1 23

Cell and Tissue Research ISSN 0302-766X Cell Tissue ResDOI 10.1007/s00441-014-2039-x

HDAC6 deacetylates alpha tubulin insperm and modulates sperm motility inHoltzman rat

Sweta Parab, Omshree Shetty, ReshmaGaonkar, Nafisa Balasinor, VrindaKhole & Priyanka Parte

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer-

Verlag Berlin Heidelberg. This e-offprint is

for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

REGULAR ARTICLE

HDAC6 deacetylates alpha tubulin in sperm and modulatessperm motility in Holtzman rat

Sweta Parab & Omshree Shetty & Reshma Gaonkar &

Nafisa Balasinor & Vrinda Khole & Priyanka Parte

Received: 10 July 2014 /Accepted: 15 October 2014# Springer-Verlag Berlin Heidelberg 2014

Abstract Histone deacetylase 6 (HDAC6) is an alpha (α)-tubulin deacetylase and its over-expression has been demon-strated to promote chemotactic cell movement. Motility insperm is driven by the flagella, the cytoskeletal structurecomprising the microtubules, which are heterodimers of α-and β-tubulins. We have hypothesized that HDAC6, by virtueof being an α-tubulin deacetylase, might modulate spermmotility. However, the presence of HDAC6 on sperm hashitherto not been reported. In this study, we have demonstrat-ed, for the first time, the presence of HDAC6 transcript andprotein in the testicular and caudal sperm of rat. We haveobserved a significantly overlapping expression of HDAC6with acetyl α-tubulin (Ac α-tubulin) in the mid-piece andprincipal piece of sperm flagella, and the co-precipitation ofα-tubulin and Ac α-tubulin together with HDAC6 and viceversa in sperm lysates. This indicates that HDAC6 interactswithα-tubulin. The HDAC6 activity of sperm, sperm motilityand status of Ac α-tubulin investigated in the presence ofHDAC inhibitors Trichostatin A, Tubastatin A and sodium

butyrate demonstrate that HDAC6 in sperm is catalyticallyactive and that inhibitors of HDAC6 increase acetylation andrestrict sperm motility. Thus, we show that (1) active HDAC6enzyme is present in sperm, (2) HDAC6 in sperm is able todeacetylate α-tubulin, (3) inhibition of HDAC6 results inincreased Ac α-tubulin expression and (4) HDAC6 inhibitionaffects sperm motility. This evidence suggests that HDAC6 isinvolved in modulating sperm movement.

Keywords Acetylated alpha-tubulin . Deacetylase activity .

HDAC6 . HDAC inhibitor . Spermmotility . Rat

Introduction

Sperm flagellar motility is well-orchestrated and is attrib-utable to a highly organized microtubule-based structurecalled the axoneme. The axoneme is composed of 9doublet microtubules and 2 singlet microtubules runningalong the length of the flagellum. The axonemal structureis surrounded by auxiliary dense fibres and the fibroussheath that have no clear active role in the sliding of micro-tubules and flagellar movement. The microtubules are com-posed of α- and β-tubulins, which undergo several post-translational modifications, namely, polyglutamylation,polyglycylation, tyrosylation/detyrosylation and acetyla-tion/deacetylation. Whereas the polyglutamylation of thelateral chain of α-tubulin has been shown to have a role inflagellar motility, detyrosination and acetylation arethought to be important for the assembly of the axoneme(Gagnon et al. 1996). The distribution of acetylated (Ac) α-tubulin is tightly controlled and stereotypic. Ac α-tubulin ismost abundant in stable microtubules but is absent fromdynamic cellular structures (e.g. neuronal growth cones,leading edges of fibroblasts). Reversible acetylation of α-

This work (RA/13/08-2013) was supported by grants from theDepartment of Science and Technology, India and the Indian Council ofMedical Research. Junior Research Fellowship and Senior ResearchFellowship provided to Sweta Parab and research associate fellowship toDr. Omshree Shetty by the Department of Science and Technology isgratefully acknowledged.

Electronic supplementary material The online version of this article(doi:10.1007/s00441-014-2039-x) contains supplementary material,which is available to authorized users.

S. Parab :O. Shetty :V. Khole : P. Parte (*)Department of Gamete Immunobiology, National Institute forResearch in Reproductive Health (ICMR), Mumbai 400012, Indiae-mail: partep@nirrh.res.in

R. Gaonkar :N. BalasinorDepartment of Neuroendocrinology and Confocal Microscopy Lab,National Institute for Research in Reproductive Health (ICMR),Mumbai 400012, India

Cell Tissue ResDOI 10.1007/s00441-014-2039-x

Author's personal copy

tubulin has been implicated in regulating microtubule sta-bility and function (LeDizet and Piperno 1987).

Although several enzymes, namely, the ARD1 subunitof the ARD1/NAT1 complex, N-acetyltransferase (NAT)10, elongator acetyltransferase complex subunit 3 (ELP3)and MEC17/αTAT1, have been proposed as tubulin ace-tyltransferases (Akella et al. 2010; Creppe et al. 2009;Kalebic et al. 2013a, 2013b; Ohkawa et al. 2008; Shenet al. 2009), histone deacetylase 6 (HDAC6) and Sirtuin 2(SIRT2) have been identified as tubulin deacetylases(Hubbert et al. 2002; Matsuyama et al. 2002; Northet al. 2003; Zhang et al. 2003). SIRT2 is dependent onHDAC6 for tubulin deacetylation, whereas interactionbetween HDAC6 and tubulin has been established asbeing independent of other proteins (Zhang et al. 2008;Zhao et al. 2010). This designates HDAC6 as a key playerin α-tubulin deacetylation.

The study of Hubbert et al. (2002) with A549 cells hasdemonstrated that the over-expression of HDAC6 leads tothe deacetylation of α-tubulin and that this promoteschemotactic cell movement supporting the idea thatHDAC6-mediated deacetylation regulates microtubule-dependent cell motility. This alteration in cell motilityhas been subsequently demonstrated to be attributable toalterations in the degree of tubulin acetylation or to theacetylation of some unidentified protein (Palazzo et al.2003).

Of the 10 HDACs known, only HDAC 1 and 6 havebeen reported in the testis and are implicated to have arole in histone acetylation during spermatogenesis(Hazzouri et al. 2000). In the testis, their presence hasbeen shown in spermatogenic cells, pachytenes, roundand elongating spermatids and condensing spermatids.Fractions enriched in condensing spermatids, residualbodies and spermatozoa show a decreased expression ofboth the HDACs.

There is a dearth of literature on the presence ofHDAC6 and the role of acetylation/deacetylation in spermfunction. The only reported study in humans has shownhypoacetylation of α-tubulin and poor sperm motility in aman with retinal degeneration (Gentleman et al. 1996).Our own observations demonstrate significantly reducedacetylation of α-tubulin in asthenozoospermic individuals(Bhagwat et al. 2014). As HDAC6 has been shown todeacetylate α-tubulin with a role in cell movement, andsince sperm motility involves flagellar activity mediatedby the axonemal microtubules that are composed of tubu-lin and are highly acetylated, we have hypothesized thatthis α-tubulin post-translational modification has a role insperm motility. The present study reports, for the firsttime, the existence of HDAC6 on the sperm flagella anddemonstrates that it is catalytically active and is involvedin regulating sperm motility.

Materials and methods

Experimental animals

Neonatal, pre-pubertal, pubertal and adult male Holtzman ratswere used. Food and water were provided ad libitum. Ratswere housed in groups of four/cage under conditions of 14 hlight and 14 h dark. For immunizations, two adult BelgiumWhite female rabbits were used. The study was approved bythe Institutional Animal Ethics Committee (IAEC).

Materials

Trichostatin A (TSA; a general HDAC inhibitor) andsodium butyrate (NaB; inhibits all HDACs exceptHDAC6) were procured from Sigma-Aldrich (SaintLouis, Mo., USA). Tubastatin A (TBSA; HDAC6 specificinhibitor) was obtained from BioVision (Calif., USA).Monoclonal antibodies to Ac α-tubulin (Clone 6-11B-1)and α-tubulin (B-5-1-12) were acquired from Sigma-Aldrich. HDAC6 antibody used in the immunofluores-cence experiments was obtained from Thermo FisherScientific (Ill., USA). Horseradish peroxidase (HRP)-la-belled swine anti-rabbit antibody, rabbit anti-mouse anti-body and fluorescein isothiocyanate (FITC)-labelledswine anti-rabbit antibody were procured from Dako(Denmark); rodamine-labelled goat anti-mouse antibodywas obtained from Invitrogen (Carlsbad, Calif., USA).Commonly used reagents, unless otherwise specified,were purchased from Qualigens or SRL India and wereanalytical grade.

Generating antibody to HDAC6

Polyclonal antibodies were raised in rabbit to the chimericpeptide “DPSVLYVSLYVSLHRYGGYMNEGELR” com-prising a B-cell epitope and a T-cell epitope of rat HDAC6separated by two glycine residues and designed by usingEMBOSS: antigenic software (Rice et al. 2000). Briefly, aftercollection of pre-immune sera, rabbits were immunized with200 μg peptide in 1 ml Freund’s Complete Adjuvant followedby three booster doses of 100 μg peptide in Freund’sIncomplete Adjuvant at 10-day intervals. Antibody titres forthe sera collected after every booster were monitored byindirect enzyme-linked immunosorbent assay (ELISA) bytitrating serial dilutions of the pre- and post-immune seraagainst 1 μg chimeric peptide coated onto the microtitre plate.Binding was detected by using HRP-conjugated swine anti-rabbit IgG and tetramethyl benzidine/H2O2 as substrate.Absorbance was determined at 450 nm. Specificity of theantibody was determined by competitive ELISA by preincu-bating the antisera (1:4000) with 0, 0.25, 0.5, 1, 2, 4 or 8 μg ofeither the corresponding peptide (DPSVLYVSLYVSLHRYG

Cell Tissue Res

Author's personal copy

GYMNEGELR) or an unrelated peptide (VVDSEDLPLN)and then by using the preincubated mixtures to probe thepeptide immobilized onto microtitre plates. Preimmune serapreincubated with peptide served as a control (see supplemen-tal data, Fig. S1a, b). Western blot analysis was performed byusing the preabsorbed antibody to confirm the specificity ofthe antipeptide antibody. Caudal sperm proteins resolved bySDS polyacrylamide gel electrophoresis (SDS-PAGE) andtransblotted onto nitrocellulose membrane were probed withthe antipeptide (HDAC6) antibody (1:4000) or with a 1:4000dilution of the antipeptide antibody pre-absorbed with 16 μgblocking peptide or with antipeptide antibody pre-absorbedwith 16 μg unrelated peptide. Negative control was probedwith pre-immune (1:4000) sera. Beta-actin was used as aloading control (see supplemental data, Fig. S1c).

Isolation of rat testicular and epididymal sperm

Testicular, caput and caudal sperm were isolated from therespective tissues bymaking 2–3 cuts and allowing the releaseof sperm into 0.1 M phosphate-buffered saline (PBS, pH 7.4)by incubating the teased tissue at 34 °C for 30 min. Thesupernatants were collected and washed three times with0.1 M PBS by centrifugation at 800g for 20 min at 4 °C.The sperm pellet thus obtained was used for all the analyses

performed in this study. If testicular sperm were used forWestern blot analysis, they were first purified from the othertesticular cell types by Percoll gradient centrifugation(Suryawanshi et al. 2011). The homogeneity of the testicularsperm population thus obtained was confirmed by microscop-ic analysis of smears of the sample stained by thePapanicolaou method (Fig. 1a). However, testicular spermwere not Percoll-purified if they were to be used for immuno-fluorescence localization studies.

Reverse transcription plus polymerase chain reaction

The presence of HDAC6 transcript in testicular and caudalsperm was determined by reverse transcription followed bythe polymerase chain reaction (RT-PCR). Sperm from thetestis and caudal region of epididymis were isolated andpelleted as described above. RNA extraction was carried outby using guanidinium-thiocyanate-chloroform extraction(TRIzol, Invitrogen). The purity and concentration of theRNA were determined spectrophotometrically at 260 and280 nm. The respective RNA (1 μg) was reverse transcribedto cDNA by using the ImProm-II Reverse TranscriptionSystem (Promega, Madison, Wis., USA) and 250 ng of thiscDNAwas amplified by PCR with the Clontech Advantage 2PCR kit (Clontech Laboratories, Mountain View, Calif.,

Fig. 1 HDAC6 is present on sperm. a Bright field image of rat testicularsperm population purified on a Percoll gradient and stained byPapanicolaou’s method. Bar 20 μm. b Reverse transcription plus thepolymerase chain reaction. A band of 209 bp is observed in testicularsperm (T sp) and caudal sperm (Cd sp). Reagent control (RC) and no-reverse-transcriptase (NRT) control were examined to determine any non-specific amplification. Bottomβ-Actin (200 bp) used as the housekeepinggene (lane 1 100-bp DNA ladder). c Western blot analysis. A band of

HDAC6 is observed at ~130 kDa in testicular and caudal sperm. Negativecontrols show no band in the 130 kDa region. d A band of acetyl (Ac) α-tubulin and α-tubulin at 55 kDa is observed in testicular and caudalsperm. e Graphical representation of the Western blot analysis for Acα-tubulin in testicular and caudal sperm. No difference was seen in theexpression of Ac α-tubulin between testicular and caudal sperm. Level ofsignificance was determined by Student’s t-test

Cell Tissue Res

Author's personal copy

USA). CAGCTAACCAGACCACGTCA and TAGTAGGCCCTCCTCGGATT were the forward and reverse primers,respectively, for HDAC6, and AGAGGGAAATCGTGCGTGAC and GCCGGACTCATCGTACTCCT were the for-ward and reverse primers for β-actin (housekeeping gene).The reactions were set for denaturation at 94 °C for 1 min,annealing at 59 °C for HDAC6 and at 62 °C for β-actin for1 min, followed by extension at 72 °C for 1 min. Finalextension was at 72 °C for 10 min. Reagent controls and no-reverse-transcriptase controls were examined to check for anycontamination from reagents used or for genomic HDAC6amplification, respectively. The experiments were repeatedthree times to ensure reproducibility of the results.

Western blot analysis

HDAC6 protein expression in sperm derived from thetestis and caudal region of the epididymis was studied byWestern blot analysis. Rat testicular and caudal spermpellets were lysed in 15 mM TRIS–HCl buffer, pH 7.4,containing 0.34 M sucrose, 60 mM KCl, 15 mM NaCl,0.65 mM spermidine, 2 mM EDTA, 0.5 mM EGTA,0.05 % Triton X-100, 1 mM dithiothreitol, 0.5 mMpheny lme thane su l fony l - f l uo r ide as de sc r ibed(Seigneurin-Berny et al. 2001), and the protein concentra-tion was quantified by using Bradford’s method (Bradford1976). Total proteins (60 μg and 10 μg, respectively) wereloaded for analysis of HDAC6 and of α- and Ac α-tubulin.Protein lysates were resolved by electrophoresis on 10 %SDS-polyacrylamide gels by using the standard protocol(Laemmli 1970) and transblotted to nitrocellulose mem-branes (GE healthcare, UK) in duplicate. These blots werefurther incubated with blocking at room temperature for1 h in buffer. One blot was probed with a 1:500 dilution ofthe polyclonal antibody to HDAC6 raised in-house andwith monoclonal antibodies to Ac α-tubulin (1:10,000)and α-tubulin (1:10,000), respectively, at room tempera-ture for 1 h. The corresponding other blot was used asnegative control and was incubated with only the antibodydiluent for Ac α-tubulin and α-tubulin and preimmune-sera in the case of HDAC6 antibody. These controls werecarried out to determine any non-specific binding of theantibodies. The blots were washed three times with 0.1 MPBS containing 0.1 % Tween 20 (0.1 % PBST). The blotswere then incubated with a 1:3000 dilution of HRP-labelled swine anti-rabbit antibody for HDAC6 and rabbitanti-mouse antibody in the cases of Ac α-tubulin and of α-tubulin followed by three washes with 0.1 % PBST.Chemiluminescent-based detection of the proteins of inter-est was undertaken by using the ECL plus Western blottingdetection kit (GE healthcare, UK) following the kit proto-col. Western blot analysis was performed by using GeneTools version 3.06.

Immunohistochemistry

Sections (5μm thick) of Bouin-fixed paraffin-embedded testis(cut transversely) and epididymis (cut sagittally to cover thecaput, corpus and cauda) were probed to study the expressionof HDAC6 protein in the respective tissues. The sections weredeparaffinized and rehydrated. Endogenous peroxidase activ-ity was quenched with 0.3 % H2O2 in 70 % methanol for30 min at room temperature followed by three washes with0.1 M PBS. Heat-induced antigen retrieval of the sections wascarried out in 10 mM sodium citrate buffer, pH 6.0, followedby three washes in 0.1 M PBS. Non-specific sites wereblocked by incubating the sections with blocking solution(Vectastain ABC System peroxidase ki t ; VectorLaboratories, Burlingame, Calif., USA) for 30 min. Sectionswere incubated with either a 1:100 dilution of HDAC6 anti-body raised in-house or with a 1:100 dilution of pre-immuneserum to serve as the negative control to account for non-specific binding of the antibody. Following overnight incuba-tions at 4 °C, sections were washed three times and thenincubated with a 1:50 diluted rabbit anti-goat antibody.Signal was detected by using the Vectastain ABC System asdescribed in the manufacturer’s protocol. Sections were coun-terstained with haematoxylin. Ten fields each from the caputepithelium, caput lumen, caudal epithelium and caudal lumenfrom duplicate slides were randomly selected for measure-ment of the integrated optical density (IOD). The stainingintensities were quantified by using the image analysis soft-ware, Aperio ImageScope (Version v11.2.0.780 Aperio, Vista,Calif., USA).

Indirect immunofluorescence

Adult rat testes were fixed by whole body perfusion by using4 % paraformaldehyde and transferred to a 60 % sucrosesolution for 3 days at 4 °C. Tissue blocks were made by usingcryo-protectant solution and processed as described byUpadhyay et al. (2011). The distribution of HDAC6 wasstudied in 8-μm-thick sections that were probed with a1:100 diluted HDAC6 antibody raised by us. Pre-immuneserum at the same dilution was used as a negative control.To study the presence and distribution of HDAC6 and toinvestigate its status of co-localization with respect to Ac α-tubulin in rat testicular, caput, and caudal epididymal sperm,the sperm were isolated from respective tissues as describedearlier, fixed with chilled 95 % ethanol, permeabilized byusing 0.1 % Triton X-100 and probed with a 1:10 dilutedrabbit polyclonal anti-rat HDAC6 antibody (Thermo FisherScientific, Ill., USA.) and a 1:100 dilution of monoclonal Acα-tubulin antibody. The secondary antibodies, namely FITC-conjugated swine anti-rabbit and rodamine-labelled goat anti-mouse, respectively, were used at a 1:100 dilution. DAPI (4,6-diamidino-2-phenylindole) was used as the counterstain to

Cell Tissue Res

Author's personal copy

stain the sperm nucleus. Co-localization was observed byusing an LSM 510 Meta Confocal microscope (Carl Zeiss,Oberkochen, Germany). Z stack images were obtained and athree-dimensional (3D) image was constructed, which wasanalysed by using LSM 510 Meta software. For statisticalevaluation, average signal intensities of HDAC6 and Ac α-tubulin expression per micrometer length of the sperm flagellawere measured for 10 sperm per group. The overlap coeffi-cient for the two proteins was also determined and cut-maskimages showing only the co-localized regions were obtained.

Co-immunoprecipitation

The interaction between HDAC6 and α-tubulin was deter-mined by co-immunoprecipitation of the correspondinginteracting proteins by using HDAC6, α-tubulin or Ac α-tubulin as bait. Aliquots containing 200 μg caudal spermlysates prepared in NP40 lysis buffer were incubated withantibodies to HDAC6 (10 μl polyclonal HDAC6 antibodyraised in-house or pre-immune sera), α-tubulin, Ac α-tubulinor mouse IgG (4 μg mouse monoclonal antibody) at 4 °C for4 h. Protein G beads (30 μl) were then added to all the tubesand further incubated for 2 h. The bound antigen-antibodycomplexes were separated by centrifugation at 12,000g for5 min and eluted in 30 μl Laemmli buffer at 95 °C for 10 min.The eluted proteins and the input protein lysates were resolvedby SDS-PAGE, transblotted onto nitrocellulose membranesand probed with antibodies to α-tubulin, Ac α-tubulin andHDAC6 as described earlier.

Sperm motility

Sperm from the caudal region of the epididymis were isolatedand 5×106 sperm were incubated in 5 % CO2-equilibratedDulbecco’s modified Eagle’s medium with or without TSA (5μM), TBSA (5 μM) or NaB (5 μM or 5 mM) at 37 °C for 3 h.At the end of the incubation, sperm viability was evaluated byusing 0.5 % eosin in 0.9 % NaCl. Equal volumes of eosinsolution and sperm suspension were mixed and observedimmediately under a microscope. Sperm heads stained darkpink were counted as being dead. Spermmotility was assessedby using Computer Assisted Sperm Analysis (CASA,Hamilton Thorne, Mass., USA) following which the spermwere fixed in 95 % chilled ethanol to determine the status ofAc α-tubulin by flow cytometry. The co-localization ofHDAC6 and Ac α-tubulin in sperm in the presence of thevarious inhibitors was determined by confocal microscopy.

Flow cytometry

Flow cytometry was performed on ethanol-fixed sperm.Sperm were permeabilized with 1 % Triton X-100 for10 min, washed and then incubated with a 1:100 dilution of

antibody to Ac α-tubulin at 37 °C for 1 h followed by threewashes by centrifugation in sheath fluid (Becton DickinsonBiosciences, San Jose, Calif., USA) at 800g for 5 min at roomtemperature. The cells were then incubated with a 1:100 dilu-tion of rabbit anti-mouse FITC for 1 h in the dark followed bythree washes of 5 min each with sheath fluid and analysed on aflow cytometer (Becton Dickinson FAC Sort Flow cytometer,San Jose, Calif., USA). A total of 10,000 cells per sample wererecorded. Cells were gated so as to avoid debris and select onlythe intact sperm for analysis (Malkov et al. 1998). The medianintensities for each of these gated cells were noted. Resultswere analysed by using CellQuestPro (Version 4.0).

HDAC6 enzyme assay

HDAC6 enzyme assay was performed by using the Fluor-de-Lys HDAC6 fluorimetric drug discovery kit (Enzo LifeSciences, Farmingdale, N.Y., USA) designed essentially toevaluate drugs for the inhibition of the deacetylase activityof recombinant human HDAC6 provided in the kit. We usedthis kit to determine the deacetylase activity in sperm lysate.Additionally, in order to demonstrate whether the activity, ifobserved, was attributable to HDAC6 or any other HDAC, weused various HDAC inhibitors. Briefly, 50 μg sperm lysatesused as a source of HDAC6 were incubated with 10 μMFluorde Lys SIRT1 substrate in the absence or presence of 5 μMHDAC inhibitors TSA and TBSA and of two concentrations(5 μM and 5 mM) of NaB at 37 °C for 2.5 h. At the end ofincubation, 50 μl 1× Fluor-de-Lys developer was added andthe assay was quantified fluorimetrically at excitation andemission wavelengths of 360 nm and 460 nm, respectively.Fluor de Lys deacetylated standard and Fluor de Lys substrateincubated with recombinant human HDAC6 were alwaysincluded in the assay as positive controls together with thetest samples. The experiment was performed three times.

Statistical analysis

All the experiments were performed ≥3 times and the signif-icance of the differences between the groups was determinedby one way analysis of variance (ANOVA) with Bonferroni’spost-test correction. The level of significance was set at P≤0.05. Analyses were performed by using Graphpad Prismsoftware (Version 5.0).

Results

HDAC6 transcript and protein is present in sperm

For HDAC6 to have a role in sperm motility, it is imperativethat it be present in the sperm. In order to avoid any ambiguity

Cell Tissue Res

Author's personal copy

with respect to the homogeneity of testicular sperm popula-tion, the purity of the testicular sperm population was ensuredas described earlier (Fig. 1a). RT-PCR performed to detect thepresence of the transcript in rat testicular and caudal spermshowed a 209-bp amplicon in testicular and caudal sperm andin the respective tissue RNA (Fig. 1b). The absence of a bandin the no-reverse-transcriptase and reagent control indicatedthat the observed bands specifically demonstrated the pres-ence of the HDAC6 transcript. β-Actin used as housekeepinggene showed a band of 200 bp in testicular and caudal sperm.The presence of HDAC6 protein in sperm was demonstratedby Western blot analysis. A prominent band (~130 kDa) forHDAC6 was observed to be present in testicular and caudalsperm but not in the negative controls for the same samples. Aweak but specific band (not seen in the negative control) wasalso observed at ~70 kDa. This, we presumed, representedfragmented HDAC6 (Fig. 1c, supplementary material inFig. S1c). However, non-specific reactivity at ~100 kDa was

observed for testicular sperm, but not for caudal sperm. Thesame band was also seen in the negative control for testicularsperm. Expression of HDAC6 in caudal sperm was clearlylower than that in testicular sperm. The band for Ac α-tubulinshowed an apparent increase in caudal sperm in comparisonwith testicular sperm. Therefore, the band intensities for Acα-tubulin in testicular and caudal sperm lysates were quantifiedand normalized to those of its corresponding α-tubulin ex-pression. However, after normalization, this increase wasfound not to be statistically significant (Fig. 1d, e).

Distribution of HDAC6 in adult rat testis and epididymis

Immunohistochemical analysis of adult rat testicular sectionsdemonstrated specific localization of HDAC6 in round andelongating spermatids (Fig. 2b, c). Indirect immunofluores-cence to further verify the distribution pattern of HDAC6 inadult rat testis, showed the presence of HDAC6 in round,

Fig. 2 Distribution of HDAC6 in adult testis and epididymis. Immuno-histochemical localization of HDAC6 in testis (a-c). a Negative control(pre-immune). b, c HDAC6 expression (arrows) in acrosome region ofround (b) and elongating (c) spermatids. Bar 10 μm. e–g Immunofluo-rescent localization of HDAC6 in the testis. HDAC6 (arrowheads) islocalized in the acrosome region of round (e), elongating (f) and elongat-ed spermatids (g). Bar 5 μm. dNegative control showing absence of non-specific staining. Bar 20 μm. h–k Immunohistochemical localization ofHDAC6 in sagittal sections of epididymis, i.e. caput (h, i) and caudal (j,k) region.Bars 20μm (h, j), 10μm (i, k). HDAC6 expression is observed

in the lumen and epithelial cells of the caput and caudal epididymis. InsetsNegative controls probed with preimmune sera instead of antibody (Cp-ecaput epithelium, Cp-l caput lumen, Cd-e cauda epithelium, Cd-l caudalumen). l Graphical representation of semi-quantitative analysis ofHDAC6 expression in epididymal tissue. A significant increase is ob-served in the caput lumen, caudal lumen and caudal epithelium ascompared with the caput epithelium. Experiments were performed twice.Values are means±standard error of mean (S.E.M.). Significance levelswere set at P≤0.05. ***Significance at P≤0.001

Cell Tissue Res

Author's personal copy

elongating and elongated spermatids (Fig. 2e–g). The expres-sion of HDAC6was observed to be polarized at the acrosomalend during spermatid development.

In order to trace the pattern of HDAC6 expression duringthe functional maturation of sperm, sagittal sections of the

epididymis encompassing the caput, corpus and cauda regionswere obtained on single slides ensuring uniform processingfor immunohistochemical localization. Although we per-formed immunohistochemistry on all the sagittal sections ofthe epididymis, quantification of the staining intensity was

Fig. 3 Co-localization of HDAC6 and Ac α-tubulin in the sperm flagel-la. Localization of HDAC6 (a, f, k) and Ac α-tubulin (b, g, l) and cutmask (c, h, m) and composite images (d, i, n) images indicating the co-localization of the two proteins in testicular (a-d), caput (f-i) and caudal(k-n) sperm. Respective negative controls are presented in e, j, o. Thecorresponding differential interference contrast (DIC) images are shownin the insets. Nuclei are stained with DAPI. HDAC6 and Acα-tubulin areco-localized, although not uniformly, along the length of the flagellum.The co-localization of HDAC6 and Ac α-tubulin can be best appreciatedin the cut-mask images of the respective sperm. The co-localization isprominently seen in the mid-piece of caudal-sperm flagella. Bars 20 μm.The graphical representation of total signal intensities of HDAC6 and Ac

α-tubulin shows a significant decrease in HDAC6 expression in flagellarregion of caput sperm (Cp sp) and caudal sperm (Cd sp) as compared withtesticular sperm (T sp) and a significant increase in Ac α-tubulin in caputand caudal sperm as compared with testicular sperm (p). The graphicalrepresentation of Manders overlap coefficient shows a significant in-crease in the degree of overlap of HDAC6 and acetyl α-tubulin in caudalsperm as compared with testicular sperm and caput sperm (q). Theexperiment was performed twice on duplicate slides. Ten of each spermwere analysed for quantification of intensities. Statistical significance wasdetermined by using a one way analysis of variance (ANOVA) withsignificance level being set at P≤0.05. *, **, ***Significance of P≤0.05, P≤0.01, and P≤0.001, respectively. Values are mean±S.E.M.

Cell Tissue Res

Author's personal copy

performed only for the caput and caudal regions of epididymisas the corpus region is too narrow to be able to discernbetween the epithelium and lumen. In the epididymis of theadult rat, HDAC6 expression was observed mainly in thelumen of the caput (Fig. 2h, i) and caudal (Fig. 2j, k) regionindicating its presence in caput and caudal sperm. The specificlocalization of HDAC6 was also observed in the cytoplasm ofepithelial cells of the caput and caudal region of the epididy-mis (Fig. 2i, k). The staining intensity in caudal epithelial cellswas significantly higher than that in the caput epithelial cells(P≤0.001). Although an observable decrease appeared tooccur in the staining intensity in the luminal region of thecauda as compared with the caput, this was not statisticallysignificant (Fig. 2l).

Co-localization of HDAC6 and Ac α-tubulin in rat sperm

The possible overlapping distribution of the two proteinsHDAC6 and Ac α-tubulin was investigated in rat testicu-lar and caudal epididymal sperm. Whereas HDAC6 ex-pression was observed mainly in the mid-piece region(Fig. 3a), Ac α-tubulin expression was observed mainlytowards the end-piece region of the flagella in testicularsperm (Fig. 3b). In caput and caudal sperm, the expres-sion of HDAC6 was seen in the mid-piece and principalpiece region of sperm flagella (Fig. 3f, k), whereas Ac α-tubulin was localized throughout the flagella (mainly inthe mid- and end-piece of sperm flagella; Fig. 3g, l).Although the two proteins were co-localized in testicular,

caput and caudal sperm, the expression of HDAC6 andAc α-tubulin was not uniform along the length of theflagellum (Fig. 3d, l, n). The co-localization of HDAC6and Ac α-tubulin can be best appreciated in the cut-maskimages of the testicular, caput and caudal sperm (Fig. 3c,h, m). HDAC6 and Ac α-tubulin were co-localized main-ly in the mid-piece region of sperm flagella from testicu-lar to caudal sperm (Fig. 3c, d, h, i, m, n). A significantdecrease (P≤0.01) was observed in the signal intensity ofHDAC6 in caput and caudal sperm flagella as comparedwith that in testicular sperm flagella, whereas the signalintensity of Ac α-tubulin was significantly increased incaput (P≤0.05) and caudal (P≤0.001) sperm flagella withrespect to testicular sperm flagella (Fig. 3p). The overlapcoefficient between HDAC6 and Ac α-tubulin showed asignificant increase (P≤0.05) in caudal sperm flagellawith respect to caput and testicular sperm flagella(Fig. 3q).

Co-immunoprecipitation of HDAC6, α-tubulin and Acα-tubulin in sperm

HDAC6 and Ac α-tubulin are observed to be co-localized onthe flagella of testicular and caudal sperm. To ascertain thatHDAC6 and α - t ubu l i n i ndeed in t e r a c t ed , co -immunoprecipitation studies were carried out by using caudalsperm. HDAC6, α-tubulin, Ac α-tubulin and their respectiveinteracting proteins were immunoprecipitated by using theirrespective antibodies and probed for the presence of α-

Fig. 4 Interaction of HDAC6, α-tubulin and Ac α-tubulin in sperm. aHDAC6 interacting proteins from 200 μg caudal sperm lysate wereimmunoprecipitated by using rabbit polyclonal HDAC6 antibody (IPHDAC6) and probed with antibodies to α-tubulin (αT), Ac α-tubulin(Ac αT) and HDAC6 byWestern blot analysis. A band at ~55 kDa for α-and Ac α-tubulin and at ~130 kDa for HDAC6 can be seen. Immuno-precipitates pulled down by using the pre-immune sera (IP IgG) testednegative for all the three proteins. The lysates show the bands for

HDAC6 , α - t ubu l i n , and Ac α - t ubu l i n ( I npu t ) . b Co-immunoprecipitation of α-tubulin (IP αT) and Ac α-tubulin (IP Ac αT)interacting proteins from caudal sperm lysates by using respective mousemonoclonal antibodies and probed with antibodies to α-tubulin (αT), Acα-tubulin (Ac αT) and HDAC6 show a band at 55 kDa for α- and Ac α-tubulin and at 130 kDa for HDAC6 on Western blot analysis. None ofthese bands are seen in the eluted interactome of normal mouse IgG (IPIgG). The lysates show the bands for HDAC6 and α-tubulin (Input)

Cell Tissue Res

Author's personal copy

tubulin, Ac α-tubulin and HDAC6 in the eluted interactome.Bands for α-tubulin and Ac α-tubulin at ~55 kDa and forHDAC6 at ~130 kDa were identified in caudal sperm

immunoprecipitates for all three proteins. The eluted interac-tome of pre-immune sera/mouse IgG used to account for anynon-specificity did not show these bands (Fig. 4a, b).

Fig. 5 HDAC6 deacetylatesα-tubulin in sperm and regulates its motility.aHDAC6 enzyme assay shows deacetylase activity in sperm lysate in thepresence of Trichostatin A (TSA, 5 μM), Tubastatin A (TBSA, 5 μM) andsodium butyrate (NaB, 5 μM and 5 mM). A significant decrease indeacetylase activity of the sperm lysate is observed in the presence ofTSA (5 μM), TBSA (5 μM) and NaB (5 mM) with respect to the controland NaB (5 μM). The assay was performed three times with differentbiological replicates (AFU arbitrary fluorescence units). Statistical signif-icance was determined by one way ANOVAwith significance level beingset at P≤0.05. Values are mean±S.E.M. b Flow cytometry analysisshowing the effect of TSA (5 μM), TBSA (5 μM) and NaB (5 μM and5 mM) on α-tubulin acetylation. A significant increase in Ac α-tubulin is

seen only in sperm treated with TBSA (5 μM) as compared with controland NaB (5 mM). The data represents mean±S.E.M. of four experiments,each in duplicate. c Effect of TSA (5μM), TBSA (5 μM) and NaB (5 μMand 5 mM) on progressive motility of sperm. A significant decrease isobserved in progressive motility of sperm treated with TBSA (5 μM) ascomparedwith control, TSA (5 μM) and NaB (5μMand 5mM). d Effectof the inhibitors on beat frequency of sperm. Beat frequency is signifi-cantly increased in sperm treated with TBSA (5 μM) as compared withTSA (5 μM) and control. Other motility parameters, namely those of pathvelocity, progressive velocity and track speed (e) and those of lateralamplitude, straightness and linearity (f), were not altered. *P≤0.05, **P≤0.01, ***P≤0.001

Cell Tissue Res

Author's personal copy

Impact of HDAC6 in α-tubulin acetylation and spermmovement

HDAC inhibitors were used to determine whether theenzyme was catalytically active in sperm and whetherdeacetylation had any influence on sperm motility.Deacetylase activity was measured by using the Fluor-de-Lys HDAC6 fluorimetric drug discovery kit. This kitallowed the determination of the general deacetylase ac-tivity of sperm lysates by using Fluor de Lys SIRT1 assubstrate. Whether this activity was attributable toHDAC6 or any other HDAC present or to a combinationof both in the sperm lysate was discerned by using thethree inhibitors; a general HDAC inhibitor (TSA at5 μM), an HDAC6 specific inhibitor (TBSA at 5 μM)and an inhibitor to which HDAC6 is resistant (NaB at5 μM and 5 mM). Sperm lysates used as the source of theenzyme were incubated with 10 μM Fluor de Lys SIRT1in the absence or presence of the inhibitors at 37 °C for2.5 h. The deacetylase activity was significantly inhibitedwith 5 μM TSA and TBSA and 5 mM NaB as comparedwith the control and with 5 μM NaB (Fig. 5a).

Rat caudal sperm were incubated with 5 μM TSA,TBSA (5 μM) or NaB (5 μM or 5 mM) and effect ofthese inhibitors on α-tubulin acetylation and on spermmotility parameters were investigated. Sperm viabilitywas verified and was approximately 80 % in all groups.Acetylation of α-tubulin in these sperm was determinedby flow cytometry analysis. α-Tubulin acetylation wassignificantly increased in sperm treated with TBSA ascompared with the control and 5 mM NaB (Fig. 5b), i.e.the acetylation of α-tubulin was significantly lower with5 mM NaB compared to that of TBSA. The signal inten-sities in sperm treated with TSA and NaB were compara-ble with that of the control. Progressive motility wassignificantly reduced in sperm treated with TBSA ascompared with the control, TSA and both concentrationsof NaB (Fig. 5c). Beat frequency in contrast was signifi-cantly higher in TBSA treated sperm as compared withthe control and TSA (Fig. 5d). Other motility kineticsparameters, namely path velocity, progressive velocity,track speed, lateral amplitude, straightness and linearity,were not affected by any of the inhibitors (Fig. 5e, f).Studies to determine the status of HDAC6 and Ac α-tubulin localization in sperm treated with the above-mentioned inhibitors showed an apparent increase in theexpression of Ac α-tubulin in the sperm incubated withTSA and TBSA (Fig. 6f, j, respectively). However, anapparent increase in HDAC6 localization on the flagellawas also noted in sperm treated with the HDAC6-specificinhibitor TBSA (Fig. 6i). Relatively weak staining forHDAC6 on the flagella was seen in the TSA- and NaB-treated sperm (Fig. 6e, m, respectively).

Discussion

Reversible acetylation of α-tubulin has been implicated in theregulation of microtubule stability and function (LeDizet andPiperno 1987). HDAC6 has been identified as an α-tubulindeacetylase and its overexpression leads to the deacetylationof α-tubulin and promotes chemotactic cell movementsupporting the idea that HDAC6-mediated deacetylation reg-ulates microtubule-dependent cell motility (Hubbert et al.2002). Analogous to this, the deacetylation of α-tubulin inthe microtubules of sperm flagella might regulate sperm mo-tility; this is the hypothesis tested in this study. The availableliterature demonstrates the presence of HDAC6 in testiculartissue (Hazzouri et al. 2000; Seigneurin-Berny et al. 2001).We have now shown the presence of the HDAC6 transcriptand protein in rat testicular and caudal sperm (Fig. 1b, c). Thisis a novel observation as the presence of HDAC6 has not beenpreviously reported on sperm. We have further observed that,as sperm mature, the acetylation of α-tubulin increases.HDAC6 expression, although reduced, persists in maturesperm (Fig. 3a–p).

Investigating the ontogenic expression of HDAC6 inrat testis, we have observed the presence of its transcriptand protein right from birth until adulthood (data notshown). In adult testis, it is present in round, elongatingand elongated spermatids. Its localization in adult epidid-ymis in the lumen of the caput and caudal region indicatesits presence on epididymal sperm. A significant increasehas been observed in the localization of HDAC6 in caudalepithelial cells as compared with that in caput epithelialcells (Fig. 2). As a part of the ubiquitinylation complex,HDAC is involved in the cellular management ofmisfolded proteins with the help of its ubiquitin-bindingdomain (Kawaguchi et al. 2003). The increased HDAC6expression in the caudal epithelial cells might reflect itsrole in the degradation of misfolded or unfolded proteinsderived from defective sperm phagocytosed by the epi-didymal epithelial cells (Sutovsky et al. 2001).

HDAC6 and Ac α-tubulin have been observed to beincreasingly co-localized in the flagella of testicular andcaudal sperm. Notably, the overlap coefficient is signifi-cantly higher in the caudal sperm in comparison with thatin testicular and caput sperm (Fig. 3). The significant co-

�Fig. 6 Localization of HDAC6 in sperm treated with HDAC inhibitors.Localization of HDAC6 (a, e, i,m) and Ac α-tubulin (b, f, j, n) togetherwith composite images (d, h, l, p) and after counterstaining with DAPI (c,g, k, o) in control (a-d) and in sperm treated with TSA (e-h), TBSA (i-l)or NaB (m-p). Despite being inhibited by its specific inhibitor (TBSA),HDAC6 persists on flagella. The relatively weak expression of HDAC6in the TSA- and NaB-treated sperm suggests that HDAC6 is able todissociate from the microtubules in the presence of these inhibitors. Acomposite image of the respective negative control is shown in q.Respective DIC images are shown in the insets. Bar 20 μm

Cell Tissue Res

Author's personal copy

Cell Tissue Res

Author's personal copy

localization of HDAC6 and Ac α-tubulin in caudal spermand the co-elution of α-tubulin, Ac α-tubulin and HDAC6as seen from the pull-down experiments (Fig. 4) demon-strate that the two proteins interact. These data suggest thatdynamic deacetylation and acetylation of α-tubulin occursin mature sperm. The interaction of HDAC6 with α- andβ-tubulin has been reported previously in NIH 3 T3 cells(Zhang et al. 2003).

To determine the specificity and relevance of theHDAC6/α-tubulin interaction, we incubated caudal spermwith inhibitors TSA, which inhibits all HDACs (Yoshidaet al. 1990), TBSA, which specifically inhibits HDAC6(Butler et al. 2010), or NaB to which HDAC6 is resistant(Candido et al. 1978; Kruh 1982), and assessed the effectof these inhibitors on sperm motility and α-tubulin acety-lation. In order to determine HDAC6 activity, sperm ly-sates were incubated with the inhibitors as described earli-er. At equimolar concentrations, HDAC6 activity was sig-nificantly inhibited in the presence of TBSA and TSA, ascompared with the control and NaB (5 μM). When NaBwas used at a concentration of 5 mM, the deacetylaseactivity was inhibited significantly compared with the con-trol and 5 μM NaB (Fig. 5a). Notably, with respect to thedeacetylase activity assay, the kit used allows the determi-nation of the total deacetylase activity of sperm lysates byusing Fluor de Lys SIRT1 as the substrate (SIRT1 is asubstrate for most Class 1 and Class 2b HDACs).Whether this activity is attributable to HDAC6 or any otherHDAC present or a combination of both in the sperm lysatewas discerned by using the three inhibitors, namely TSA,TBSA and NaB. As this activity was measured by usingacetylated SIRT1 peptide (Fluor de Lys SIRT1) as a sub-strate, we saw an enhanced reduction of activity with TSAcompared with TBSA suggesting the presence of otherHDACs. However, this was not statistically significant.With NaB (5 μM), we see HDAC6 activity that is compa-rable with that in the control. Interestingly, with NaB at aconcentration of 5 mM, deacetylase activity was signifi-cantly inhibited compared with the control and 5 μM NaB,further substantiating the contribution of other HDACs,most likely HDAC1, which is a known histone-specificdeacetylase and which has earlier been reported in thetestis during spermatogenesis (Hazzouri et al. 2000).Whereas the inhibition of deacetylase activity with 5 μMTSA and 5 mM NaB suggests the presence of otherHDACs in sperm, the inhibition of deacetylase activitywith 5 μM TBSA certainly demonstrates the presence ofcatalytically active HDAC6 in sperm. Sperm progressivemotility was significantly inhibited by TBSA with respectto the control, TSA and NaB (5 μM and 5 mM). Of note,motility in presence of NaB was comparable with that inthe control and significantly increased compared with thatin TBSA. The finding that HDAC6 is resistant to inhibition

by NaB only consolidates our observations with TBSA(Fig. 5c). A significant increase in the signal intensity forAc α-tubulin as determined by flow cytometry and as alsoapparent by IIF has been observed in sperm treated withTBSA (Figs. 5b,d 6j). An anticipated decrease in motilityand increase in acetylation of α-tubulin was not observedwith TSA at the concentration used, although, at this dose,deacetylase activity was inhibited. As a general HDACinhibitor, TSA would probably be needed at much higherconcentrations to inhibit HDAC6 specifically (Butler et al.2010). Additionally, whereas activity was studied by usingsperm lysate, an effect on motility and Ac α-tubulin ex-pression was studied by using intact sperm. This meansthat, in the lysate, the drugs had direct access to HDAC6/other HDACs, whereas in the intact sperm, the drugs had topenetrate the membrane to access its site of action.Notably, the acetylation of the α-tubulin was significantlylower with 5mM NaB compared with that with TBSA.Given that HDAC6 is resistant to inhibition by NaB, thisobservation in conjunction with the significantly increasedacetylation seen with the HDAC6-specific inhibitor TBSAprovides evidence that HDAC6 regulates a tubulin acety-lation in sperm. At equimolar concentrations, an effect onprogressive motility, beat frequency and increase in a tu-bulin acetylation is observed to be significant only with theHDAC6-specific inhibitor TBSA. Neither with TSA norNaB was motility affected, even at the 5mM concentrationof NaB, thereby providing evidence suggesting thatHDAC6 deacetylates α-tubulin in sperm and is involvedin modulating sperm movement. Intriguingly, an increasedintensity for HDAC6 localization on the sperm flagella wasseen in the TBSA treated sperm (Fig. 6i). This suggeststhat, although the HDAC6-specific inhibitor reducesHDAC6 activity, as can be seen from Fig 5a, it preventsdissociation of HDAC6 from the microtubules, as a con-sequence of which HDAC6 persists on the flagella. Therelatively weak expression of HDAC6 in the untreated(Control), TSA and NaB-treated sperm (Fig 6a, e, m)indicates that HDAC6 is able to dissociate from the micro-tubules in the presence of these inhibitors. On inhibition byTBSA, HDAC6 possibly undergoes a conformationalchange that prevents its dissociation from its binding siteon the microtubule, thus physically blocking the site. Thiscreates stearic hindrance for other MAPs to bind to themicrotubules, thereby interfering with their molecular pro-cesses, with a consequent affect on sperm movement. Ourpresent study shows that, with regard to the pharmacolog-ical inhibition of HDAC6 activity in sperm, α-tubulinacetylation increases and sperm motility decreases. Workby Zilberman et al. (2009) in B16F1 cells has demonstratedthat, whereas HDAC6 knockdown does not affect micro-tubule dynamics, HDAC6 with impaired enzymatic activ-ity can influence microtubule stability. A similar study in

Cell Tissue Res

Author's personal copy

MCF-7 cells has shown that the inhibition of HDAC6deacetylase activity increases its binding with microtu-bules leading to increased acetylation of α-tubulin andincreased stability of the microtubules (Asthana et al.2013). Observations from α-tubulin acetyltransferase 1(Atat1) knockout mice indicate that, although these miceare viable and develop normally, they exhibit significantlyreduced sperm motility and fertility. Thus, although acety-lation of α-tubulin is absent, microtubule stability in-creases (Kalebic et al. 2013b). The status of HDAC6 inthese mice is not known. Our data from individuals withpoor sperm motility show significantly reduced acetylationof α-tubulin in the sperm of these individuals (Bhagwatet al. 2014). In both cases, acetylation and sperm motilityare reduced. The status of HDAC6 in these individuals isbeing investigated.

Taken together, these data suggest that the acetylation statusmight not be the determinant of sperm motility. We proposethat, instead, the stability of the microtubules defines spermmotility; the more stable the microtubules are, the lower theflagellar motility is. The persistent association of HDAC6 withthe flagella, even in the presence of HDAC6 inhibitor as seen inour study, and the increased binding of HDAC6 with microtu-bules in the presence of the inhibitor and the consequent in-crease in stability of these microtubules reported in the B16F1cells (Zilberman et al. 2009) and MCF7 cells (Asthana et al.2013) suggests that HDAC6 functions as a MAP and plays animportant role in maintaining the dynamic instability in thesperm flagellar microtubules. Recently, MAP7 domain-containing protein 3 (Mdp3) has been shown to regulateHDAC6 activity and control microtubule stability through itsbinding to tubulin and microtubules (Tala et al. 2014). Wepropose that dynamic instability exists in sperm and is essentialfor normal sperm motility; investigations on this aspect areongoing.

In summary, we have demonstrated that (1) an activeHDAC6 enzyme is present in sperm, (2) HDAC6 in spermis able to deacetylate α-tubulin, (3) the inhibition of HDAC6activity results in increased α-tubulin acetylation and (4)HDAC6 inhibition affects sperm motility. These pieces ofevidence suggest that HDAC6 is the α-tubulin-specificdeacetylase in sperm and is involved in modulating spermmovement.

Acknowledgments The authors acknowledge with gratitude the assis-tance of Ms G. Bhonde with the design of the HDAC6 peptide forantibody generation. They thank Mr S. Jadhav and D. Gaikwad for theirhelp in animal handling and generation of the antibody and Ms S.Sonawane for her help with confocal microscopy. The assistance of Dr.G. Vanage, Mr P. Salunkhe, Mr M. Ghosalkar (Histological TissueProcessing and Sectioning and the CASA facility), Mr S. Mandavkar(Cryosectioning), Dr. S. Mukherjee, Ms G. Shinde and Ms S. Khavle(Flow Cytometry Facility) is gratefully acknowledged. The authors arealso thankful to Dr. Shahina Begum for her assistance with the statisticalanalysis.

References

Akella JS, Wloga D, Kim J, Starostina NG, Lyons-Abbott S, MorrissetteNS, Dougan ST, Kipreos ET, Gaertig J (2010) MEC-17 is an alpha-tubulin acetyltransferase. Nature 467:218–222

Asthana J, Kapoor S, Mohan R, Panda D (2013) Inhibition of HDAC6deacetylase activity increases its binding with microtubules andsuppresses microtubule dynamic instability in MCF-7 cells. J BiolChem 288:22516–22526

Bhagwat S, Dalvi V, Chandrasekhar D, Matthew T, Acharya K, GajbhiyeR, Kulkarni V, Sonawane S, Ghosalkar M, Parte P (2014)Acetylated alpha-tubulin is reduced in individuals with poor spermmotility. Fertil Steril 101:95–104

BradfordMM (1976) A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal Biochem 72:248–254

Butler KV, Kalin J, Brochier C, Vistoli G, Langley B, Kozikowski AP(2010) Rational design and simple chemistry yield a superior, neu-roprotective HDAC6 inhibitor, tubastatin A. J Am Chem Soc 132:10842–10846

Candido EP, Reeves R, Davie JR (1978) Sodium butyrate inhibits histonedeacetylation in cultured cells. Cell 14:105–113

Creppe C, Malinouskaya L, Volvert ML, Gillard M, Close P, Malaise O,Laguesse S, Cornez I, Rahmouni S, Ormenese S, Belachew S,Malgrange B, Chapelle JP, Siebenlist U, Moonen G, Chariot A,Nguyen L (2009) Elongator controls the migration and differentia-tion of cortical neurons through acetylation of alpha-tubulin. Cell136:551–564

Gagnon C, White D, Cosson J, Huitorel P, Edde B, Desbruyeres E,Paturle-Lafanechere L, Multigner L, Job D, Cibert C (1996) Thepolyglutamylated lateral chain of alpha-tubulin plays a key role inflagellar motility. J Cell Sci 109:1545–1553

Gentleman S, Kaiser-Kupfer MI, Sherins RJ, Caruso R, Robison WG Jr,Lloyd-Muhammad RA, Crawford MA, Pikus A, Chader GJ (1996)Ultrastructural and biochemical analysis of sperm flagella from aninfertile man with a rod-dominant retinal degeneration. Hum Pathol27:80–84

Hazzouri M, Pivot-Pajot C, Faure AK, Usson Y, Pelletier R, Sele B,Khochbin S, Rousseaux S (2000) Regulated hyperacetylation ofcore histones during mouse spermatogenesis: involvement of his-tone deacetylases. Eur J Cell Biol 79:950–960

Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, Nixon A, YoshidaM, Wang XF, Yao TP (2002) HDAC6 is a microtubule-associateddeacetylase. Nature 417:455–458

Kalebic N, Martinez C, Perlas E, Hublitz P, Bilbao-Cortes D, FiedorczukK, Andolfo A, Heppenstall PA (2013a) Tubulin acetyltransferasealphaTAT1 destabilizes microtubules independently of its acetyla-tion activity. Mol Cell Biol 33:1114–1123

Kalebic N, Sorrentino S, Perlas E, Bolasco G, Martinez C, HeppenstallPA (2013b) AlphaTAT1 is the major alpha-tubulin acetyltransferasein mice. Nat Commun 4:1962

Kawaguchi Y, Kovacs JJ, McLaurin A, Vance JM, Ito A, Yao TP(2003) The deacetylase HDAC6 regulates aggresome formationand cell viability in response to misfolded protein stress. Cell115:727–738

Kruh J (1982) Effects of sodium butyrate, a new pharmacological agent,on cells in culture. Mol Cell Biochem 42:65–82

Laemmli UK (1970) Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 227:680–685

LeDizet M, Piperno G (1987) Identification of an acetylation site ofChlamydomonas alpha-tubulin. Proc Natl Acad Sci U S A 84:5720–5724

Malkov M, Fisher Y, Don J (1998) Developmental schedule of thepostnatal rat testis determined by flow cytometry. Biol Reprod 59:84–92

Cell Tissue Res

Author's personal copy

Matsuyama A, Shimazu T, Sumida Y, Saito A, Yoshimatsu Y,Seigneurin-Berny D, Osada H, Komatsu Y, Nishino N,Khochbin S, Horinouchi S, Yoshida M (2002) In vivo destabili-zation of dynamic microtubules by HDAC6-mediateddeacetylation. EMBO J 21:6820–6831

North BJ,Marshall BL, BorraMT, Denu JM, Verdin E (2003) The humanSir2 ortholog, SIRT2, is an NAD+−dependent tubulin deacetylase.Mol Cell 11:437–444

Ohkawa N, Sugisaki S, Tokunaga E, Fujitani K, Hayasaka T, Setou M,Inokuchi K (2008) N-acetyltransferase ARD1-NAT1 regulates neu-ronal dendritic development. Genes Cells 13:1171–1183

Palazzo A, Ackerman B, Gundersen GG (2003) Cell biology: tubulinacetylation and cell motility. Nature 421:230

Rice P, Longden I, Bleasby A (2000) EMBOSS: the European molecularbiology open software suite. Trends Genet 16:276–277

Seigneurin-Berny D, Verdel A, Curtet S, Lemercier C, Garin J,Rousseaux S, Khochbin S (2001) Identification of components ofthe murine histone deacetylase 6 complex: link between acetylationand ubiquitination signaling pathways.Mol Cell Biol 21:8035–8044

Shen Q, Zheng X, McNutt MA, Guang L, Sun Y, Wang J, Gong Y, HouL, Zhang B (2009) NAT10, a nucleolar protein, localizes to themidbody and regulates cytokinesis and acetylation of microtubules.Exp Cell Res 315:1653–1667

Suryawanshi AR, Khan SA, Gajbhiye RK, Gurav MY, Khole VV (2011)Differential proteomics leads to identification of domain-specificepididymal sperm proteins. J Androl 32:240–259

Sutovsky P, Moreno R, Ramalho-Santos J, Dominko T, Thompson WE,Schatten G (2001) A putative, ubiquitin-dependent mechanism for

the recognition and elimination of defective spermatozoa in themammalian epididymis. J Cell Sci 114:1665–1675

Tala, Sun X, Chen J, Zhang L, Liu N, Zhou J, Li D, Liu M (2014)Microtubule stabilization by Mdp3 is partially attributed to its mod-ulation of HDAC6 in addition to its association with tubulin andmicrotubules. PLoS One 9:e90932

Upadhyay R, D’Souza R, Sonawane S, Gaonkar R, Pathak S,Jadhav A, Balasinor NH (2011) Altered phosphorylation anddistribution status of vimentin in rat seminiferous epitheliumfollowing 17beta-estradiol treatment. Histochem Cell Biol 136:543–555

Yoshida M, Kijima M, Akita M, Beppu T (1990) Potent and specificinhibition of mammalian histone deacetylase both in vivo andin vitro by trichostatin A. J Biol Chem 265:17174–17179

Zhang Y, Li N, Caron C, Matthias G, Hess D, Khochbin S, Matthias P(2003) HDAC-6 interacts with and deacetylates tubulin and micro-tubules in vivo. EMBO J 22:1168–1179

Zhang Y, Kwon S, Yamaguchi T, Cubizolles F, Rousseaux S, KneisselM, Cao C, Li N, Cheng HL, Chua K, Lombard D, Mizeracki A,Matthias G, Alt FW, Khochbin S, Matthias P (2008) Mice lackinghistone deacetylase 6 have hyperacetylated tubulin but are viableand develop normally. Mol Cell Biol 28:1688–1701

Zhao Z, Xu H, Gong W (2010) Histone deacetylase 6 (HDAC6) is anindependent deacetylase for alpha-tubulin. Protein Pept Lett 17:555–558

Zilberman Y, Ballestrem C, Carramusa L, Mazitschek R, Khochbin S,Bershadsky A (2009) Regulation of microtubule dynamics by inhi-bition of the tubulin deacetylase HDAC6. J Cell Sci 122:3531–3541

Cell Tissue Res

Author's personal copy