamplified and sequenced. Sequence identities are

shown on the right, BO 8805¼ genotype of isolated strain Synecho-

coccus sp. BO 8805.

Fig. 3. Evaluation of a Taq nuclease assay for Synechococcus sp. BO

8805. A: standard curve. 10 ll assays contained approximately 101 to

106 genome copies of BO 8805, 300 nM primers PS8805F/PS8805RA

and 200 nM probe S8805. For details on other components and PCR

program, see Becker et al. [25]. Fluorescence threshold DRQ¼ 0.05;

s¼ slope; amplification efficiency: e ¼ 10�1=s � 1. B: Detection of

Synechococcus sp. BO 8805 in the presence of DNA from Synecho-

coccus sp. BO 0014 from the same cluster (Subalpine Cluster II,

compare Fig. 1). Approximately 100 to 107 genome copies of this strain

were added to approximately 102 (j) and 103 (�) genome copies of

Synechococcus sp. BO 8805. Controls: Synechococcus sp. BO 8805

only. Assay conditions as described for panel A.

186 S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190

gracile Cluster was found, but in one sample (June 2,1999) the genotype of Synechococcus sp. BO 8805 was

identified (Fig. 2B). All other bands with similar Rf

values yielded five sequences of unknown genotypes.

The unknown partial ITS-1 sequences recovered (157–

194 bp, without primer sequences) often deviated in only

a few bases from the sequences of isolated strains. A

phylogenetic analysis assigned three of the new se-

quences to Subalpine Cluster II (Fig. 1). The sequences54963 and 55936 (Figs. 2B and C) represent genotypes

of a Subalpine Cluster III previously unknown in Lake

Constance (Fig. 1).

The presence of genotype Synechococcus sp. BO 8805,

which had been isolated from the pelagic zone in 1988,

in this habitat in 1999, caused us to assess quantitatively

the dynamics of this genotype in the picoplankton dur-ing the growth seasons of two consecutive years. For

this, we established a Taq nuclease assay (TNA) in order

to detect genotype BO 8805 in the same samples that

were used for DGGE analysis (Fig. 2). The oligonu-

cleotide primers PS8805F and PS8805RA were chosen

to generate a 106 bp amplicon in the variable region of

ITS-1 between tRNAAla and 23S rRNA [20] and a log-

linear calibration curve was established (Fig. 3A) by theapplication of fluorescent probe S8805 on serially di-

luted genomic DNA from strain BO 8805. We also

tested the stability of the CT value of the standard assays

by the addition of a background of genomic DNA from

a PE-rich genotype from the same cluster, strain Syn-

echococcus sp. BO 0014 (Fig. 1). The genome copy

number of BO 0014 that was added to these assays had

Fig. 4. DGGE identification of Synechococcus genotypes from the

Cyanobium gracile Cluster and Subalpine Cluster II in periphyton

(cultured cell suspensions). Tiles had been deposited in spring of the

year 2000 at 0.5 m depth (left panel) and 3 m depth (right panel). Each

lane represents the mixture of all colonies of one out of four segments

of a BG11 agar plate after culturing for 12 weeks (see Section 2). M:

marker with pelagic and periphytic strains (see Fig. 2). For DGGE

conditions in brief, see legend of Fig. 2 or Section 2 for details. The

band in lane 6 that is indicated by a white arrowhead was excised,

reamplified and sequenced.

S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190 187

been confirmed (data not shown) by a general TNA for

Synechococcus spp. [25]. In assays with 102 and 103 ge-

nome copies of Synechococcus sp. BO 8805, no change

of the CT value was observed, even if as many as 107

genome copies of strain BO 0014 were added (Fig. 3B).Hence, the genotype of strain BO 8805 could be traced

with high specificity, even when the ratio of background

to target was 105. Additionally, we calculated the am-

plification efficiency at the threshold cycle of all reac-

tions to ensure the similarity of reaction efficiencies with

genomic (e ¼ 0:88, Fig. 3A) and natural DNA [25]. By

this methodology as few as 20 copies of BO 8805 ge-

nomes could be detected in a 10 ll Taq nuclease assay,which due to concentration of the pelagic water samples

by filtration corresponded to a detection limit of 10

genomes per ml of lake water.

In the growth period of the year 1999, genotype BO

8805 was detected in seven out of 11 pelagic samples,

with up to 133� 105 genomes per ml or up to 0.4% of

the total pelagic population of Synechococcus spp. (cf.

[25]). In the sample from June 2, 1999, when the geno-type of BO 8805 had been detected by DGGE (see

Fig. 2B), 28� 27 genomes per ml were observed, the

lowest abundance and second lowest fraction (0.08%) in

this year. In the year 2000, genotype BO 8805 was less

abundant and was detected on two occasions only:

12� 3 genomes per ml on August 29 (0.06% of the total

population) and 14� 6 genomes per ml on October 10

(0.04% of the total population).In order to get information on the diversity and dis-

tribution of epibenthic Synechococcus genotypes on

tiles, we used DGGE and the oligonucleotide primers

for genotypes of the C. gracile Cluster and the Subalpine

Cluster II (compare Figs. 1 and 2). First, we analysed

the numerous blue-green colonies on solidified BG11

that had been inoculated with picocyanobacteria sus-

pensions obtained from tiles in the spring 2000. Tilesthat had been deposited for six weeks at 3, 5, and 7 m

water depth exhibited co-dominance of several geno-

types: virtually identical patterns of amplicons were

observed at all depths (Fig. 4, 3 m depth, other data not

shown). Only the plate inoculated with periphytic cells

from 0.5 m depth partially deviated from this pattern; as

in pelagic samples, we noticed the absence of amplicons

assigned to (periphytic) genotypes of the C. gracile

cluster. All DGGE gels showed a band with the same Rf

value as the amplicon derived from strain Synechococcus

sp. BO 8805. Its genotype was identified in these bands

by sequence analysis (Fig. 4, lane 6, other data not

shown). Although strain BO 8805 was isolated from the

pelagic habitat in 1988, in the year 2000 its genotype was

detected by Taq nuclease assays in August and October

in the same habitat (see above); it also occurred on allfour tiles deposited in early spring in the same year.

In the year 2000, we also examined the picocyano-

bacterial periphyton in situ on tiles deposited at the end

of the growth season. We applied three sets of PCR

primers: PPCGCANF/PTRNAGC for genotypes of the

C. gracile Cluster and the Subalpine Cluster II (seeabove), PITSGCANF/PITSGC for genotypes of Sub-

alpine Cluster I [25] and the new set PLITCLUST/

PTRNAGC exclusively for genotypes of Subalpine

Cluster II. High genetic diversity was observed down to

a water depth of 7 m and also differences in the number

of genotypes at various depths were found (Fig. 5).

Genotypes of Subalpine Cluster I showed homogeneous

distribution at all depths (Fig. 5B), whereas a highernumber of genotypes of the C. gracile Cluster and

Subalpine Cluster II was observed at greater depth

(Fig. 5A); this is in stark contrast to the distribution of

genotypes of the Subalpine Cluster II (only one geno-

type at 7 m depth, Fig. 5C). These results illustrate that

the overlap in the target groups of the two primer pairs

can be very small and, if analysed separately, would lead

to conflicting conclusions about the depth distributionof picocyanobacteria.

Two genotypes of Subalpine Cluster II, which are

held as isolated strains (BO 00703 and BO 8805,

Fig. 5A) and two of Subalpine Cluster I (BO 9404, BO

8809, Fig. 5B), were identified at depths of 3 and 0.5 m,

respectively. Several unknown Synechococcus genotypes

were identified and assigned to Subalpine Clusters I and

II (Fig. 1). No bands that represented known genotypesof the C. gracile Cluster were detected (Fig. 5A).

As demonstrated for Synechococcus sp. BO 8805, two

other genotypes of Subalpine Cluster II were identified

on tiles in the littoral zone and also in the pelagic habitat

of Lake Constance. Sequence 80259 (¼ 54959) was

found in the pelagic zone on June 14, 2000 (Fig. 2C) and

also on a tile at 1 m depth in the autumn of the same

year (Fig. 5A). In the same two samples sequence 80261(¼ 54960) was detected.

Fig. 5. DGGE identification of Synechococcus genotypes in periphyton

in situ. Tiles had been exposed for 6 weeks in autumn of the year 2000

at the water depths indicated. A: Separation of genotypes from the

Cyanobium gracile Cluster and Subalpine Cluster II with primer pair

PPCGCANF/PTRNAGC in a 30–70% denaturing gradient. B: Ge-

notypes from Subalpine Cluster I (primer pair PITSGCANF/PITSGC,

10–40% denaturing gradient). C: Genotypes from Subalpine Cluster II

only (primer pair PLITCLUST/PTRNAGC, 30–70% denaturing gra-

dient). For details, see Section 2. M: marker with PCR fragments of

the isolated strains that are indicated on the left. Bands excised for

sequence analysis are indicated by white arrowheads, compare se-

quence identities on the right. Sequences designated as ‘‘BO’’ plus four

or five digits represent genotypes of isolated Synechococcus strains

from Lake Constance.

188 S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190

4. Discussion

From biofilms that covered natural and artificial

substrates in the littoral zone of Lake Constance, we

isolated 17 strains of Synechococcus spp. that represent

10 new genotypes (Table 1). Most of the isolates syn-

thesise PC as the major accessory pigment, but by using

an improved isolation protocol (low concentration ofcombined nitrogen during the initial culturing, selective

light during sub-culturing), we were able to recover se-

ven different PC- and PE-rich Synechococcus strains that

represent seven new genotypes from the periphyton of a

single substrate (tiles, see Table 1). This isolation pattern

represented a highly diverse picocyanobacterial com-munity on tiles in situ and was confirmed by DGGE as a

culture-independent method (Figs. 4 and 5). Our origi-

nal isolation procedure (high concentration of combined

nitrogen, white light), which was applied to obtain epi-

phytic and epilithic strains, not only may have biased

the pigment type but also may have reduced genetic

diversity among recovered strains.

A phylogenetic study based on sequences of theribosomal ITS-1 assigned all periphytic isolates from

Lake Constance to two of three phylogenetic clusters

known from the pelagic zone of this lake (Fig. 1). In

Subalpine Cluster II, six out of seven genotypes were

isolated from periphyton on tiles, and four of the seven

genotypes in the C. gracile Cluster originated from the

four substrates investigated in this study. The ITS-1

clusters correspond to three lineages in a 16S rRNA-based phylogenetic analysis [20] of the picophytoplank-

ton clade [22] or the corresponding ‘major evolutionary

lineage VI’ of cyanobacteria described by Honda et al.

[17]. Thus, picocyanobacteria from biofilms in Lake

Constance exhibited much closer phylogenetic relation-

ships to isolates of the picoplankton than to Synecho-

coccus spp. isolated from substrates in hot springs and

hypersaline ponds [12,13] or than to picocyanobacteriaidentified by fluorescence in situ hybridisation and

DGGE in the picobenthos of hypersaline microbial mats

[14].

Previously we had demonstrated that genotypes of

isolated Synechococcus strains from the Subalpine

Cluster I can be identified in natural pelagic samples by

DGGE, with PCR primers that target ITS-1 sequences

instead of the more conserved 16S rRNA [25]. In thisstudy, pelagic samples from growth seasons of two years

were subjected to DGGE analysis to identify (known)

genotypes of the C. gracile Cluster and the Subalpine

Cluster II (Fig. 2). The band patterns in the gels were

much less regular than those of the pelagic genotypes of

Subalpine Cluster I, which represent the PE-rich auto-

trophic picoplankton that dominates Lake Constance

[25]. Only once in 21 samples a known genotype, that ofstrain Synechococcus sp. BO 8805, was identified

(Fig. 2B). Furthermore, the second half of the growth

period in 1999 was dominated by a genotype, which

according to sequence analysis, belongs to a previously

unknown Subalpine Cluster III of Synechococcus spp.

(Fig. 1). In the year 2000, the picoplankton appeared

highly dynamic and many unknown genotypes formed

temporally significant subpopulations (Fig. 2C). Someof the recovered genotypes of this year were assigned to

Subalpine Cluster II and one to the new Subalpine

Cluster III.

S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190 189

In all our experiments, we failed to detect genotypes

of the C. gracile Cluster by DGGE in situ, i.e. in

picoplankton (Fig. 2) and in periphyton (Figs. 4 and

5). Nevertheless, three strains of this cluster had been

isolated from the picoplankton and four from periph-yton on natural and artificial substrates. Because these

strains use phycocyanin as the major accessory pig-

ment, their isolation may have been favoured by our

initial method (see above). Genotypes of the C. gracile

Cluster may not be as rare in situ as suggested by our

DGGE protocol. We explain our results with a possi-

ble bias in the PCR assays, which have been performed

for the generation of GC-clamped amplicons forDGGE analysis. In these assays the primer pair

PPCGCANF/PTRNAGC amplified a 424 and a 261-

bp fragment in genotypes of the C. gracile Cluster and

the Subalpine Cluster II, respectively. These reactions

may have been biased towards the shorter amplicon

(see [24] on the effect of target competition in PCR)

and, hence, in DGGE gels genotypes of the C. gracile

Cluster may not have yielded visible bands. Therefore,this technique provided no information on the in situ

distribution of genotypes of the C. gracile cluster in

Lake Constance.

The picocyanobacteria in the periphyton of an arti-

ficial substrate (tiles) with (Fig. 4) or without prior en-

richment (Fig. 5) appeared no less diverse in DGGE

analysis than the picoplankton (Fig. 2). On tiles, the

presence of many genotypes assigned to SubalpineCluster I and II was confirmed by sequence analysis of

DGGE bands (Fig. 1). Furthermore, in early spring an

inoculum of many picocyanobacterial genotypes must

have been present in the waterbody of the littoral zone

in Lake Constance. Additionally, the occurrence of a

periphytic community with depth-related differences of

genotype distribution on tiles in autumn (Fig. 5) implies

colonisation along gradients of light and nutrients,but may also reflect the influence of turbulence and

predation.

DGGE analysis revealed the occurrence of two un-

identified and two identified genotypes (BO 8809 and

BO 9404) of Subalpine Cluster I in periphyton that had

developed after six weeks on tiles in the autumn of the

year 2000 (Fig. 5B). As yet, isolates of this cluster have

been obtained only from the pelagic picoplankton. Thequestion arises whether at the end of the growth period

planktonic genotypes sink down and can be found in the

epibenthos (biofilm on tiles) or whether genotypes of

Subalpine Cluster I can thrive on both the solid sub-

strates and in the picoplankton, depending on environ-

mental factors. Evidence for the existence of such

widespread organisms in the highly diverse population

of picocyanobacteria in Lake Constance is provided bythe results of strain isolation (C. gracile cluster) and the

detection of one known (that of strain BO 8805) and two

unknown genotypes of Subalpine Cluster II in the year

2000 in the pelagic habitat as well as in biofilms on tiles

(Figs. 2, 4 and 5). These findings suggest that Synecho-

coccus spp. of Subalpine Cluster I and II as well as the

C. gracile Cluster can occur in the periphyton and

picoplankton of Lake Constance.From the results presented in this study, we conclude

that picocyanobacteria of the evolutionary lineage VI of

cyanobacteria [17] are not exclusively pelagic organisms

but also colonise periphyton (biofilms) in the euphotic

zone of temperate-zone lakes. The occurrence of wide-

spread genotypes in bacteria, which can thrive in bio-

films and the pelagic habitat, challenges the conceptual

discrimination of organisms by their habitats, as sug-gested by the terminologies picoplankton and picoben-

thos [14]. Such a discrimination seems to be valid only

for an ecological but not for a taxonomic description.

The presence of picocyanobacteria with a certain geno-

type in various habitats of aquatic ecosystems may be

the result of acclimation or of a local (endemic) adaptive

radiation of these organisms [15,20]. Ecotypes may have

recently acquired the ability to occupy various niches inthe same ecosystem. At present, we cannot say whether

the genotypes that were followed by our methodology

represent identical strains that compete in two very

different habitats, or are ecotypes with identical ITS-1

target sequences. Nevertheless, the observed versatility

may be the key-feature for the ubiquity of organisms of

the picophytoplankton clade [22] or evolutionary lineage

VI of cyanobacteria [17] in marine and freshwater eco-systems. Further insights into the ecology of picocy-

anobacterial periphyton and the distribution of

genotypes in biofilms and adjacent waterbodies will re-

quire additional physiological and quantitative genetic

studies.

Acknowledgements

This project was funded by Deutsche Forschungs-

gemeinschaft through Sonderforschungsbereich 454

‘Bodenseelitoral’. We are grateful to BITg, Biotechnol-

ogie Institut Thurgau an der Universit€at Konstanz,

T€agerwilen, Switzerland, for utilisation of the ABI

PRISM� 7700 Sequence Detection System and thank R.

Grimm for excellent work on strain isolation. This isPublication No. 3105 of NIOO-KNAW Netherlands

Institute of Ecology.

References

[1] Stockner, J.G. and Antia, N.J. (1986) Algal picoplankton from

marine and freshwater ecosystems: a multidisciplinary perspective.

Can. J. Aquat. Sci. 43, 2472–2503.

[2] Partensky, F., Blanchot, J. and Vaulot, D. (1999) Differential

distribution and ecology of Prochlorococcus and Synechococcus in

oceanic waters: a review. Bull. Inst. Oceanogr. 19, 457–475.

190 S. Becker et al. / FEMS Microbiology Ecology 49 (2004) 181–190

[3] Pick, F.R. (1991) The abundance and composition of freshwater

picocyanobacteria in relation to light penetration. Limnol. Oce-

anogr. 36, 1457–1462.

[4] Callieri, C., Amicucci, E., Bertoni, R. and V€or€os, L. (1996)

Fluorometric characterization of two picocyanobacteria strains

from lakes of different underwater light quality. Int. Rev. ges.

Hydrobiol. 81, 13–23.

[5] V€or€os, L., Callieri, C., V.-Balogh, K. and Bertoni, R. (1998)

Freshwater picocyanobacteria along a trophic gradient and light

quality range. Hydrobiologia 369/370, 117–125.

[6] Wood, A.M., Phinney, D.A. and Jentsch, C.S. (1998) Water

column transparency and the distribution of spectrally distinct

forms of phycoerythrin-containing organisms. Mar. Ecol. Prog.

Ser. 162, 25–31.

[7] G€ude, H., Rossknecht, H. and Wagner, G. (1998) Anthropogenic

impacts on the trophic state of Lake Constance during the 20th

century. Arch. Hydrobiol. Spec. Issues Advanc. Limnol. 53, 85–

108.

[8] Gaedke, U. and Weisse, T. (1998) Seasonal and interannual

variability of picocyanobacteria in Lake Constance (1987–1997).

Arch. Hydrobiol. Spec. Issues Advanc. Limnol. 53, 143–158.

[9] Weisse, T. (1988) Dynamics of autotrophic picoplankton in

marine and freshwater ecosystems. Adv. Microbiol. Ecosyst. 13,

327–370.

[10] Ferris, M.J., Ruff-Roberts, A.L., Kopczynski, E.D., Bateson,

M.M. and Ward, D.M. (1996) Enrichment culture and microscopy

conceal diverse thermophilic Synechococcus populations in a

single hot spring microbial mat habitat. Appl. Environ. Microbiol.

62, 1045–1050.

[11] Ward, D.M., Ferris, M.J., Nold, S.C. and Bateson, M.M. (1998)

A natural view of microbial biodiversity within hot spring

cyanobacterial mat communities. Microbiol. Mol. Biol. Rev. 62,

1353–1370.

[12] Miller, S.R. and Castenholz, R.W. (2000) Evolution of thermo-

tolerance in hot spring cyanobacteria of the genus Synechococcus.

Appl. Environ. Microbiol. 66, 4222–4229.

[13] Garcia-Pichel, F., N€ubel, U. and Muyzer, G. (1998) The phylog-

eny of unicellular extremely halotolerant cyanobacteria. Arch.

Microbiol. 169, 469–482.

[14] Abed, R.M., Sch€onhuber, W., Amann, R. and Garcia-Pichel, F.

(2002) Picobenthic cyanobacterial populations revealed by 16S

rRNA-targeted in situ hybridization. Environ. Microbiol. 4, 375–

382.

[15] Postius, C. and Ernst, A. (1999) Mechanisms of dominance:

coexistence of picocyanobacterial genotypes in a freshwater

ecosystem. Arch. Microbiol. 172, 69–75.

[16] Mattern, A. (1970) Beobachtungen €uber die Algenflora im

Uferbereich des Bodensees ( €Uberlinger See und Gnadensee).

Arch. Hydrobiol. 37 (Suppl.), 1–163.

[17] Honda, D., Yokota, A. and Sugiyama, J. (1999) Detection of

seven major evolutionary lineages in cyanobacteria based on 16S

rRNA gene sequence analysis with new sequences of five marine

Synechococcus strains. J. Mol. Evol. 48, 723–739.

[18] Robertson, B.R., Tezuka, N. and Watanabe, M.M.

(2001) Phylogenetic analyses of Synechococcus strains

(cyanobacteria) using sequences of 16S rDNA and part of the

phycocyanin operon reveal multiple evolutionary lines and

reflect phycobilin content. Int. J. Syst. Evol. Microbiol. 51, 861–

871.

[19] Crosbie, N.D., Pockl, M. and Weisse, T. (2003) Dispersal and

phylogenetic diversity of nonmarine picocyanobacteria, inferred

from 16S rRNA gene and cpcBA-intergenic spacer sequence

analyses. Appl. Environ. Microbiol. 69, 5716–5721.

[20] Ernst, A., Becker, S., Wollenzien, U.I.A. and Postius, C. (2003)

Ecosystem-dependent adaptive radiations of picocyanobacteria

inferred from 16S rRNA and ITS-1 sequence analysis. Microbi-

ology 149, 217–228.

[21] Fuller, N.J., Marie, D., Partensky, F., Vaulot, D., Post, A.F. and

Scanlan, D.J. (2003) Clade-specific 16S ribosomal DNA oligonu-

cleotides reveal the predominance of a single marine Synechococ-

cus clade throughout a stratified water column in the Red Sea.

Appl. Environ. Microbiol. 69, 2430–2443.

[22] Urbach, E., Scanlan, D.J., Distel, D.L., Waterbury, J.B. and

Chisholm, S.W. (1998) Rapid diversification of marine picoplank-

ton with dissimilar light harvesting structures inferred from

sequences of Prochlorococcus and Synechococcus (cyanobacteria).

J. Mol. Evol. 46, 188–201.

[23] Muyzer, G., de Waal, E.C. and Uitterlinden, A.G. (1993) Profiling

of complex microbial populations by denaturing gradient gel

electrophoresis analysis of polymerase chain reaction-amplified

genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695–

700.

[24] Becker, S., B€oger, P., Oehlmann, R. and Ernst, A. (2000) PCR

bias in ecological analysis: a case study for quantitative Taq

nuclease assays in analyses of microbial communities. Appl.

Environ. Microbiol. 66, 4945–4953.

[25] Becker, S., Fahrbach, M., B€oger, P. and Ernst, A. (2002)

Quantitative tracing, by Taq nuclease assays, of a Synechococcus

ecotype in a highly diversified natural population. Appl. Environ.

Microbiol. 68, 4486–4494.

[26] Stanier, R.Y., Kunisawa, R., Mandel, M. and Cohen-Baziere, G.

(1971) Purification and properties of unicellular blue-green algae

(order Chroococcales). Bacteriol. Rev. 35, 171–205.

[27] Ernst, A. (1991) Cyanobacterial picoplankton from Lake Con-

stance, I. Isolation by fluorescence characteristics. J. Plankton

Res. 13, 13071312.

[28] Ernst, A., Sandmann, G., Postius, C., Brass, S., Kenter, U. and

B€oger, P. (1992) Cyanobacterial picoplankton from Lake Con-

stance. II. Classification of isolates by cell morphology and

pigment composition. Bot. Acta 105, 161–167.

[29] Postius, C., Ernst, A., Kenter, U. and B€oger, P. (1996) Persistence

and genetic diversity among strains of phycoerythrin-rich cyano-

bacteria from the picoplankton of Lake Constance. J. Plankton

Res. 18, 1159–1166.

[30] Higgins, D.G. and Sharp, P.M. (1988) CLUSTAL: a package for

performing multiple sequence alignment on a microcomputer.

Gene 73, 237–244.

[31] Jukes, T.H. and Cantor, C.R. (1969) Evolution in protein

molecules. In: Mammalian Protein Metabolism (Muntu, H.N.,

Ed.), vol. III, pp. 21–132. Academic Press, New York.

[32] Saitou, N. and Nei, M. (1987) The neighbor-joining method: a

new method for reconstructing phylogenetic trees. Mol. Biol.

Evol. 4, 406–425.

[33] Van de Peer, Y. and De Wachter, R. (1994) TREECON: a

software package for the construction and drawing of evolution-

ary trees. Comput. Appl. Biosci. 9, 177–182.

[34] Heid, C.A., Stevens, J., Livak, K.J. and Williams, P.M. (1996)

Real-time quantitative PCR. Genome Res. 6, 986–994.