HLA-DRB1 genotyping by modfied PCR- RFLP method combined with group-specific pruners M. Ota, T. Seki, H. Fukushima, K. Tsuji, Inoko. HLA-DRB1 genotyp- ing by modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1992: 39: 187-202. Abstract: We previously introduced HLA-DQAl ,-DPB 1 and DQBl geno- typing with the modified PCR-RFLP method using some informative restriction enzymes which have either a single cleavage site or alternatively no cleavage site in the amplified DNA region, depending on the HLA alleles, making reading of RFLP band patterns much easier. In this study, 43 HLA-DRB 1 aneles, excluding DRB 1 * 1 103 and * 1 104 for which no restriction enzymes are available to distinguish each from the other, could be defined by this modified PCR-RFLP method combined with 7 pairs of group-specific primers. It is impossible to distinguish DRB1*0701 and DRB1*0702 as they are identical for the second exon of DRBI. For DRI- DRBl or DRw52 associated antigens (DR3, wll, w12, w13, w14, and DRw8)-DRBl gene amplification, the second exon of the DRBl gene was selectively amplified using each group-specific primer from genomic DNAs of 70 HLA-homozygous B-cell lines and healthy Japanese by PCR. Amplified DNAs were digested with restriction endonucleases and then subjected to electrophoresis assaying simply for cutting, or no cutting, of the DNA, although some alleles can be distinguished only after examination of RFLP band patterns generated and in some cases using double diges- tion technique with two restriction enzymes. This modified PCR-RFLP method can be successfully applied to all possible DRB 1 heterozygotes, despite the fact that 15 pairs of heterozygotes among them cannot be distinguished theoretically by the PCR-SSO method, because the PCR- RFLP method can tell whether two polymorphic sites are linked to each other (cis position) or located on a different chromosome (trans position) by checking the length of RFLP bands generated with double digestion. Thus, the PCR-RFLP method is technically simple, practical and inexpen- sive for determination of the HLA-DRB1 alleles for routine HLA typing work. , DRBI, DR2-DRB1, DRCDRBl, DR7-DR1, DR9-DRB1, DRwlO- Introduction The HLA class I1 genes (HLA-DR, -DQ, -DP), located in the short arm of chromosome 6, specify heterodimeric glycoproteins involved in the regu- lation of the immune response (1). These highly polymorphic molecules bind to foreign or self anti- genic peptides and present them to antigen-specific T cells in a self-restricted fashion (2-5). Accurate identification of their polymorphisms is a prerequi- site for determination of the functional role of HLA in immunoreactivity (6) and transplantation immunity (7-8), as well as in the susceptibility to autoimmune diseases (9). In the DRB region, five DRB (DRB1, DRB2, DRB3, DRB4 and DRB5) Masao Ota', Takeshi Seki', Hirofumi Fukushima', Kimiyoshi Tsuji' and Htdstoshi Inoko' 'Department of Legal Medicine, *Second Depart- ment of Internal Medicine, Shinshu University School of Medicine, Nagano. and 'Department of Transplantation, Tokai University school of Medicine, Kanagawa, Japan Key words: PCR: polymerase chain reaction - RFLP: restriction fragment length polymorphism - SSO: sequencespecific oligonucleotide - DRBl alleles - genotyping Received 16 September, revised, accepted for publication 4 December 1991 loci have been identified and these DRB genes, except for a pseudogene, DRB2, are known to encode specific DR chain molecules. Among them, the DRBl genes is thought to be the most import- ant in controlling the immune response as well as the main alloantigen determinants. There are now as many as 46 DRBl alleles known, among which 43 have different amino acid sequences in the /3 1 domain-exon (10). DR specificities are usually determined by serological procedures using alloan- tisera or monoclonal antibodies. The availability of these antibodies is limited in specificity, quantity and sensitivity for full DRB typing (1 1). Further- more, the cellular assay procedure (12) used for definition of Dw specificity is time-consuming and 187
Transcript
HLA-DRB1 genotyping by modfied PCR- RFLP method combined with group-specific pruners
M. Ota, T. Seki, H. Fukushima, K. Tsuji, Inoko. HLA-DRB1 genotyp- ing by modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1992: 39: 187-202.
Abstract: We previously introduced HLA-DQAl ,-DPB 1 and DQBl geno- typing with the modified PCR-RFLP method using some informative restriction enzymes which have either a single cleavage site or alternatively no cleavage site in the amplified DNA region, depending on the HLA alleles, making reading of RFLP band patterns much easier. In this study, 43 HLA-DRB 1 aneles, excluding DRB 1 * 1 103 and * 1 104 for which no restriction enzymes are available to distinguish each from the other, could be defined by this modified PCR-RFLP method combined with 7 pairs of group-specific primers. It is impossible to distinguish DRB1*0701 and DRB1*0702 as they are identical for the second exon of DRBI. For DRI-
DRBl or DRw52 associated antigens (DR3, wll , w12, w13, w14, and DRw8)-DRBl gene amplification, the second exon of the DRBl gene was selectively amplified using each group-specific primer from genomic DNAs of 70 HLA-homozygous B-cell lines and healthy Japanese by PCR. Amplified DNAs were digested with restriction endonucleases and then subjected to electrophoresis assaying simply for cutting, or no cutting, of the DNA, although some alleles can be distinguished only after examination of RFLP band patterns generated and in some cases using double diges- tion technique with two restriction enzymes. This modified PCR-RFLP method can be successfully applied to all possible DRB 1 heterozygotes, despite the fact that 15 pairs of heterozygotes among them cannot be distinguished theoretically by the PCR-SSO method, because the PCR- RFLP method can tell whether two polymorphic sites are linked to each other (cis position) or located on a different chromosome (trans position) by checking the length of RFLP bands generated with double digestion. Thus, the PCR-RFLP method is technically simple, practical and inexpen- sive for determination of the HLA-DRB1 alleles for routine HLA typing work.
Introduction The HLA class I1 genes (HLA-DR, -DQ, -DP), located in the short arm of chromosome 6, specify heterodimeric glycoproteins involved in the regu- lation of the immune response (1). These highly polymorphic molecules bind to foreign or self anti- genic peptides and present them to antigen-specific T cells in a self-restricted fashion (2-5). Accurate identification of their polymorphisms is a prerequi- site for determination of the functional role of HLA in immunoreactivity (6) and transplantation immunity (7-8), as well as in the susceptibility to autoimmune diseases (9). In the DRB region, five DRB (DRB1, DRB2, DRB3, DRB4 and DRB5)
Masao Ota', Takeshi Seki', Hirofumi Fukushima', Kimiyoshi Tsuji' and Htdstoshi Inoko' 'Department of Legal Medicine, *Second Depart- ment of Internal Medicine, Shinshu University School of Medicine, Nagano. and 'Department of Transplantation, Tokai University school of Medicine, Kanagawa, Japan
Received 16 September, revised, accepted for publication 4 December 1991
loci have been identified and these DRB genes, except for a pseudogene, DRB2, are known to encode specific DR chain molecules. Among them, the DRBl genes is thought to be the most import- ant in controlling the immune response as well as the main alloantigen determinants. There are now as many as 46 DRBl alleles known, among which 43 have different amino acid sequences in the /3 1 domain-exon (10). DR specificities are usually determined by serological procedures using alloan- tisera or monoclonal antibodies. The availability of these antibodies is limited in specificity, quantity and sensitivity for full DRB typing (1 1). Further- more, the cellular assay procedure (12) used for definition of Dw specificity is time-consuming and
187
Ota et al.
Table 1. PCR primers for allele- or groupspecific amplification of the DRBl gene
~
Gene Primers codon matched Sequences (5’ to 3’) PCR-products
DRBlS primer for DR2 5’R2 7-1 3 TTCCTGTGGCAGCCTAAGAGG (261 bp) for DR4 5‘R4 6-1 3 GmCTTGGAGCAGGllAAAC (263bP) for DR9 539-1 8-1 5 GPAGCAGG ATAAGmGAGTG (256bP) for DRl 5’Rl 25-32 GGTTGCTGGAAAGAECATCT (206bp) forDR7 SR7 25-32 AGTTCCTGGAAAGACTCTTCT (206bp) for DR10 SR10 25-32 GGTGCTGGAAAGACGCGTCC (206bP)
for DR6 DR5 5’R3568 5-1 2 ACGmCTTGGAGTAClCTACG (265hp)
DR3
DR8
DRBl 3’ primer 3’R 87-93 CCGCTGCACTGTGAAGCTCT
complicated by the limited availability of the typing reagents, homozygouS typing cells (HTCs). Restric- tion fragment length polymorphism (RFLP) analy- sis with a genomic Southern hybridization tech- nique allows the identification of DRB alleles at the gene level, but requires a large amounts of high-molecular weight DNAs and a complicated procedure; also, the interpretation of RFLP band patterns is not straightforward. The limitation of these methods for identification of DRB poly- morphisms has been overcome by the advent of polymerase chain reaction (PCR) technique
(13-17). The PCR method permits precise and di- rect analysis of allelic variations with as little as lng of genomic DNA. The PCR-RFLP method we reported previously (18-20) is practical and conventional for genotyping, but small fragments or bands located close to each other on the poly- acrylamide gels sometimes obstruct precise analysis and the majority of heterozygotes cannot be dis- criminated from each other (21). These problems have been overcome by the modified PCR-RFLP method of incorporating informative restriction enzymes which have a single recognition site in some alleles, but none in other alleles in the ampli- fied segments for the DPB1, DQAl and DQB1 genes (22-23) and thus reading of RFLP band patterns generated has become much simpler and easier. In this study, this modified PCR-RFLP method was applied to DRBl genotyping along with 7 pairs of group-specific primers. The PCR- amplified DNAs digested with restriction endo- nucleases (AvaII and PstI for DR1 group; FokI, Cfrl3I and HphI for DR2 group; SacII, AvaII, HinfI, HaeII, HphI and MnlI for DR4 group; AvaII, FokI, KpnI, HaeII, Cfrl31, SfaNI, SacII, BsaJI, ApaI, HphI and RsaI for DR3,5,6 and 8 group) were subjected to electrophoresis. DRBl
Table 2. Correlation between cleavage patterns obtained by two restriction endo- nucleases and DRB1 homozygous and heterozygous alleles for OR1
Combinations of Restriction endonucleases
DRBl alleles Groups Avall Pstl
01 01/01 01 N A 1 1 01 02/01 02 BIB 1 0 01 03/01 03 c/c 0 1
Figure 1. The PCR products were amplified by each pair of the 01 01 101 02 A/B 1 2 group-specific S’primers (SR1, S’R10, SR2, S’R4, S’R7, SR9 01 01 101 03 NC 2 1 and S‘R3.568) and common 3’(3’R) primer. DNAs were extract- 01 02/01 03 BiC 2 2 ed from HTCs and a healthy donor cells having DRwlOIDR2 heterozygote as indicated. 0: not cleaved, 1: cleaved, 2: both for heterozygote.
188
Modified PCR-RFLP for DRBl
Table 3. Cleavage and RFLP patterns obtained by three restriction endonucleases in combinations of DRBl homozygous and heterozygous alleles for OR2 specificity -~ ~
0: not cleaved, 1: cleaved, 2: both for heterozygote. +: positive, -: negative.
genotypes were determined mainly by checking whether the amplified DNAs are digested or not. Heterozygotes could also be analyzed with the method. This modified PCR-RFLP method re- solves the multiple subtypes within the major DR groups and is technically simpler, cheaper and more practical for routine HLA typing work than our previous PCR-RFLP method, and thus is a good alternative and a complementary technique to the PCR-SSO method.
Material and Methods DNA samples
Seventy DNA samples used in this study were dis- tributed for Southern blot analysis in the Tenth
1 1 1 0 DRBM3101/0101 oRBrolo2/0102
HOM2 M2070782
Figure 2. Cleavage patterns of polymorphic restriction frag- ments in the PCR-amplified DRI-DRBl genes obtained from DNAs of two HTCs after digestion with AvaII and PstI en- zymes. Determination of their genotypes was based on Table 2. The size of the amplified region of the DRI-DRBI exon 2 is 206 bp as indicated.
International Histocompatibility Workshop. They were isolated from EBV-transformed HLA homo- zygous B lymphoblastoid cell lines which were the same ones used in the previous study (23). Genomic DNAs from healthy Japanese volunteers were iso- lated by phenol extraction of sodium dodecyl sul- fate (SDS)-lysed and proteinase K-treated cells, as described earlier (24). As no homozygous DRwlO cell line was available, a DRwlO heterozygote (DR2/DRwlO) was included for obtaining the standard RFLP band pattern of DRwlO.
PCR amplification
Genomic DNA (200-300 ng) was amplified by the PCR procedure with 2.5 units of the Taq DNA polymerase (Perkin Elmer Cetus Inc.) (25). The reaction mixture (genomic DNA, PCR buffer; 50 mM KCl, 2.5 mM MgCl,, 10 mM Tris-HC1 pH8.4, 0.01% gelatin, 0.02% N(Nonidet)P-40; 200 pM each of dATP, dCTP, TTP and dGTP; 1 pM of each of the primers) and distilled water for a total volume 100 pI in a 1.5 ml eppendorf tube (Eppen- dorf Co.) was covered with 50 pl of mineral oil to prevent evaporation and was subjected to 30 cycles of 1 min at 94'C, I min at 6OoC, and 2 min at 72°C by automated PCR thermal sequencer (Iwaki Glass Inc.). For DR1 and DR9 amplification, an- nealing was performed at 55°C. The second exon of the DRBl gene was amplified using 1 of 7 group- specific 5' primers (5'R2, 5'R4,5'R9- I , 5'R 1, YR7, SR10 and YR3568) along with the common 3' primer (3'R) as shown Table 1.
Table 4. Cleavage and RFLP patterns obtained by six restriction endonucleases in DR4-DR61 hornozygous alleles
0: not cleaved, 1: cleaved, +: positive, -: negative.
189
Ota et al.
Digestion with restriction endonucleases After amplification, aliquots (7 pl} of the reaction mixtures were digested with restriction endo- nucleases (AvaII and PstI for DRl-DRB1; FokI, Cfrl3I and HphI for DR2-DRB1; SacII, AvaII, HinfI, HaeII, HphI and Mn1I for DRCDRBl; AvaII, FokI, KpnI, HaeII, Cfrl31, SfaNI, SacII, BsaJI, ApaI, HphI and RsaI for DR3,5,6 and 8- DRB1 and 1-2 units) for 1 to 3 h after addtition of appropriate incubation buffer at suitable tem- perature. Complete digestion of restriction en- zymes was confirmed by inluding positive control DNAs with the HLA alleles which have cleavage sites for respective enzymes in the PCR-amplified regions.
1 1 1 1 I 1 0 0
Fokl
1 1 1 1 1 1 0 1
Cfrl31
Hphl
Figure 3. Cleavage patterns of polymorphic restriction frag- ments in the PCR-amplified DRZ-DRBI genes obtained from DNAs of 8 HTCs after digestion with FokI, Cfrl3I and HphI enzymes. Determination of their genotypes was based on Table 3. The size of the amplified region of the DRZDRBI exon 2 is 261 bp as indicated.
Table 5. Cleavage patterns obtained by restriction enzymes in combinations of DR4- DRBI heterozygous alleles
Combinations of DRB1 alleles Restriction endonodeases
Sacll Avall Hinfl Haell
0403 (C) 2 1 0 0 0407 0405
041 0
0401
0408 0404 0409 (0) 1 1 0 2
0406 (E) 2 1 2 0
0411 (F)# 2 1 0 2
0403 (C) 2 2 0 0 0407
0405
041 0 0402 (B) 0409 to) 1 2 0 2
0406 (E) 2 2 2 0
0411 (F) 2 2 0 2
0409 (D)# 2 1 0 2
0406 (E) 0 1 2 0 0411 (F) 0 1 0 2
0405
0403 (C)’ 0410 0407
2 1 2 2 041 0 0411 (F) 2 1 0 1
0405 0409 (0)’ 0406
0406 (E) 0471 (F) 0 1 2 2
0: not cleaved, 1: cleaved, 2: both for heterozygote. (A)’ 0401,0404,0408, (Cr 0403,0407 and (Dy 0405,0409,0410 can be distinguished by the use of Hphl and Mnl l restriction enzymes (Table 6), or Sacll+Haell, Sacll+Hphl, Haell+Hphl or Haell+Mnl I double-digestion technique (Table 7). Combinations (#) of AF (0401, 0404 or 0408/0411) to CD (0403 or 0407/0405. 0409 or 0410) can be discriminated from each other by RFLP band patterns obtained after Hphl and.Mnll enzymes [Table 6), or Sacll+Hphl or Sacll+Haell double digestion (Table 7).
Acrylarnide gel electrophoresis Samples of the restriction enzyme-cleaved ampli- fied DNAs were usually subjected to electro- phoresis in 12% polyacrylamide gels in a horizontal minigel apparatus (Mupid, Cosmo Bio Co. Ltd.). Cleavage or no cleavage of amplified fragments was detected by staining with ethidium bromide.
Results Groupspecific amplification Fig. 1 shows the products of PCR amplification by 7 pairs of the group-specific 5’ primers and common 3’ primers (Table 1). Twelve genomic
190
Modified PCR-RFLP for DRBl
Table 6. Patterns of polymorphic fragments detected with Hphl and Mnll enzymes for discrimination of heterozygotes between DRB1*0401, 0404 or 0408. DRB1’0403 or 0407, or DRB1.0405, 0409, or 0410 and other DACDRBl alleles
-: negative, +: positive. Combinations of 0401/0411 and 0403/0409 (!), 0404/0411 and 0403/0410 (?), 0408/0411 and 0403/0405 or 0407/0410 (V) can be distinguished by RFLP bands obtained by doubledigestion with Sacll+Haell. Combinations of 0403/0405 and 0407/0410 (V) and 04031 0408 and 0404/0407 [‘) can be distinguished by doubledigestion with Sacll+Hphl. Combinations of 0401/0410 and 0404/0409 (S) and 0404/0405 and 0408/0410 (a) can be distinguished by doubledigestion with Haell+ Hphl. Combination of 0401/0405 and 0408/0409 (#) can be distinguished by doubledigestion with Haell+Mnll (See Table 7).
DNAs were extracted from HTCs distributed at the Tenth International HLA Workshop (HOM2,9005 on lane 1; WT8,9017 on lane 3; KA- SOII,9009 on lane 4; SAVC,9034 on lane 5; MOU,9050 on lane6; DXB,9075 on lane 7; VAVY,9023 on lane 8; BM21,9043 on lane 9; BM15,9040 on lane 10; OMW,9058 on lane 11 and TEM,9057 on lane 12) and healthy donor cells having DRwlO/ DR2 heterozygote on lane 2. These DRBl group-speficific primers (5’R2 to 5’R3568) were confirmed as amplifying the DRBl genes selectively from the DR2, DR4, DR9, DR1, DR7, DRw 10 and DRw52-associated antigens (DR3,
* : Hphl
7 : S a d
Figure 4. The PCR-RFLP method can show linkage between two polymorphic sites. The nucleotide sequences are identical between DRB1*0403 and 0407 and between D R B l * W and 0408 except at the HphI(*) (in the right end) and Sac11 (V) sites. A characteristic feature of genetic polyrnorphisms displayed by the HLA genes is that their alleles can be distinguished by differing in combinations of variable regions by taking patch- work structure in the first domain exon. In the PCR-RFLP method double digestion (in this case, HphI+SacII) gives the information on the linkage between two polymorphic sites (here, the Sac11 and righ-end HphI sites) by the appearance of the cleaved fragment (in this case, a 47 bp fragment) which allows unequivocal discrimination between such heterozygotes.
191
Ota et al.
DR5, DR6 and DR8), respectively. The DR7, DR9 and DRwlO alleles which have no suballele (DRB1*0701 and 0702 have the same nucleotide sequences in their j3l domain exons) can be typed simply by the presence of amplified bands gener- ated with these group-specific primers (more exact- ly, allele-specific primers in these cases) as DRBl*O701 or 0702, 0901 and 1001 , respectively.
DR1-DRB1 genotyping
The DNA sequence allelic variations in the 206bp PCR-amplified region of the j3l domain exon in the DRl -DRB 1 genes (lo), where polymorphism in the DR 1 -DRB 1 locus is primarily localized, were used to search for restriction' endonucleases which have a single cleavage site in some alleles (indicated
Table 7. RFLP patterns detected with Sacll+Haell. Sacll+Hphl, Haell+Hphl or Haell+ Mnll doubledigestion for discrimination among 9 pairs of DR4 heterozygotes
Figure 5. Cleavage patterns of polymorphic restriction frag- ments in the PCR-amplified DRw52 associated antigen-DRBI genes obtained from 12 HTCs distributed at the Tenth Interna- tional HLA Workshop. Determination of their genotypes was based on Table 10. The size o f the amplified region of the DRBl exon 2 is 265 bp as indicated.
by 1 in Table Z), none in other alleles (indicated by 0 in Table 2) and both cleavage and non-cleavage sites for heterozygote (indicated by 2 in Table 2) in the amplified region by computer analysis and two different restriction endonucleases, AvaII and PstI were selected for digestion to detect allele- specific cleavage after PCR-amplification (Table 2). As shown in Table 2, these two different en- zymes predict discrimination of 6 possible DR1- DRBl allelic combinations with homozygote and heterozygote. Fig. 2 demonstrates that DRBl *(I101 (HOM2,9005) displayed the cleavaged patterns with AvaII (122bp, 84bp) and PstI (1 65bp, 41bp) and that DRB1*0102 (M2070782) had the cleavage site with AvaII (122bp, 84bp) but no cleavage one with PstI (206bp) as predicted from their nucleotide sequences. HTC of DRB1*0103 was not available in this study.
192
Modified PCR-RFLP for DRBl
DR2-DRB1 genotyping
The DR2-DRBI genes were amplified with the use of the DRZspecific primers (S'R2 and 3'R: Table 1) from DRZpositive HTCs (Fig. 3). In a similar way, the nucleotide sequences of the DR2-DRB1 alleles were used to search for restriction endo- nucleases specific for each of the four DRZDRBI alleles by computer analysis, and 3 restriction endonucleases, FokI, Cfrl3I and HphI, were se- lected to detect allele-specific cleavage and RFLP patterns after PCR-amplification followed by en- zyme digestion and found to produce the band patterns expected from Table 3 (Fig. 3). These 3 restriction endonucleases predict discrimination of all of 10 possible homozygous and heterozygous combinations by the DRZDRB1 alleles.
D R b D R B l genotyping
Eleven subtypes of the DR4 antigen (DRB1*0401 to DRB1*0411) were determined by the modified PCR-RFLP method with 6 restriction enzymes listed in Table 4. After selective amplfication of the DR4-DRB 1 gene using the DR4-specific primers (5'R4 and 3'R). 11 subtypes can be typed by cleav- age patterns with SacII, AvaII, HinfI and HaeII restriction enzymes and RFLP patterns with HphI and MnlI enzymes (26). All 66 possible combi-
nations (Tables 4, 5 and 6) of the DR4-DRB1 alleles in homozygous and heterozygous ways can be unequivocally discriminated with the restriction endonucleases selected here, except for nine combi- nations (DRB1*0403/0408 and 0404/0407, DRB1*0401/0411 and 0403/0409, DRB1*0404/ 041 1 and 0403/0410, DRB1*0408/0411 and 04031 0405, DRB1*0408/0411 and 0407/0410, DRBl*0403/0405 and 0407/0410, DRB1*0401/ 0410 and 040l0409, DRB1*0404/0405 and 0408/ 0410, DRB1*0401/0405 and 0408/0409) which give the identical cleavage and RFLP band pat- terns. As shown in Table 7, these heterozygotes, which cannot be discriminated by the PCR-SSO method theoretically (Fig. 4), can be distinguished by the use of double digestion (for example, SacII + HphI for discrimination between DRB1*0403/0408 and 0404/0407; see Fig. 4) in the PCR-RFLP method which allows examination of whether two polymorphic sites are located on the different chromosomes (trans position) or on the same chromosome (cis position).
DRw52-associated (DR3, DRwl1, DRwl2, DRwl3, DRwl4 and DRw8) antigen-DRBI genotyping
Twenty-two suballeles of DR3, DRwl 1, DRwl2, DRwl3, DRwl4 and DR8 in the DRw52-associ- ated group can be distinguished by the modified
Table a. Correlation between cleavage and RFLP patterns obtained by restriction endonucleases and DRB1 alleles for DR3,5.6 and w8 antigens
Restriction Endonucleases
Hphl
DRBl 109 alleles DR Group Avall Fokl Kpnl Haell Cfrl31 sfaNl Sacll Bsall Apal 145 120 110
0301 3 A 0302 3 B 1101 5u 1) C 1103-4 5(11) C 1102 5U1) 0 1201 5U2) E 1202 5(12) F 1301 6U 3) G 1302 6U3) G 1303 6 s 3) H 1304 W 3 ) H 1305 4 1 3) I 1401 6U 4) J 1404 W 4 ) J 1402 6U4) K 1403 6V4) L 1405 6U 4) M oaoi a N 0802 a 0 0804 a 0 0803 a P
except ones including DRBI* 1103 or 1104, as men- tioned above.
HIA-DRB1 genotyping from healthy Japanese
HLA-DRB 1 DNA typing was performed for geno- mic DNAs obtained from healthy Japanese volun- teers. Generation of PCR-amplified bands with the DRB 1 group-specific primers indicated a complete agreement with DR antigens assigned serologically. Fig. 7 shows the heterozygous DRBl allelic pat- terns obtained by the modified PCR-RFLP method in 3 individuals (DR2/DR4; DRB1*1502/ 0401, DR4/DR6;DRBI*0405/1403, DR6/DR6; DRBI * 1303/ 1403).
Discussion
The HLA-DRB I genes which encode p chain mol- ecules of DR antigens defined by the serological method, as well as Dw antigens recognized by
1 1 0 1 1 0
2 2 0 2 1 1 2 2 2
Figure 7. Cleavage patterns of polymorphic restriction frag- ments in the PCR-amplified DRBl exon 2 genes obtained from DNAs of 3 normal individuals (No. I; DRB1*1502/0401, No. 11; DRB1*0405/ 1403, No. 111; DRBI*I303/1403) after diges- tion with restriction enzymes. Their genotypes were determined on the basis of Tables 3, 4, 8 and 9.
197
Ota et al.
Table 11. Patterns of polymorphic fragments detected with Hphl digestion, Fokl+Hphl or Sacll+Hphl double digestion for discrimination of heterozygotes between DRB1.1101 or 1103-4 allele and the other DR3,5,6 or w8-DRBl alleles
Hphl (bp)
Combinations of 145 120 110 35 11 DRB1 alleles 109
+: positive, -: negative. Three pairs of *A, 08 and 4 can be discriminated by RFCP band patterns obtained after double digestion with Fokl+Hphl and Sacll+ Hphl, respectively.
cellular typing, became assignable for a high degree of their polymorphisms, type at the nucleotide level using PCR procedures such as PCR-SSO typing with raido-labelled oligonucleotide probes (27-28) and with non-radioactive oligonucleotide probes (29). However, the PCR-SSO method requires mul- tiple SSO probes, especially for the DRBI genes with as many as 43 allles, as well as labeling and washing temperatures with several stringencies
(27-33). A non-radioactive “reverse dot blot” method has also been used for SSO typing (15), but the amount and length of oligonucleotide probes must be adjusted and suitable conditions for hybridization determined, which is technically demanding. In this study, in order to establish a simple and practical PCR-DRB 1 genotyping, the modified PCR-RFLP method which depends mainly on cleavage or no cleavage of the amplified
198
Modified PCR-RFLP for DRBl
Table 12. Patterns of polymorphic fragments detected with Hphl digestion, Haell+Hphl and Sacll+Hphl double digestion for discrimination of heterozygotes between DRB1.1301 or 1302 allele and the other DR3,5,6 or wBDRB1 alleles
HDhl (bo)
Combinations of 145 120 110 35 11 DRB1 alleles 109
+: positive, -: negative. Two pairs of *A and *B can be discriminated by RFLP band patterns obtained after double digestion with Haell+Hphl and Sacll+ Hphl, respectively.
segment by informative restriction enzymes was applied to the DRBl gene. This modified PCR- RFLP method also utilizes allele - or group-speci- fic primers in order to avoid cross hybridization with other DRBZ-DRBS genes and can distinguish all the 43 previously described alleles to date dif- fering in amino acid sequence in the PI domain in homozygous and heterozygous ways, except for DRB1*1103 and 1104.
The PCR-RFLP method is a simple, practical and reproducible technique for accurate definition
of HLA alleles without the use of multiple probes, and their labeling and can clearly discriminate even one base difference between alleles by restriction enzyme. Further, one of the advantages over the PCR-SSO method is that PCR-RFLP can show linkage between two polymorphic sites of interest by measurement of the length of a fragment gener- ated after double digestion with two restriction enzymes (cis or trans position, Fig. 4), while the PCR-SSO cannot provide any such information. A characteristic feature of genetic polymorphisms
199
Ota et al.
Table 13. Patterns of polymorphic fragments detected with Hphl digestion, Hphl +Sac11 double digestion for discrimination of heterozygotes between ORB1 +1303 or 1304 allele and the other OR 3,5.6 or w8-ORB1 alleles
+: positive, +: strong positive, -: negative, pair of *A can be discriminated by RFLP band patterns obtained after double digestion with Sacll+Hphl.
in the HLA genes is that they generally have no allele-specific nucleotide sequences, but that alleles differ in combinations of variable regions by taking patchwork structure. Therefore,. 15 pairs of hetero- zygotes* so far examined in the DRBI gene, with the same combinations of variable regions, result in the same reactive patterns to SSO probes in the PCR-SSO method as in the case of DRB1*0403/ 0408 and DRB1*0404/0407 in Fig. 4. In contrast, in the PCR-RFLP method double digestion gives
*I DRB1*0401/0411 and 0403/0409, DRB1*0404/0411 and 0403/0410, DRB1*0408/0411 and 0403/0405, DRB1*0408/ 041 1 and 0407/0410, DRB1*0403/0405 and 0407/0410, DRB1*0403/0408 and 0404/0407, DRB1*0401/0410 and 040410409. DRB1*0404/0405 and 0408/0410, DRB1*0401/ 0405 and 0408/0409, DRB1*1101/1301 and 1104/1302, DRB1*0804/1101 and 0802/1104, DRB1*0892/1301 and 08041 1302, DRBl *I 103 I 1201 and 1 102/ 1202, DRBl*080 1 / 1102 and 0803/1103, DRB1*0801/1201 and 0803/1202.
the information on the linkage between two poly- morphic sites by the appearance of the cleaved fragments which allow unequivocal discrimination between such heterozygotes.
Incomplete or partial digestion of the PCR prod- ucts by restriction enzymes, which will obscure definite assignment of HLA alleles can be over- come by preparation of positive control DNAs for ensuring that the digestion is complete. Further, PCR primers incorporating recognition sites for recognition enzymes used here will be more useful as an internal control. Unusual patterns of cleav- age by restriction enzymes virtually indicate the presence of new alleles in the HLA genes, which must be confirmed by determination of their nu- cleotide sequences.
This modified PCR-RFLP method could also be successfully applied to complete DRB 1, DQAl ,
200
Modified PCR-RFLP for DRBl
Table 14. Patterns of polymorphic fragments detected with Hphl digestion, Apal +Hphl double digestion for discrimination of heterozygotes between DRBl.1401 or 1404 allele and the other DR 3,5,6 or w8-DRBl alleles
+: positive, +: strong positive, -: negative, pairs of *A and *B can be discriminated by RFLP band patterns obtained after double digestion with Apal+Hphl.
and DQB 1 genotyping as reported previously (22-23). This genotyping analysis can be made eas- ily accessible to automation with a personal com- puter program for identification of HLA alleles. Further, PCR-RFLP is much cheaper than PCR- SSO typing, especially for small numbers of samples. Thus, the PCR-RFLP method will be sub- stituted for conventional serological and cellular typing and a good alternative to the PCR-SSO method.
Acknowledgments
We thank Dr. J. Trowsdale of Imperial Cancer Research Fund for critical reading of the manu- script. This work was supported by a grant-in-aid for scientific research in 1991 from the Japanese Ministry of Education.
References
1. Bach FH. Class I1 genes and products: HLA-D region. Imrnunol Toby 1985: 6: 89-94.
2. Zinkernagel RM, Doherty PC. Restriction of in vitro T cell mediated cytotoxicity in lymphocytic choriomeningitits within a syngenic or semiallogenic system. Nature 1974:
3. Babbit BP, Allen PM, Matsueda G, Haber E, Unanue ER. Binding of immunogenic peptides to Ia histocompatibility molecules. Nature 1985: 317: 359-61.
4. Buus S, Sette A, Colon S, Miles C, Grey HM. The relation between major histocompatibility complex (MHC) restric- tion and the capacity of Ia to bind immunogenic peptides. Science 1987: 235: 1353-8.
5. Guillet JG, Lai MZ, Briner TJ, et al. Immunological self/ nonself discrimination. Science 1987: 235: 865-70.
6. Schwartz RH. T-lymphocyte recognition of antigen in as- sociation with gene products of the major histocompat- ibility complex. Ann Rev Immunol 1985: 3 237-50.
7. Bach F, Sachs DH. Transplanted immunology. N Engl J Med 1987: 317: 489-92.
248: 701-3.
201
Ota et al.
Table 15. Patterns of polymorphic fragments detected with Hphl digestion for discrimi- nation of heterozygotes between DRB7.0802 or 0804 allele and the other DR 3,5,6 or w8-DRB1 alleles
Com binations of 145 120 110 35 11 DRB1 alleles 109
8. Khagani A, Yacoub M, McCloskey D, et al. The influence of HLA matching, donor, recipient sex, and influence of acute rejection on survival in cardiac allograft ren'pients receiving cyclosporin A and Azathioprine. Transplant Proc
9. Todd JA, Acha-Orbea H, Bell JI, et al. A molecular basis for MHC class 11-associated autoimmunity. Science 1988:
1 I . Marsh SGE, Bodmer JG. DR and DQ epitopes and mono- clonal antibody specificity. Immunol Today 1990: 10
12. Grosse-Wilde H, Doxiadis I, Brandt H. Definition of HLA- D with HTC. In: Albert MT, Baur MT, Mayr WR, eds. Histocompatibility Testing 1984. Heidelberg: Springer-Ver- lag, 1984: 249-64.
13. Saiki RK, Scharf S, Faloona F, et al. Enzymatic amplifi- cation of P-globin genominc sequence and restriction site analysis for diagnosis of sickle cell anemia. Science 1985: 230: 1350-4.
14. Mullis KB, Fallona F. Specific synthesis of DNA in vitro via polymerase catalyzed chain reaction. Methodr Enzymol
15. Saiki R, Walsh PS, Levenson CH, Erlich HA. Genetic analysis of amplified DNA with immobilized sequence- specific oligonucleotide probes. Proc Natl Acad Sci USA 1989: 86: 6230-4.
16. Trucco G, Fritsch R, Giorda R, Trucco M. Rapid detection of IDDM susceptibility with HLA-DQ-alleles as markers. Diabetes 1989: 38: 1617-22.
1989: 21: 799-800.
240: 1003-9.
305-1 I .
1987: 155: 335-50.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
Yunis I, Salazar M, Yunis EY. HLA-DR generic typing by AFLP. Tissue Antigens 1991: 38: 78-88. Maeda M, Murayama H, Ishi H, et al. A simple and rapid method for HLA-DQAl genotyping by digestion of PCR- amplified DNA with allele specific restriction endo- nucleases. Tissue Antigens 1989: 34 290-8. Maeda M, Uryu N, Murayama H, et al. A simple and rapid method for HLA-DP genotyping by digestion of PCR- amplified DNA with allele-specific restriction endo- nucleases. Human Immunol 1990: 27: 11 1-21. Uryu N, Maeda M, Ota M, Tsuji K, Inoko H. A simple and rapid method for HLA-DRB and -DQB typing by digestion of PCR- amplified DNA with allele specific re- striction endonucleases. Tissue Antigens 1990: 3 5 20-31. Olerup 0. HLA-class I1 typing by digestion of PCR-ampli- fied DNA with allele-specific restriction endonucleases wit1 fail to unequivocally identify the genotypes of many homo- zygous and heterozygous individuals. Tissue Antigens 1990:
Nomura N, Ota M, Tsuji K, Inoko H. HLA-DQBI geno- typing by a modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1991: 38: 53-9. Ota M, Seki T, Nomura N, et al. Modified PCR-RFLP method for HLA-DPB1 and -DQAI genotyping. Tissue Antigens 1991: 38: 60-71. Inoko H, Ando A, Ito M, Tsuji K. Southern hybridization analysis of DNA polymorphism in the HLA-D .region. Human Immunol 1986: 16: 304-13. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988: 239: 487-9 I . Ota M, Seki T, Kiyosawa K, et al. A possible association between basic amino acids of position 13 of DRBl chains and autoimmune hepatitis. Immunogenefics 1992 (in press). Vaugham RW, Lanchburg JSS, Marsh SGE, Hall MA, Bodmer JG, Welsh KI. The application of oligonucleotide probes to HLA class I1 typing of the DRB subregion. Tissue Antigens 1990: 36: 149-55. Mach B, Tiercy J-M. Genotypic typing of HLA class 11: from the bench to the bedside. Human Immunol 1991: 30:
Scharf SJ, Griffith RL, Erlich HA. Rapid typing of DNA sequence polymorphism at the HLA-DRBI locus using the polymerase chain reaction and nonradioactive oligonuc- leo tide Drobes. Human Immunol 199 1 : 30: 190-20 1.
36 83-7.
278-84.
30. Gao X,. Moraes JR, Miller S, Stastny P. DNA typing for class I1 HLA antigens with allele-specific or group-specific amplification V. Typing for subsets of HLA-DR1 and DR'Br'. Human Immunol 1991: 30: 147-54.
31. Moraes ME, Vina MF, Stastny P. DNA typing for class I1 antigens with allele-specific or group-specific amplification. IV. Typing for alleles of the HLA-DR2 group. Human Immunol 1991: 31: 139-41.
32. Gao X, Vina MF, Shumway W, Stastny P. DNA typing for class I1 HLA antigens with allele-specific or group-specific amplification. 1. Typing for subsets of HLA-DR4. Human Immunol 1990: 2 7 40-50.
33. Petersdorf EW, Smith A, Mickelson EM, Martin PJ, Han- sen JA. Ten HLA-DR4 alleles defined by sequence poly- morphisms within the DRBl first domain. Immunogenefics 1991: 33: 26.5-71.
Address: Dr. Masao Ota Department of Legal Medicine Shinshu University School of Medicine 3-1-1 Asahi, Matsumoto Nagano 390, Japan Tel: 0263-35-4600, ext. 5217 Fax: 0263-34-8480
