Research article

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expressionanalysis in wounded artichoke heads

Angela Quarta a, Giovanni Mita a, Miriana Durante a, Marco Arlorio b, Angelo De Paolis a,*

a Istituto di Scienze delle Produzioni Alimentari-CNR, Unità di Lecce, Via Prov.le Lecce-Monteroni, 73100 Lecce, ItalybDipartimento di Scienze del Farmaco and Drug and Food Biotechnology (DFB Center), Largo Donegani 2, 28100 Novara, Italy

a r t i c l e i n f o

Article history:

Received 20 December 2012

Accepted 29 March 2013

Available online 11 April 2013

Keywords:

Artichoke

Enzymatic browning

Gene expression

Polyphenol oxidase

a b s t r a c t

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has

been reported to be involved in undesirable browning in many plant foods. This phenomenon is

particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA

encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence up-

stream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var.

scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a

calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region

revealed the presence of cis-acting elements, some of which are putatively involved in the response to

light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was

significantly induced after 48 h, even though the browning process had started earlier. This suggests that

the early browning event observed in artichoke heads was not directly related to de novo mRNA syn-

thesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the up-

stream regulative region in artichoke.

! 2013 Elsevier Masson SAS. All rights reserved.

1. Introduction

Artichoke (Cynara cardunculus var. scolymus L.) is widely culti-

vated in the Mediterranean area [1,2] and its immature flower

heads (or capitula) constitute the edible part of this food plant

much appreciated by the ancient Romans as a tasty vegetable, with

beneficial effects on digestion. Chemical components from arti-

choke, particularly phenolics, have been purified and extensively

characterized [3,4]. Among the 22 major phenolic compounds

identified, 11 caffeoylquinic acids and 8 flavonoids have been

detected. Apigenin 7-O-glucuronide was found to be the major

flavonoid and 1,5-di-O-caffeoylquinic acid the main caffeate in

artichoke heads [5e7].

Several papers have reported that artichoke extracts, due to

their phenolic composition, possess interesting bioactive proper-

ties, such as anticarcinogenic, antibacterial, anti HIV, urinative, bile-

expelling, hepatoprotective and choleretic properties, as well as

inhibiting cholesterol biosynthesis [8e11].

However, although polyphenols are a fundamental molecular

class in foods owing to their health-promoting potential, they are

also the substrate for undesirable oxidative browning reactions,

catalyzed by the polyphenol oxidase enzyme (PPO; 1,2 benzene-

diol:oxygen oxidoreductase; EC 1.10.3.1), widely distributed in

nature [12].

It is well known that antioxidant capacity is positively correlated

with the presence of unoxidized polyphenols; in fact, the formation

of the quinonic forms (either free or in their polymerized form as

oxidized coloured compounds), significantly reduces antioxidant

properties. Therefore, from a nutritional point of view, the

browning phenomenon is generally considered an undesirable trait

in edible plant parts. Some technological approaches have been

exploited in order to eliminate or reduce the enzymatic activity of

PPO, such as dipping in boiling water or in acid solutions, use of an

aqueous steam (blanching), etc. However, a limited number of

technological approaches can be used as alternatives to sulphites,

which though very effective in controlling browning are subject to

regulatory restrictions [12]. Sulphites are potentially responsible

for adverse reactions in sensitized consumers and were therefore

included in Annex IIIa of Directive 2003/89/EC (and following

amendments, the latest coming in the new EU Regulation 1169/

2011, that will apply from 13 December 2014), reporting the list of

allergenic ingredients in foods that must be declared on the label.

Abbreviation: PPO, polyphenol oxidase; PCR, polymerase chain reaction; RACE,

rapid amplification of cDNA ends.

* Corresponding author. Tel.: þ39 0832422608; fax: þ39 0832422620.

E-mail address: angelo.depaolis@ispa.cnr.it (A. De Paolis).

Contents lists available at SciVerse ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

0981-9428/$ e see front matter ! 2013 Elsevier Masson SAS. All rights reserved.

http://dx.doi.org/10.1016/j.plaphy.2013.03.020

Plant Physiology and Biochemistry 68 (2013) 52e60

Replacing sulphites with other safer substances is considered

strategic in the agro-food sector. Moreover, improvements in the

knowledge of enzymatic browning are strategic, given the increase

in food safety concerns. Finally, as previously reported, oxidation of

polyphenols in plant food generally triggers a decrease (or even a

complete loss) of antioxidant capacity. Polyphenol oxidase (PPO; EC

1.10.3.1) also known as phenolase, phenol oxidase, catechol oxidase

or tyrosinase) is a copper enzyme with two different enzymatic

activities: 1) the hydroxylation of monophenols to o-diphenols

(monophenolase activity) and 2) the oxidation of o-diphenols to

reactive o-quinones (diphenolase activity) which then polymerize

to form brown, red or black pigments. PPO genes from different

plant species have been cloned and sequenced, including Solanum

tuberosum [13], Solanum lycopersicon [14], Vicia faba [15], Malus

domestica [16], Vitis vinifera [17], Populus spp [18], Prunus armeniaca

[19] and Ipomoea batatas [20]. Plant PPO genes encode mature

proteins in the range of 52e62 kDa containing transit 8e12 kDa

peptides responsible for transporting the enzyme into the thylakoid

lumen. While plant PPOs are localized in plastids, their substrates

are mainly located in the vacuole, so enzymatic browning occurs

only when this subcellular compartmentalisation is lost [21]. PPOs

are described as bi-copper metalloenzymes with two conserved

copper-binding domains, CuA and CuB, responsible for copper co-

ordination and interaction with molecular oxygen and phenolic

substrates [22]. Each copper atom is presumed to be coordinated by

three histidine residues provided by the CuA and CuB sites.

There are no reports on PPO genes from artichoke, even though

there are several highlights correlated with the purification and

biochemical characterization of the enzyme. The purified enzyme

showed a 57 kDa molecular mass on sodium dodecyl sulphate-

polyacrylamide gel electrophoresis, with optimum pH values of

5.0, 8.0, and 7.0 when 4-methylcatecol, pyrogallol, and catechol

were used as substrates [23,24].

The aim of this study was to clone and sequence the PPO gene

and its promoter from artichoke and to determine the expression

profile of this gene upon wounded artichoke heads.

2. Results

2.1. Isolation of artichoke PPO cDNA

Degenerate primers, designed on the basis of the highly-

conserved domains of various plant PPO genes, were first used to

amplify the 202-bp core fragment from genomic DNA as described

in Material and methods (Fig. 1). After sequencing, the 202 bp

fragment did not show any significant nucleotide homology to

other plant PPO sequences using the Blast-n software. On the other

hand, after in silico translation of the DNA fragment, the Blast-x

program revealed a significant amino acid sequence similarity to

other plant PPO proteins reported in literature and in databases.

On the basis of this encouraging similarity with other plant PPO

genes, we then used a gene specific primer and the universal UPM

(Universal primer mix) as the 30 RACE nested primer and obtained a

1420-bp fragment.

Although different 50 cDNA specific primers were used to isolate

the 50 region of the PPO gene using 50 RACE, the fragments obtained

did not contain any in-frame ATG start codon. Considering these

negative results, we then moved on to a genome walker strategy.

This approach enabled us to obtain a full length ORF of the

artichoke PPO gene and a 1432 bp sequence upstream of the ATG

start codon submitted to the NCBI database (Accession number

KC342809) (Fig. 2).

A detailed analysis of the identified sequence revealed a 1764-bp

coding sequence (NCBI accession number KC342808) (Fig. 1).

Although this coding sequence revealed no significant similarity

Fig. 1. Full-length cDNA and deduced amino acid sequence of CsPPO. The nucleotide

coding sequence is in capital letters, the stop codon is marked with a star. The 50- and

30- untranslated regions are in lowercase. The transit peptide is underlined, and the

two Cu binding sites are double underlined. PPO core fragment of 202 bp is in bold.

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e60 53

with other already reported plant PPO sequences, we observed that

after in silico translation the resulting peptide showed a high degree

of identity in the highly conserved PPO functional motifs.

The Cs-PPO deduced peptide consists of 587 amino acids, with a

theoretical pI/Mw ratio of 5.50/65,327 and was characterized by a

putative 30 amino acid transit peptide in the N-terminal region

(Fig. 1). TargetP indicated a putative localization of the protein

within the chloroplasts.

Structural analysis of the (Cs-PPO) protein confirmed that all the

key motifs of a PPO-like protein were present (Fig. 1). In particular,

the two CuA and CuB active sites defined as copper-binding do-

mains were observed. These features are characteristic for the type-

3 tyrosinase enzyme, inwhich each centre is characterized by three

histidine residues (Fig. 3).

2.2. Bioinformatic analysis of CsPPO

The deduced amino acid sequence of CsPPO was analyzed using

the BLASTp program (http://www.ncbi.nlm.gov/BLAST/) and the

results revealed that the CsPPO polypeptide shared various degrees

of identity with other plant PPOs. The highest identity was

observed towards chloroplastic polyphenol oxidase from Tarax-

acum officinale (70%),Gossypium hirsutum (45%) Camellia nitidissima

(45%), and Ziziphus jujuba (43%).

A phylogenetic tree was constructed using 12 PPO amino acid

sequences from other plant species present in the database. The

dendrogram showed that artichoke Cs-PPO clustered with

T. officinale PPO (Fig. 4).

2.3. CsPPO promoter analysis

To gain further information about the promoter region of the

CsPPO gene, the 1432 bp 50 upstream of the translation start codon

was analyzed. The PLACE Web signal Scan software was used to

search for various cis-acting elements. A TATA-box-like sequence

(ATATAA) was found at position-23, and a CAAT-box-like sequence

was found 19 bp upstream of the TATA box. A putative transcription

start sitewasalso identified17bpupstreamof theATGcodon (Fig. 2).

The PlantCARE and PLACE software identified putative cis-acting

elements involved in light response such as I box (GATAA) [25], GT-

1 box (GRWAAW) [26], Sp1 and Lamp-element. Moreover CsPPO

promoter sequence contained a WUN motif (TCATTACGAA) [27] on

the (e) strand of promoter DNA, a cis-acting element known to be

involved in wound-response (Fig. 2).

2.4. PPO gene expression in wounded artichoke heads

In order to clarify the involvement of the PPO gene in response

towounding, we quantified PPOmRNA levels inwounded artichoke

heads by real-time PCR experiments at different times after

wounding (Fig. 5). The results showed that PPO transcript levels

increased slowly soon after wounding, reaching a peak of about 65

times after 48 h, and then declining after 72 h.

3. Discussion

PPO is a widely distributed enzyme in plants, being involved in

the production of brown pigments (o-quinone-based pigments)

resulting from the oxidation of di-phenol molecules. In this work,

we describe for the first time the cloning of a cDNA encoding a PPO

from artichoke. As reported in the introduction, artichoke is subject

to browning in the early post-harvest stages, particularly after

mechanical damage, and this affects the quality (as well as the

consumer acceptance) of the product. It is therefore crucial to gain

more information on the artichoke PPO gene structure and regu-

lation of its expression in wounded artichoke tissues.

The artichoke sequence isolated and characterized in this work

contains the 50 upstream promoter region. Although no significant

sequence identity was observed at nucleotide level, the deduced

amino acid sequence of CsPPO revealed significant identity with

other plant PPOs. In particular, the similarity of the copper-binding

domains (Cu-A and Cu-B) of CsPPO from artichoke is, significantly,

identical to those reported for other plant PPO proteins. This is

consistent with the essential role of copper in catalytic mecha-

nisms, as previously reported in other studies [28]. We also

observed the presence of a 30 AA amino-terminal signal peptide,

possibly involved in targeting the protein to the chloroplast. Again,

this observation is in agreement with other already reported in-

formation, that suggests that the PPO is localized in the chloroplast

thylakoid lumen [29]. The mature form of the protein contains 557

amino acid residues and shows a 62.14 kDa molecular weight.

Dogan et al., 2005 [24] reported that the molecular mass of PPO

Fig. 2. The 1432 bp promoter region of the CsPPO gene. The putative transcription origin is in capital letters. The TATA and CAAT boxes are in capital letters. Regulative conserved

motifs of light-regulated genes are in bold (I-BOX GATAA, GT1consensus, GRWAAW, GATA BOX). The WUN motif TCATTACGAA on the [estrand of the sequence] is underlined.

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e6054

from artichoke, estimated by SDS-PAGE, was about 57 kDa. This

result differs from that calculated in silico in this study, on the basis

of the cDNA we isolated. Although it can be considered that mo-

lecular masses determined by SDS-PAGE and in silico may slightly

differ, the presence in artichoke of different PPO isoforms cannot be

excluded.

The protein sequence obtained from the in silico translation of

the isolated cDNA revealed that among the other plant species

analyzed, CsPPO shared the highest degree of identity (70%) with

T. officinale PPO, a plant species belonging, like artichoke, to the

Asteraceae family (Fig. 4).

It is known that plant PPO gene expression is induced by

different biotic and abiotic stresses [18,29,30]. In order to identify

putative cis-binding elements in the isolated promoter region of

CsPPO, the sequence was scanned with signal scan software

(PLACE and PlantCARE). The sequence analysis of the upstream

region of the globe artichoke PPO gene revealed the presence of

various regulatory motifs (I box, G box, Sp1 and Lamp-element)

Fig. 3. Multiple alignment of amino acid sequences of the PPO from Ziziphus jujuba, Camellia nitidissima, Gossypium hirsutum, Vitis vinifera, Malus domestica, Populus deltoides,

Phytolacca americana, Nicotiana tabacum, Larrea tridentata, Pyrus pyrifolia, Solanum lycopersicon, Ipomoea batatas, Taraxacum officinale, Triticum aestivum, Oryza sativa, Cynara

cardunculus. The transit peptide is underlined. The two active sites (squares CuA and CuB), including their histidines (black H in shaded box) and a tyrosine motif (square) with a

couple of residues (black Y in white box) are indicated.

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e60 55

Fig. 3. (continued).

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e6056

that are present in most genes induced by light (RBCS, PHYA,

CHS) [25].

It is therefore possible that transcription factors that recognize

these cis-acting elements may regulate the expression of the arti-

choke PPO gene. Moreover, we observed the presence of a WUN

motif involved in wound-induced response [27]. Therefore, pro-

moter deletion experiments in transgenic plants may provide evi-

dence of the involvement of these motifs in regulating the

expression of the CsPPO gene.

In order to investigate the relation between PPO mRNA accu-

mulation and the browning of artichoke tissues observed soon after

artichoke heads are processed and mechanically wounded, the

amount of PPO mRNA in wounded artichoke heads was quantified

by real-time PCR. The high level of mRNA accumulation observed

24e48 h after wounding did not directly correlate with the rapid

appearance of the brown colour on the artichoke heads. It is

worthwhile noting that also in apricot and banana the levels of PPO

expression did not correlate with the observed enzymatic activity

[19,31]. It must be considered, however, as reported in other plant

species, that the PPO genes are organized as a gene family and it is

likely that other PPOmembers are present in artichoke, andmay be

involved in different plant physiological needs.

Although the exact biological role of PPO in plants is still

unclear, in artichoke the observed induction of gene expression

after wounding, suggests a possible role in plant defence. This

hypothesis is supported by experimental evidence obtained in

genetically-modified tomato plants with altered PPO expression.

The authors reported that transformed tomato plants over-

expressing a potato PPO exhibited increased resistance to Pseu-

domonas syringae pv. tomato. Moreover, transgenic tomato plants

in which mRNA levels were not detectable and PPO activity was

highly reduced showed enhanced susceptibility to the same

pathogen [32,33].

Although the mechanism by which PPO contributes to path-

ogen resistance is still unclear, it has been suggested that the

primary product of PPO activity (quinones) could be responsible

for increased levels of reactive oxygen species (ROS), some of

which act as systemic signals able to induce plant defense genes

[33].

According to our data, it seems that the browning of the capitula

occurring soon after mechanical damage is independent of de novo

synthesis of PPO mRNA. It is most likely that the loss of cell

compartmentalization resulting from tissue damage is important in

allowing PPO to react with its cytoplasmic substrates by catalyzing

polyphenol oxidation and the consequent enzymatic browning

phenomenon observed soon after wounding.

It is well known that other non-enzymatic mechanisms may be

involved in the browning process in water-rich fresh plant tissues:

particularly, ascorbic acid oxidation and formation of browned

polymeric pigments by oxidized lipids. An alternative and peculiar

browning mechanism has been suggested by Lattanzio and col-

laborators [12] and is correlated to the formation of pigmented

molecular complexes such as chlorogenic acideFeþþþ following the

release of Fe þþ by oxidative stress in the cell. More precisely,

chlorogenic acids (particularly 1,5-O-dicaffeoyl-quinic acid and 3,5-

O-dicaffeoyl-quinic acid, the most abundant phenolics in artichoke

and considered as the best substrates for PPO) are suggested to be

able to easily bind reduced iron (Feþþ) released from ferritin,

allowing the formation of colourless complexes. After the oxidative

Fig. 3. (continued).

Fig. 4. Neighbour-joining tree phylogenetic analysis of CsPPO. Sequence accession

number are as follows (in brackets): Malus domestica, (BAA21676); Pyrus pyrifolia,

(BAB64530); Populus deltoides, (AAU12257); Vitis vinifera, (P43311); Phytolacca amer-

icana, (BAA08234); Triticum aestivum, (AEY79826.1); Oryza sativa, (ABG23057.1);

Larrea tridentata, (CAA73103); Ipomoea batatas, (AAW78869.1); Cynara cardunculus,

(KC342808); Taraxacum officinale, (CBZ41491.1); Nicotiana tabacum, (CAA73103);

Solanum lycopersicon, (AAB22610); Ziziphus jujuba, (ADR78836); Camellia nitidissima

(ACM43505); Gossypium hirsutum (AFC36521). The numbers on the branches repre-

sent bootstrap support for 1000 replicates.

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e60 57

process occurring in artichoke during cold storage, as previously

observed by Lattanzio and collaborators [12], iron shifts to its

oxidized form (Feþþþ), thereby lending colour to its complexes. In

this case, the same authors suggested a strong and effective

involvement of the chemical oxidation of the phenolics in cold

preserved artichoke, also observing the late involvement of the PPO

enzyme in browning (without any evaluation of the PPO expression

at molecular level).

In conclusion, this work reports the cloning of the PPO gene and

promoter region in artichoke. This is the first time that the time-

course of the expression of this gene has been studied in arti-

choke. Further studies are now in progress to better clarify the

biological role of this PPO gene in artichoke. Moreover, the avail-

ability of the artichoke PPO gene sequence may make it possible to

produce recombinant PPO in microbial models in order to further

clarify the biochemical features of this enzyme.

4. Material and methods

4.1. Plant material and DNA extraction

Leaves and capitula from the artichoke variety “Locale di Mola”

were harvested at the commercial stage from artichoke plants

grown at the Botanical Garden, University of Salento, Lecce, Italy.

For wounding experiments, external bracts were discarded and

heads cut (approximately 0.5 cm # 0.5 cm) with stainless steel

scissors. Samples of approximately 100 g were placed in sealed

plastic containers and stored at room temperature. Injured head

samples were collected at 0, 15, 30, 60 min, then at 2, 4, 8, 24, 48,

72 h, immediately frozen in liquid nitrogen and stored at $80 %C

prior to further analysis.

Total genomic DNA was isolated from leaves, using the cetyl-

trimethylammonium bromide (CTAB) method as previously re-

ported [34].

4.2. Cloning of the core DNA fragment of CsPPO

The core fragment of CSPPO was obtained using total genomic

DNA as template for polymerase chain reaction (PCR) and

degenerate primers ppoF (50-CAACAAGCTARKRTHCATTGTGC-30)

and ppoR (50-GATGRTCCCARTTCCARWAHGG-30) designed on the

highly conserved amino acid blocks of PPO from other species.

PCR reaction was carried out using 50 ng of genomic DNA as

template in a total volume of 50 ml of 1# buffer, 1.5 mM MgCl2,0.2 mM each primer and 2.5 U Taq. DNA polymerase (Promega s.r.l.,

Milan, Italy).

The PCR mix was subjected to the following thermal profile:

94 %C for 3min, followed by 35 cycles of 94 %C for 30 s, 50 %C for 30 s,

72 %C for 1 min and a final extension at 72 %C for 7 min. After

agarose gel electrophoresis, the amplified fragment was cloned into

pGEM-T Easy vector (Promega s.r.l., Milan, Italy) and sequenced by

an ABI3130 genetic analyzer (Applied Biosystems, Life Technologies

Ltd, Paisley, UK). The nucleotide sequence of the cloned fragment

was confirmed by Blast-n similarity search to other plant PPO

genes, using the National Center for Biotechnology Information

website (http//www.ncbi.nlm.nih.gov).

4.3. Cloning of full-length cDNA of CsPPO by RACE

In order to recover the 30 end of the artichoke PPO gene, total RNA

from artichoke heads was extracted using the SV total RNA isolation

system (Promega s.r.l., Milan, Italy) and processed using the 30 RACE

System (Life Technologies Ltd, Paisley, UK). The amplification

of cDNA was performed using a gene specific primer designed on

the basis of the previously isolated core PPO fragment (50-

ACAAAGTGGTCACCCGGAACTACA -30) and the adapter primer pro-

vided with the kit. The PCR reactions were carried out using a ther-

mal profile of 94 %C for 3 min, followed by 35 cycles of 94 %C for 30 s,

52 %C for 30 s, 72 %C for 1min and a final extension at 72 %C for 7min.

Fig. 5. Time-course expression levels of artichoke polyphenol oxidase mRNA in wounded head tissues. Values are the mean of three independent experiments and error bars

represent standard deviation. Columns with an asterisk represent values that differ significantly from control (P < 0.05).

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e6058

Similarly, the 50 end of the PPO gene was obtained using the 50

RACE system (Invitrogen, Life Technologies Ltd, Paisley, UK). The

amplification of the 50 regionwas performed using a specific primer

designed on the basis of the 50 region of the core PPO fragment (50-

TGTAAGCGCCATTGCAGTAAGCAC-30) and the adapter primer pro-

vided with the kit.

The resulting amplicons were analyzed by agarose gel electro-

phoresis, and selected bands were purified using the QIAquick gel

extraction kit (Qiagen, Milan, Italy). After purification, DNA frag-

ments were cloned into pGEM-T Easy vector (Promega s.r.l., Milan,

Italy), and sequenced as reported above.

4.4. Cloning of 50 UTR region and its promoter

The Genome Walker Universal kit (Clontech, Madison, WI) was

used to isolate the globe artichoke PPO promoter sequence,

following the manufacturer’s protocol. Fragments were separated

on agarose gel and DNA was eluted form the band as above re-

ported. Then the DNA fragment was cloned into pGEM-T Easy

vector (Promega s.r.l., Milan, Italy) and sequenced as described

previously. cis-Acting regulatory DNA elements were searched

by using PLACE Signal Scan software (http://www.dna.affrc.go.jp/

htdocs/PLACE/) [35], and PlantCARE (http://bioinformatics.psb.

ugent.be/plantcare/html) [36].

4.5. Phylogenetic analysis

Multiple global sequence alignments were performed using the

ClustalW software (http://www.ebe.ac.uk/clustalw/), setting

default parameters on PPO amino acid sequences of different plant

species recorded in the EMBL database.

Finally, a phylogenetic analysis was conducted on the PPO

amino acid sequence by means of the neighbour-joining method

with phylogenetic and molecular evolutionary analyses using the

MEGA v5.0 software with 1000 bootstrap replicates [37].

4.6. Real-time PCR expression study

In order to study PPO gene expression in wounded artichoke

heads, real-time PCR experiments were performed. Total RNA was

isolated using SV Total RNA Isolation System (Promega s.r.l., Milan,

Italy). First-strand cDNAwas obtained starting from 1 mg total RNA,

using random primers and the ImProm-II Reverse Transcription

System (Promega s.r.l., Milan, Italy), according to the manufac-

turer’s instructions. The probes were labelled at the 50-end with 6-

carboxy-fluorescein and at the 30-end with tetramethylrhodamine

(TAMRA).

Primers and probes (Table 1) used for real-time PCR experi-

ments were purchased from PRIMM s.r.l. (Milan, Italy). Amplifi-

cation was performed in an Applied Biosystems 7500 Real-Time

PCR System (Applied Biosystems, Life Technologies Ltd, Paisley,

UK) using the sequence specific primer set (900 nM each primer),

the specific probe (200 nM), 0.5 ml of the first strand cDNA, 12.5 ml

of TaqMan Universal MasterMix (Applied Biosystems, Life

Technologies Ltd, Paisley, UK), in a total volume of 25 ml. Tran-

scripts were quantified using the comparative quantization

module, as described in the ABI7500 Sequence Detection System

(User Bulletin 2, Applied Biosystems), based on the DDCT method

[38]. The relative expression was normalized against artichoke

actin sequence (EMBL accession no. AM744951), and calculated

using the unwounded samples as a calibrator, whose expression

was arbitrarily set to one.

4.7. Statistical analysis

Results are presented as the mean value & standard deviation

(SD) of three independent experiments. Statistical analysis was

based on a one-way ANOVA using SigmaStat version 11.0 software

(Systat Software Inc., Chicago, IL). The significance of differences

was determined using the HolmeSidak test. P values <0.05 are

considered to be significant.

Acknowledgements

The authors are grateful to Dr. Sofia Caretto begin of the skype

highlighting end of the skype highlighting for helpful comments

and suggestions, to Dr. Vittorio Falco for his technical assistance.

They also thank Dr. Anthony Green for proofreading and providing

valuable linguistic advice.

References

[1] V.V. Bianco, Present situation and future potential of artichoke in the Medi-terranean basin, Acta Hortic. 681 (2005) 39e55.

[2] G. Sonnante, D. Pignone, K. Hammer, The domestication of artichoke andcardoon: from Roman times to the genomic age, Ann. Bot. 100 (2007) 1095e1100.

[3] F. Fratianni, M. Tucci, M. De Palma, R. Pepe, F. Nazzaro, Polyphenoliccomposition in different parts of some cultivars of globe artichoke (Cynaracardunculus L. var. scolymus (L.) Fiori), Food Chem. 104 (2007) 1282e1286.

[4] D. Negro, V. Montesano, S. Grieco, P. Crupi, G. Sarli, A. De Lisi, G. Sonnante,Polyphenol compounds in artichoke plant tissues and varieties, J. Food Sci. 77(2012) 244e252.

[5] K. Schütz, D. Kammerer, R. Carle, A. Schieber, Identification and quantificationof caffeoylquinic acids and flavonoids from artichoke (Cynara scolymus L.)heads, juice, and pomace by HPLC-DAD-ESI/MSn, J. Agric. Food Chem. 52(2004) 4090e4096.

[6] M. Curadi, P. Picciarelli, R. Lorenzi, A. Graifenberg, N. Ceccarelli, Antioxidantactivity and phenolic compounds in the edible parts of early and late Italianartichoke (Cynara scolymus L.) varieties, Ital. J. Food Sci. 17 (2005) 33e44.

[7] J. Wang, C.P. Constabel, Biochemical characterization of two differentiallyexpressed polyphenol oxidases from hybrid poplar, Phytochemistry 64 (2003)115e121.

[8] R. Gebhart, Anticholestatic activity of flavonoids from artichoke and theirmetabolites, Med. Sci. Monit. 7 (2001) 316e320.

[9] J.S.T. Coon, E. Ernst, Herbs for serum cholesterol reduction: a systematic view,J. Fam. Pract. 52 (2003) 468e478.

[10] V. Lattanzio, P.A. Kroon, V. Linsalata, A. Cardinali, Globe artichoke: a func-tional food and source of nutraceutical ingredients, J. Funct. Foods 1 (2009)131e144.

[11] J. Zawistowski, C.G. Biliaderis, N.A.M. Eskin, Polyphenol oxidase, in:D.S. Robinson, N.A.M. Eskin (Eds.), Oxidative Enzymes in Foods, Elsevier,London, 1991, pp. 217e273.

[12] V. Lattanzio, A. Cardinali, D. Di Venere, V. Linsalata, V.S. Palmieri, Browningphenomena in stored artichoke (Cynara scolymus L.) heads: enzymatic orchemical reaction? Food Chem. 50 (1994) 1e7.

[13] P.W. Thygesen, I.B. Dry, S.P. Robinson, Polyphenol oxidase in potato: a mul-tigene family that exhibits differential expression patterns, Plant Physiol. 109(1995) 525e553.

[14] T. Shahar, N. Hennig, T. Gutfinger, D. Hareven, E. Lifschitz, The tomato 66.3-kDpolyphenol oxidase gene: molecular identification and developmentalexpression, Plant Cell 4 (1992) 135e147.

[15] J.W. Cary, A.R. Lax, W.H. Flurkey, Cloning and characterization of a cDNAcoding for Vicia faba polyphenol oxidase, Plant Mol. Biol. 20 (1992) 245e253.

[16] P.K. Boss, R.C. Gardner, B.J. Janssen, G.S. Ross, An apple polyphenol oxidasecDNA is up-regulated in wounded tissues, Plant Mol. Biol. 27 (1995) 429e433.

[17] V.M. Virador, J.P. Reyes Grajeda, A. Blanco-Labra, E. Mendiola-Olaya,G.M. Smith, A. Moreno, J.R. Whitaker, Cloning, sequencing, purification, andcrystal structure of Grenache (Vitis vinifera) polyphenol oxidase, J. Agric. FoodChem. 58 (2010) 1189e1201.

Table 1

Real time PCR primer and probe sequence of artichoke PPO and actin genes.

Gene Amplicon Primer/probes Primer sequence

ppo 79 bp Forcynreal 50GGTTCCCATCGTTCAAACTTAA30

Revcynreal 50AACCACATGCACCAACATCA30

Probcynreal 50TTGCATGCATGCATGCATCTGCT30

Actin 74 bp Foractreal 50CGCATACAGTGCCAATTTATGAA30

Revactreal 50GTCACGGCCAGCAAGATCA30

Proactreal 50TGCTCTTCCTCATGCCATCCTCCG30

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e60 59

[18] C.P. Constabel, L. Yip, J.J. Patton, M.E. Christopher, Polyphenol oxidase fromhybrid poplar. Cloning and expression in response to wounding and herbiv-ory, Plant Physiol. 124 (2000) 285e295.

[19] T. Chevalier, D. de Rigal, D. Mbéguié-A-Mbéguié, F. Gauillard, F. Richard-Forget, B.R. Fils-Lycaon, Molecular cloning and characterization of apricot fruitpolyphenol oxidase, Plant Physiol. 119 (1999) 1261e1269.

[20] Z. Liao, R. Chen, M. Chen, Y. Yang, Y. Fu, Q. Zhang, X. Lan, Molecular cloningand characterization of the polyphenol oxidase gene from sweetpotato, Mol.Biol. 40 (2006) 907e913.

[21] K.C. Vaughn, A.R. Lax, S.O. Duke, Polyphenol oxidase: the chloroplast oxidasewith no established function, Physiol. Plant. 72 (1988) 659e665.

[22] J.C. Steffens, E. Harel, M.D. Hunt, Polyphenol oxidase, in: B.E. Ellis (Ed.), InGenetic Engineering of Plant Secondary Metabolism, Plenum Press, New York,1994, pp. 275e311.

[23] T. Aydemir, Partial purification and characterization of polyphenol oxidasefrom artichoke (Cynara scolymus L.) heads, Food Chem. 87 (2004) 59e67.

[24] S. Dogan, Y. Turan, H. Erturk, O. Arslan, Characterization and purification ofpolyphenol oxidase from artichoke (Cynara scolymus L.), J. Agric. Food Chem.53 (2005) 776e785.

[25] W.B. Terzaghi, A.R. Cashmore, Light-regulated transcription, Annu. Rev. PlantPhysiol. Plant Mol. Biol. 46 (1995) 445e474.

[26] D.X. Zhou, Regulatory mechanism of plant gene transcription by GT-elementsand GT-factors, Trends Plant Sci. 4 (1999) 210e214.

[27] M. Pastuglia, D. Roby, C. Dumas, J.M. Cock, Rapid induction by wounding andbacterial infection of an S gene family receptor-like kinase gene in Brassicaoleracea, Plant Cell 1 (1997) 49e60.

[28] C. Gerdemann, C. Eicken, B. Krebs, The crystal structure of catechol oxidase:new insight into the function of type-3 copper proteins, Acc. Chem. Res. 35(2002) 7019e7031.

[29] O. Emanuelsson, H. Nielsen, G. von Heijne, ChloroP, a neural network-basedmethod for predicting chloroplast transit peptides and their cleavage sites,Protein Sci. 8 (1999) 978e984.

[30] C.P. Constabel, D.R. Bergey, C.A. Ryan, Systemin activates synthesis of wound-inducible tomato leaf polyphenol oxidase via the octadecanoid defensesignaling pathway, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 407e411.

[31] P.S. Gooding, C. Bird, S.P. Robinson, Molecular cloning and characterization ofbanana fruit polyphenol oxidase, Planta 213 (2001) 748e757.

[32] L. Li, J.C. Steffens, Overexpression of polyphenol oxidase in transgenic tomatoplants results in enhanced bacterial disease resistance, Planta 215 (2002)239e247.

[33] P. Thipyapong, M.D. Hunt, J.C. Steffens, Antisense downregulation of poly-phenol oxidase results in enhanced desease susceptibility, Planta 220 (2004)105e117.

[34] G. Sonnante, A. De Paolis, V. Lattanzio, P. Perrino, Genetic variation in wild andcultivated artichoke revealed by RAPD markers, Genet. Resour. Crop Evol. 49(2002) 247e252.

[35] K. Higo, Y. Ugawa, M. Iwamoto, T. Korenaga, Plant cis-acting regulatory DNAelements (PLACE) database:1999, Nucleic Acids Res. 27 (1999) 297e300.

[36] M. Lescot, P. Dhais, G. Thijs, K. Marchal, Y. Moreau, Y. Van de Peer, P. Rouz,S. Rombauts, PlantCARE, a database of plant cis-acting regulatory elementsand a portal to tools for in silico analysis of promoter sequences, Nucleic AcidsRes. 30 (2002) 325e327.

[37] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5:molecular evolutionary genetics analysis using maximum likelihood, evolu-tionary distance, and maximum parsimony methods, Mol. Biol. Evol. 10(2011) 2731e2739.

[38] K.J. Livak, T. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method, Methods 25 (2001) 402e408.

A. Quarta et al. / Plant Physiology and Biochemistry 68 (2013) 52e6060