☆ Conflict of interest statement: Kohei Matsushita and the otheroauthors have no conflicts of interest.⁎ Corresponding author. Tel.: +81 59 232 1111x5645; fax: +81 59
Neuroblastoma (NB) is the most common extracranialsolid tumor of childhood [1] and accounts for approximately15% of all childhood cancer deaths [2]. Approximately halfof all children with a diagnosis of NB present with a high-risk disease. Despite intensive chemotherapy and autologousstem cell transplantation, long-term survival continues to beless than 50% for these patients. Furthermore, children with
high-risk tumors often fail to benefit from intensivetreatment, and development of a novel therapeutic approachis warranted for these patients. Thus, identification of novelbiomarkers is critical to improve prognostication and todevelop tailored therapies and new therapeutic targets.
In tumor cells, energy is typically produced throughglucose oxidation, and glucose metabolism in tumor cellsdiffers significantly from that in normal cells. A significantcharacteristic of tumor cells is that glycolysis increases withmalignancy [3,4]. The glucose transporter isoform 1(GLUT1/solute carrier family 2, member 1) is a key factorfor glucose transport and metabolism in cancer cells. GLUT1expression is typically undetectable in normal epithelialtissues and benign epithelial tumors but is overexpressed in asignificant proportion of human carcinomas [5,6]. Up-regulation of GLUT1 accompanied by increased glucoseuptake has been demonstrated in numerous tumors includingesophageal, gastric, breast, and colon cancers [7-10]. Amongpediatric tumors, GLUT1 has been shown to be expressed injuvenile hemangioblastoma [11]. However, studies ofGLUT1 expression in NB have generated conflicting results,and the biological significance of GLUT1 expression in NBremains unknown [12]. Here, we have investigated GLUT1expression and the relationship between GLUT1 expressionand prognosis in patients with NB.
Several agents are well known to abolish adenosinetriphosphate (ATP) generation by inhibiting the glycolyticpathway. 3-Bromopyruvate acid (3-BrPA) is an inhibitor ofhexokinase, the first step and rate-limiting enzyme in theintracellular glucose metabolism pathway. 3-Bromopyruvateacid has been shown to be effective against a variety of tumortypes in several preclinical cell lines [13,14]. The Ki-67/MKI67 protein is a marker for cell proliferation. Ki-67protein is present during all active phases of the cell cycle(G1, S, G2, and M) but is absent from resting cells (G0),making it an excellent marker for detecting the so-calledgrowth fraction of a cell population [15]. In cancer, manystudies have shown that MKI67 can serve as an importantindex of cell proliferation and as a marker of tumormalignance and invasive ability [16-18]. Previous studieshave shown that overexpression of MKI67 is correlated withunfavorable prognosis in NB [19,20]. Therefore, weinvestigated GLUT1 and MKI67 expression in NB celllines and tested the effects of 3-BrPA on NB cell lines withdifferent patterns of GLUT1 and MKI67 messenger RNA(mRNA) expression.
The value of each target gene is expressed as a median value.
1. Methods
1.1. Patients and samples
Ninety-one patients with NB were referred to ourdepartment for surgical treatment between 1978 and 2010.Patients with NB were managed according to the Japan
Neuroblastoma Study Group protocol. Four surgeons whohad prior experience in our hospital carried out all surgeries.Formalin-fixed, paraffin-embedded specimens wereobtained from 47 patients (Table 1). Samples from theother patients were either used in other experiments orpoorly preserved and could not be used. Of the 47 patients,13 were treated in the 2000s, 22 were treated in the 1990s,10 were treated in the 1980s, and 2 were treated in the1970s. Using International Neuroblastoma Staging System(INSS) classifications, the tumors were classified as stage 1(n = 7), stage 2A (n = 8), stage 2B (n = 7), stage 3 (n = 10),stage 4 (n = 11), or stage 4S (n = 4). The ages of the patientsranged from 1 month to 8 years, with a median age of8 months. The length of follow-up ranged from 4 months to29 years, with a median length of 119 months. The patientswere treated with several courses of standard chemotherapyprotocols in our hospital. Informed consent was obtained forlaboratory analysis according to institutional requirements atthe time of admission.
1.2. Neuroblastoma cell lines and cell culture
The NB cell lines IMR-32, INDEN, KP-N-SI, KP-N-SI(FA), LAN-1, NB69, SJ-N-JF, SJ-N-KP, SJ-N-SD, andSK-N-SH were grown in monolayer cultures in RPMI-1640medium (nacalai tesque, Kyoto, Japan) supplemented withfetal bovine serum (10% vol/vol), glutamine (2 mmol/L),penicillin (10,0000 U/L), streptomycin (100 mg/L), andgentamicin (40 mg/L) at 37°C in a 5% CO2 environment. Forroutine passages, the cultures were split 1:10 when they
1325GLUT1 in neuroblastoma
reached 90% confluence, generally every 3 days. Cells in thefifth to ninth passages were used for all experiments, whichwere carried out in exponentially growing cells.
1.3. RNA extraction
Microdissection of formalin-fixed, paraffin-embeddedwas performed as described previously [21]. The micro-dissected samples were digested with proteinase K in lysisbuffer containing Tris-HCl, ethylenediaminetetraacetic acid,and sodium dodecyl sulfate as previously described [22],with minor modifications. For the cell lines, cells (5 × 103)were seeded in plastic tissue culture flasks (75 cm2) in 15 mLof culture medium. After a 24-hour incubation, the cells werewashed with phosphate-buffered saline and harvested bytrypsinization. Next, total RNA was extracted using anRNeasy Midi Kit (Qiagen Inc, Chatsworth, CA) according tothe manufacturer's instructions. RNA was purified by phenoland chloroform extraction. RNA purity was assessed by the260-nm/280-nm ratio after measuring ultraviolet absor-bances at 260 and 280 nm. Complementary DNA (cDNA)was synthesized using random hexamer primers (Takara BioInc, Kyoto, Japan) and Superscript III reverse transcriptase(Invitrogen, Carlsbad, CA).
Quantitative real-time polymerase chain reaction (PCR)analysis was carried out using SYBR Green PCR MasterMix (Applied Biosystems, Foster City, CA) in an AppliedBiosystems 7500 Real-Time PCR System according to themanufacturer's instructions. Primers for GLUT1, Ki-67,and ACTB (β-actin) were designed with Primer3 software(Biology Workbench version 3.2; San Diego Supercom-puter Center, University of California, San Diego, CA).Sequences were as follows: GLUT1-specific primers(sense, CCTGCAGTTTGGCTACAACA, and antisense,GTGGACCCATGTCTGGTTG); MKI67 (sense, TGAG-CCTGTACGGCTAAAACA, and antisense, TTGAC-TTCCTTCCATTCTGAAG), and ACTB (sense,ACAGAGCCTCGCCTTTGC, and antisense, GCGGCG-ATATCATCATCC). Polymerase chain reaction wasperformed in a final volume of 25 μL, and the reactionscontained Master Mix, 1 μL cDNA, and 400 nmol/L of eachprimer for the gene of interest. Cycle conditions were asfollows: 50°C for 2minutes and 95°C for 10minutes, followedby 35 cycles of 95°C for 15 seconds and 60°C for 1 minute.
1.5. Relative expression of GLUT1 and Ki-67
Relative gene expression levels were determined by thestandard curve method. Standard curves and line equationswere generated using 5-fold serially diluted solutions ofcDNA from qPCR Human Reference Total RNA (Clontech,
Mountain View, CA) for GLUT1 and MKI67. All standardcurves were linear in the analyzed range with an acceptablecorrelation coefficient (R2). Target gene expression levelswere calculated from the standard curve, followed byquantitative normalization of cDNA in each sample usingACTB gene expression as an internal control. Target genemRNA levels are presented as ratios with ACTB mRNAlevels. Real-time PCR assays were done in duplicate for eachsample, and the mean value was used for calculation ofmRNA expression levels.
1.6. Immunohistochemistry for GLUT1 and Ki-67
Formalin-fixed, paraffin-embedded specimens were slicedinto 2- to 3-μm sections. After deparaffinization anddehydration, the specimens were brought to a boil in 10mmol/L sodium citrate buffer for antigen unmasking. Thespecimens were then blocked and incubated with primaryantibody overnight at 4°C. The antibody was detected usingEnvision reagents (Envision Kit/HRP; DakoCytomation,Glostrup, Denmark). GLUT1 antibody (SPM498; Abcam,Tokyo, Japan) and monoclonal mouse antihuman Ki-67antigen (clone MIB-1; DakoCytomation) were used asprimary antibodies at a dilution of 1:100, for implementationof the labeled streptavidin-biotin method (LASB2 kit/HRP;DakoCytomation), and 3,3′-diaminobenzidine (DakoCyto-mation). All sections were counterstained with hematoxylinand were then dehydrated and mounted. Negative controlswere also run simultaneously.
1.7. Growth inhibition assay with 3-BrPA
3-Bromopyruvate acid was obtained from Sigma-Aldrich(St Louis, MO). It was dissolved in phosphate-bufferedsaline (pH 7.4) and stored at −20 °C until use. Cytotoxicitywas evaluated by the WST-8 [2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium,monosodium salt] colorimetric assay. Cancer cells (5 × 103
cells/well) were seeded on 96-well plates in 100 μL ofculture medium for 24 hours before drug exposure. After a24-hour preincubation, the cells were treated with variousconcentrations of 3-BrPA for 12, 24, or 48 hours. After drugexposure, the medium was discarded and replaced with 90μL of fresh medium. Next, 10 μL of WST-8 reagent solution(Cell Counting Kit; Dojindo Laboratories, Tokyo, Japan)was added, and the cells were incubated for 4 hours at 37 °C.Cell viability was determined through colorimetric compar-ison by measuring optical densities at an absorptionwavelength of 450 nm using a microplate reader.
1.8. Statistical analysis
Statistical analyses were performed using Stat View5.0 for Windows (SAS Institute Inc, Cary, NC). Anonparametric receiver operating characteristic analysis
100
80
60
40
20
0
0 50 100 150 200 250 300 350Time (months)
% O
vera
ll su
rviv
al
GLUT1<0.4516 (n = 37)
GLUT1 0.4516 (n = 10)
Log rank test :P < .0001
Fig. 1 Kaplan-Meier survival curves vs GLUT1 gene expression.Patients with elevated GLUT1 expression had significantly pooreroverall survival.
1326 K. Matsushita et al.
was performed to calculate the best cutoff value for eachgene expression level to predict distant recurrence andsurvival, using Medcalc 7.2 for Windows (Mariakerke,Belgium). The Kaplan-Meier method was used to estimateoverall survival rates. Overall survival duration wascalculated as the period from the study entry date to thedate of death. If the patient did not die, the date of lastreported contact was used. P values were calculated usingthe log-rank test. Univariate and multivariate survivalanalyses were performed using GLUT1 expression and theother variables. The Cox proportional hazards model wasapplied to test the significance of the independent influencesof various genetic and clinical variables on patient out-comes. For analysis of in vitro experiments, the data areshown as the means of at least 3 independent experiments.P b .05 was considered statistically significant.
2. Results
2.1. Association between expression ofGLUT1 mRNA and prognosis
Of the 47 patients observed, the mean follow-up timewas 119 months (range, 4.5-337 months). The medianGLUT1/ACTB mRNA expression level was 0.23. To assessthe predictive value of GLUT1 gene expression for
Table 2 Univariate and multivariate analyses for predictors of surviv
Variables Univariate
HR 95% CI
Primary tumor size (≥5 cm vs b5 cm) 4.517 1.054-21.INSS stage (4 vs 1, 2, 3, 4S) 15.15 3.703-62.INPC stage (unfavorable vs favorable) 5.78 1.218-27.GLUT-1 (≥cutoff vs bcutoff) 6.184 1.729-22.
prognosis based on survival, we defined the cutoff valueaccording to the best predictive values as calculated byreceiver operating characteristic analysis (cutoff valueGLUT1/actin, 0.4516). The survival curves for all patientswith NB on the basis of GLUT1 gene expression are shownin Fig. 1. High expression of GLUT1 was associated withpoor prognosis in patients with NB (P = .0014, log-ranktest). On the basis of Cox univariate proportional hazardsanalysis, primary tumor size (≧5 cm; P b .0474), INSSstage (4; P = .0001), International Neuroblastoma PathologyClassification (INPC) stage (unfavorable; P = .0272), andhigh expression of GLUT1 (P = .0051) were significantprognostic factors for overall survival. Multivariate analysisidentified INSS stage (4; P = .0161) and high expression ofGLUT1 (P = .0497) as independent risk factors predicting apoor prognosis (Table 2).
2.2. Immunohistochemical staining of GLUT1and Ki-67 in NB tissue
Immunohistochemical analysis was performed on tissuesfrom several patients with NB. We observed GLUT1expression at the plasma membranes of NB cells. Ki-67, aproliferation marker, was expressed in the nuclei of NB cells.GLUT1 expression was detected in the centers of NB cellnests. In contrast, Ki-67 expression appeared along themargins of NB cell nests (Fig. 2).
2.3. Association between GLUT1 and MKI67expression and sensitivity to 3-BrPA in vitro
GLUT1 expression was measured in 10 NB cell lines.As shown in Fig. 3A, GLUT1 expression was high in KP-N-SI(FA) and INDEN cells and was low in SK-N-SH andSJ-N-JF cells. Next, we investigated whether MKI67expression was correlated with the expression of GLUT1in these 4 cell lines. Fig. 3B shows that MKI67 expressionwas high in KP-N-SI(FA) and SK-N-SH and was low inINDEN and SJ-N-JF. We investigated the sensitivity ofthese 4 cell lines to 3-BrPA. KP-N-SI(FA), INDEN, andSK-N-SH cells showed significantly inhibited growth after12, 24, or 48 hours of exposure to 3-BrPA atconcentrations of 50 or 100 μmol/L. However, SJ-N-JFcells showed no growth inhibition after 12, 24, or 48
Fig. 2 Immunohistochemical analysis of GLUT1 and Ki-67. GLUT1 expression was detected at the center of NB cell nests (A:magnification ×100). GLUT1 expression was observed at the plasma membrane in NB cells (B: magnification ×100). Ki-67 expressionwas localized to the margins of NB cell nests (C: magnification ×100). Ki-67 expression was observed in the nuclei of NB cells (D:magnification ×400).
1327GLUT1 in neuroblastoma
hours of exposure to 50 μmol/L 3-BrPA (Fig. 4A-D).Furthermore, KP-N-SI(FA), INDEN, and SK-N-SHshowed significantly greater growth inhibition than didSJ-N-JF after 24 hours of exposure to 10, 50, or 100μmol/L 3BrPA (Fig. 5).
1.8
1.6
1.4
1.2
1
.8
.6
.4
.2
.0Rel
ativ
e G
LU
T-1
gene
exp
ress
ion
IMR-3
2
INDEN
KP-N-S
I
KP-N-S
I(FA)
LAN-1NB69
SJ-N-JF
SJ-N-K
P
SJ-N-S
D
SKN-SH
A B
Fig. 3 GLUT1 and MKI67 gene expression in 10 NB cell lines. GLUmRNA levels. KP-N-SI(FA), INDEN, SK-N-SH, and SJ-N-JF cells were
3. Discussion
Given the hypoglycemic environment within a tumormass, maintaining a high level of glycolytic activity is afundamental challenge for cancer cells to survive and
Rel
ativ
e M
K16
7 ge
ne e
xpre
ssio
n 35
30
25
20
15
10
5
0
IMR-3
2
INDEN
KP-N-S
I
KP-N-S
I(FA)
LAN-1NB69
SJ-N-JF
SJ-N-K
P
SJ-N-S
D
SKN-SH
T1 (A) and MKI67 (B) mRNA levels are shown relative to ACTBselected for in vitro studies.
Fig. 4 Proliferation assay with 3-BrPA. Growth of KP-N-SI(FA) (A), INDEN (B), and SK-N-SH (C) cells was significantly inhibited after12, 24, or 48 hours of exposure to 3-BrPA at concentrations of 50 or 100 μmol/L (P b .05). Growth of SJ-N-JF cells (D) was not inhibited by12, 24, or 48 hours of exposure to 50 μM 3-BrPA.
1328 K. Matsushita et al.
grow. To maintain a high level of glycolytic activity,overexpression of GLUTs is commonly observed incancer, and high GLUT expression is associated with
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2cont 10 50 100
Concentration of 3Br-PA (µM)
OD
**
*KP-N-SI(FA)
SK-N-SH
SJ-N-JF
INDEN
Fig. 5 Sensitivity to the 24-hour 3Br-PA exposure in NB celllines. Growth of KP-N-SI(FA), INDEN, and SK-N-SH wassignificantly more inhibited than the growth of SJ-N-JF after 24hours of exposure to 3BrPA at concentrations of 10, 50, or 100μmol/l. (⁎vs KP-N-SI-FA, SJ-N-JF, SK-N-SH; P b .0001).
rapid metabolism and cell growth in often-hypoxictumor regions [23]. Although most of the GLUT subtypeshave been detected in various human cancers, GLUT1 is theonly subtype that has been shown to be overexpressed innearly all human carcinomas [24]. Furthermore, GLUT1expression has been detected in many carcinomas atdifferent sites [7-10]. However, little is known aboutGLUT1 expression in NB. Russo et al [12] found thatGLUT1 mRNA was up-regulated in NB cell lines, and Fangand Jia [25] showed that insulin-like growth factor-1treatment increased glucose uptake and GLUT1 expressionin an NB cell line. However, there has been no priorinvestigation of the relationship between NB and GLUT1expression in clinical samples from patients with NB. In thecurrent study, we found that high expression of GLUT1 inNB cells was significantly associated with poor survival andwas an independent risk factor for poor survival. Further-more, immunohistochemical assessment showed thatGLUT1 was expressed in the central portion of NB nests, apotentially hypoglycemic environment. Moreover, the NBcells expressing GLUT1 in nests were not positive for Ki-67.These results suggest that NB cells in the central areas ofnests are more glycolytically active than those along theedges of nests.
1329GLUT1 in neuroblastoma
In normal cells, at least 90% of ATP production resultsfrom mitochondrial oxidative phosphorylation, whereastumor cells are approximately 50% dependent on cytoplas-mic aerobic glycolysis [26,27]. When glycolysis is inhibited,the intact mitochondria in normal cells are able to usealternative energy sources such as fatty acids and aminoacids to produce metabolic intermediates channeled to thetricarboxylic acid cycle for ATP production throughrespiration. Thus, cells with normal mitochondria areexpected to be less sensitive to agents that inhibit glycolysis.However, in most cancer cells, the rate of glucose uptake issignificantly elevated, and oxidative phosphorylation inmitochondria is often decreased compared with normal cells.This metabolic feature has led to the hypothesis thatinhibition of glycolysis may abolish ATP generation incancer cells and, thus, may preferentially kill the malignantcells [28-30]. Indeed, 2-deoxy-D-glucose, a synthetic glucoseanalogue that inhibits glycolysis and glycosylation andblocks cell growth, is currently being investigated in avariety of early-phase clinical trials [31]. In this study, wehypothesized that the increased dependency on glycolysis inNB cells could be exploited for therapeutic benefit and testedthis hypothesis in defined experimental systems using3-BrPA as a pharmacologic tool to inhibit glycolysis. Indeed,we showed that the growth of KP-N-SI(FA) and INDENcells, which have high GLUT1 expression, was inhibited by3-BrPA. Furthermore, the growth of SK-N-SH cells,characterized by low GLUT1 and high MKI67, wassignificantly inhibited by 3-BrPA compared with SJ-N-JFcells, which showed low GLUT-1 and low MKI67. In otherwords, 3-BrPA did not effectively inhibit the growth of cellswith low expression of GLUT1 and MKI67, which ischaracteristic of cells with low malignancy potential.
These results suggest that 3-BrPA is less disruptive tonormal cells, which have low expression of GLUT1 andMKI67. Indeed, Ko et al [32] showed that 3-BrPA inducedloss of cancer cell viability but that normal cells showedresistance to 3-BrPA. Furthermore, in an animal model ofadvanced cancer, 3-BrPA therapy to deplete ATP selectivelydestroyed cancer cells without apparent toxicity or recur-rence. Therefore, the inhibition of glycolysis may represent anew strategy for treatment of patients with NB with fewadverse effects.
In conclusion, our results suggest that elevated GLUT1expression is a predictor of poor prognosis in NB. Inaddition, our study suggests that inhibition of glycolysis is aneffective strategy to inhibit NB with high expression ofGLUT1 and a high rate of proliferation. Thus, glycolysisinhibitors can be considered as a potential therapeutic optionfor aggressive tumors expressing GLUT1.
Acknowledgments
The authors would like to thank Motoko Ueeda and YukaKato for providing excellent technical assistance.
References[1] Esiashvili N, Anderson C, Katzenstein HM. Neuroblastoma. Curr
Probl Cancer 2009;33:333-60.[2] Maris JM, Matthay KK. Molecular biology of neuroblastoma. J Clin
Oncol 1999;17:2264-79.[3] Isselbacher KJ. Sugar and amino acid transport by cells in culture—
differences between normal and malignant cells. N Engl J Med1972;286:929-33.
[4] Pedersen PL. The cancer cell's power plants as promising therapeutictargets: an overview. J Bioenerg Biomembr 2007;39:1-12.
[5] Airley RE, Mobasheri A. Hypoxic regulation of glucose transport,anaerobic metabolism and angiogenesis in cancer: novel pathways andtargets for anticancer therapeutics. Chemotherapy 2007;53:233-56.
[7] Younes M, Ertan A, Lechago LV, et al. Human erythrocyte glucosetransporter (Glut1) is immunohistochemically detected as a late eventduring malignant progression in Barrett's metaplasia. Cancer Epide-miol Biomarkers Prev 1997;6:303-5.
[8] Sakashita M, Aoyama N, Minami R, et al. Glut1 expression in T1 andT2 stage colorectal carcinomas: its relationship to clinicopathologicalfeatures. Eur J Cancer 2001;37:204-9.
[9] Grover-McKay M, Walsh SA, Seftor EA, et al. Role for glucosetransporter 1 protein in human breast cancer. Pathol Oncol Res 1998;4:115-20.
[10] Godoy A, Ulloa V, Rodriguez F, et al. Differential subcellulardistribution of glucose transporters GLUT1-6 and GLUT9 in humancancer: ultrastructural localization of GLUT1 and GLUT5 in breasttumor tissues. J Cell Physiol 2006;207:614-27.
[11] North PE, Mizeracki A, Mihm Jr MC, et al. GLUT1 immunoreactionpatterns reliably distinguish hemangioblastoma from metastatic renalcell carcinoma. Clin Neuropathol 2000;19:131-7.
[12] Russo VC, Kobayashi K, Najdovska S, et al. Neuronal protection fromglucose deprivation via modulation of glucose transport and inhibitionof apoptosis: a role for the insulin-like growth factor system. Brain Res2004;1009:40-53.
[13] Geschwind JF, Georgiades CS, Ko YH, et al. Recently elucidatedenergy catabolism pathways provide opportunities for novel treatmentsin hepatocellular carcinoma. Expert Rev Anticancer Ther 2004;4:449-57.
[14] Ko YH, Pedersen PL, Geschwind JF. Glucose catabolism in the rabbitVX2 tumor model for liver cancer: characterization and targetinghexokinase. Cancer Lett 2001;173:83-91.
[15] Scholzen T, Gerdes J. The Ki-67 protein: from the known and theunknown. J Cell Physiol 2000;182:311-22.
[16] Yerushalmi R, Woods R, Ravdin PM, et al. Ki67 in breast cancer:prognostic and predictive potential. Lancet Oncol 2010;11:174-83.
[17] Lin MX, Wen ZF, Feng ZY, et al. Expression and significance ofBmi-1 and Ki67 in colorectal carcinoma tissues. Ai Zheng 2008;27:1321-6.
[18] Sanada Y, Osada S, Tokuyama Y, et al. Critical role of c-Met and Ki67in progress of biliary carcinoma. Am Surg 2010;76:372-9.
[19] Rudolph P, Lappe T, Hero B, et al. Prognostic significance of theproliferative activity in neuroblastoma. Am J Pathol 1997;150:133-45.
[20] del Carmen Mejia M, Navarro S, Pellin A, et al. Study of proliferationand apoptosis in neuroblastoma. Their relation with other prognosticfactors. Arch Med Res 2002;33:466-72.
[21] Saigusa S, Toiyama Y, Tanaka K, et al. Stromal CXCR4 and CXCL12expression is associated with distant recurrence and poor prognosis inrectal cancer after chemoradiotherapy. Ann Surg Oncol 2010;17:2051-8.
[22] Bijwaard KE, Aguilera NS, Monczak Y, et al. Quantitative real-time reverse transcription-PCR assay for cyclin D1 expression:utility in the diagnosis of mantle cell lymphoma. Clin Chem2001;47:195-201.
1330 K. Matsushita et al.
[23] Clavo AC, Brown RS, Wahl RL. Fluorodeoxyglucose uptake inhuman cancer cell lines is increased by hypoxia. J Nucl Med 1995;36:1625-32.
[24] Younes M, Lechago LV, Somoano JR, et al. Wide expression of thehuman erythrocyte glucose transporter Glut1 in human cancers.Cancer Res 1996;56:1164-7.
[25] Fang BY, Jia JP. Human neuroblastoma cells transfected with twoChinese presenilin 1 mutations are sensitized to trophic factorwithdrawal and protected by insulin-like growth factor-1. Chin MedJ (Engl) 2008;121:910-5.
[27] Matoba S, Kang JG, Patino WD, et al. p53 regulates mitochondrialrespiration. Science 2006;312:1650-3.
[28] Munoz-Pinedo C, Ruiz-Ruiz C, Ruiz de Almodovar C, et al. Inhibitionof glucose metabolism sensitizes tumor cells to death receptor-triggered apoptosis through enhancement of death-inducing signaling
complex formation and apical procaspase-8 processing. J Biol Chem2003;278:12759-68.
[29] Izyumov DS, Avetisyan AV, Pletjushkina OY, et al. Wagesof fear: transient threefold decrease in intracellular ATPlevel imposes apoptosis. Biochim Biophys Acta 2004;1658:141-7.
[30] Xu RH, Pelicano H, Zhou Y, et al. Inhibition of glycolysis in cancercells: a novel strategy to overcome drug resistance associated withmitochondrial respiratory defect and hypoxia. Cancer Res 2005;65:613-21.
[31] Singh D, Banerji AK, Dwarakanath BS, et al. Optimizing cancerradiotherapy with 2-deoxy-D-glucose dose escalation studies inpatients with glioblastoma multiforme. Strahlenther Onkol 2005;181:507-14.
[32] Ko YH, Smith BL, Wang Y, et al. Advanced cancers: eradication in allcases using 3-bromopyruvate therapy to deplete ATP. BiochemBiophys Res Commun 2004;324:269-75.
