In vivo and In vitro Regulation of Type I IFN Synthesis bySynergistic Effects of CD40 and Type II IFN1
Jennifer A. Greene,* Jennifer L. DeVecchio,‡ Meetha P. Gould,* Jeffery J. Auletta,† andFrederick P. Heinzel2*‡
During cognate interaction with CD40 ligand (CD154)-expressing T cells, Ag-presenting accessory cells are activated for increasedcytokine synthetic and costimulatory function. We examined whether CD40 modulates in vivo innate immune function over time,hypothesizing that distinct cytokine responses evolve to delayed microbial exposure. C3H/HeN mice pretreated with activatinganti-CD40 Ab (FGK45) produced 10-fold more serum IFN-� and IL-12 p70 to delayed, but not synchronous, challenge with LPS.A novel finding was that LPS-induced IFN-� increased by 20-fold in mice pretreated for 24 h, but not 6 h or less, with anti-CD40.Anti-CD40-pretreated C57BL/6 RAG-2�/� mice similarly increased IFN-� responses to delayed LPS challenge, confirming me-diation by innate immunity. Type I IFNR- and IFN-�-deficient mice treated with anti-CD40 failed to expand serum IFN-�responses to LPS challenge. Combined pretreatment with anti-CD40 and anti-IFN-� mAb showed that IFN-� produced afteranti-CD40 pretreatment, but before LPS challenge, was necessary for IFN-� synthetic enhancement. Anti-CD40 also increasedpolyinosinic-polycytidylic acid (poly(I:C))-inducible IFN-� by 5-fold in an IFN-�-dependent fashion, but did not significantlyincrease IFN-� production to CpG or Pam3Cys challenges. Poly(IC)-stimulated splenocytes from anti-CD40-pretreated miceproduced 4-fold more IFN-� than controls and production associated with CD11c� cells. Finally, rIFN-� and anti-CD40 combinedsynergistically to increase poly(IC)-inducible IFN-� synthetic capacity in bone marrow dendritic cells. We conclude that innateimmune production of IFN-� is cooperatively regulated by CD40 and IFN-� acting on dendritic cells, suggesting a uniquemechanism by which innate immune function evolves in response to specific adaptive immune signals. The Journal of Immu-nology, 2006, 176: 5995–6003.
T ype I (IFN-� and IFN-�) and type II (IFN-�) IFNs areinducible cytokines that mediate critical regulatory andanti-infective functions during an immune response (1).
Both can be produced by the innate cellular immune system inresponse to TLR activation by viral and bacterial-derived pathogenassociated molecular patterns. Defined groups of these moleculesactivate specific TLRs (2). Bacterial LPS and lipopeptide triggerTLR2 and TLR4, respectively, whereas microbial DNA containingunmethylated CpG motifs activates TLR9 and viral double-stranded or single-stranded RNA activate TLR3 or TLR7/TLR8,respectively (3, 4). Most TLR activations result in synthesis ofimmunoregulatory cytokines, some of which, such as IL-12 p70and IL-18, critically regulate innate IFN-� production by NK cells(5, 6). IFN-� is also a product of IL-12-stimulated T cells in anongoing adaptive immune response.
In contrast, type I IFN production is largely restricted to innateimmune responses triggered by a few TLR operating though dis-tinct mechanisms. For instance, TLR3 and TLR4 activate synthesis
of IFN-� indirectly through MyD88-independent mechanisms thatuse Toll-IL-1 receptor domain-containing adaptor inducing IFN-�and IFN-regulatory factor-3 as the critical signaling intermediates.This leads to IFN-� synthesis that then acts through the type IIFNR to self-induce high-level production of IFN-�. This model oftype I IFN autoinduction is characteristic of fibroblasts, macro-phages, and myeloid dendritic cells responding to viral infection orendotoxemia (7, 8). In contrast, TLR7/8 and TLR9 activateMyD88-dependent and IFN-�/IFN-�R-independent pathways forinnate production of type I IFN after exposure to CpG oligonu-cleotide sequences or potent synthetic analogs of ssRNA, such asR848. This mechanism is restricted to a small population of plas-macytoid dendritic cells that are otherwise unresponsive to LPSand polyinosinic-polycytidylic acid (poly(I:C))3 (9).
Once produced, IFNs provide a regulatory link between innateimmune activation and the intensity and phenotype of an ensuingadaptive immune response. Both IFN-� and type I IFNs enhanceaccessory cell Ag presentation and costimulatory function, therebyaccelerating T cell responses to Ag (10, 11). These distal immu-noregulatory effects of LPS, poly(I:C), and CpG contribute to theireffectiveness as adjuvants when incorporated into experimentaland clinical vaccine preparations (11). Both IFNs also separatelyand directly modulate T cell differentiation, partly by up-regulatingthe IL-12R and downstream signaling functions that favor devel-opment of IFN-�-producing CD4 and CD8 T cells (12, 13). De-pending on the circumstances, type I IFNs can also impair IL-12production, resulting in a paradoxical attenuation of cellular im-munity during viral infection (14) or when used for therapy ofautoimmune diseases (15).
*Center for Global Health and Diseases and †Department of Pediatrics, Case WesternReserve University, and ‡Medical Research Service, Louis Stokes Cleveland VeteransAffairs Medical Center, Cleveland, OH 44106
Received for publication August 26, 2005. Accepted for publication February28, 2006.
The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by Merit Review funding from the Veterans Affairs Med-ical Research (to F.P.H.) and National Institute of Allergy and Infectious DiseasesGrants AI45602, AI35979 (to F.P.H), and AI57801 (to J.A.A.). Flow cytometry stud-ies were supported by Grant AI36219 (Center for AIDS Research, Case WesternReserve University).2 Address correspondence and reprint requests to Dr. Frederick P. Heinzel, Center forGlobal Health and Diseases, Case Western Reserve University School of Medicine,Wolstein 4131, Cleveland, OH 44106-7286.
3 Abbreviations used in this paper: poly(I:C), polyinosinic-polycytidylic acid; KO,knockout.
We studied whether regulatory signals generated as part of anadaptive immune response, including T cell-derived cytokines andcostimulatory ligands, reciprocally modulate innate cellular immu-nity to evolve new functions. T cells that express CD40L on theirsurface stimulate CD40-bearing dendritic cells and macrophagesfor greater function in support of both innate and adaptive immuneresponses. CD40L-conditioned dendritic cells previously or simul-taneously exposed to microbial stimuli, such as Toxoplasma gondiior CpG, increase both their T cell-activating functions and producehigher quantities of regulatory cytokine, including IL-12 p70 (16,17). We hypothesized that the immune-enhancing effects of CD40agonists in vivo are progressive, causing the innate cellular im-mune system to evolve quantitative and/or qualitative changes incytokine response to delayed Toll agonist exposures. For thesestudies, mice were pretreated with the CD40-activating mAb,FGK45, a reagent previously shown to generate CD40L-comparableand immune-enhancing responses in vitro and in vivo (18–20).Anti-CD40 pretreatment not only amplified cytokine responses todelayed LPS exposure, but also broadened the diversity of theLPS-inducible cytokine repertoire to include a novel 20-fold ex-pansion in IFN-� synthesis. We show that this was mediated bysynergistic effects of both CD40 and CD40-induced IFN-� actingon dendritic cells, identifying a novel mechanism for regulation oftype I IFN by specific and sequential combinations of innate andadaptive immune signals.
Materials and MethodsReagents
Anti-CD40 mAb, clone FGK45 (21), and neutralizing anti-mouse IFN-�XMG1.2 were purchased from Bio Express and affinity-purified rat IgGwas purchased from Sigma-Aldrich. Recombinant murine IFN-� was ob-tained from PeproTech. Salmonella enteritidis LPS was obtained fromSigma-Aldrich, phosphorothioated CpG oligonucleotide 1826 (TCCATGACGTTCCTGACGTT 5� to 3�) from Oligos Etc., bacterial lipopeptidePam3CysSerLys4 from EMC Microcollections, poly(I:C) from AmershamBiosciences, and R848 from InvivoGen. The LPS reagent used in this studywas shown to be TLR4 dependent, as it only induced endotoxin tolerancein C3H/HeN and TLR2 knockout (KO) C57BL/6 mice, but not in TLR4-deficient C3H/HeJ mice. Both the anti-CD40 Ab and CpG and R848 re-agents were proven free of LPS contamination by Limulus lysate assay(E-Toxate; Sigma-Aldrich).
Mice
Four- to 6-wk-old female C3H/HeN mice were purchased from CharlesRiver Laboratories and C57BL/6 and C57BL/6 IFN-� KO mice from TheJackson Laboratory. IFN-�/IFN-�R KO 129S6/SvEv mice were bred atCase Western Reserve University (CWRU) from breeders provided byDr. R. Fairchild (Lerner Research Institute, Cleveland Clinic Foundation,Cleveland, OH). Control 129S6/SvEv mice were obtained from TaconicFarms and IFN-�/IFN-� null genotype was verified by PCR analysis of tailDNA using primers and protocols obtained from B&K Universal. All micewere housed at the CWRU Animal Facility under specific pathogen-freeconditions. For pretreatment, mice were injected once i.p. with either 0.2mg of FGK45 or 0.2 mg of normal rat IgG. Twenty-four hours after pre-treatment, mice were challenged by i.p. injection with either 200 �g of LPS(LD90) or PBS. Because anti-CD40 pretreatment increased the apparenttoxicity of LPS challenge, mice were euthanized no later than 6 h afterchallenge. All procedures were approved by the CWRU Institutional An-imal Care and Use Committee.
ELISAs
Cytokine concentrations in serum and conditioned culture medium weredetermined for IFN-� and IL-6 using Ab kits from BD Pharmingen aspreviously described (19). Serum IL-12 p70 was measured using ELISAkits purchased from R&D Systems. IL-18 was measured using an ELISAobtained from Medical and Biological Laboratories that detects maturemouse IL-18 with minimal cross-reactivity to precursor forms of IL-18.Serum IFN-� was measured using an ELISA purchased from PBL Bio-medical Laboratories that has no cross-reactivity with mouse IFN-� orIFN-�.
Tissue homogenization
Freshly harvested tissue (5 g) was placed in 10 ml of PBS containing 0.5%Triton X-100 and protease inhibitor mixture (Sigma-Aldrich). The tissuewas homogenized using a Virtis blender, clarified by centrifugation at12,000 � g for 10 min, and stored at �70°C.
Spleen cultures and splenocyte subset separations
Splenocytes were prepared and cultured at 107 cells/ml in tissue culturemedium/Nutridoma medium (1:1 mix of RPMI 1640 and DMEM withsupplemental 10 mM HEPES (pH 7.4), 1 mM L-glutamine, L-arginine,nonessential amino acids, 50 �M 2-ME, 100 �g/ml penicillin/streptomycinand 1% Nutridoma). TLR agonists were added as previously described(22). Where indicated, splenocytes (108 total cells each) were incubatedseparately with magnetic beads specific for mouse CD11c, CD11b, or DX5(Miltenyi Biotec) and applied to magnetized LS columns in degassed washbuffer (PBS, 0.5% BSA, 5 �M EDTA (pH 7.4)) per manufacturer’s in-structions. Unlabeled cells were eluted using 5 ml of wash buffer and la-beled cells were recovered by washing of columns after removal from themagnetic field. The extent of depletion and the composition of the mag-netically selected cells were confirmed by FACS analysis. Preselection andpostdepletion cell populations were separately suspended at 1 � 107
cells/ml in tissue culture medium/Nutridoma culture medium with or with-out 33 �g/ml poly(I:C) and cultured for 24 h. Supernatants were assayedfor IFN-�.
Dendritic cell cultures
Using a published methodology (23), C57BL/6 bone marrow cells wereharvested from femurs, passed through a 70 �M cell strainer, centrifugedat 200 g � 10 min and RBC lysed using ACK buffer (150 nM ammoniumchloride, 10 mM potassium carbonate, and 0.1 mM EDTA adjusted to pH7.4). Cells were washed in HBSS and resuspended at 106 cells/ml in den-dritic cell medium: (RPMI 1640/10% FBS containing 1 mM sodium pyru-vate, 10 mM HEPES, 50 mM 2-ME, and 100 �g/ml each of penicillin andstreptomycin). Recombinant mouse Flt3L (Bio Express) was added to afinal concentration of 300 ng/ml. Media were changed every 4 days andnonadherent cells were gently washed free of culture plates on day 10,counted, centrifuged, and resuspended to 106 cells/ml dendritic cell me-dium without Flt3L. Cells were cultured at 2 � 105 cells/well in round-bottom 96-well cluster plates and incubated with medium, rIFN-� (10 ng/ml), or anti-CD40 (5 �g/ml) alone or in combination for 4 h before addingTLR agonists.
Statistics
Tests for significant differences were determined using the parametric Stu-dent t test for independent samples. Statistical significance was defined asp � 0.05.
ResultsPretreatment with anti-CD40 enhances systemic cytokineresponses to LPS challenge 24 h later
C57BL/6 mice were pretreated with either 0.2 mg of rat IgG oranti-CD40 IgG and challenged with 0.2 mg (8 mg/kg) of S. enter-itidis LPS, either at the time of anti-CD40 treatment or 24 h later.Compared with LPS challenge of rat IgG-pretreated mice, LPSadministered 24 h after anti-CD40 pretreatment increased serumlevels of IL-12 p70, IFN-�, and IFN-� by �20-fold ( p � 0.05) at5 h postchallenge (Fig. 1A). In contrast, injection of anti-CD40 andLPS at the same time did not increase serum cytokine levels rel-ative to LPS-only controls and decreased cytokine production to asecond LPS challenge 24 h later. In a repeat study (Fig. 1B), invivo exposure to anti-CD40 of �6 h was needed to increase LPS-induced production of IFN-�.
We confirmed that anti-CD40-enhanced serum cytokine levelsmeasured at 5 h were not simply a result of altered kinetics ofcytokine appearance. Groups of five C3H/HeN mice were pre-treated once i.p. with either 0.2 mg of anti-CD40 mAb or affinitypurified control rat IgG, challenged at 24 h with LPS challenge, andsera were obtained at 2, 4, and 6 h afterward (Fig. 1C). Levels ofIFN-�, IFN-�, IL-12 p70, IL-6, and IL-18 in anti-CD40-pretreatedmice were 4- to 20-fold increased compared with those of rat IgG-pretreated mice throughout the time course studied. Anti-CD40 also
5996 ANTI-CD40 AND IFN-� COAMPLIFY LPS-INDUCIBLE IFN-� PRODUCTION
increased LPS-induced TNF-� by 40-fold (0.12 � 0.06 to 4.86 �0.31 ng/ml; p � 0.05) and IL-1� by 10-fold (0.36 � 0.16 to 3.19 �0.26 ng/ml; p � 0.05) at 1 and 4 h after LPS, respectively. Endotoxin-induced serum cytokines are dramatically and persistently elevated inanti-CD40-pretreated mice.
Low levels of serum IFN-� were observed at the time of LPSchallenge (Fig. 1C) and we confirmed that anti-CD40 pretreatment
independently generates circulating IFN-� that peaks at 6 h and issustained until 24 h afterward (Fig. 1D).
Anti-CD40-enhanced production of IFN-�, IFN-�, and IL-12p70 is not dependent on T or B cells
These studies did not exclude possible contributions by CD40-positive B cells or indirectly activated T cells as sources of
FIGURE 1. Anti-CD40 pretreatment increases serum cytokine responses to delayed, but not simultaneous, LPS challenge in vivo. A, Groups of fourC57BL/6 mice were pretreated (0 h) with 0.2 mg of either normal rat IgG or rat anti-CD40 IgG FGK45 and then challenged i.p. 24 h later with 0.2 mgof LPS. In another group, mice were injected with both anti-CD40 and 0.2 mg of LPS at the same time. A fourth group was pretreated with anti-CD40and low dose LPS (25 �g), followed 24 h later by a full dose LPS challenge (0.2 mg). Shown are the mean and SEM of circulating IFN-�, IFN-�, andIL-12 p70 present at 5 h after LPS challenge. �, Statistically significant increases in all three cytokines in response to delayed LPS challenge of anti-CD40-pretreated mice when compared with cytokines produced in the other three groups (�, p � 0.05). B, Repeat study using C3H/HeN mice (n � 5 pergroup) pretreated with anti-CD40 or PBS. At the indicated time after pretreatment, mice were challenged with LPS and sera obtained at 3 h afterward.LPS-inducible IFN-� concentrations were increased relative to PBS-pretreated controls only after a pretreatment interval of 24 h, not after 0, 3 and 6 h ofpretreatment (p � 0.05). All LPS-challenged sera contained IFN-� levels significantly greater than sera from unchallenged, PBS-pretreated mice. PBS-preconditioned/PBS-challenged sera did not contain detectable IFN-�. C, Kinetics of serum cytokine accumulation after delayed LPS challenge ofanti-CD40-pretreated mice. Groups of five C3H/HeN mice were pretreated with anti-CD40 or rat IgG, indicated by � or �, and then challenged with 0.2ml of PBS or 0.2 mg of LPS 24 h later. Shown are the mean concentrations and SEM of serum IFN-�, IL-12 p70, IL-18, IL-6, and IFN-� in nanogramsper milliliter at the indicated times after LPS challenge. Sera were not obtained at later times due to the appearance of severe toxicity in both experimentalgroups. �, Statistically significant increases in LPS-induced serum cytokine levels in anti-CD40-pretreated compared with rat IgG-pretreated mice at thesame time point (�, p � 0.05; Student’s t test). Differences in IL-18 levels at 6 h showed borderline significances (p � 0.051). Mice pretreated withanti-CD40 alone showed levels of serum IFN-� and IL-12 p70 (2.1 and 0.10 ng/ml) that were undetectable in normal mouse sera. D, Anti-CD40 Ab inducescirculating IFN-�. Shown are the mean and SEM for IFN-� (nanograms per milliliter) in sera obtained at the indicated times after injection with anti-CD40(n � 5 mice per time point). Six and 24-h levels were significantly �0 and 3-h concentrations (p � 0.05).
anti-CD40-expanded cytokine synthesis in response to Toll re-ceptor activation (24). However, compared with their respectivePBS-pretreated controls, anti-CD40-pretreated RAG KO micegenerated as much or more LPS-induced IFN-� and IFN-� asdid anti-CD40-pretreated wild-type C57BL/6 (Fig. 2). The2-fold increase in RAG2 KO production of IL-12 p70 comparedwith wild-type mice was not significant. These findings confirmthat the cytokine-enhancing effects of anti-CD40 pretreatmentare mediated by mechanisms not dependent on the presence ofT or B cells.
Anti-CD40-enhanced synthesis of IFN-�, but not IFN-� andIL-12, is regulated by the type I IFNR
IFN-� synthesis in endotoxemic mice is normally autoregulated bythe IFN-�/IFN-�R responding to IFN-� stimulated throughMyD88-independent pathways downstream from TLR4 (7). Weconfirmed that a similar pattern of type I IFN self-induction wasessential for the augmented release of IFN-� in anti-CD40-pretreated mice (Fig. 3). Compared with anti-CD40 pre-treated wild-type 129S6/SvEv mice that generated 100-fold in-creased levels of IFN-� after LPS challenge relative to controlendotoxemic mice, type I IFNR KO mice failed to generate anysignificant increase in IFN-� relative to the amounts induced byLPS or anti-CD40 alone. Although type I IFN was released beforeIL-12 p70 or IFN-� in this model, IFN-�/IFN-�R deficiency didnot alter the LPS-induced increase in these cytokines inanti-CD40-pretreated mice.
Anti-CD40 pretreatment increases IFN-� production through anIFN-�-dependent mechanism
Although IFN-� is not known to regulate IFN-� synthesis, bothtype I and type II IFNRs share downstream signaling and RNA-transactivating components that can mediate similar in vivo LPS-sensitizing effects (25, 26). Because anti-CD40 injection signifi-cantly increased levels of circulating IFN-� before LPS challenge(Fig. 1D), we tested whether the enhanced IFN-� synthetic re-sponse was IFN-� dependent. Consistent with a novel regulatoryrole for IFN-� over the quantity of type I IFN produced, IFN-� KOC57BL/6 mice pretreated with anti-CD40 failed to increase theirIFN-� response to LPS compared with PBS-pretreated controls(Fig. 4A). In contrast, wild-type C57BL/6 mice pretreated withanti-CD40 showed a 2-log increase in LPS-inducible IFN-�. Thepresence or absence of IFN-� competency had no significant effecton anti-CD40-expanded production of IL-12 p70 (30% difference,p � 0.05), consistent with previous reports of IFN-�-independentproduction of IL-12 p70 during endotoxemia (27). To specificallydetermine whether circulating IFN-� induced by anti-CD40 was
necessary for amplifying IFN-� production to later LPS challenge,C3H/HeN mice were pretreated with anti-CD40 with or withoutinjection of neutralizing anti-IFN-� IgG (0.5 mg) 2 h before. Micecotreated with both anti-CD40 and anti-IFN-� produced 11-foldless serum IFN-� after LPS challenge than did mice pretreatedonly with anti-CD40 (Fig. 4B). In contrast, anti-IFN-� injected 2 hbefore LPS challenge failed to reduce the IFN-� response in anti-CD40-pretreated mice. These findings confirm a direct regulatoryeffect of anti-CD40-induced IFN-� and indicate that these effectsare mediated before LPS challenge.
FIGURE 2. Anti-CD40 pretreatment enhances compara-ble LPS-inducible serum cytokine responses in wild-typeand B and T cell-deficient mice. Groups of five C57BL/6mice, either wild-type (RAG WT) or RAG2-deficient (RAGKO), were pretreated with rat IgG (�) or anti-CD40 Ab (�)24 h before challenge with LPS or PBS as described above.Shown are the mean concentration and SEM of the indicatedcytokines in nanograms per milliliter at 5 h after LPS chal-lenge. As indicated by the asterisk (�), levels of IFN-�, IL-12p70, and IFN-� were significantly increased after LPS chal-lenge of anti-CD40-pretreated RAG (�/�) and (�/�) micecompared with their respective controls treated with rat IgG�
or anti-CD40 without challenge or with rat IgG-pretreatedfollowed by LPS challenge (�, p � 0.05; Student’s t test).Brackets indicate nonsignificant (N.S.) differences betweencytokine production in wild-type and RAG knockout afteranti-CD40 pretreatment and LPS challenge.
FIGURE 3. Type I IFNR is necessary for expansion of IFN-�, but notIL-12 p70 and IFN-�, production, in response to LPS. Groups of five129S6 mice, expressing either wild-type (�/�) or IFN-�/IFN-�R knock-out (�/�) genotypes, were pretreated with either rat IgG or anti-CD40 IgGor, as indicated by � or �, respectively. Mice were challenged with eitherLPS (�) or PBS (�) 24 h later. Shown are the mean and SEM concen-trations of IFN-�, IFN-�, and IL-12 p70 in serum taken 5 h after LPSchallenge. Brackets indicate that anti-CD40-expanded, LPS-induced IFN-�production was significantly decreased in IFN-�/IFN-�R-deficient micecompared with wild-type mice (�, p � 0.05), but that IL-12 p70 and IFN-�levels were nonsignificantly (N.S.) changed as determined by Student’s t test.
5998 ANTI-CD40 AND IFN-� COAMPLIFY LPS-INDUCIBLE IFN-� PRODUCTION
IFN-� treatment alone is insufficient to expand IFN-� syntheticcapacity in vivo
To determine whether IFN-� alone could substitute for anti-CD40to increase LPS-inducible IFN-� production, groups of C3H/HeNmice were pretreated once i.p. with either rat IgG or anti-CD40 ortwice on successive days with 20 �g of rIFN-� before challengewith LPS on the third day. Pretreatment with rIFN-� was sufficientto increase LPS-induced serum levels of IL-18 at 3 h (Fig. 4C) andto increase TNF-� at 1.5 h relative to controls (1.3 ng � 0.33ng/ml compared with 0.12 � 0.06 ng/ml; p � 0.05). However,relative to 100-fold increases in serum IFN-� present in anti-CD40-pretreated mice, rIFN-� pretreatment only increased LPS-induced IFN-� levels 4-fold over rat IgG-pretreated controls, anincrease that was not statistically significant ( p � 0.05). IFN-� istherefore necessary, but not sufficient, to increase systemic IFN-�synthetic capacity after anti-CD40 pretreatment.
Anti-CD40 pretreatment expands IFN-� production to poly(I:C),but not to Pam3Cys or CpG challenges
We determined that CD40 pretreatment expanded IFN-� produc-tion in response to challenges with TLR agonists other than LPS.
Both LPS and poly(I:C) challenges triggered similar levels of cir-culating IFN-� in anti-CD40-pretreated mice (Table I), althoughthe increase from PBS-pretreated control mice was only 5-fold forpoly(I:C) due to higher levels of induction in control mice com-pared with LPS. Similar to results obtained using LPS, poly(I:C)-elicited IFN-� in anti-CD40-primed mice was dependent on IFN-�activity, as demonstrated by a significant 56% reduction in cyto-kine release when anti-CD40 was administered with anti-IFN-�Ab. In contrast, neither the TLR2 agonist Pam3Cys nor a TLR9-active CpG oligonucleotide generated significant increases inIFN-� production after anti-CD40 pretreatment relative to PBS-pretreated controls (�2-fold increase, p � 0.05). Anti-CD40 se-lectively expands LPS- and poly(I:C)-inducible IFN-� productionby a common IFN-�-dependent mechanism in vivo, but does notalter type I IFN synthetic capacity in response to at least two otherheterologous TLR agonists.
Anti-CD40 expanded IFN-� production localizes to splenicCD11c� cells
IFN-� levels were assayed in homogenates of selected tissues ob-tained 2 h after LPS challenge of PBS- or anti-CD40-pretreated
FIGURE 4. IFN-� is necessary, but not sufficient, for anti-CD40-mediated expansion of IFN-� synthetic capacity in vivo. A, Groups of five C57BL/6wild-type (�/�) or IFN-�-deficient (�/�) mice were pretreated with rat IgG or anti-CD40 IgG as indicated by � and �. All were challenged with LPS24 h later. Shown are the mean and SEM concentrations of serum IFN-� and IL-12 p70 at 4 h after challenge. Anti-CD40-expanded LPS-inducible IFN-�production in wild-type mice, but IFN-� �/� mice significantly underproduced IFN-� (�, p � 0.05). No significant difference (NS) was observed foranti-CD40-expanded IL-12 p70 production in these two mouse groups. B, Groups of five C3H/HeJ mice were pretreated with saline with or without laterLPS challenge. One group was anti-CD40 IgG pretreated (�) and LPS challenged. Two other groups of anti-CD40-injected mice were alternatively treatedwith 0.5 mg of neutralizing anti-IFN-� IgG (XMG1.2) 2 h before anti-CD40 or 2 h before the LPS challenge (22 h after anti-CD40 injection). Sera wereobtained and assayed for IFN-� at 4 h after LPS challenge and results shown as mean and SEM concentration. Anti-IFN-� Ab only significantly impairedanti-CD40-enhanced production of IFN-� when administered before anti-CD40 (�, p � 0.05), but not before LPS (p � 0.34). C, C3H/HeN mice werepretreated with either rat IgG, anti-CD40 IgG or 10 �g of rIFN-� given by i.p. injection, followed by LPS challenge 24 h later. Shown are the mean andSEM concentrations for LPS-inducible IFN-�, IL-12 p70, and IL-18 in sera 4 h after LPS challenge. Anti-CD40 pretreatment increased IFN-�, IL-18, andIL-12 p70 production after LPS challenge significantly (p � 0.01) with respect to rat IgG-pretreated controls. rIFN-� pretreatment was sufficient tosignificantly increase LPS-induced IL-18 levels relative to rat IgG pretreatment (p � 0.05), but failed to significantly increase IFN-� or IL-12 p70.
mice. Anti-CD40-expanded IFN-� production was evident only inspleen tissue (Fig. 5, top panel). Based on this information, spleno-cytes from anti-CD40-pretreated mice were cultured withpoly(I:C) and shown to produce 4-fold more IFN-� than did PBS-pretreated splenocytes (Fig. 5, middle panel). Unexpectedly, LPSdid not stimulate IFN-� production in anti-CD40-pretreatedsplenocyte cultures and subsequent studies instead identified cel-lular sources of IFN-� using poly(I:C) as a mechanistically rele-vant substitute stimulus. In three studies, anti-CD40-pretreatedsplenocytes were depleted or enriched for CD11b� or CD11c�
cells using Ab-coated magnetic beads and production of poly(I:C)-inducible IFN-� was shown to segregate with the presence ofCD11c� cells (Fig. 5, bottom panel). IFN-� production did notsort according to enrichment for the NK cell marker DX5, rulingout CD11c� NK cells as a source (data not shown). These findingswere consistent with splenic dendritic cells as the source of anti-CD40-augmented IFN-� synthesis.
Production of IFN-� by cultured dendritic cells issynergistically increased by combinations of IFN-� andanti-CD40
We tested whether IFN-� and anti-CD40 were both required toexpand poly(I:C)-inducible IFN-� production in dendritic cells ob-tained from Flt3L-expanded bone marrow cultures. Cells harvestedfrom 10-day-old cultures contained 60% myeloid (CD11c�/CD11b�) and 40% plasmacytoid (CD11clow/CD11b�/B220�)dendritic cells, as originally described (24). Following a 4-h pre-incubation with medium, rIFN-�, or anti-CD40 alone or rIFN-�and anti-CD40 combined, the conditioned cells were stimulatedwith poly(I:C) for another 20 h. In five separate studies, poly(I:C)generated IFN-� levels that were highest in rIFN-�/anti-CD40-preincubated cultures, at levels that were at least 6-fold greaterthan observed after either rIFN-� or anti-CD40 preincubation (Fig.6, top panels). LPS was an inconsistent stimulus for IFN-� in somestudies, despite reproducibly triggering dendritic cell production ofIL-12 p70 and IL-6. However, IFN-�-inducing activity was re-stored in subsequent studies using freshly prepared and sonicatedLPS reagent (Fig. 6, bottom panel).
CpG proved to be a strong inducer of IFN-� in these cultures,showing similar levels of synergy for IFN-� and anti-CD40. Thepattern of cytokine induction for IL-12 p70 was also IFN-� andCD40 synergistic, although induction was less restricted with re-gard to the specific TLR/pathogen-associated molecular patterninteraction, as LPS, peptidoglycan, R848, and CpG were all activestimuli. In contrast, the pattern of regulation over IL-6 production
by IFN-� and anti-CD40 was additive and all of the TLR agoniststested effectively induced IL-6 synthesis. These findings show anunexpected and strongly synergizing regulatory effect of IFN-�and CD40 on the IFN-�- and IL-12 p70-productive capacity ofdendritic cells that was not apparent for IL-6 production.
DiscussionDendritic cells and macrophages constitutively express TLR thatactivate preprogrammed cytokine responses in response to specificsets of microbial molecules. The types and amounts of cytokineinitiated by TLR activation are not fixed, but can be modified bythe presence of costimulatory or cytokine signals. In this report, weconfirm that the CD40L-mimetic Ab, FGK45, reprograms innateimmunity for increased synthesis of IL-12 and IFN-� in responseto LPS, poly(I:C), and Pam3Cys. CD40-mediated expansion ofinnate immune function has been well-described, both in its use asa dendritic cell-maturational agent and as a signal synergizing withconcurrent TLR engagement (16, 17). However, the central andnovel findings of this study are that anti-CD40 also primes for adramatic expansion of IFN-� production in response to either LPSor poly(I:C), that the reprogramming of IFN-� synthesis requires�6 h of exposure to anti-CD40 and that IFN-� bioactivity presentafter anti-CD40 treatment is a necessary cofactor in up-regulationof IFN-� synthesis. Finally, we identify splenic dendritic cells asa probable source of increased IFN-� synthesis in vivo and con-firm that anti-CD40 and rIFN-� combine synergistically to dra-matically increase IFN-� synthetic capacity in cultures of bonemarrow-derived dendritic cell. Synergy was also observed forIL-12 p70 production, but not for IL-6 in response to the sameTLR challenges, suggesting differing effects on distinct cytokine-specific synthetic pathways. On the basis of these findings, wepropose that anti-CD40 promotes IFN-� synthesis both directly, byactivating dendritic cell CD40, and indirectly, by triggering IFN-�production during the requisite conditioning period. These findingsare important in that they identify a new mechanism by whichsynergistic signals produced by activated T cells can regulate in-nate type I IFN responses.
To our knowledge, an IFN-�-dependent mechanism for regula-tion of IFN-� synthesis has not been described. This may reflectthe unusual context in which two distinct signals were required toachieve the regulatory effect. Although IFN-� was essential forIFN-� up-regulation, treatment with recombinant mouse IFN-�alone did not expand IFN-� synthetic capacity. We propose thatanti-CD40 Ab and IFN-� act together in support of high-levelIFN-� synthesis in the in vivo model. Although anti-CD40 may
Table I. Anti-CD40-pretreated mice produce increased IFN-� in response to LPS and poly(I:C), but not Pam3Cys or CpG challenges
a Where indicated, mice were pretreated with both anti-CD40 Ab and 0.5 mg of neutralizing anti-IFN-� XMG1.2.b Groups of five C3H/HeN mice were pretreated with PBS alone or PBS containing 0.2 mg of FGK45 anti-CD40 Ab. Twenty-four hours later, mice were challenged with
the indicated amounts of LPS, Pam3Cys, poly(IC) or CpG oligonucleotide. Sera were obtained at 4 h after challenge.c Cytokine concentration is significantly compared to PBS control at p � 0.05.d IFN-� levels are significantly reduced compared to mice pretreated with anti-CD40 without anti-IFN-� at p � 0.05.e Mice were pretreated at 0 h as indicated but were challenged at 24 h with PBS only.f Mice were pretreated at 0 h as indicated but were challenged at 24 h with CpG (1846) 300 �g.
6000 ANTI-CD40 AND IFN-� COAMPLIFY LPS-INDUCIBLE IFN-� PRODUCTION
induce additional intermediary factors that critically interact withIFN-� to alter cytokine synthetic capacity, this seems unlikelygiven the synergistic effects of rIFN-� and anti-CD40 when theywere directly applied to dendritic cell culture. We also show thatIFN-� synthesis after anti-CD40 pretreatment was necessary toalter IFN-� production. Serum levels of IFN-� that peaked be-tween 6 and 24 h after anti-CD40 injection were necessary forincreased IFN-� synthesis, whereas IFN-� produced after LPSchallenge was not. This probably explains why only delayed, andnot synchronous, LPS challenges demonstrated an increasedIFN-� response. Separating the primary CD40 and secondary LPSchallenge by 24 h also markedly increased serum IL-12 p70, IL-6,and IL-18 synthesis, although the role of IFN-� as a critical anti-CD40-induced mediator of these responses requires further study.
The failure of simultaneous pretreatment with anti-CD40 andLPS to expand cytokine levels to a second LPS challenge 24 h latersuggests that premature exposure to LPS had a dominant and neg-ative effect on acquisition of new innate synthetic functions. Thisresembles the phenomenon of endotoxin tolerance. In this model,LPS causes macrophages to become unresponsive to subsequentTLR activation due to complex disruptions of signal transduction(28, 29). More specific to these studies, LPS separately depletesdendritic cells in multiple tissues, thereby removing a cell typecritical to the systemic IL-12 p70 response (30). We previouslyshowed that dendritic cell depletion by LPS prevented the cyto-kine-enhancing and dendritic cell preserving effects of CpG whenthe two TLR agonists were coadministered to mice (22). Thesenew results reported here suggest that LPS-dominant and -negativeregulatory effects similarly disrupt anti-CD40 expansion of cyto-kine synthesis by removing dendritic cells that are the source ofanti-CD40-expanded IFN-� production.
The finding that dendritic cells were effective targets for syner-gistic IFN-�/anti-CD40-conditioning defines a culture model inwhich the molecular mechanisms of synergy can be better defined.Although combined CD40L and CpG stimuli synergistically acti-vate dendritic cell cytokine production in culture (31), we showthat IFN-� further amplifies cytokine synthetic capacity. Both my-eloid and plasmacytoid dendritic cell subsets responded to the reg-ulatory effects of anti-CD40 and IFN-�. We first observed thatsuperinduction of IFN-� in anti-CD40-pretreated mice was re-stricted to poly(I:C) and LPS challenges and depended on autoin-duction through the type I IFNR. This was most consistent with amyeloid dendritic cell target. However, CpG-induced IFN-� wasalso markedly increased by anti-CD40/rIFN-� in Flt3L-expandeddendritic cell culture, which is known to contain both myeloid andplasmacytoid dendritic cells (23). The lack of CpG-inducibleIFN-� in anti-CD40-pretreated mice, relative to LPS or poly(I:C)stimuli, probably reflects the much decreased representation ofplasmacytoid dendritic cells in C57BL/6 spleen compared withFlt3L-derived bone marrow dendritic cell cultures (32) or mayindicate that there are additional cell populations in mouse tissueresponding to TLR4 and TLR3 signals. The similar ability ofIFN-� and anti-CD40 to superinduce IFN-� by either MyD88-independent (LPS- and poly(I:C)) or by MyD88-dependent (CpG)stimuli suggests a regulatory mechanism that either nonspecificallyincreases TLR expression or that acts distal to the MyD88-distinctportions of TLR-induced signal transduction. Although IFN-� isknown to up-regulate TLR4 expression as a mechanism for in-creased cytokine synthesis (33), levels of splenic mRNA forTLR2, TLR4, and TLR9 were either unchanged or reduced at 24 hafter anti-CD40 treatment. Furthermore, surface expression ofTLR2 on splenic macrophages was unchanged by anti-CD40 pre-treatment (data not shown). An alternative possibility is that acti-vation of two distinct receptor families by IFN-� and anti-CD40
FIGURE 5. Anti-CD40-enhanced production of IFN-� localizes tospleen and segregates with CD11c� cell populations. Top panel, Groupsof three C3H/HeN mice were pretreated with rat IgG or with anti-CD40followed by either PBS or LPS challenge. Two hours after LPS chal-lenge, the indicated tissues were harvested, pooled, homogenized in thepresence of proteinase inhibitors, and the clarified homogenates wereassayed for IFN-� by ELISA. Shown are the means of duplicate assaysfor each tissue. Middle panel, Cultures of spleen cells from PBS oranti-CD40-pretreated C3H/HeN mice were incubated with increasingconcentrations of poly(I:C) for 24 h and IFN-� was assayed. Bottompanel, Anti-CD40-pretreated spleen cells were depleted or enriched forCD11c and CD11b cells using magnetic beads; the eluted cells wereadjusted to 107 cells/ml and incubated 24 h with medium alone or me-dium containing 30 �g/ml poly(I:C) as indicated in the legend. Shownare the mean concentrations of IFN-� in picograms per milliliter fromtriplicate assays. Relative to preselected control cells, the amounts ofpoly(I:C)-induced IFN-� in CD11c-depleted cultures were significantlyreduced (�, p � 0.05) whereas IFN-� produced in CD11c-enrichedcultures were significantly increased (†, p � 0.05). Depletion with anti-CD11b beads or sham depletion with anti-human CD56 beads did notsignificantly affect IFN-� production relative to preselection controlcultures.
results in complementary signal cascades that synergistically en-hance IFN-� production at the level of transcriptional regulation.A similar explanation has been proposed for recent observations ofsynergy between different TLR for cytokine production (34).
In summary, we report the novel finding that anti-CD40 pre-treatment promotes an IFN-�-dependent up-regulation of LPS-in-duced IFN-� synthesis in amounts that approach those obtained inresponse to live viral infection (4). We propose that activation ofCD40 on dendritic cells results in low-level synthesis of IFN-� invivo that, in combination with direct effects of anti-CD40, in-creases the synthetic capacity for IFN-� in response to suitableTLR stimuli. Based on results obtained using cultured dendriticcells, CD40 and IFN-� probably modulate cytokine production inboth myeloid and plasmacytoid dendritic cell populations (35, 36).The in vivo significance of this observation needs to be confirmed.We speculate that CD40/IFN-�-regulated IFN-� synthesis maycontribute to biologically relevant host responses against viral in-fections, especially in settings where activated Ag-specific T cellsprovide both CD40L and IFN-� during cognate interactions withdendritic cells. Through these molecular interactions, products ofan adaptive immune response may instruct TLR-driven innate im-munity to evolve specialized functions that are adapted to distinctinfectious threats and that reflect the Ag specificity of the accom-panying memory or effector T cell responses.
AcknowledgmentsWe thank Robert Fairchild for his provision of IFN-�/IFN-�R KO miceand Donald Anthony, Eric Pearlman, and Christopher King for criticalreading and discussion of the manuscript. We also gratefully acknowledgeGopal Yadavalli and Lopamudra Das for valuable discussions.
DisclosuresThe authors have no financial conflict of interest.
References1. Pestka, S., C. D. Krause, and M. R. Walter. 2004. Interferons, interferon-like
cytokines, and their receptors. Immunol. Rev. 202: 8–32.2. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Im-
munol. 21: 335–376.3. Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Adams, N. W. Gale,
A. Iwasaki, and R. A. Flavell. 2004. Recognition of single-stranded RNA virusesby Toll-like receptor 7. Proc. Natl. Acad. Sci. USA 101: 5598–5603.
4. Tabeta, K., P. Georgel, E. Janssen, X. Du, K. Hoebe, K. Crozat, S. Mudd,L. Shamel, S. Sovath, J. Goode, et al. 2004. Toll-like receptors 9 and 3 as es-sential components of innate immune defense against mouse cytomegalovirusinfection. Proc. Natl. Acad. Sci. USA 101: 3516–3521.
5. Fantuzzi, G., A. J. Puren, M. W. Harding, D. J. Livingston, and C. A. Dinarello.1998. Interleukin-18 regulation of interferon � production and cell proliferationas shown in interleukin-1�-converting enzyme (caspase-1)-deficient mice. Blood91: 2118–2125.
6. Wysocka, M., M. Kubin, L. Q. Vieira, L. Ozmen, G. Garotta, P. Scott, andG. Trinchieri. 1995. Interleukin-12 is required for interferon-� production andlethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672–676.
FIGURE 6. Anti-CD40 and rIFN-� synergistically expand poly(I:C)-induced IFN-� synthesis by Flt3L-expanded bone marrow dendritic cells. Toppanels, C57BL/6 marrow-derived dendritic cells were obtained from 10-day cultures and incubated for 4 h in medium, or medium containing 10 ng/mlrIFN-�, 10 �g/ml anti-CD40 or both, as indicated by the legend. At 4 h, TLR agonists were added as indicated on the ordinate; medium: poly(I:C) at 30�g/ml final concentration, LPS at 100 ng/ml, peptidoglycan (PGN) at 100 ng/ml, R848 at 5 �g/ml, or CpG ODN at 10 �g/ml. Supernatants were obtainedafter another 20 h of culture and assayed for IFN-�, IL-12 p70, and IL-6 as indicated on the abscissa. Asterisks (�) by the combined IFN-�/anti-CD40culture bar indicate a significant increase in cytokine concentration compared with the other three culture preconditions. For IFN-� and IL-12 p70, combinedpreconditioning resulted in cytokine concentrations that were synergistic, defined as being at least two times greater than the sum of concentrations presentin IFN-�- and anti-CD40-preconditioned cells for the same stimulus. IL-6 production was additive for combined-compared with singly preconditioned cells.Bottom panel, Repeat study showing synergistic effects of anti-CD40 and rIFN-� on LPS- and poly(I:C)-induced IFN-� production by bone marrow-deriveddendritic cells. LPS was freshly prepared and sonicated before culture. Brackets (��) indicate significant increases in IFN-� for the indicated comparisonsbetween anti-CD40/rIFN-�-preincubated cells (p � 0.05). �, significant increases comparing anti-CD40/rIFN-�-preincubated cells compared with cellsincubate singly with media, rIFN-�, or anti-CD40 (p � 0.01).
6002 ANTI-CD40 AND IFN-� COAMPLIFY LPS-INDUCIBLE IFN-� PRODUCTION
7. Karaghiosoff, M., R. Steinborn, P. Kovarik, G. Kriegshauser, M. Baccarini,B. Donabauer, U. Reichart, T. Kolbe, C. Bogdan, T. Leanderson, et al. 2003.Central role for type I interferons and Tyk2 in lipopolysaccharide-induced en-dotoxin shock. Nat. Immunol. 4: 471–477.
8. Malmgaard, L., T. P. Salazar-Mather, C. A. Lewis, and C. A. Biron. 2002. Pro-motion of �/� interferon induction during in vivo viral infection through �/�interferon receptor/STAT1 system-dependent and -independent pathways. J. Vi-rol. 76: 4520–4525.
9. Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasmacytoid dendritic cells inimmunity. Nat. Immunol. 5: 1219–1226.
10. Boehm, U., T. Klamp, M. Groot, and J. C. Howard. 1997. Cellular responses tointerferon-�. Annu. Rev. Immunol. 15: 749–795.
11. Hoebe, K., E. M. Janssen, S. O. Kim, L. Alexopoulou, R. A. Flavell, J. Han, andB. Beutler. 2003. Upregulation of costimulatory molecules induced by lipopoly-saccharide and double-stranded RNA occurs by Trif-dependent and Trif-inde-pendent pathways. Nat. Immunol. 4: 1223–1229.
12. Byrnes, A. A., X. Ma, P. Cuomo, K. Park, L. Wahl, S. F. Wolf, H. Zhou,G. Trinchieri, and C. L. Karp. 2001. Type I interferons and IL-12: convergenceand cross-regulation among mediators of cellular immunity. Eur. J. Immunol. 31:2026–2034.
13. Cousens, L. P., R. Peterson, S. Hsu, A. Dorner, J. D. Altman, R. Ahmed, andC. A. Biron. 1999. Two roads diverged: interferon �/�- and interleukin 12-me-diated pathways in promoting T cell interferon � responses during viral infection.J. Exp. Med. 189: 1315–1328.
14. Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, and T. P. Salazar-Mather.1999. Natural killer cells in antiviral defense: function and regulation by innatecytokines. Annu. Rev. Immunol. 17: 189–220.
15. Byrnes, A. A., J. C. McArthur, and C. L. Karp. 2002. Interferon-� therapy formultiple sclerosis induces reciprocal changes in interleukin-12 and interleukin-10production. Ann. Neurol. 51: 165–174.
16. Edwards, A. D., S. P. Manickasingham, R. Sporri, S. S. Diebold, O. Schulz,A. Sher, T. Kaisho, S. Akira, and C. Reis e Sousa. 2002. Microbial recognitionvia Toll-like receptor-dependent and -independent pathways determines the cy-tokine response of murine dendritic cell subsets to CD40 triggering. J. Immunol.169: 3652–3660.
17. Hochrein, H., K. Shortman, D. Vremec, B. Scott, P. Hertzog, and M. O’Keeffe.2001. Differential production of IL-12, IFN-�, and IFN-� by mouse dendritic cellsubsets. J. Immunol. 166: 5448–5455.
18. Ferlin, W. G., T. von der Weid, F. Cottrez, D. A. Ferrick, R. L. Coffman, andM. C. Howard. 1998. The induction of a protective response in Leishmania ma-jor-infected BALB/c mice with anti-CD40 mAb. Eur. J. Immunol. 28: 525–531.
19. Martin, D. L., C. L. King, E. Pearlman, E. Strine, and F. P. Heinzel. 2000. IFN-�is necessary but not sufficient for anti-CD40 antibody-mediated inhibition of theTh2 response to Schistosoma mansoni eggs. J. Immunol. 164: 779–785.
20. Ridge, J. P., F. Di Rosa, and P. Matzinger. 1998. A conditioned dendritic cell canbe a temporal bridge between a CD4� T-helper and a T-killer cell. Nature 393:474–478.
21. Rolink, A., F. Melchers, and J. Andersson. 1996. The SCID but not the RAG-2gene product is required for S�-S� heavy chain class switching. Immunity 5:319–330.
22. Gould, M. P., J. A. Greene, V. Bhoj, J. L. DeVecchio, and F. P. Heinzel. 2004.Distinct modulatory effects of LPS and CpG on IL-18-dependent IFN-� synthe-sis. J. Immunol. 172: 1754–1762.
23. Gilliet, M., A. Boonstra, C. Paturel, S. Antonenko, X. L. Xu, G. Trinchieri, A.O’Garra, and Y. J. Liu. 2002. The development of murine plasmacytoid dendriticcell precursors is differentially regulated by FLT3-ligand and granulocyte/mac-rophage colony-stimulating factor. J. Exp. Med. 195: 953–958.
24. Wagner, M., H. Poeck, B. Jahrsdoerfer, S. Rothenfusser, D. Prell, B. Bohle,E. Tuma, T. Giese, J. W. Ellwart, S. Endres, and G. Hartmann. 2004. IL-12p70-dependent Th1 induction by human B cells requires combined activation withCD40 ligand and CpG DNA. J. Immunol. 172: 954–963.
25. Doughty, L., K. Nguyen, J. Durbin, and C. Biron. 2001. A role for IFN-�� invirus infection-induced sensitization to endotoxin. J. Immunol. 166: 2658–2664.
26. Platanias, L. C. 2005. Mechanisms of type-I- and type-II-interferon-mediatedsignalling. Nat. Rev. Immunol. 5: 375–386.
27. Heinzel, F. P., R. M. Rerko, F. Ahmed, and A. M. Hujer. 1996. Interferon-�-independent production of interleukin-12 during murine endotoxemia. J. Immu-nol. 157: 4521–4528.
28. Kobayashi, K., L. D. Hernandez, J. E. Galan, C. A. Janeway, Jr., R. Medzhitov,and R. A. Flavell. 2002. IRAK-M is a negative regulator of Toll-like receptorsignaling. Cell 110: 191–202.
29. Ropert, C., M. Closel, A. C. Chaves, and R. T. Gazzinelli. 2003. Inhibition of ap38/stress-activated protein kinase-2-dependent phosphatase restores function ofIL-1 receptor-associate kinase-1 and reverses Toll-like receptor 2- and 4-depen-dent tolerance of macrophages. J. Immunol. 171: 1456–1465.
30. Wysocka, M., S. Robertson, H. Riemann, J. Caamano, C. Hunter, A. Mackiewicz,L. J. Montaner, G. Trinchieri, and C. L. Karp. 2001. IL-12 suppression duringexperimental endotoxin tolerance: dendritic cell loss and macrophage hypore-sponsiveness. J. Immunol. 166: 7504–7513.
31. Krug, A., A. Towarowski, S. Britsch, S. Rothenfusser, V. Hornung, R. Bals,T. Giese, H. Engelmann, S. Endres, A. M. Krieg, and G. Hartmann. 2001. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus forplasmacytoid dendritic cells which synergizes with CD40 ligand to induce highamounts of IL-12. Eur. J. Immunol. 31: 3026–3037.
32. Asselin-Paturel, C., G. Brizard, J. J. Pin, F. Briere, and G. Trinchieri. 2003.Mouse strain differences in plasmacytoid dendritic cell frequency and functionrevealed by a novel monoclonal antibody. J. Immunol. 171: 6466–6477.
33. Frleta, D., R. J. Noelle, and W. F. Wade. 2003. CD40-mediated up-regulation ofToll-like receptor 4-MD2 complex on the surface of murine dendritic cells.J. Leukocyte Biol. 74: 1064–1073.
34. Napolitani, G., A. Rinaldi, F. Bertoni, F. Sallusto, and A. Lanzavecchia. 2005.Selected Toll-like receptor agonist combinations synergistically trigger a T helpertype 1-polarizing program in dendritic cells. Nat. Immunol. 6: 769–776.
35. Boonstra, A., C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y. J. Liu, andA. O’Garra. 2003. Flexibility of mouse classical and plasmacytoid-derived den-dritic cells in directing T helper type 1 and 2 cell development: dependency onantigen dose and differential Toll-like receptor ligation. J. Exp. Med. 197:101–109.
36. Ito, T., R. Amakawa, T. Kaisho, H. Hemmi, K. Tajima, K. Uehira, Y. Ozaki,H. Tomizawa, S. Akira, and S. Fukuhara. 2002. Interferon-� and interleukin-12are induced differentially by Toll-like receptor 7 ligands in human blood dendriticcell subsets. J. Exp. Med. 195: 1507–1512.
![TYPE TEXT] [TYPE TEXT] [TYPE TEXT](https://static.documents.pub/doc/80x56/631908f7b41f9c8c6e098cb7/type-text-type-text-type-text.jpg)
