Granulysin-Mediated Tumor Rejection in Transgenic Mice1
Lisa P. Huang, Shu-Chen Lyu, Carol Clayberger, and Alan M. Krensky2
Granulysin (GNLY) is a cytolytic molecule expressed by human CTL and NK cells with activity against a variety of tumors andmicrobes, including Mycobacterium tuberculosis. Although the molecular mechanism of GNLY-induced apoptosis of Jurkat T cellsis well defined in vitro, no direct evidence for its in vivo effects has been demonstrated. Because there is no murine homologue ofGNLY, we generated mice expressing GNLY using a bacterial artificial chromosome containing the human GNLY gene and its 5�
and 3� flanking regions. GNLY is expressed in leukocytes from transgenic mice with similar kinetics as in PBMC from humans:GNLY is constitutively expressed in NK cells and, following stimulation through the TCR, appears in T lymphocytes 8–10 daysafter activation. Both forms of GNLY (9 and 15 kDa) are produced by activated T cells, whereas the 15-kDa form predominatesin freshly isolated NK cells from transgenic animals. GNLY mRNA is highest in spleen, with detectable expression in thymus andlungs, and minimal expression in heart, kidney, liver, muscle, intestine, and brain. Allospecific cell lines generated from GNLYtransgenic animals showed enhanced killing of target cells. In vivo effects of GNLY were evaluated using the syngeneic T lym-phoma tumor C6VL. GNLY transgenic mice survived significantly longer than nontransgenic littermates in response to a lethaltumor challenge. These findings demonstrate for the first time an in vivo effect of GNLY and suggest that GNLY may prove auseful therapeutic modality for the treatment of cancer. The Journal of Immunology, 2007, 178: 77–84.
G ranulysin (GNLY)3 is a cytolytic molecule expressed byhuman CTL and NK cells with activity against a varietyof tumors (1–6) and microbes (7–12), including Mycobac-
terium tuberculosis (13). GNLY was first identified as part of a searchfor genes expressed by T lymphocytes late after T cell activation (14,15). It belongs to the saposin-like protein family that includesamoebapores and NK lysin and is characterized by a conserved three-dimensional structure (10, 16). GNLY is expressed in a variety ofdisease settings as diverse as infection (17–25), autoimmunity (17),and transplant rejection (26–28). Recent studies show that GNLYalso has chemoattractant and proinflammatory activities (29).
Both biologic and clinical studies strongly suggest that GNLYmay also function as a tumoricidal agent (6, 10, 30–32). Themechanism of GNLY-induced apoptosis of Jurkat T cells in vitrois well defined and involves a novel pathway of cell killing (2, 10).Two clinical studies suggest that GNLY may be important in pa-tients with cancer. Kishi et al. (6) correlated GNLY expressionwith clinical outcome in cancer patients. Progression of cancer wasassociated with decreased GNLY expression in peripheral NKcells in comparison with controls and tumor-free patients. In con-trast, perforin expression was similar in all three groups. These
findings suggest that impaired GNLY expression correlates withtumor progression. In another recent study, Pages et al. (31) foundGNLY among other markers in infiltrating cells in colorectal can-cer. As compared with tumors with signs of early metastatic in-vasion, tumors with GNLY-expressing infiltrating cells had no ev-idence of invasion and were independently associated withimproved survival (31). These two studies suggest that GNLY maybe a valid prognostic indicator and that it may be used to developan effective tumor therapeutic.
Because no murine homolog for GNLY has been identified, wegenerated GNLY transgenic mice to test its in vivo biological func-tion. We report in this study that GNLY transgenic mice have nor-mal development and fertility and no abnormal phenotype whenhoused in a pathogen-free environment. These mice expressGNLY similarly to that in human T and NK cells in vitro and invivo and in resting and activated states. Transgenic mice exhibit anenhanced in vivo response against the T lymphoma C6VL com-pared with littermates, giving rise to improved tumor rejection andsurvival. This is the first demonstration of an in vivo action ofGNLY and suggests that GNLY, or its derivative peptides (6, 30),may prove useful as a cancer therapeutic.
Materials and MethodsGeneration of transgenic mice
The DNA fragment used for the transgene was human bacterial artificialchromosome (BAC) clone RP11-439L14 (Chori Children’s Hospital Oak-land Research Institute). This BAC clone is constructed in the BAC vectorpBACe3.6 and grows in Luria-Bertani medium supplemented with 20�g/ml chloramphenicol. The BAC is 186 kb, covering four genes (partialsmall nuclear ribonucleoprotein (SnRNP) assembly defective 1 homologue,surfactant pulmonary-associated protein B (SFTPB), GNLY, and basic he-lix-loop-helix transcription factor 6). It was streaked to single coloniesfrom a bacterial Luria-Bertani agar stab culture in host Escherichia coliDH10. Ten single colonies were purified and confirmed by two differentGNLY PCR sets that cover exons 1–4. BAC DNA was purified to micro-injection quality and quantity. Size, concentration, and purity were con-firmed by restriction enzyme digestions and clamped homogeneous electricfield gel electrophoresis. BAC DNA was microinjected into embryonicstem cells and offspring were produced. DNA was isolated from mousetails and analyzed by PCR using two pairs of GNLY (CBA � C57BL/6)F1
Department of Pediatrics, Stanford University School of Medicine, Stanford,CA 94305
Received for publication August 14, 2006. Accepted for publication October20, 2006.
The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This research was supported by National Institutes of Health Grant AI43348 (toA.M.K.). A.M.K. is the Shelagh Galligan Professor of Pediatrics.2 Address correspondence and reprint requests to Dr. Alan M. Krensky, Departmentof Pediatrics, Stanford University School of Medicine, Center for Clinical ScienceResearch 2105, 300 Pasteur Drive, Stanford, CA 94305-5164. E-mail address:[email protected] Abbreviations used in this paper: GNLY, granulysin; BAC, bacterial artificial chro-mosome; Ct, cycle threshold; FloKA, flow-based killing assay; GUS, �-glucoroni-dase; qRT-PCR, quantitative real-time RT-PCR; SnRNP, small nuclear ribonucleo-protein; SFTPB, surfactant pulmonary-associated protein B.
CTTGCAGCCATGCTCCTGGGC)and3�exon2(GCAGGGTGCAGGGGGCAGGAAGTCTGCCTTGAACA), generating a 469-bp product; and pair 2GNLY 5� exon 3 (GGTCTTCTCTCGTCTGAGCCCTGAGTACTACGACC) and GNLY 3� exon 4 (CTGTAGTCACGGCCCAGCTCCTGTGTTTTGGTCAA), generating a 668-bp product. The following condi-tions were used in a GeneAmp PCR system 9700 Thermocycler (AppliedBiosystems): denaturing at 94°C for 1 min, followed by 40 cycles of 30 sat 94°C, 30 s at 65°C, and 1 min at 72°C; final extension at 72°C for 10min. For each PCR, primers targeting the endogenous gene Nemo-likekinase 245-bp product were included simultaneously: Nemo-like kinase5-exon 2 (CAGTAACAGATCCAAGAGATGGAAAGAGAGTAGC) and3-control-RC (GGCATAAACTATAGCTGAATTATTCCATGCCCCC).Five mice expressing the transgene were backcrossed for more than eightgenerations with wild-type C57BL/6 mice or six generations with CBA/Jmice, producing independent lines of GNLY heterozygous offspring onpure C57BL/6 or CBA/J backgrounds.
Mice and cell lines
CBA/J (H-2k) mice were purchased from The Jackson Laboratory, andC57BL/6 (H-2b) mice were purchased from Charles River Laboratories.All mice were housed at the Laboratory Animal Facility at Stanford Uni-versity Medical Center. Studies reported in this work were performed usingprotocols approved by the institutional review board. C6VL is an MHCclass I�, MHC class II� T cell lymphoma cell line of C57BL/6 mouseorigin (33). The RMA-S cell line, derived from a C57BL/6 mouse, is a Tlymphoma devoid of internally derived antigenic peptides and that ex-presses low levels of MHC class I (34). EL4.F15, a mouse thymoma (H-2b)defective in Fas signaling, was a gift from M. Simon (Max-Planck-Institutfor Immunbiology, Freiburg, Germany) (35). YAC-1, a mouse lymphomaestablished by inoculation of the Moloney leukemia virus into a newbornA/Sn mouse, is a target for NK cells (36).
NK cell purification and activation of splenocytes
Murine NK cells were isolated from GNLY�/� splenocytes by negativeselection using NK cell MACS isolation kits (Miltenyi Biotec); �98%stained with the NK cell-specific Ab DX5 (BD Biosciences) by FACSanalysis. Human NK cells were purified from PBMC by negative selectionusing NK cell MACS isolation kits (Miltenyi Biotec), and purity was con-firmed by FACS analysis using the human NK-specific Ab CD56 (BDBiosciences; clone B159). Splenocytes were cultured in 24-well plates pre-coated with 0.2 �g/ml anti-CD3 (BD Biosciences; clone 145-2c11) at 106
cells/ml in Medium I (RPMI 1640 supplemented with 10% heat-inactivedFCS (HyClone), 2 mM L-glutamine, 100 U/ml penicillin-streptomycin, 0.05mM 2-ME) plus 0.2 �g/ml anti-CD28 Ab (BD Biosciences; clone 37.51). Atotal of 50 U/ml IL-2 (TECIN) was added to the culture daily starting on day 5.
Intracellular GNLY staining and flow cytometric analysis
One million cells were first blocked with unlabeled Abs against CD16(FcRIII) and CD32 (FcRII) (Caltag Laboratories) and then labeled withfluorochrome-conjugated Abs specific for CD4 (clone H129.19), CD8(clone 53-6.7), or NK (clone DX5) (all from BD Pharmingen). After fix-ation and permeabilization (Cytofix/Cytoperm; BD Pharmingen), sampleswere stained with rabbit anti-GNLY antiserum (1) diluted 1/10,000 instaining buffer, followed by FITC-conjugated goat anti-rabbit secondaryAb diluted 1/2,000, or with PE-granzyme B Ab (Caltag Laboratories). Flu-orescence was analyzed using a FACSCalibur four-color flow cytometrysystem (BD Biosciences). All FACS results are representative of three ormore independent experiments.
Quantitative real-time RT-PCR (qRT-PCR)
Total RNA was isolated from cells (stabilized in RNAlater solution whennecessary; Ambion) using the RNeasy Mini Kit (Qiagen). One-half micro-gram of total RNA from each sample was reverse transcribed into cDNAusing Superscript III (Invitrogen Life Technologies). The qRT-PCR wasperformed using A 7900HT Fast Real-Time PCR System (Applied Bio-systems) using validated primer sets. GNLY and �-glucoronidase (GUS)primers were designed using software Primer Express (Applied Biosys-tems) and are as follows: GNLY, forward, 5�-GATAAGCCCACCCAGAGAAGTG-3�, and reverse, 5�-CGTGACCTCCCCGTCCTA-3�;mouse GUS, forward, 5�-GATTCAGATATCCGAGGGAAAGG-3�, andreverse, 5�-CCAACGGAGCAGGTTGAAAT-3�; human GUS, forward,5�-CGCACAAGAGTGGTGCTGAG-3�, and reverse, 5�-CACGATGGCATAGGAATGGG-3�. All other primers were purchased (Applied Bio-systems). Thermal cycler parameters were as follows: 2 min at 50°C;heated to 95°C for 10 min; 40 amplification cycles at 95°C for 15 s (de-naturing), 60°C for 1 min (annealing and extension). The amount of prod-
uct in a particular sample was determined by interpolation from a standardcurve of cycle threshold (Ct) values generated from dilution series withknown amounts of gene product. Each gene is expressed as a relative ratioof gene to the housekeeping gene GUS. The expression level of a gene wasalso represented as fold increase (2���Ct), where ��Ct � [�Ct(stimulated)] �[�Ct(unstimulated)], and �Ct � [Ct(sample)] � [Ct(GUS)]. All PCR assays were
FIGURE 1. GNLY expression in transgenic mice. A, Schematic repre-sentation of the human GNLY gene and its position in BAC RP11-439L14.E � Exon. B, Fluorescent in situ hybridization for transgenic line A (upperpanel) and transgenic line B (lower panel). There is a single transgeneintegration site for each line, at chromosome 14E2 in line A and at chro-mosome 18E for line B. C, qRT-PCR analysis of tissue distribution ofGNLY mRNA in GNLY�/� mice. Each value represents the average �SEM of three mice.
78 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE
performed in triplicate. Results are representative of two or more independentexperiments.
Flow-based killing assay (FloKA)
For allospecific CTL, spleens were harvested from CBA/J mice that hadbeen primed 4 wk prior by i.p. injection with 107 irradiated (10,000 rad)EL4.F15 cells. Splenocytes were cultured in Medium I in 24-well plates at2 � 106 cells/well. Irradiated (10,000 rad) EL4.F15 (2 � 105/well) wereadded on day 0 and every week thereafter. Cultures were supplementedwith 50 U/ml rIL-2 beginning on day 7. Immediately before FloKA, cellswere purified over Ficoll, washed twice, and resuspended in Medium I and50 U/ml IL-2.
For NK cells, splenocytes were cultured in 24-well plates in Medium Iplus 50 ng/ml IL-15 (R&D Systems) for 8 days. NK cells were isolated bynegative selection using NK cell MACS isolation kits (Miltenyi Biotec).Purity was �98% purity, as determined by staining with the DX5 Ab andFACS analysis immediately before FloKA.
For FloKA, target cells (El4.F15, RMA-S, or YAC-1) were washedthree times with PBS and labeled with 1 �M CFSE (Molecular Probes) for15 min at 37°C. The reaction was stopped by addition of RPMI 1640supplemented with 10% FCS. Cells were washed twice with PBS supple-mented with 2% FCS, resuspended in Medium I plus 50 U/ml IL-2 (forCTL) or 50 ng/ml IL-15 (for NK cells). Effector cells were mixed with 105
labeled target cells in 50 �l of medium into 96-well plates. A total of 1�g/ml 7-aminoactinomycin D (Calbiochem) was added to each well im-mediately before FACS analysis.
Tumor challenge
C6VL and RMA-S tumor cell lines used for challenge were expanded invitro in Medium I and injected within 1 wk of culture. Tumor cells werewashed three times and diluted in PBS. Eight- to 10-wk-old mice(C57BL/6 background) were injected i.p. with 5,000 C6VL cells or 70,000RMA-S cells in 500 �l of PBS. Survival of mice was monitored daily forat least 60 days after tumor injection. For the RMA-S tumor, mice were
FIGURE 2. GNLY expression in acti-vated human PBMC and mouse spleno-cytes. A, Kinetics of GNLY expression inactivated human PBMC (initial concentra-tion of PBMC is 1–2 � 106/ml), measuredby qRT-PCR. B–D, Kinetics of GNLY, per-forin, and granzyme B expression in acti-vated splenocytes from GNLY�/� mice.E, Western blot of GNLY, perforin, andgranzyme B in activated splenocytes fromGNLY�/� mice. Jab-1 protein was used as aloading control. F, Flow cytometry analysisof GNLY and granzyme B colocalization inactivated GNLY�/� CD8� T cells on day12 after activation of splenocytes. Bars inA–D represent the average � SD of three ormore experiments using cells from differentdonors.
79The Journal of Immunology
weighed daily and sacrificed when their body weight increased by 25%.Survival statistical analysis was performed using the LogRank method inGraphPad Prism software.
Immunofluorescence cell staining and microscopy
Cells were immobilized on poly(L-lysine)-coated slides, and exocytosiswas conducted, as previously described (1).
ResultsGNLY transgenic mice
Transgenic mice were generated to investigate the in vivo functionof GNLY. Initial attempts used cDNA encoding the 9- or 15-kDaforms of GNLY driven by either the mouse TCR promoter (a giftfrom M. Davis, Stanford University, Stanford, CA) or the gran-zyme B promoter (a gift from T. Ley, Washington University, St.Louis, MO). Although in both cases the cDNA was incorporatedinto the mouse DNA, neither mRNA nor protein could be detected,suggesting that tissue-specific promoter elements were lacking inthese constructs or that certain intron(s) or more distant gene re-gions were required for the expression of this molecule. Therefore,we obtained a human BAC (RP11-439L14) that contains the com-plete GNLY gene and 3� and 5� flanking regions (Fig. 1A). EightGNLY transgenic (GNLY�/�) mice were derived. Seven of eightmice gave germline transmission, and four of these seven linesexpress GNLY protein. Lines A and B express GNLY at the high-est levels and appear indistinguishable in degree of transgene ex-pression and phenotype. They are both from parental strainB6CBAF1/J (strain details: F1 hybrid from C57BL/6J female �CBA/J male). Both lines were used in the experiments reportedwith similar results. The two selected lines were used separately inindividual experiments, and results obtained were identical.GNLY�/� mice display normal development, fertility, and no ab-normal phenotype when housed in a specifically pathogen-free en-vironment. Fluorescent in situ hybridization indicates a singletransgene integration site for each line, at chromosome 14E2 inline A (Fig. 1B, upper panel) and at chromosome 18E in line B(Fig. 1B, lower panel).
mRNA tissue distribution of the GNLY transgene was assessedby qRT-PCR (Fig. 1C). The highest expression was observed inspleen, with detectable expression in the thymus and lung, andminimal expression in heart, kidney, liver, muscle, intestine, andbrain. These findings demonstrate that GNLY is largely expressedin immune organs. No GNLY mRNA was detected in any of theseorgans in nontransgenic littermates using the same qRT-PCRprobe (data not shown).
GNLY expression in activated splenocytes
GNLY is expressed late after activation of human PBMC (Fig. 2A)(1). To characterize GNLY protein expression in GNLY�/� ani-mals, splenocytes were activated with anti-CD3 and anti-CD28Abs, and aliquots were removed on days 0–12 for assessment ofGNLY mRNA (by qRT-PCR) and protein (by Western blot) ex-pression (Fig. 2, B–D). On day 8, 86% of cells were CD8�, andthis increased to 95% CD8� at day 12. In GNLY�/� cultures,GNLY mRNA was expressed with nearly identical kinetics to thatin activated human PBMC (Fig. 2, A and B), and expression wassignificantly delayed compared with that of perforin and granzymeB. Similar to activated human PBMC, two forms of GNLY, 9 and15 kDa, are detected (Fig. 2E) (1). Granzyme B expression isdetected early (by 2 days after activation), and expression in-creases dramatically at days 10–14. Glycosylation of granzyme Bresults in a number of larger species detected from days 10 to 14after activation (37). Using intracellular staining and FACS anal-ysis of anti-CD3/anti-CD28-activated splenocytes on day 12 ofculture, 22% of the cells express GNLY and essentially all of thesecoexpress granzyme B (Fig. 2F).
GNLY expression in NK cells
Because NK cells express perforin and granzymes (38), we rea-soned that the low level of GNLY expression in freshly isolatedsplenocytes (Fig. 1C) might be attributed to NK cells. To investi-gate this, NK and non-NK cells were isolated from GNLY�/�
splenocytes and from human PBMC (Fig. 3, A and B). For bothhuman and mouse cells, essentially all of the mRNA encodingGNLY, granzyme B, and perforin was found in the NK population,and the fold increase of each of these genes in NK cells relative tosplenocytes or PBMC was similar for mouse and human NK cells,respectively. Lysates from these cells were analyzed by Westernblot for GNLY protein (Fig. 3, C and D). Densitometry of theWestern blots revealed that in human NK cells, expression of the9- and 15-kDa forms is similar: 15 kDa/JAB-1 � 0.8; 9 kDa/JAB-1 � 0.46. In contrast, in NK cells isolated from GNLY�/� spleens,only the 15-kDa form is detectable and, by densitometry, theamount is less than in human NK cells (15 kDa/Jab-1 � 0.26).GNLY was not detected in non-NK cells from either humanPBMC or spleens from GNLY�/� mice.
In contrast to the later expression of GNLY in GNLY�/� spleno-cytes activated by anti-CD3 and anti-CD28 Abs, IL-15 inducesexpression of both forms of GNLY within 4 days (Fig. 4A). After8 days of culture with IL-15, approximately half of the cells are
FIGURE 3. GNLY expression in freshly iso-lated, unstimulated NK cells. A and B, Fold in-crease in GNLY, granzyme B, and perforinmRNA. Expression in unseparated murinesplenocytes (A) or human PBMC (B) was com-pared with expression in purified NK andnon-NK cells. C and D, Western blot of GNLYin the same GNLY�/� (C) and human (D) cellsas in A and B. Jab-1 protein was used as a load-ing control. Each figure is a representative ex-ample of at least two independent experimentswith similar results. Each value represents theaverage � SD of three or more repeated exper-iments. Jab-1 designates mouse protein, andJAB-1 designates human protein.
80 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE
CD8�, half are NK cells, and a small minority are CD4� (Fig. 4B).One-third of NK cells, but only 5% of CD8� cells, express GNLY(Fig. 4B). GNLY and perforin levels decreased by day 12 becausesome cells were undergoing apoptosis. Thus, NK cell expressionof GNLY is both constitutive and inducible, but T cells expressGNLY only after activation through the TCR.
GNLY is exocytosed upon stimulation of the TCR
We previously showed that stimulation of activated human CD8�
cells with anti-CD3 Ab results in granule exocytosis, releasingintracellular GNLY stores into the extracellular environment (1).Similar exocytosis of GNLY is observed after anti-CD3 mAbtreatment of activated cells from GNLY�/� animals (Fig. 4D, up-per and lower left panels). In contrast, NK cells do not release
GNLY after stimulation with anti-CD3 Ab (Fig. 4D, upper andlower right panels). FACS analysis of these cells revealed thatonly NKT cells (among NK cells) released GNLY in response toanti-CD3 (data not shown).
Effects of GNLY expression on in vitro cytotoxicity
To assess the role of GNLY in cytotoxicity in vitro, we adapted theFloKA described by Ley and coworkers (39). Four weeks afterimmunization with allogeneic cells, splenocytes from GNLY�/�
animals and from nontransgenic littermates were cultured with ir-radiated EL4.F15 cells. On day 14 of culture, these cells wereassayed for cytotoxicity against CFSE-labeled EL4.F15 target cells
FIGURE 4. GNLY expression in IL-15-stimulated cells. A, Splenocytesfrom GNLY�/� mice were cultured with IL-15, and expression of GNLY,granzyme B, and perforin was determined by Western blot. �-Actinin pro-tein was used as a loading control. B and C, Expression of GNLY in CD4,CD8, and NK cells after 8 days of culture of GNLY�/� and GNLY�/�
splenocytes with IL-15. D, GNLY is exocytosed upon the simulation ofTCR. Splenocytes from GNLY�/� mice were activated with anti-CD3 andanti-CD28 (left panels) or IL-15 (right panels) for 10–12 days and thenadded to plates precoated with IgG1 (top panels) or anti-CD3 Ab (lowerpanels). Four hours later, cells were stained with anti-GNLY antiserum(green) and propidium iodide (red). Cultures enriched for CD8� T cells(left panels), but not NK cells (right panels) exocytose GNLY when trig-gered with anti-CD3 Ab.
FIGURE 5. GNLY expression in CD8�-allospecific cells increases ap-optosis. A, Allogeneic CTL from GNLY�/� and nontransgenic littermatesinduce apoptosis in EL4.F15 target cells, as measured by FloKA (E:T �5:1). The R1 gate includes target cells in late stages of apoptotic cell deathwith shrinking cell size. The R2 gate includes the early apoptotic targetcells. Target: CFSE-labeled target cells only. 7-AAD, 7-aminoactinomycinD; FSC, forward light scatter. B, Graphic representation of FloKA resultsat different E:T ratios over time (R1 gate only). p � 0.04 (1 h); p � 0.04(2 h); p � 0.08 (3 h); p � 0.12 (4 h). Results are representative of threesimilar experiments.
81The Journal of Immunology
for incorporation of 7-aminoactinomycin D, which measures apo-ptosis/late cell death (Fig. 5). EL4.F15 cells are unable to signalthrough Fas, so lysis is mediated mainly by the granule exocytosispathway (35, 39). At early time points (1 and 2 h), GNLY�/�
effector cells show significantly enhanced killing of the targetsover a wide range of E:T ratios. However, by 3–4 h, the differencebetween the cells expressing GNLY and the nontransgenic litter-mates controls is much less, especially at higher E:T ratios. Thus,GNLY plays a role in CTL-mediated lysis.
Similar experiments were conducted to assess the role of GNLYin NK cell-mediated cytotoxicity. Splenocytes from GNLY�/� andnontransgenic littermates were cultured for 8 days with IL-15, atwhich time NK cells were isolated using magnetic beads. Therewas no difference in cytotoxicity using YAC-1 (Fig. 6) or RMA-Scells (data not shown) as targets in the FloKA assay.
GNLY and tumors in vivo
The effects of GNLY expression on tumor rejection in vivo wereevaluated in two lymphoma models. CD8� T cells are necessaryand sufficient for protection against the C6VL T cell lymphoma(40), whereas NK cells are central to rejection of the MHC-defi-cient RMA-S tumor (34). GNLY�/� mice showed significant pro-tection against the C6VL tumor compared with nontransgenic lit-termates ( p � 0.03) (Fig. 7A). Both GNLY�/� and nontransgeniclittermates began to die by day 24 after injection, but the rate ofdeath was slower in the GNLY�/� group, with 20% of the animalssurviving �80 days. However, nontransgenic littermates died rap-idly, with 100% mortality by 40 days. In contrast, GNLY�/� andnontransgenic littermates injected with the RMA-S tumor showedsimilar survival, suggesting that GNLY plays little or no role inrejection of this tumor (Fig. 6).
DiscussionTo date, the in vivo function of GNLY has been inferred from invitro assays (5, 9, 13, 30, 41–48) and clinical correlates (6, 17, 26,
28, 49–51). rGNLY is cytotoxic against a variety of microbes (13,42, 52) and tumor cells (5, 52); GNLY is coexpressed with per-forin and granzymes in cytotoxic granules in CTL and NK cells(13, 53); and increased GNLY expression is associated with im-proved prognosis in cancer patients (6, 31, 32). This study is thefirst direct demonstration that GNLY functions in vivo to enhancetumor-specific immunity.
GNLY homologues have been identified for pig (NK-lysin)(54), cow (Bo-lysin) (55), and horse (56), but not for rodents (10).Although gene disruption in mice has proven highly informative indefining the function of perforin (57) and granzymes (58), suchexperiments are not possible for GNLY. Therefore, we engineereda transgenic mouse to assess the in vivo effects of GNLY. Initialefforts used a TCR promoter and the human granzyme B promoter,both of which have been used previously to produce transgenicanimals expressing proteins of interest (59, 60). However, nomRNA or protein was detected in mice using these promoters foreither the 9- or 15-kDa forms of GNLY, suggesting that flankingand/or intronic sequences are required for expression.
GNLY is constitutively expressed in NK cells isolated from hu-man PBMC or from GNLY�/� spleens. Although the relativeamounts of GNLY mRNA in human and GNLY�/� NK cells aresimilar, there is substantially more GNLY protein in human thanGNLY�/� NK cells, suggesting that GNLY protein expression iscontrolled in part at the level of translation. Moreover, only the15-kDa form of GNLY is detectable in GNLY�/� mouse NK cells,whereas both the 9- and 15-kDa forms are present in nearly equalamounts in human NK cells. Nevertheless, NK cells fromGNLY�/� mice are capable of expressing high levels of both formsof GNLY when activated by IL-15 (Fig. 4A). This suggests thatmice maintained in a relatively clean facility are not exposed toenvironmental Ags that induce NK cell activation, altering the pat-tern of expression of GNLY.
FIGURE 6. GNLY expression in activated NK cells does not increaseapoptosis. Purified NK cells from GNLY�/� and GNLY�/� splenocytesincubated with IL-15 for 8 days lyse YAC-1 target cells at various E:Tratios (2-h incubation), as measured by FloKA. 7-AAD, 7-aminoactino-mycin D; FSC, forward light scatter.
FIGURE 7. GNLY protects mice from C6VL tumor, but not RMA-Stumor challenge. A, Nontransgenic littermates (n � 12) and GNLY�/� (n �11) mice were challenged with i.p. injection of 5,000 C6VL tumor cells(median survival: nontransgenic littermates � 27.7 days, GNLY�/� � 32days, p � 0.03). B, Nontransgenic littermates (n � 9) and GNLY�/� (n �8) mice were challenged with i.p. injection of 70,000 RMA-S tumor cells.The mean survival: nontransgenic littermates � 29.5 days, GNLY�/� �31.2 days, p � 0.4. Each figure is a representative example of at least threeindependent experiments with similar results.
82 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE
For humans and GNLY�/� mice, GNLY is constitutively ex-pressed by NK cells and inducible in T cells. We observed thatsplenocytes from GNLY�/� mice activated with anti-CD3/CD28show enhanced lysis of targets at early times and at low E:T ratioswhen assayed by FloKA. Additionally, GNLY�/� mice survivedlonger than wild-type mice after challenge with the C6VL tumor.In contrast, splenocytes from GNLY�/� mice activated with IL-15did not show enhanced lysis of RMA-S tumor cells, and there wasno difference in survival of GNLY�/� mice challenged with thistumor in vivo. Thus, transgenic human GNLY plays a role in elim-ination of tumors by CD8� T cells, but not by NK cells. This isespecially interesting in light of previous in vitro data indicatingthat, although both human CD8� T cells and NK cells expressGNLY and kill Cryptococcus neoformans, only the CD8� T cells,and not the NK cells, use GNLY to kill this fungus (11).
The BAC clone contains one partial gene (SnRNP assemblydefective 1 homologue) and three complete genes SFTPB, GNLY,and basic helix-loop-helix transcription factor 6 (also known asHATH6 or ATOH8). The SnRNP assembly defective 1 homologuegene is truncated at the 5� terminus, and therefore is not expressedin the transgenic mice. Using RT-PCR, we detected human SFTPBmRNA expression in the transgenic mice at a level similar to thatof murine SFTPB. The main function of SFTPB is to lower thesurface tension at the air-liquid interface in the alveoli of lung,suggesting that expression of human SFTPB in mice would notaffect any of the parameters measured in our studies. In humans,expression of ATOH8 is restricted to infants 3 years of age (Na-tional Center for Biotechnology Information UniGene Hs.135569).Because all of our studies were conducted in adult mice, we do notexpect expression of this gene to affect any of the parametersinvestigated.
The FloKA is more sensitive than the 51Cr release assay andallows analysis of early steps in apoptosis (39, 61). EL4.F15 tar-gets are defective in signaling through Fas, and thus, lysis is me-diated chiefly by the granule exocytosis pathway (35). Allospecificcultures from GNLY�/� mice showed significantly enhancedcytolysis at early time points and low E:T ratios compared withnontransgenic littermates. In contrast, purified NK cells fromGNLY�/� and nontransgenic littermates show equivalent lysis ofYAC-1 or RMA-S targets in the FloKA. These studies indicate thatGNLY can play a role in allospecific cytotoxicity in vitro. Therelatively minor effect of GNLY is most likely due to high expres-sion of other cytolytic molecules such as perforin and granzymes.These molecules most likely overwhelm the measurements athigher E:T ratios and longer times in culture.
The identification and characterization of GNLY as an antimi-crobial and tumoricidal product of T lymphocytes and NK cellssuggest a broader, and perhaps more important, role for these celltypes in the ongoing war against microbes and provide an addi-tional effector mechanism against tumors (3, 26, 43, 45, 62).Phagocytes, not lymphocytes, have generally been implicated asthe important lines of defense against bacteria (21). The roles ofCTL and NK cells have been more narrowly confined to tumor andantiviral immunity and certain specific bacterial and parasitic in-fections (46, 63). GNLY has broad-based clinical relevance as adiagnostic (biomarker) and potential therapeutic in entities as di-verse as transplant rejection, cancer, and infectious diseases (6,17–25, 30–32). GNLY may also be involved in the normal phys-iologic response that kills dysregulated cells (64). Two clinicalstudies suggest that GNLY may be important in fighting cancer inpatients. As noted above, Kishi et al. (6) correlated GNLY expres-sion with clinical outcome in cancer patients. More recently, colo-rectal cancer patients have prolonged survival associated with in-creased level of GNLY mRNA in effector T cells in tumors
without early invasion (31). Sekiya et al. (30) used a murine lungcancer model to show that gene transfer of 9-kDa GNLY is ther-apeutic in vivo. In this study, we now show that GNLY expressedas a transgene in mice improves outcome for experimental lym-phoma compared with wild-type controls. These studies suggestthat GNLY or its derivatives may prove useful as new therapeuticswith novel mechanisms of action and low toxicity.
DisclosuresThe authors have no financial conflict of interest.
References1. Pena, S. V., D. A. Hanson, B. A. Carr, T. J. Goralski, and A. M. Krensky. 1997.
Processing, subcellular localization, and function of 519 (granulysin), a humanlate T cell activation molecule with homology to small, lytic, granule proteins.J. Immunol. 158: 2680–2688.
2. Okada, S., Q. Li, J. C. Whitin, C. Clayberger, and A. M. Krensky. 2003. Intra-cellular mediators of granulysin-induced cell death. J. Immunol. 171: 2556–2562.
3. Pardo, J., P. Perez-Galan, S. Gamen, I. Marzo, I. Monleon, A. A. Kaspar,S. A. Susin, G. Kroemer, A. M. Krensky, J. Naval, and A. Anel. 2001. A role ofthe mitochondrial apoptosis-inducing factor in granulysin-induced apoptosis.J. Immunol. 167: 1222–1229.
4. Kaspar, A. A., S. Okada, J. Kumar, F. R. Poulain, K. A. Drouvalakis, A. Kelekar,D. A. Hanson, R. M. Kluck, Y. Hitoshi, D. E. Johnson, et al. 2001. A distinctpathway of cell-mediated apoptosis initiated by granulysin. J. Immunol. 167:350–356.
5. Gamen, S., D. A. Hanson, A. Kaspar, J. Naval, A. M. Krensky, and A. Anel.1998. Granulysin-induced apoptosis. I. Involvement of at least two distinct path-ways. J. Immunol. 161: 1758–1764.
6. Kishi, A., Y. Takamori, K. Ogawa, S. Takano, S. Tomita, M. Tanigawa,M. Niman, T. Kishida, and S. Fujita. 2002. Differential expression of granulysinand perforin by NK cells in cancer patients and correlation of impaired granulysinexpression with progression of cancer. Cancer Immunol. Immunother. 50:604–614.
7. Krensky, A. M. 2000. Granulysin: a novel antimicrobial peptide of cytolytic Tlymphocytes and natural killer cells. Biochem. Pharmacol. 59: 317–320.
8. Wang, Z., E. Choice, A. Kaspar, D. Hanson, S. Okada, S. C. Lyu, A. M. Krensky,and C. Clayberger. 2000. Bactericidal and tumoricidal activities of synthetic pep-tides derived from granulysin. J. Immunol. 165: 1486–1490.
9. Kumar, J., S. Okada, C. Clayberger, and A. M. Krensky. 2001. Granulysin: anovel antimicrobial. Expert Opin. Investig. Drugs 10: 321–329.
10. Clayberger, C., and A. M. Krensky. 2003. Granulysin. Curr. Opin. Immunol. 15:560–564.
11. Ma, L. L., C. L. Wang, G. G. Neely, S. Epelman, A. M. Krensky, and C. H.Mody. 2004. NK cells use perforin rather than granulysin for anticryptococcalactivity. J. Immunol. 173: 3357–3365.
12. Ramamoorthy, A., S. Thennarasu, A. Tan, D. K. Lee, C. Clayberger, andA. M. Krensky. 2006. Cell selectivity correlates with membrane-specific inter-actions: a case study on the antimicrobial peptide G15 derived from granulysin.Biochim. Biophys. Acta 1758: 154–163.
13. Stenger, S., D. A. Hanson, R. Teitelbaum, P. Dewan, K. R. Niazi, C. J. Froelich,T. Ganz, S. Thoma-Uszynski, A. Melian, C. Bogdan, et al. 1998. An antimicro-bial activity of cytolytic T cells mediated by granulysin. Science 282: 121–125.
14. Donlon, T. A., A. M. Krensky, and C. Clayberger. 1990. Localization of thehuman T lymphocyte activation gene 519 (D2S69E) to chromosome 2p12—q11.Cytogenet. Cell Genet. 53: 230–231.
15. Manning, W. C., S. O’Farrell, T. J. Goralski, and A. M. Krensky. 1992. Genomicstructure and alternative splicing of 519, a gene expressed late after T cell acti-vation. J. Immunol. 148: 4036–4042.
16. Anderson, D. H., M. R. Sawaya, D. Cascio, W. Ernst, R. Modlin, A. Krensky, andD. Eisenberg. 2003. Granulysin crystal structure and a structure-derived lyticmechanism. J. Mol. Biol. 325: 355–365.
17. Raychaudhuri, S. P., W. Y. Jiang, S. K. Raychaudhuri, and A. M. Krensky. 2004.Lesional T cells and dermal dendrocytes in psoriasis plaque express increasedlevels of granulysin. J. Am. Acad. Dermatol. 51: 1006–1008.
18. Toossi, Z., H. Mayanja-Kizza, A. Kanost, K. Edmonds, M. McHugh, andC. Hirsch. 2004. Protective responses in tuberculosis: induction of genes forinterferon-� and cytotoxicity by Mycobacterium tuberculosis and during humantuberculosis. Scand. J. Immunol. 60: 299–306.
19. Oono, T., S. Morizane, O. Yamasaki, Y. Shirafuji, W. K. Huh, H. Akiyama, andK. Iwatsuki. 2004. Involvement of granulysin-producing T cells in the develop-ment of superficial microbial folliculitis. Br. J. Dermatol. 150: 904–909.
20. Gansert, J. L., V. Kiessler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky,S. A. Porcelli, R. L. Modlin, and S. Stenger. 2003. Human NKT cells expressgranulysin and exhibit antimycobacterial activity. J. Immunol. 170: 3154–3161.
21. Dieli, F., G. Sireci, N. Caccamo, C. Di Sano, L. Titone, A. Romano, P. Di Carlo,A. Barera, A. Accardo-Palumbo, A. M. Krensky, and A. Salerno. 2002. Selectivedepression of interferon-� and granulysin production with increase of prolifera-tive response by V�9/V�2 T cells in children with tuberculosis. J. Infect. Dis.186: 1835–1839.
22. Modlin, R. L. 2002. Learning from leprosy: insights into contemporary immu-nology from an ancient disease. Skin Pharmacol. Appl. Skin Physiol. 15: 1–6.
23. Morizane, S., D. Suzuki, K. Tsuji, T. Oono, and K. Iwatsuki. 2005. The role ofCD4 and CD8 cytotoxic T lymphocytes in the formation of viral vesicles.Br. J. Dermatol. 153: 981–986.
24. Takemoto, M., R. Kira, K. Kusuhara, H. Torisu, Y. Sakai, and T. Hara. 2005.Gene expression profiles in peripheral blood mononuclear cells from patientswith subacute sclerosing panencephalitis using oligonucleotide microarrays.J. Neurovirol. 11: 299–305.
25. Sun, Q., R. L. Burton, and K. G. Lucas. 2002. Cytokine production and cytolyticmechanism of CD4� cytotoxic T lymphocytes in ex vivo expanded therapeuticEpstein-Barr virus-specific T-cell cultures. Blood 99: 3302–3309.
26. Sarwal, M. M., A. Jani, S. Chang, P. Huie, Z. Wang, O. Salvatierra, Jr.,C. Clayberger, R. Sibley, A. M. Krensky, and M. Pavlakis. 2001. Granulysinexpression is a marker for acute rejection and steroid resistance in human renaltransplantation. Hum. Immunol. 62: 21–31.
27. Soccal, P. M., R. L. Doyle, A. Jani, S. Chang, O. A. Akindipe, C. Poirier, andM. Pavlakis. 2000. Quantification of cytotoxic T-cell gene transcripts in humanlung transplantation. Transplantation 69: 1923–1927.
28. Kotsch, K., M. F. Mashreghi, G. Bold, P. Tretow, J. Beyer, M. Matz,J. Hoerstrup, J. Pratschke, R. Ding, M. Suthanthiran, et al. 2004. Enhanced granu-lysin mRNA expression in urinary sediment in early and delayed acute renalallograft rejection. Transplantation 77: 1866–1875.
29. Deng, A., S. Chen, Q. Li, S. C. Lyu, C. Clayberger, and A. M. Krensky. 2005.Granulysin, a cytolytic molecule, is also a chemoattractant and proinflammatoryactivator. J. Immunol. 174: 5243–5248.
30. Sekiya, M., A. Ohwada, M. Katae, T. Dambara, I. Nagaoka, and Y. Fukuchi.2002. Adenovirus vector-mediated transfer of 9 kDa granulysin induces DNAfragmentation in HuD antigen-expressing small cell lung cancer murine modelcells. Respirology 7: 29–35.
31. Pages, F., A. Berger, M. Camus, F. Sanchez-Cabo, A. Costes, R. Molidor,B. Mlecnik, A. Kirilovsky, M. Nilsson, D. Damotte, et al. 2005. Effector memoryT cells, early metastasis, and survival in colorectal cancer. N. Engl. J. Med. 353:2654–2666.
32. Banerjea, A., S. Ahmed, R. E. Hands, F. Huang, X. Han, P. M. Shaw, R. Feakins,S. A. Bustin, and S. Dorudi. 2004. Colorectal cancers with microsatellite insta-bility display mRNA expression signatures characteristic of increased immuno-genicity. Mol. Cancer 3: 21.
33. Allison, J. P., B. W. McIntyre, and D. Bloch. 1982. Tumor-specific antigen ofmurine T-lymphoma defined with monoclonal antibody. J. Immunol. 129:2293–2300.
34. Franksson, L., E. George, S. Powis, G. Butcher, J. Howard, and K. Karre. 1993.Tumorigenicity conferred to lymphoma mutant by major histocompatibility com-plex-encoded transporter gene. J. Exp. Med. 177: 201–205.
35. Pardo, J., S. Balkow, A. Anel, and M. M. Simon. 2002. The differential contri-bution of granzyme A and granzyme B in cytotoxic T lymphocyte-mediatedapoptosis is determined by the quality of target cells. Eur. J. Immunol. 32:1980–1985.
36. Kiessling, R., E. Klein, and H. Wigzell. 1975. “Natural” killer cells in the mouse.I. Cytotoxic cells with specificity for mouse Moloney leukemia cells: specificityand distribution according to genotype. Eur. J. Immunol. 5: 112–117.
37. Trapani, J. A., K. A. Browne, M. J. Smyth, and D. A. Jans. 1996. Localization ofgranzyme B in the nucleus: a putative role in the mechanism of cytotoxic lym-phocyte-mediated apoptosis. J. Biol. Chem. 271: 4127–4133.
38. Clement, M. V., P. Haddad, A. Soulie, S. Legros-Maida, J. Guillet, E. Cesar, andM. Sasportes. 1990. Involvement of granzyme B and perforin gene expression inthe lytic potential of human natural killer cells. Res. Immunol. 141: 477–489.
39. Revell, P. A., W. J. Grossman, D. A. Thomas, X. Cao, R. Behl, J. A. Ratner,Z. H. Lu, and T. J. Ley. 2005. Granzyme B and the downstream granzymes Cand/or F are important for cytotoxic lymphocyte functions. J. Immunol. 174:2124–2131.
40. Wong, C. P., C. Y. Okada, and R. Levy. 1999. TCR vaccines against T celllymphoma: QS-21 and IL-12 adjuvants induce a protective CD8� T cell re-sponse. J. Immunol. 162: 2251–2258.
41. Andreu, D., C. Carreno, C. Linde, H. G. Boman, and M. Andersson. 1999. Iden-tification of an anti-mycobacterial domain in NK-lysin and granulysin. Biochem.J. 344: 845–849.
42. Ernst, W. A., S. Thoma-Uszynski, R. Teitelbaum, C. Ko, D. A. Hanson,C. Clayberger, A. M. Krensky, M. Leippe, B. R. Bloom, T. Ganz, andR. L. Modlin. 2000. Granulysin, a T cell product, kills bacteria by altering mem-brane permeability. J. Immunol. 165: 7102–7108.
43. Dieli, F., M. Troye-Blomberg, J. Ivanyi, J. J. Fournie, A. M. Krensky,M. Bonneville, M. A. Peyrat, N. Caccamo, G. Sireci, and A. Salerno. 2001.
Granulysin-dependent killing of intracellular and extracellular Mycobacteriumtuberculosis by V�9/V�2 T lymphocytes. J. Infect. Dis. 184: 1082–1085.
44. Hata, A., L. Zerboni, M. Sommer, A. A. Kaspar, C. Clayberger, A. M. Krensky,and A. M. Arvin. 2001. Granulysin blocks replication of varicella-zoster virusand triggers apoptosis of infected cells. Viral Immunol. 14: 125–133.
45. Ma, L. L., J. C. Spurrell, J. F. Wang, G. G. Neely, S. Epelman, A. M. Krensky,and C. H. Mody. 2002. CD8 T cell-mediated killing of Cryptococcus neoformansrequires granulysin and is dependent on CD4 T cells and IL-15. J. Immunol. 169:5787–5795.
46. Gansert, J. L., V. Kiessler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky,S. A. Porcelli, R. L. Modlin, and S. Stenger. 2003. Human NKT cells expressgranulysin and exhibit antimycobacterial activity. J. Immunol. 170: 3154–3161.
47. Farouk, S. E., L. Mincheva-Nilsson, A. M. Krensky, F. Dieli, and M. Troye-Blomberg. 2004. �� T cells inhibit in vitro growth of the asexual blood stages ofPlasmodium falciparum by a granule exocytosis-dependent cytotoxic pathwaythat requires granulysin. Eur. J. Immunol. 34: 2248–2256.
48. Walch, M., E. Eppler, C. Dumrese, H. Barman, P. Groscurth, and U. Ziegler.2005. Uptake of granulysin via lipid rafts leads to lysis of intracellular Listeriainnocua. J. Immunol. 174: 4220–4227.
49. Ochoa, M. T., S. Thoma-Uszynski, P. A. Sieling, S. Sabet, S. Cho, A. M.Krensky, A. Burdick, T. H. Rea, and R. L. Modlin. 2000. Role of granulysin inimmunity to leprosy. Lepr. Rev. 71(Suppl.): S115–S116.
50. Ochoa, M. T., S. Stenger, P. A. Sieling, S. Thoma-Uszynski, S. Sabet, S. Cho,A. M. Krensky, M. Rollinghoff, E. Nunes Sarno, A. E. Burdick, et al. 2001. T-cellrelease of granulysin contributes to host defense in leprosy. Nat. Med. 7:174–179.
51. Sakai, M., K. Ogawa, A. Shiozaki, S. Yoneda, Y. Sasaki, K. Nagata, and S. Saito.2004. Serum granulysin is a marker for Th1 type immunity in pre-eclampsia.Clin. Exp. Immunol. 136: 114–119.
52. Hanson, D. A., A. A. Kaspar, F. R. Poulain, and A. M. Krensky. 1999. Biosyn-thesis of granulysin, a novel cytolytic molecule. Mol. Immunol. 36: 413–422.
53. Obata-Onai, A., S. Hashimoto, N. Onai, M. Kurachi, S. Nagai, K. Shizuno,T. Nagahata, and K. Matsushima. 2002. Comprehensive gene expression analysisof human NK cells and CD8� T lymphocytes. Int. Immunol. 14: 1085–1098.
54. Andersson, M., H. Gunne, B. Agerberth, A. Boman, T. Bergman, R. Sillard,H. Jornvall, V. Mutt, B. Olsson, and H. Wigzell. 1995. NK-lysin, a novel effectorpeptide of cytotoxic T and NK cells: structure and cDNA cloning of the porcineform, induction by interleukin 2, antibacterial and antitumor activity. EMBO J.14: 1615–1625.
55. Endsley, J. J., J. L. Furrer, M. A. Endsley, M. A. McIntosh, A. C. Maue,W. R. Waters, D. R. Lee, and D. M. Estes. 2004. Characterization of bovinehomologues of granulysin and NK-lysin. J. Immunol. 173: 2607–2614.
56. Davis, E. G., Y. Sang, B. Rush, G. Zhang, and F. Blecha. 2005. Molecularcloning and characterization of equine NK-lysin. Vet. Immunol. Immunopathol.105: 163–169.
57. Kagi, D., B. Ledermann, K. Burki, P. Seiler, B. Odermatt, K. J. Olsen,E. R. Podack, R. M. Zinkernagel, and H. Hengartner. 1994. Cytotoxicity medi-ated by T cells and natural killer cells is greatly impaired in perforin-deficientmice. Nature 369: 31–37.
58. Heusel, J. W., R. L. Wesselschmidt, S. Shresta, J. H. Russell, and T. J. Ley. 1994.Cytotoxic lymphocytes require granzyme B for the rapid induction of DNA frag-mentation and apoptosis in allogeneic target cells. Cell 76: 977–987.
59. Bluthmann, H., P. Kisielow, Y. Uematsu, M. Malissen, P. Krimpenfort, A. Berns,H. von Boehmer, and M. Steinmetz. 1988. T-cell-specific deletion of T-cell re-ceptor transgenes allows functional rearrangement of endogenous �- and�-genes. Nature 334: 156–159.
60. Grossman, W. J., J. T. Kimata, F. H. Wong, M. Zutter, T. J. Ley, and L. Ratner.1995. Development of leukemia in mice transgenic for the tax gene of humanT-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 92: 1057–1061.
61. Lecoeur, H., M. Fevrier, S. Garcia, Y. Riviere, and M. L. Gougeon. 2001. A novelflow cytometric assay for quantitation and multiparametric characterization ofcell-mediated cytotoxicity. J. Immunol. Methods 253: 177–187.
62. Caccamo, N., S. Milano, C. Di Sano, D. Cigna, J. Ivanyi, A. M. Krensky, F. Dieli,and A. Salerno. 2002. Identification of epitopes of Mycobacterium tuberculosis16-kDa protein recognized by human leukocyte antigen-A*0201 CD8� T lym-phocytes. J. Infect. Dis. 186: 991–998.
63. Samten, B., B. Wizel, H. Shams, S. E. Weis, P. Klucar, S. Wu, R. Vankayalapati,E. K. Thomas, S. Okada, A. M. Krensky, and P. F. Barnes. 2003. CD40 ligandtrimer enhances the response of CD8� T cells to Mycobacterium tuberculosis.J. Immunol. 170: 3180–3186.
64. Krensky, A. M., and C. Clayberger. 2005. Granulysin: a novel host defense mol-ecule. Am. J. Transplant 5: 1789–1792.
84 ANTITUMOR EFFECT OF HUMAN GNLY IN TRANSGENIC MICE
