Histopathology and molecular diagnosis of corneal infections

MINI-SYMPOSIUM: OCULAR PATHOLOGY

Histopathology andmolecular diagnosis ofcorneal infectionsGeeta K Vemuganti

Somasheila I Murthy

Savitri Sharma

AbstractInfectious keratitis is an important cause of visual loss worldwide. Clinical

diagnosis in the past was often supported only by microbiology and

pathology to a lesser extent. Recent advances in the histological and

molecular diagnosis of corneal infections have resulted in rapid and accu-

rate diagnosis of the infectious agent. This review will provide an over-

view of the various corneal infections, with emphasis on

histopathologic and molecular diagnosis. This is more so in cases

where microbiology, the gold standard for corneal infections, comes out

as negative. Thus a cumulative input from clinical, microbiology, histopa-

thology and molecular methods of diagnosis not only helps in treating the

patients but also contributes to better understanding of the disease

process and paves the way to evaluate the emerging modalities of treat-

ment like disease modifying medications, biomaterials and surgical

techniques.

Keywords corneal histopathology; corneal infiltrate; microbial keratitis;

molecular diagnosis; polymerase chain reaction

Introduction

Microbial keratitis is an important cause of ocular morbidity

worldwide, the outcome of which depends on early diagnosis,

prompt and effective treatment and various host and agent

factors.1 Some of the common causes of corneal infections

include bacterial, fungal, viral, and protozoan, the diagnosis of

which is made on clinical examination aided by microbiological

demonstration in smears or cultures from corneal tissues. In

advanced cases however, therapeutic or diagnostic indications

necessitate procedures like corneal biopsy, penetrating

Geeta K Vemuganti MD DNB FAMS is Head of Ophthalmic Pathology

Laboratory and Sudhakar and Sreekant Ravi Stem Cell Biology Labo-

ratory at L V Prasad Eye Institute, Hyderabad, India. Conflicts of

interest: none declared.

Somasheila I Murthy MS is a Consultant at the Cornea and Anterior

Segment Service, at L V Prasad Eye Institute, Hyderabad, India.

Conflicts of interest: none declared.

Savitri Sharma MD MAMS Associate Director & Head, Microbiology

Services-LVPEI, Network, L V Prasad Eye Institute, Patia, Bhubaneswar,

751 024. Conflicts of interest: none declared.

DIAGNOSTIC HISTOPATHOLOGY 17:1 17

keratoplasty or even evisceration of the eye, which thus provides

an opportunity to the pathologist to aid in early diagnosis and

thus initiation of early treatment. Histological evaluation and

molecular methods not only aid in diagnosis but also improve

our understanding of the disease pathogenesis of this unique

avascular, unarmed, and transparent tissue. This chapter

provides a brief outline of clinical features and treatment of

specific infections with emphasis on histopathology and molec-

ular methods of diagnosis.

Histopathology of corneal infections: general considerations

Unlike other tissues of the body where orientation is not a big

concern, corneal tissues require edge embedding to retain proper

orientation of corneal layers. Histological features of infectious

keratitis reflect the features seen on slit lamp examination or by

confocal examination of the eye. The severity of the disease

process, rate of progression, response to treatment, complica-

tions differ in different types of corneal infections. However, in

general, uncontrolled infections usually go through the phase of

epithelial ulceration, destruction of Bowman’s layer, stromal

infiltration by polymorphonuclear (PMN) and lymphomononu-

clear cells, necrosis of stroma, breakdown of Descemets

membrane, and ultimately perforation of cornea. Suppurative

infections like bacterial and fungal lead to infiltrates in anterior

2/3 of stroma and abscess formation. Chronic infections show

epithelial regeneration, vascularization, edema, giant cell reac-

tion, myofibroblastic transformation and stromal remodelling

(scarring) and round cell infiltration. Table 1 provides a guideline

on evaluation of corneal layers in infectious keratitis. In addition

to routine haematoxylin and eosin (H & E) and periodic acid

Schiff’s stain (PAS); appropriate special stains are useful in

identifying the organisms.

Histopathology of specific infections

Bacterial keratitis

Clinical presentation and treatment: predisposing factors

include ocular trauma or injury, contaminated water and eye

drops, contact lens use, post-surgery, epithelial defects, ocular

surface disease and systemic conditions.1 Only a few microor-

ganisms, notably Neisseria gononorrhoea can penetrate intact

epithelium. Etiologic agents include gram-positive bacteria like

Staphylococcus and Streptococcus. Pseudomonas and other

Enterobacteriaceae are the primary gram-negative pathogens

involved in microbial keratitis. Gram-negative infection shows

relatively a rapid pace of inflammation, often leading to severe

corneal abscess and perforation with hypopyon. For infection

with gram-positive organisms, fortified cefazolin is the treatment

of choice. For other bacteria, and gram-negative bacteria, cipro-

floxacin or fourth generation fluoroquinolones are agents of

choice. If diagnosed early, the infection can be limited and topical

corticosteroids can be commenced once the culture-sensitivity is

available. Rapid thinning often necessitates tissue adhesive

application. In general, therapeutic keratoplasty is required far

less often than in fungal keratitis and has a fair prognosis.

Histopathology: bacterial infections result in epithelial ulcera-

tion, with destruction of Bowman’s layer and anterior stroma

with severe and diffuse infiltration by PMNs. The stromal

� 2010 Elsevier Ltd. All rights reserved.

http://dx.doi.org/10.1016/j.mpdhp.2010.10.001

Summary of histologic features of corneal infections

Anatomic layer Histologic features to be observed Remarks

General features Thickness, thinning, necrosis, perforation, separation, exudates,

pigmentation.

Epithelium Intactness, edema, ulceration, hyperplasia, downgrowths

inflammatory infiltrates, giant cell reaction, cytoplasmic inclusions

regularity/breaks of basement membrane, pannus formation

(inflammatory or degenerative).

Periodic acid Schiff’s (PAS) stain is

complementary to Haematoxylin and Eosin.

Bowman’s layer Thickness, breaks, absence, calcification, degenerative changes,

any deposits.

Special stains as and when required.

Stroma Thinning, edema, vascularization, inflammation and density and

type of inflammatory cells (neutrophils, lymphocytes, plasma cells,

giant cells), location of cells (anterior/mid/posterior stroma),

perforation, cellularity, changes in keratocytes (myofibroblastic

transformation, loss of keratocytes) orientation of collagen fibres,

fibrosis, scarring, abnormal deposits, any infectious agent and its

load and location.

Special stains as and when required for

fungus, bacteria, Acanthamoeba and

microsporidia.

Descemet’s membrane

(DM) & endothelium

Thin, fragmented or intact.

Giant cell reaction around DM, granulomatous inflammation around

fragmented ends.

Presence of microorganisms (like fungus), presence and adequacy

of endothelial cells, morphology of endothelial cells, retrocorneal

membrane and exudates adherent to DM, anterior chamber

exudates.

PAS stain, GMS.

Others Adherent uveal tissue, AC exudates.

Table 1


thinning and destruction is contributed by collagenolytic

enzymes released by the PMNs and bacterial endotoxins which

leave behind nuclear debris. If left unattended, it results in

perforation with herniation of iris into the site formatting

a pseudocornea. Cyanoacrylate glue, if applied, could be seen

as refractile wavy unstained glue on the surface of cornea

with scalloping margins, appreciated better with the lowered

condenser of the microscope. Bacteria on histologic sections are

appreciated when present in colonies and with the use of Gram’s

stain. Unusual patterns of bacterial keratitis can be seen in

infectious crystalline keratitis, commonly seen in corneal grafts

or with the use of steroids. Bacterial colonies develop a biofilm

thus appearing as discrete and viable colonies with fine, needle

like extensions within the corneal stroma, (resembling crystals)

with minimal stromal inflammation. The most common

organism implicated is alpha-haemolytic streptococcus.1

Fungal keratitis

Clinical presentation and treatment: fungal keratitis is a major

blinding disease and accounts for upto 44% of central corneal

ulcers in South India.2 Organisms commonly implicated are

Aspergillus sp., Fusarium sp., Penicillium sp. and Candida sp.

Dematiaceous fungi include Curvularia sp.2 Approximately half

do not respond to medical therapy and need surgical interven-

tion. Predisposing factors include: trauma (vegetative matter),

contact lenses, post-surgery (after PK), use of corticosteroids and

chronic keratitis like viral keratitis. Large dry raised infiltrate

with feathery or hyphate margins is pathognomic of this


infection.2 Diagnosis is based on identification of septate hyaline

filaments on Gram’s stain fluorescent filaments on potassium

hydroxide calcofluor white preparation (KOHeCW) and fungal

growth on most media. Confocal scan is a promising modality for

the in-vivo diagnosis of fungal keratitis, especially in deep seated

keratitis. Intensive medical therapy with topical natamycin or

amphotericin B is successful in anterior stromal infection.

Advanced disease necessitates therapeutic penetrating kerato-

plasty with recent trends favoring lamellar keratoplasty which

involves removal of only the anterior corneal lamella leaving

behind the posterior stroma and Descemet’s. While this is an

advantage for many corneal diseases, presence of fungus in

posterior stroma, Descemet’s and anterior chamber hampers its

use in severe fungal keratitis.

Histopathology: corneal epithelium is usually ulcerated, accom-

panied by edema, severe inflammation and stromal thinning.

Density and extent of inflammation, necrosis depends on the mode

of injury, duration of insult, treatment received and the local and

systemic condition of the host. We observed that in the early stages

the inflammation is focal, patchy and mostly involves the anterior

2/3rds of the stroma; with satellite lesions or abscesses in the

surrounding stroma. The posterior stromawhen affectedmay show

loss of stromal keratocytes due to apoptosis (Figure 1b). Later these

abscesses become confluent, extend to deep stroma, and lead to

total destruction of stromal architecture with necrosis and perfo-

ration. Predominantly deep-seated lesions along with anterior

chamber exudates and hypopyon, with relative sparing of



a DALK specimen in fungal keratitis shows ulceration of epithelium, stromal edema, and diffuse stromal infiltration. H & E stain 10�.

b Dense anterior stromal infiltrates in a case of fungal keratitis. Note the absence of inflammatory cells in the deeper stroma. H & E stain 10�.

c The deeper section of the DALK specimen shows deep stroma and Descemet’s membrane invaded by fungal filaments (unstained segments).

PAS 100�. d The fungal filaments are seen in the anterior chamber exudates, beyond the DM. GMS stain, 100�.

Figure 1


superficial stroma are noted in a few cases. Some of the cases could

represent fungal keratitis superadded to a pre-existing viral infec-

tion. Granulomatous inflammation or giant cell reaction has been

reported in 14% of cases.3 Fungus on routine stains appears as

hollow, unstained filaments with two parallel borders. Identifica-

tion is easier with special stains (PAS, GMS) which highlight the

hyphate filaments, measuring upto 10 m in diameter, and of varying

lengths. The fungal filaments may appear as long filaments with

septae and branching, or as short fragmented filaments, as rounded

structures (end-on view) and are found in any or all corneal layers

including DM and endothelial exudates (Figure 1c, d).

Although histopathology with special stains has a high yield in

the detection of fungus, it may be negative in 1/3rd of cases,

especially in late stages of disease. This may be either simply

because of sampling error or due to elimination of the fungus by

prior medical therapy.6 We also observed an interesting associa-

tion between inflammatory cells and fungus distribution. Fewer

filaments are seen in the region of dense inflammation whereas

high concentration is noted more commonly beyond the zone of

inflammation, into the posterior stroma, suggesting that fungus

would penetrate beyond the clinically evident zone of infiltration.

Other changes found in fungal keratitis are granulomatous

inflammation, especially in the posterior stroma, vascularization


in advanced disease and satellite lesions. An interesting variant of

fungal infection is dematiaceous fungal keratitis, which presents

like a dry raised pigmented plaque on the surface of cornea.4 The

excised plaque shows a carpet-like growth of filaments on the

surfacewith variable pigmentationwhich can be identified even in

H & E, with minimal inflammation and necrosis.

Viral keratitis

Herpes simplex virus (HSV) serotypes 1, 2 commonly affect the

cornea. Involvement ranges from epithelial disease (dendritic

ulcer) to stromal keratitis, endotheliitis, keratouveitis and meta-

herpetic keratitis.5 Healing is invariably by scarring and vascu-

larization, and visual rehabilitation includes penetrating

keratoplasty. Graft failure is not infrequent and is secondary to

rejection or recurrence of viral disease. Stromal disease can be

primary or secondary manifestation of infection. Primary forms

of stromal disease from HSV include necrotizing stromal keratitis

(NSK) and immune stromal keratitis (ISK).

Necrotizing stromal keratitis: direct invasion and replicating

virus and severe host inflammatory response leads to destructive

stromal inflammation that is often refractory to treatment. Single

or multiple, grey-white, creamy homogenous abscesses with



a Stromal neovascularization, patchy lymph-plasmacytic infiltrates and stromal scarring in a case of chronic viral keratitis. b Subepithelial pannus,

fragmentation of Bowman’s layer, activated keratocytic nuclei and prominent focal infiltrate in stroma.

Figure 2


edema, secondary guttate, severe iridocyclitis, hypopyon and

secondary glaucoma are noted.

Histopathology of NSK: corneal epithelium may be intact or

ulcerated. Neutrophilic stromal infiltrates can be focal, diffuse or

stratified or coalescent abscesses; depending upon severity of

inflammation.

Epithelial regeneration, round cell infiltrates with multinu-

cleate giant cells (MNG) with or without inclusion bodies, could

be around the DM, is indicative but not diagnostic of HSV.

Stromal edema and DM folds are noted. In extreme cases, intense

stromal loss and necrosis can lead to descemetocele or perfora-

tion. Vascularization is a prominent feature, seen at any level,

progressing towards the site of active inflammation. In NSK, HSV

antigen have been documented in epithelial cells and to some

extent in keratocytes, endothelial cells, and in MNG cells around

DM. Electron microscopy can detect intact viruses.6

Immune stromal keratitis (ISK): ISK may be a continuum of

NSK and is a chronic recurrent manifestation, occurring in 20%

of population with ocular disease. It is predominantly immune

mediated although direct invasion and active replication of virus

may play a role.6 The mechanism of inflammation is thought to

be due to retained viral antigen within the stroma that triggers

antigeneantibodyecomplement cascade (AAC) that results in

intrastromal inflammation. Evidence also suggests that HSV-1

disrupts the normal equilibrium between angiogenic and anti-

angiogenic stimuli leading to vascularization.

Histopathology of ISK: since this entity is more due to the persis-

tence of inflammation, epithelium is usually intact with minimal

inflammation. Stromal mixed inflammatory infiltrates of varying

degree could be focal,multifocal or diffuse, associatedwith stromal

edema. Rapid neovascularization with multiple fronds of new

vessels or ghost vessels with perivascular cuffing is a common

feature (Figure 2a). Other changes suggestive of its chronicity are

ingrowth of pannus, fragmented Bowman’s membrane, lipid ker-

atopathy, stromal scarring, granulomatous reaction around DM,

duplication of DM and retrocorneal membrane (Figure 2b).


Acanthamoeba keratitis

Acanthamoeba is a free living pathogenic amoeba. Corneal

infection was first recognized in 1973 and was associated with

contact lens wear. Predisposing factors include trauma or ocular

exposure to contaminated water.

Clinical features and treatment: severe ocular pain out of

proportion to clinical findings is hallmark. Classical radial peri-

neuritis observed as infiltrates along the corneal nerves in early

stages and dry, grayish infiltrate, with epithelial defect and ring

infiltrate later is classical for this disease. Presence of double-

walled cysts and trophozoites on Gram’s stain, KOHeCFW and

Giemsa stains, with growth only on non-nutrient agar is diag-

nostic. Multiple scrapings are required in some cases in order to

demonstrate the parasite. More recently, confocal scanning has

demonstrated stromal cysts. If diagnosed early, medical

management with antiprotozoal drugs like propramidine isethi-

onate or polyhexamethylene biguanide or chlorhexidine has

been effective. Surgical therapy includes DALK with good

outcomes reported. PK has been reported to have poor outcome.

Histopathology: in addition to epithelial ulceration, destruction

of Bowman’s layer and stromal inflammation, there are presence

of cysts and trophozoites of Acanthamoeba and apoptosis of

keratinocytes.7 Cysts are seen as oval, double-walled structures

with paracentral nucleus, the wall stain prominently with H & E

or PAS and GMS (Figure 3aec). Trophozoites are noted within

the collagen lamellae as elongated structures, larger than kera-

tocytic nuclei. Unusual features like granulomatous inflamma-

tion, vascularization and loss of keratocytes in deeper stroma

which are postulated to be due to apoptosis of stromal kerato-

cytes have also been reported.8

Nocardia keratitis

Nocardia are filamentous beaded bacilli, belonging to the order

Actinomycetales. It is a rare cause of infectious keratitis9 and the

following species have been reported more often: Nocardia

asteroides (commonest), Nocardia gypsoides, Nocardia brasi-

liensis, Nocardia caviae and Nocardia farcinic. It is slowly



Acanthomoeba cysts and trophozoites in H & E stained sections

a, PAS b and GMS c.

Figure 3

Figure 4 Slit lamp photograph showing discrete oval infiltrates in

a wreath-like configuration in the anterior stroma.


progressive indolent and recalcitrant. Since it is infrequently seen

clinically, it is often misdiagnosed as fungal keratitis or other

microbial keratitis. Factors predisposing to infection include

trauma with soil, use of corticosteroids, surgery and contact lens

wear.10

Clinical features and treatment: the history can be acute or

chronic, with recurrent episodes lasting for years. Pain can be

out of proportion to the clinical findings. Corneal involvement

is seen as punctuate epitheliopathy in the earliest stages, or as

a well defined ulcer with grey sloughing bed and incomplete


necrotic boundaries. The margins are studded with white

discrete, pin-head infiltrates, in a wreath-like configuration

with feathery borders. These are predominantly anterior

stromal and are pathognomonic of this infection (Figure 4).

Nocardia has also been reported in post refractive surgery

keratitis, both in laser in situ keratomileusis (LASIK)10 and

photorefractive keratotomy (PRK),11 either as sporadic cases or

occurring as outbreaks. The infiltrate mimics diffuse lamellar

keratitis or sterile infiltrates, unresponsive to or worsening with

topical corticosteroids. In confocal scan, the organisms are seen

as highly reflective, short and thin branching filaments (9 � 15

mm in size) at the edges of the inflammatory exudates. On

microbiology, the bacilli are seen as Gram-variable, non-fluo-

rescent branching filaments on KOHeCFW, stain black with

GMS and bright red with 1% acid fast stain. Cultures can be

obtained within 7 dayse2 weeks on a variety of media, as dry

tiny white colonies. Molecular-based diagnostic methods like

PCR are proving useful both for the detection of Nocardia as

well as in species determination. Topical fortified amikacin and

timethorpim-sulfamethoxazole are effective drugs and resolu-

tion of infiltrate with scar formation usually occurs. Failure of

medical therapy is noted with prior use of topical corticoste-

roids, post-LASIK infections and in advanced infection and

perforation. Keratoplasty is required in these cases and fortu-

nately, recurrence has not been reported post-PK.

Histopathology: since this infection is seen in unusual settings,

the corneal specimen could be a corneal biopsy and amputated

flap of LASIK or corneal button following either lamellar or

penetrating keratoplasty. There is often epithelial ulceration with

severe stromal loss and intense inflammatory infiltrates. The

bacilli itself can be seen as clusters of gram-positive filaments

(with branching) noted within the necrotic areas in post-LASIK

and post-PRK infections; appearing bright red on acid fast staining

with 1% modified Ziehl Neelsen stain seen at 1000� magnifica-

tion (oil immersion). These organisms can also be noted at the

edge of the inflammatory foci. In cases pre-treated with cortico-

steroids, clusters of Nocardia appearing as colonies can also be

noted. Generally the organisms appear limited to anterior and mid-

stroma on histopathology and do not appear to breach the DM.




Atypical mycobacterial keratitis

Nontuberculous mycobacteria (NTM) or atypical mycobacteria

were not considered pathogenic until Turner and Stinson

described keratitis due toMycobacterium fortuitum in 1965. Since

then, there have been several reports of these pathogens in kera-

titis. Predisposing factors include ocular trauma, corneal foreign

body, post-surgery and post-penetrating keratoplasty (infectious

crystalline keratopathy). More recently, this pathogen has gained

notoriety in post-LASIK infections, especially as outbreaks.12,13

Post-LASIK NTM has been reported in several series and consti-

tutes 64% of all bacterial infections following LASIK. Six species

have been reported, of which Mycobacterium chelonea and M.

fortuitum (both are rapid growers) are the most common.12

Clinical features and treatment: intact overlying epithelium is

sometimes observed and pain is variable, but is certainly never

as excruciating as in Acanthamoeba keratitits. The stromal

infiltrate is generally located in deep stroma and shows a dense

yellow-white appearance and can be single or multiple. Typi-

cally, the infection presents 2e8 weeks after the event and has an

indolent course. In case of LASIK infections, infiltrates are first

noted in the corneal interface, mimicking diffuse lamellar kera-

titis, and then may spread to anterior and posterior stroma. The

lesion may have well defined borders or radiating projections

(cracked windshield appearance) mimicking fungal keratitis.

These are gram-variable slender rods which are 20% acid fast on

ZeN stain. While these organisms can grow on blood agar and

chocolate agar as confluent tiny, white colonies, recommended

culture media for NTM are LowensteineJensen (LJ), and Mid-

dlebrook media. On LJ medium the colonies appear as confluent

creamy colonies. PCR based methods are useful for species

identification. Medical management has been reasonably

successful. Multi-drug therapy is recommended and includes

amikacin sulphate, clarithromycin, imipenem and fourth gener-

ation fluoroquinolones like gatifloxacin and moxifloxacin.

Topical corticosteroids should be withheld. Other measures

include lifting and irrigating the flap in cases of post-LASIK

infection and even flap amputation. In cases of advanced infec-

tion and non-responsive to medical therapy, DALK or PK is

required and has been associated with good therapeutic success.

Histopathology: in most cases, epithelial ulceration, stromal

necrosis and tissue loss and dense infiltration by acute and chronic

inflammatory are seen. Development of granulomatous inflam-

mation has been described and appears to play a role in pre-

venting the spread and in clearing the bacteria from the infected

tissue. In cases where corticosteroids have been used, there is

suppression of granulomatous inflammation and this may account

for the severe and prolonged keratitis seen clinically.12 On histo-

logical examination, cases pre-treated with steroids would show

stromal thinning and paucity of inflammatory cells. The organisms

may be noted as dense colonies of long, acid fast bacilli within

corneal stromal pockets, or in amputated LASIK flaps.

Microsporidial keratitis

Figure 5 Microsporidial spores on 1% acid fast stain, note the character-

istic waist-band (100�).

Microsporidia are spore forming parasites and is an emerging

cause of keratitis.14 There are two clinical presentations of ocular

microsporidial infections: corneal stromal keratitis and epithelial

keratopathy with conjunctivitis.


Clinical features and treatment: stromal keratitis occurs as deep-

stromal infiltrate with history of recurrent episodes of acute

inflammation, temporarily subsiding with topical steroids, closely

mimicking herpes simplex keratitis. No specific predisposing

factor has been identified, although trauma and oro-fecal

contamination have been implicated. The lesions may be single or

multiple and can also be mistaken for fungal keratitis. Micro-

sporidia have also been reported in a quiet eye with a corneal scar

following trauma.14 Corneal scrapings show small oval refractile

bodies, on KOHeCFW and Gram’s stain. These organisms are 1%

acid fast and can be identified as bright pink-red spores with

distinctive waist-band. Generally not amenable to topical anti-

parasitic drugs, topical fumagillin and oral albendazole have been

tried with limited success. Lamellar or penetrating keratoplasty is

required.

Histopathology: the cornea may show varying degrees of

inflammation based on whether corticosteroids were used. The

microsporidial spores are faintly stained and easily overlooked

by inexperienced pathologists in routine H & E stains.

They appear oval to round, brown in colour and the internal

band girding the spore appearing like a “waist-band”. Though

many stains highlight the spores like 1% acid fast stain, GMS,

CFW with KOH, Masson’s trichrome, (Figure 5), we find 1% acid

fast stain is easy, economical with good interobservable

aggrement.15

Miscellaneous infections16

Treponema pallidum e this causes syphilitic stromal (inter-

stitial) keratitis. Congenital syphilis can present with stromal

inflammation between the ages of 5 and 15. Histological study

has been possible in only a few cases and shows a thickened

cornea, diffuse and localized lymphocytic infiltration in middle

and posterior stroma and vascularization. In chronic keratitis,

healed lesions would be noted as fibrous pannus, ghost vessels,

stromal scarring, and DM thickening. T. pallidum organisms

have not been isolated from these lesions.

Mycobacterium tuberculosis e patients with systemic tuber-

culosis have chronic corneal inflammation and lesions near the

limbus called phlyctenules. Histologically, this consists of



Summary of different primers used to detect infectious agents in keratitis

S. No Name of the PCR Forward primer (5’e3’) Reverse primer (5’e3’) Ref No.

1 Pan microsporidial PCR CACCAGGTTGATTCTGCC GTGACGGGCGGTGTGTAC 21

2 Pan fungal PCR (28S rRNA based) GTGAAATTGTTGAAAGGGAA GACTCCTTGGTCCGTGTT 22

3 Nocardia PCR GCTTAACACATGCAAGTCG GAATTCCAGTCTCCCCTG 23

4 Acanthamoeba PCR GGCCCAGATCGTTTACCGTGAA TCTCACAAGCTGCTAGGGAGTCA 24

5 Mycobacterium tuberculosis PCR CGTGAGGGCATCGAGGTGGC GCGTAGGCGTCGGTGACAAA) 25

6 Eubacterial nested PCR (16S rDNA) Round 1

TTGGAGAGTTTGATCCTGGCTC

Round 1

GGCGTGCTTAACACATGCAAGTCG

26

Round 2

GGACTACCAGGGTATCTAA

Round 2

GCGGCTGGCACGTAGTTAG

7 Herpes simplex virus 1 PCR ATCACGGTAGCCCGGCCGTGTGACA CATACCGGAACGCACCACACAA 27

Table 2


anterior to midstromal focus of sub-acute and chronic inflam-

matory cells with necrosis of collagen, and replacement by

vessels and scar tissue in chronic stage. Tubercle bacilli have not

been identified in these lesions and it appears to be a hypersen-

sitivity reaction.

Mycobacterium leprae e corneal disease is frequently seen

in long-standing leprosy, either directly as an infection due to

lepra bacilli or secondary to chronic ocular changes like

exposure keratopathy. Histological, lepromatous leprosy

produces a nonulcerating diffuse granulomatous stromal infil-

tration characterized by infiltration with foamy histiocytes and

giant cells. These cells contain lepra bacilli, picked up on acid

fast staining.

Onchocerciasis e infection by Onchocerciasis volvulus is one

of the leading causes of blindness worldwide. Microfilaria has

been observed in all ocular tissues and migrates easily to the

cornea. Histologically, intact microfilaria with scant inflam-

mation is noted. In case of degenerated organisms, intense

eosinophilic response is noted with secondary changes in all

layers of cornea, like epithelial edema, bullae, replacement of

Bowman’s layer by inflammatory pannus and stromal vascu-

larization and fibrosis.

Molecular diagnosis

Nucleic acid based testing has revolutionized our approach to

diagnosis and therapy in a wide variety of conditions including

infections. These assays are based on isolation of DNA or RNA,

followed by hybridization or amplification methods or

a combination of the two. DNA probe based assays are partic-

ularly well suited for in situ hybridization in tissues and for

culture confirmation. However, they are less sensitive than

DNA amplification techniques such as polymerase chain reac-

tion (PCR). An overview of principles and applications of

molecular diagnostic techniques such as PCR, fluorescent in

situ hybridization (FISH), microarray and DNA chip technology

can be found elsewhere.17

Even under best of laboratory conditions, the sensitivity of

culture methods for diagnosis of non-viral microbial keratitis is

not very high and the molecular methods seem to fit in to this

gap. In the case of viruses, the culture methods are expensive,

tedious and not sensitive. Molecular methods were quickly


adopted in virology to overcome these difficulties and have come

to form the mainstay of diagnosis of viral keratitis as well as

many other viral infections. Being a sensitive test method, care

should be taken to handle and prepare the sample. Positivity of

results can be altered depending on the nature of specimen (fresh

versus formalin-fixed), amplification, load of organism,

contamination and the presence of inhibitors. Availability of

methods that facilitate extraction of DNA from formalin-fixed,

paraffin-embedded tissues, make it possible to evaluate the

archived material, with reasonable results.

These methods have been applied to diagnose viral infections,

microsporidial infection, atypical mycobacterium, Mycobacte-

rium causing lepromatous lesions.18 In addition to aiding in

diagnosis, molecular techniques also improve our understanding

of the disease process. For example, corneal tissue from HSV

seropositive patients (with no clinical manifestation of the

disease) was shown to have presence of HSV DNA as well as

viable HSV in culture.19 This finding strengthened the under-

standing about the potential of latent HSV to induce donor-to-

host infection in corneal recipients. Copy number of HSV DNA

has been correlated to differentiate between latent virus and

active infection. Table 2 provides the summary of different

probes that have been used to diagnose different types of infec-

tious agents in corneal infections.

Other techniques that have been added to the increasing

armentarium of molecular diagnosis include quantitative PCR

(qPCR), RT-PCR, in situ hybridization and in situ PCR (ISPCR).

Our centre has developed a DNA vision chip that combines

multiplex PCR with enzyme-based detection of amplified DNA by

hybridization (unpublished data) with oligonucleotide probes. It

allows simultaneous detection of bacterial, fungal and viral DNA

(Xcyton Diagnostics Limited, Bangalore, India). Some of the

draw backs that dampens the virtues of PCR is the risk of

contamination of samples and reagents by the amplicons of

previous amplification reactions.20

Conclusions

In summary, corneal infections, though rarely seen by a general

pathologist comprise a special set of challenges both to clinicians

and pathologists. High index of suspicion, proper evaluation of

tissues with appropriate histochemistry and molecular methods



Practice points

C Good orientation of the corneal button, use of periodic acid

Schiff’s and examination of all the layers of cornea is the

minimal requirement for interpreting corneal infections.

C Adequate clinical information along with assessment of

pattern, degree and extent of inflammation and the associated

features like necrosis, granulomatous inflammation, vascular-

ization provides 60e70% of information towards the etiologic

agents.

C Identification and confirmation of organisms however is based

on judicious use of special stains like GMS, AFB, Gram’s, etc.

C Molecular methods in routine practice are required mostly in

viral keratitis or identification of rare organisms or in rare

settings.


could facilitate prompt diagnosis, early intervention thus

reducing the vision threatening infections of the eye. A

REFERENCES

1 Huang AJW, Wichiensin P, Yang M. Bacterial keratitis. In: Krachmer JH,

Mannis MJ, Holland EJ, eds. Cornea volume one, fundamentals, diag-

nosis and management. Elsevier-Mosby, 2005: 1025e33. chapter 81.

2 SrinivasanM. Fungal keratitis. Curr Opin Ophthalmol 2004; 15: 321e7.

3 Vemuganti GK, Garg P, Gopinathan U, et al. Evaluation of agent and

host factors in progression of mycotic keratitis: a histopathological

and microbiological study of 167 buttons. Ophthalmology 2002; 109:

1538e46.

4 Garg P, Vemuganti GK, Chatarjee S, Gopinathan U, Rao GN. Pigmented

plaque presentation of dematiaceous fungal keratitis: a clinicopath-

ologic correlation. Cornea 2004; 23: 571e6.

5 Holland Edward J, Schwartz Gary S. Classification of Herpes Simplex

Virus keratitis. Cornea 1999; 18: 144e54.

6 Holbach LM, Font RL, Naumann GO. Herpes simplex stromal and

endothelial keratitis. Granulomatous cell reaction at the level of

Descemet’s membrane, the stroma and Bowman’s layer. Ophthal-

mology 1990; 97: 722e8.

7 Vemuganti GK, Sharma S, Atmanathan S, Garg P. Keratocytic loss in

Acanthamoeba keratitis: phagocytosis, necrosis or apoptosis? Ind J

Ophthalmol 2000; 48: 291e4.

8 Vemuganti GK, Parisha G, Sharma S, Joseph J, Garg P. Granumolmatous

inflammation in Acanthamoeba keratitis: an immunohistochemical

studyof five cases and reviewof literature. Ind JMedMicrobiol2005;23:

231e8.

9 Sridhar MS, Gopinathan U, Garg P, Sharma S, Rao GN. Ocular Nocardia

infectionswith special emphasis on the cornea.SurvOphthalmol2001;

45: 361e78.

10 Garg P, Sharma S, Vemuganti GK, Ramamurthy B. A cluster of

Nocardia keratitis after LASIK. J Refract Surg 2007; 23: 309e12.

11 Javadi M, Kanavi MR, Zarei S, et al. Outbreak of Nocardia keratitis

after photorefractive keratectomy. Clinical, microbiological, histo-

pathological and confocal scan study. J Cataract Refract Surg 2009;

35: 393e8.

12 de la Cruz J, Pineada R. LASIK-assocaited atypical Mycobacteria

keratitis. A case report and review of literature. Int Opthalmol Clin

2007; 47: 73e84.

13 Garg P, Bansal AK, Sharma S, Vemuganti GK. Bilateral infectious

keratitis after laser in situ keratomileusis. A case report and review of

literature. Ophthalmology 2001; 108: 121e5.

14 Vemuganti GK, Garg P, Sharma S, Joseph J, Gopinathan U. Is micro-

sporidial keratitis an emerging cause of stromal keratitis? A case

series study. Ophthalmology 2005; 5: 19.

15 Joseph J, Vemuganti GK, Sharma S. Histopathological evaluation of

ocular microsporidiosis by different stains. BMC Clin Pathol 2006; 6: 6.

16 Spencer WH. Cornea. In: Spencer WH, ed. Ophthalmic pathology: an

atlas and a textbook, vol. 1. Philadelphia: Suanders, 1996: 202e6.

17 Netto GJ, Saad RD, Dysert PA. Diagnostic molecular pathology:

current techniques and clinical applications, part 1. Proc (Bayl Univ

Med Cent) 2003; 16: 379e83.


18 Fyfe JA, McCowan C, O’Brien CR, et al. Molecular characterization of

a novel fastidious Mycobacterium causing lepromatous lesions of the

skin, subcutis, cornea, and conjunctiva of cats living in Victoria,

Australia. J Clin Microbiol 2008; 46: 618e26.

19 Robert PY, Adenis JP, Denis F, Alain S, Ranger-Rogez S. Herpes

simplex virus DNA in corneal transplants: prospective study of 38

recipients. J Med Virol 2003; 71: 69e74.

20 Shamsi FA, Chaudhry IA, Moraes MO, Martinez AN, Riley FC. Detection

of Mycobacterium leprae in ocular tissues by histopathology and

real-time polymerase chain reaction. Ophthalmic Res 2007; 39:

63e8.

21 Reddy AK, Balne PK, Garg P, et al. Dictyostelium polycephalum

infection of human cornea. Emerg Infect Dis 2010; 16: 1644e5.

22 Vengayil S, Panda A, Satpathy G, et al. Polymerase chain reaction

guided diagnosis of mycotic keratitis: a prospective evaluation of

its efficacy and limitations. Invest Ophthalmol Vis Sci 2009; 50:

152e6.

23 Rodriguez-Nava V, Couble A, Devulder G, Flandrios JP, Boiron P,

Laurent F. Use of PCR restriction enzyme pattern analysis and

sequencing database for hsp 65 gene based identification of

Nocardia species. J Clin Microbiol 2006; 44: 536e46.

24 Schroeder JM, Booton GC, Hay J, et al. Use of subgenic 18S ribosomal

DNA PCR and sequencing for genus and genotype identification of

Acanthamoebae from humans with keratitis and from sewage sludge.

J Clin Microbiol 2001; 39: 1903e11.

25 Hermans PW, van Soolingen D, Dale JW, et al. Insertion element IS986

from Mycobacterium tuberculosis: a useful tool for diagnosis and

epidemiology of tuberculosis. J Clin Microbiol 1990; 28: 2051e8.

26 Hykin PG, Tobal K, McIntyre G, Matheson MM, Towler HMA,

Lightman SL. The diagnosis of delayed post-operative endoph-

thalmitis by polymerase chain reaction of bacterial DNA in vitreous

samples. J Med Microbiol 1994; 40: 408e15.

27 Aurelius E, Johansson B, Skoldenberg B, Staland A, Forsgren M.

Rapid diagnosis of herpes simplex encephalitis by nested poly-

merase chain reaction assay of cerebrospinal fluid. Lancet 1991; 337:

189e92.



Date post:	11-Nov-2023
Category:	Documents
Upload:	independent
View:	0 times
Download:	0 times

Histopathology and molecular diagnosis of corneal infections

Documents