J. Mol. Biol. (1983) 170, 827-842

Lambda Replacement Vectors Carrying Polylinker Sequences

ANNA-MARIA FRISCHAUF, HANS LEHRACH, ANNEMARIE POUSTKA AND NOREEN MURRAY t

European Molecular Biology Laboratory Heidelberg, Postfach 10.2209, F.R.G.

(Received 30 May 1983, and in revised form 29 June 1983)

To simplify the construction and screening of genomic libraries, we have made a new family of lambda replacement vectors (EMBLI, EMBL2, EMBL3, EMBL4) and derivatives containing amber mutations (EMBL3 Sam, EMBL3 AamBam, EMBL3 AamSam). These vectors have a large capacity and polylinker sequences flanking the middle fragment. The polylinkers allow a choice of cloning enzymes and, especially useful in the case of cloning of Sau3A partial digests, the excision of the entire insert by flanking SalI (EMBL3) or EcoRI (EMBL4) sites. Phages with inserts can be selected either biochemically (particularly EMBL3) or genetically by their Spi- phenotype. Amber derivatives of the EMBL3 vector allow the application of genetic screening procedures based on selection for the products of homologous recombination events, and for the selective cloning of DNA sequences linked to supF genes.

1. I n t r o d u c t i o n

An essential step in the analysis of the s t ructure and function of genes and gene regions is their isolation in cloned form, a step which in many cases involves the establishment and screening of libraries comprising millions of independent clones. This technical feat has been made possible, and in many cases even easy, by the development of high capaci ty cloning vehicles ()~ replacement vectors and cosmid vector systems: for reviews, see Williams & Blat tner , 1980; Brammar , 1982; Murray, 1983), the use of packaging systems in vitro to allow efficient recovery of recombinant molecules (Hohn & Murray, 1977; Sternberg et al., 1977) and the application of efficient screening techniques (Benton & Davis, 1977; Hanahan & Meselson, 1980).

The efficiency of cloning is sufficiently high to allow the recovery of essentially complete libraries of mammalian genomes from microgram amounts of DNA, and rapid high density screening techniques make lambda replacement vectors a very convenient system to use. In some cases, the well-developed genetics of lambda

? Present address: University of Edinburgh, Department of Molecular Biology, Mayfield Road, Edinburgh, Scotland.

827 0022-2836/83/320827-16 $03.00/0 O 1983 Academic Press Inc. (London) Ltd.

828 A,-M. FRISCHAUF ET AL.

can be used for sophisticated gene selection and gene manipulation procedures, including most recently the genetic selection of phages carrying specific sequences (Seed, 1983).

A limitation of lambda vector systems is the maximum amount of foreign DNA tha t can be accommodated (approximately 23 kbt); the difference between the minimal amount of DNA needed to code for genes essential for lytic growth and the maximum amount of DNA packageable in lambda phage heads. At a considerable cost in the ease of l ibrary construction, amplification and screening, this limitation can be overcome by using cosmid vectors (Collins & Hohn, 1978; Ish-Horowitz & Burke, 1981). In this case, the minimal amount of information required for a plasmid tha t can be encapsidated in a phage ~ head is encoded by a few kb of DNA, thereby permit t ing insert sizes of up to 50 kb. This large capacity is especially useful in applications requiring the cloning and analysis of large contiguous regions of the genome, as well as in applications requiring the recovery of complete functional genes extending over 30 to 40 kb. In many cases this capacity is not required, and lambda replacement vectors allow the construction and screening of libraries with a fraction of the effort required for cosmid vector systems.

A gam + lambda replacement vector containing polylinker sequences has recently been constructed (Loenen & Blat tner , personal communication).

In this paper, we describe lambda replacement vectors tha t combine a capacity close to the theoretical limit with features allowing simple and efficient l ibrary construction and screening.

2. Materials and Methods

(a) Enzymes

Restriction enzymes were purchased from Boehringer-Mannheim and Bethesda Research Laboratories or prepared by Helene Cambier. DNA ligase was a gift from Eric Remaut. DNA polymerase large fragment was purchased from Boehringer-Mannheim. EcoRI, BgIII and SalI linkers were from Collaborative Research.

(b) Bacteria, phage and plasmid strains

The bacterial strains used are listed in Table 1. Lambda 1059 (Karn et al., 1980) was provided by G. Cesareni, P2cox3 (Lindahl & Sunshine, t972) by J. Bertani and L.E. Bertani. Other phages, NM760 (Murray et al., 1977), ~b538 imm 434 Pam3 (NM668) and ,~Wam Earn lac cI AKH54 nin5 srI~4 ° srI~5 ° Sam7 (NM1032) were from our own collection. Plasmids pUC2, pUC8 and pUC9 were gifts from B. Gronenborn. The miniplasmid PiAN7 was provided H. V. Huang.

(c) Media

LB medium (10 g Difco Tryptone broth, 5 g Difco yeast extract and 5 g NaC1 per litre) was used for liquid cultures. Phages were assayed and recovered on Baltimore Biological Laboratories Trypticase agar, containing (in g/l): Trypticase (10); NaC1 (5), Difco agar (12 for plates and 7 for top layer). For the amplification of libraries on miniplasmid containing hosts BBL plates containing 7"5 gg tetracycline/ml and 15/~g ampicillin/ml were used.

Abbreviations used: kb, 103 bases; bp, base-pair.

LAMBDA REPLACEMENT VECTORS

TABLE 1

B a c t e r i a l s t r a i n s u s e d i n t h i s w o r k

829

Strain Source Relevant genotype

Q358 Karn et al. (t980) h.sdR .nLpE tonA Q359 Karn et al. (1980) ]~sdE supE tonA(P2) ED8514 Hopkins el at. (1976) trp(OE)AI supE KB8 J .P . Brockes polAl sup ° Yme] A.D. Kaiser supF, F + W3110rk- mk + Seed (1983) hsdR sup ° W3110/p3 Seed hsdR sup°/kan, amp am, tet am MCI061 Casadaban et al. (1980) hsdRA/acX74 MCI061/p3 H.V. Huang hsdRAlacX74/kan, amp am, tet am NM430 hsdR/acZam sup ° NM512 £~dR recA99 sup ° W31OlrecAl3 N.C. Franklin fecal3 sup ° 5K Hubacek & Glover (1970) hsdR derivative of C600 5K/RI Murray & Murray (1974) 5K/carrying plasmid encoding EcoRI C600recBC ]~vdS S.C. Clarkson recBC supE R594(,~Bamimra 21 ) This work sup ° ED8654 Borck et al. (1976) ~'upE supF hsdR NM538 Derivative of ED8654 supF h~sdR NM539 Derivative of NM538 supF hsdR (P2cox3) NM531 Derivative of ED8654 ~ntpE supF hsdR fecal3

(d) Phage and p lasmid D N A preparat ions

Phages were grown as liquid lysates in LB medium, by infecting growing bacterial cultures at about 0-3 0.9.]600 with phage, using a multiplici ty of infection of 0-1. After lysis, bacterial debris was removed by centrifugation, the phages were precipitated by addition of NaCl to 4°/o and polyethylene glycol (PEG 6000) to 10~/o (Yamamoto et al., 1970) and purified either, for small preparations, by a CsCl step gradient or, for phages to be used as source of vector DNA, by 2 cycles of CsCl equilibrium centrifugation. Phage DNA was prepared by extract ing phage suspensions twice with sa turated phenol/ chloroform/isoamyl alcohol ( 2 5 : 2 4 : 1 , by vol.), followed by extract ion with ether and precipitat ion with ethanol. Piasmids were prepared from saturated cultures by a modification of an alkaline lysis protocol (Birnboim & Doly, 1979), followed by 2 cycles of equilibrium centrifugation in CsCl/ethidium bromide gradients or, for construction intermediates, by a modification of a procedure described by Holmes & Quigley (1981).

(e) Phage and bacterial s train constructions

(i) E M B L 1

EMBLI was derived from ).1059 (Karn et al., 1980) by substi tut ing a 5.7 kb fragment carrying the Escherichia coli t rpE gene for a segment in the middle fragment containing pBR322 sequences. This was accomplished by ligating a H i n d I I I digest of )~1059 DNA to a t rpE fragment released by H i n d I I I digestion of the red- vector NM760 after inactivation of the ends of this donor vector by limited digestion with Bal31. Recombinant molecules were packaged and Red + phages recovered on a p o l A - host (KB8). TrpE + derivatives were then selected by their abil i ty to form plaques on a t r p E - host (ED8514) in the absence of t ryptophan (Franklin, 1971). DNA was prepared from a ~trpE + red + phage, the predicted restriction map verified, and this phage was designated EMBLI (Fig. 1).

830 A.-M. F R I S C H A U F E T A L .

I I I I I I I I I I I I I I I I I I I

3 lO 20 30 40

I I L1 I ii lo 20

d.p,

't Bam

zbP'

"1 Barn d.P'

'I Bam

Sol Bam RI

o ~

C[D0 CDCDn 01IISI3 003 50 60 YO 80

I [I I I I

30 ~0 p . p ,

SaI H3H3 R1 H3 Born H3

, EC _ ,,ilso, ! ' , , , Sot H3 8o:m H3

~-- .... RP' i I- . . . . -I'I I S0 H3 H3 "~, I

Sol Bom H3 Rl ~ Sol

90 %),, J

I ~./.,. Kb

k 1059

Barn [

EMBL 1

EMBL 2

EMBL 3

Sal H3 H3 RI Bam Sol S~ Bom RI,

Snl H3 H3

I

FIG. 1. Schematic structure of the lambda vectors EMBL1, EMBL2, EMBL3, and EMBL4. The sequence (hyphens omitted) predicted for the polylinker is (starting and ending with the original BamHI half sites):

GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC SalI- - BamHI . . . . EcoRI

replacing the BamHI sites.

(ii) EMBL2

A derivative of EMBL1 lacking EcoRI sites was selected by serial growth on an EcoRI restricting host (5K/RI) followed by growth on a non-modifying host, 5K (Murray & Murray, 1974). Removal of all EcoRI sites by mutat ion and recombination events was indicated by a restriction coefficient of unity. The DNA from one such derivative was characterized and shown to be compatible with the structure expected for simple mutational removal of the EcoRI sites. This isolate was designated EMBL2 (see Fig. 1).

(iii) EMBL3 and EMBL4

EMBL3 and EMBL4 were derived from EMBL2 by replacing the BamHI cloning sites with short sequences assembled by modification of the symmetrical polylinker (RI-Bam- Sal-Pst-Sal-Bam-RI) carried by the plasmid pUC2 (Vieira & Messing, 1982). As a first s tep (see Fig. 2) 2 derivatives of pUC2 were made by subst i tut ing a BglII linker for either the segment of the polytinker flanked by two EcoRI sites or, al ternatively, the shorter segment between the two SalI sites. The first of these two plasmids, which retains an EcoRI-BglII- EcoRI polylinker sequence, was made by coligating EcotCI and BglII linkers, cleaving the products with EcoRI and inserting the resulting fragments into pUC2 cleaved by EcoRI. Similarly, a plasmid carrying the linker sequence EeoI~I-BamHI-SalI-BgIII-SalI-BamHI- EcoRI was made by inserting a coligation product of SalI and BgIII linkers into SaII- cleaved pUC2. In both cases, plasmids were recovered by transformation of a lacZAMl5

LAMBDA REPLACEMENT VECTORS 831

S Bg RBSPSBR R Bg ( )

S(Bg}mS(Bg}n... pUC 2 R(Bg)mR(Bg)n.. I l l l l I I I r i i i i i I

\ / / RBS(BglmSBR R(BglnR

I l l l r l l l 1 t l l (. ) ( )

pUC(S- Bg) pUZ(R - Bg )

FI(}. 2. Construction of polylinker-eontaining plasmids for insertion into EMBL2. Copolymers of SaII-BglII or RI-BglII linkers cut with SalI or EcoRI, respectively, were inserted between the SalI or EcoRI sites of pUC2. S, SalI; R, EcoRI; B, BglII; B, BamHI; P, PstI.

host (Vieira & Messing, 1982). Uptake of a BglII linker sequence by a plasmid was indicated by loss of the abi l i ty to complement the lacZ lesion of the host.

To introduce these linkers into EMBL2, the plasmids were linearized by digestion with BglII and ligated to BamHI-cleaved EMBL2 DNA. Phages carrying plasmids were identified by their blue plaques on a Lac + host in the presence of Xgal. This effect is due to induction of the chromosomal lac operon, with lac repressor predominant ly bound to the lac operator sequence in the plasmid. The number of plasmids included was determined by using the efficiency of restriction by 5K/RI , an EcoRI restricting host, as a measure of the number of EcoRI targets. DNA was made from phages presumed to carry four EcoRI sites (2 plasmids) and checked by restriction digests to identify phages with plasmid sequences flanking the middle fragment.

The final step in the construction of EMBL3 and EMBL4 required the reassortment of arms and middle fragments to separate the two sides of the polylinker (see Fig. 3). Since identification of the orientation of a polylinker is difficult, we constructed Sp i - derivatives of both vectors by cloning EcoRI fragments of E. coli DNA in the EMBL2Sal and EMBL2RI vectors. EcoI:tI digests of these Sp i - derivatives were then ligated with purified middle fragments of the opposite type, and Spi + phages were selected on a recA- host.

DNAs of 3 isolates from both the EMBL3 and EMBL4 constructions were tested for the presence of the EcoRI, BamHI and SalI sites. DNAs from phages carrying all 3 sites in the expected position were then checked by 2 routes to distinguish between the symmetrical and the asymmetrical polylinker arrangement and to verify the expected orientation of the

o pUC(S-Bg), a 8 EMBL2 opUC(R-Bg)

\ / \ / SBR RBS SBR RBS R R R R . . . . . . ' - ~ .EHBL Sal - ,~ u .EMBLRt

SBR ~ S B R -',,,J I.~ 1EMBL3 ~,.-" --~ . EMBL4

FIo. 3. Construction of EMBL3 and EMBL4. pUC(S-Bg) and pUC(R-Bg) were cleaved with BglII and ligated into EMBL2 cut with BamHI to give EMBL Sal and EMBL RI. The EcoRI-digested arms of derivatives of EMBL Sal and EMBL RI containing E. coli DNA in place of the middle fragment were then ligated to the middle fragment of the other partner (EMBL RI and EMBL Sal, respectively, also digested with EcoRI). For a description of the selection of the correct products, see the text. S, SalI; B, BamHI; R, EcoRI; pUC(S-Bg) and pUC(R-Bg) are the polylinker plasmids described in Fig. 2.

832 A.-M. FRISCHA(I~ ET AL.

polylinker. One test involved cutt ing the vector DNA within 2 of the restriction sites of the polylinker sequences, removal of the resulting short "adap to r" fragments by precipitation with isopropanol, and then determining whether the available ends could be effectively joined. As expected in the case of asymmetrical linker arrangements, ligation failed to restore plaque-forming ability.

To directly verify the linker arrangement, DNA from the different isolates was cleaved with EcoRI. The resulting ends were radioactively labelled with Klenow polymerase, and the molecules recleaved with SalI. The pat tern of labelled and untabelled restriction fragments, observed after gel electrophoresis and autoradiography uniquely defines the type and orientation of the polylinker sequence, verifying the expected structures.

(iv) E M B L 3 A a m B a m

Since genes A and B are closely linked to sbaml ° and no simple screen for recombination in this interval is available, we used recombination in vitro to transfer the Aa.m32 Baml mutations to the EMBL3 vector, while preserving the sbaml ° mutation. The source of the donor fragment was an AvaI digest of Charon 4A (Blattner et al., 1977; Fig. 4). This was ligated in excess to a mixture of a phosphatase-treated KpnI digest of EMBL3 and of EMBL3 DNA cleaved by both KpnI and AvaI. The products of this triple ligation were recovered on a supE recA- host and phages carrying the AamBam configuration were identified by spot tests on Su + and Su- hosts. Phages carrying amber mutat ions were further characterized by determining the reversion rate (less than 1 in 109) and by complementation tests with Aam and Barn phages. The DNA from one such isolate, EMBL3A, .was checked by digesting with EcoRI, BamHI, SalI and AvaI. The fragments of DNA derived from EMBL3 and EMBL3A were indistinguishable. EMBL3A, however, gives small plaques on supE hosts and during propagation a variant forming larger plaques was detected (EMBL3B). This derivative probably results from a mutat ion tha t par t ia l ly compensates for the reduced vigour of AamBamsbaml ° phages on supE hosts. Since, however, both EMBL3A and EMBL3B show higher, though similar, burst sizes on supF hosts (Table 2), we have generally used EMBL3A and supF hosts in our work.

(v) EMBL3Sam7

This was constructed from a cross between EMBL3 and NM1032 (~Wam Earn lacZ cIKH54 srI4°nin5 srI5 ° Sam). Preservation of the Chic mutat ion in the right arm of EMBL3 was verified by the presence of imm43%II- recombinants in the progeny of a cross to lambda NM668 (b538imm434Pam3). These are easily detected as clear plaques selected on a suppressor-free host lysogenic for lambda.

A I /

Aam Barn A

A KK/ i Tt~,

An A

An A,

&

KK 5 &

I i AomBom

~, Choron 4A hvoI

+ ~, EMBL 3 Avo I + Kpn I

+ EMBL 3 KpnI

EMBL 3 Aam Bam

FIO. 4. Transfer of AamBam to EMBL3 v/a a DNA fragment from Charon 4A. An Aval digest of Charon 4A was ligated with an AvaI and KpnI digest of EMBL3 and a phosphatase-treated KpnI digest of EMBL3. For a description of the selection of the correct product, see the text. A, AvaI; K, KpnI; triangle, BamHI. An indicates many AvaI sites.

LAMBDA REPLACEMENT VECTORS

TABLE 2

Burs t size

833

Phage strain supE .~upF

EMBL3A 3.7 31-! EMBL3B 7-4 26.6 EMBL3AsBaml + 14.1 48-3 EMBL3AAam ÷ 13.9 35"3 EM BL3ABam + 13"3 48.4 EM BL3 32"7 52"8 EMBL3sBaml + 28"0 n.t. lambdacI - 92"5 200 EMBL3 Spi- 31 EMBL3 Aam Barn Spi- 25 EMBL3 Aam Sam Spi- 26

n.t. not tested in this experiment; not different from EMBL3 in 2 other experiments.

(vi) EMBL3Aam, E M B L 3 B a m

A Bam+ rever tant of EMBL3A was selected on a sup ° (,~Bam imm 21) host. Similarly an Aam + Barn derivative was selected by taking advantage of the observation that the Aam32 mutation is poorly suppressed by supE in a recBC- host.

(vii) EMBL3AamSam, E M B L 3 B a m S a m

These were constructed in vitro from the EcoRI digests of the DNAs of EMBL3Sam, EMBL3Aam and EMBL3Bam.

(viii) Bacterial strain construction

Restriction deficient derivatives of different bacterial hosts were made by transferring hsdR-A4 from a lambda hsd-A 4 phage (Sain & Murray, 1980) to the bacterial chromosome. Similarly, the transfer of the recAl3 allele was mediated by a lambda recA transducing phage and NM538 was constructed by transferring the wild-type allele of supE from a transducing phage to the chromosome of ED8654. P2 lysogenic strains were derived from P2cox3, a mutan t of P2 defective in excision from the bacterial chromosome (Lindahl & Sunshine, 1972).

(f) Preparation of mouse DNA

DNA was prepared from frozen livers of mice starved for 1 night using a modification of the procedure of Blin & Stafford (1976). Two frozen livers (2 g) were ground to a fine powder under liquid nitrogen. The powder was suspended in 30 ml of 0.5 M-EDTA (pH 8-0), 0.5% (v/v) Sarcosyl (Sigma), 100 pg proteinase K/ml, and predigested for 30 rain a t 55°C. The mixture was shaken gently for 2 h at 55°C and then extracted with sa tura ted phenol/ chloroform/isoamyl alcohol (50 : 48 : 2, by vol.) until the interphase was clear. The aqueous phase was then dialysed against 3 changes of 50 mM-Tris. HCl (pH 8), l0 m~-NaCl, l0 mM- EDTA. CsCl was added to give a density of 1.7 g/ml and the solution was then centrifuged for 2 days at 18°C in a Ti 50.2 rotor at 40,000 revs/min. Fract ions were collected by dripping through a thick needle from the side of the tube. Fract ions containing DNA were pooled and dialysed against 3 changes of l0 mM-Tris- HCl (pH 8), 1 mM-EDTA. The yield was 2 mg of DNA.

834 A.-M. F R I S C H A U F ET AL.

(g) Partial digestion

DNAs were first tested in analytical reactions to determine the approximate range of MboI concentrations required to achieve length distr ibutions with a number average length of 20 kb. Typically, we digested 60/~g of DNA in 1 ml of digestion buffer (50 mM-NaC1, l0 mM-Tris- HCl (pH 7-5), l0 mM-MgCl2; 1 mM-dithiothreitol) with 3 units of MboI (New England Biolabs, batch 5). The reactions were incubated at 37°C, portions of 400, 300 and 300/ll were removed after 10, 20 and 30 min incubation, EDTA was added to 15 mM, and the samples were incubated for 10 min at 70°C to inactivate the restriction endonuclease, precipitated with ethanol and taken up to a concentration of 0"5 pg//~l in 0" 1 x TE (l mM- Tris. HCl (pH 8-0), 0-1 mM-EDTA).

This DNA was then dephosphorylated by t rea tment with calf intestine alkaline phosphatase (Boehringer-Mannheim): 13/2g of DNA digested par t ia l ly with MboI as described before was dephosphorylated in a 40-/~1 reaction containing 50 mM-Tris. HCl (pH 9-5), 1 mM-spermidine, 0. l mM-EDTA and 1 unit of calf intestine alkaline phosphatase (Weaver & Weissman, 1979) for 30rain at 37°C. Trinitriloacetic acid was then added to a final concentration of l0 mM, the enzyme was inactivated for l0 min at 70°C and the DNA recovered by precipitation with ethanol. The pellet was then taken up to a concentration of 0.5 12g/pl into 0.1 x TE and left to disolve overnight at 4°C.

A sample (20 pg) of vector DNA (EMBL3 or EMBL3A) was digested to completion with BamHI in a 50-/~1 reaction volume in 50 mM-NaC1, l0 mM-Tris-HCl (pH 7-4), I mM- dithiothreitol using 30 units of enzyme for 1 h at 37°C. EDTA was added to 15 mM, the reaction was heated for l0 min to 70°C to inactivate the enzyme and the DNA was recovered by precipitation with ethanol. To give an added selection against recovering phages with the original middle fragment, this DNA was then redigested with a 3-fold excess of EcoFCI, extracted with phenol, then with ether and precipitated with isopropanol (0.3 M-sodium acetate (pH 6"0), 0"6 vol. isopropanol, 15 min at 0°C) to remove the short linker. Vector DNA was then dissolved in TE (10 mM-Tris. HC1 (pH 8), I mM-EDTA) to a concentration of 0"5/tg/t~l.

(h) Ligation

For ligation, part ial ly MboLdigested and phosphatased DNA was mixed with doubly cut vector and ligated at a total DNA concentration of 100 ttg/ml in 40 mM-Tris, HC1 (pH 7-6), 10 mM-MgCl 2, 1 mM-dithiothreitol and approx. 1 unit of phage T4 ligase in an overnight ligation at 15°C.

Ligation mixes were then directly packaged in extracts prepared essentially as described by Scalenghe et al. (1981) by adding to 20gl of ligation mixtures; first, 20#1 of sonic extract , and then 80 pl of freeze-thaw lysate. After l h incubation at room temperature, the reaction was diluted with 400 gl of lambda diluent (10 mM-Tris. HCI (pH 7.6), 10 mM- MgSO 4, 1 mM-EDTA) and stored at 4°C. Portions were t i t ra ted on permissive and selective indicators. Packaging efficiencies on uncut EMBL3 or EMBL3A were in the order of 3 × l0 T plaques/#g of DNA.

(i) Library amplification

To amplify the l ibrary under conditions selecting against Spi + phages, we preincubated portions of the packaged material containing approximately 100,000 phages for 15 min with 2 ml of an overnight culture of an appropriate P2 lysogen, concentrated 2-fold by centrifugation and resuspension in l0 mM-MgS04. The infected cells were then overlayed on BBL agar in square 22 em x 22 cm plates (Nunc screening plates). After overnight growth, the top agar was scraped off with a sterile spatula, resuspended with 1 vol. lambda diluent, and stirred for 30 min at medium speed with 0.05 vol. chloroform.

P BH

PPPP P

N P

PP

P K

K MSDRN

MN NSS

(N)T

NP

{N)

RDS

M T

,~

if

~I?

~if,

I

if if

t ?i

~if~

Ifif

i~

??

¢

CA

HH

H

H

H

S

C C

A

A

CH

AC

C

C

S

I SS

I(B

) A

IA

CC

HB

B BB

HA

C

l C

H

H

H

(B)

A

H

Fro

. 5.

Res

tric

tion

map

of

EM

BL

3 an

d de

riva

tive

s pr

edic

ted

from

ava

ilab

le s

eque

nce

info

rmat

ion

and

veri

fied

par

tial

ly b

y re

stri

ctio

n m

appi

ng.

Sym

bols

us

ed a

re:

D (

Bam

HI)

; R

(E

coR

I);

S (S

alI)

; B

(Bgl

II);

M (

Sin

ai);

T (

Sac

II);

P (

Pvu

II);

N (

Nru

I);

C (

Cla

I);

H (

Hpa

I);

K (

Kpn

I);

A (

AvaI

); I

(H

indI

II).

Sit

es

encl

osed

in

brac

kets

map

to

1 of

the

2 p

osit

ions

giv

en.

836 A.-M. FRISCHAUF ET AL.

(j) M iniplasmid construction

Sequences precloned in the PstI site of pUC8 or pUC9 were transferred into the mini- pIasmid by a 2-step protocol allowing genetic selection at both stages. First, the subclones were cleaved with EcoRI and ligated to EcoRI-cleaved PLAN7. Coligation products of the 2 plasmids were selected by transforming a polAam host (KB8) with the ligation mixture and selecting for ampicillin-resistant colonies. Only bacteria containing chimaeric plasmid molecules will grow, since the supF function in the host is required to supress the polAam mutation, in turn necessary for the replication of ColEl type plasmids.

DNA from chimaeric plasmids carrying the 2 components in the required orientation was then cleaved with HindIII to release the pUC8 sequence, religated, and the subclones recovered after transformation into MC1061(p3), selecting for both tetracycline and ampicillin resistance. Other miniplasmid derivatives for screening were constructed by ligation of the corresponding fragments into vector cleaved and dephosphorylated as described before.

(k) Genetic screen

Starting from a fresh colony, either strain W31t0r-m÷(p3) or MC1061(p3) containing the miniplasmids with the sequence homology were grown to saturation under constant selection with ampicillin (14 ttg/mt) and tetracycline (8 gg/ml). Overnight cultures were then concentrated 2-fold by centrifugation and resuspension in l0 mM-MgS04: 2× l06 phages of the amplified library were preincubated with 0.2 ml of cell suspension and overlayed in 3 ml of BBL top agar on BBL plates containing ampicillin and tetracycline. After overnight growth, plates were overlayed by 5 ml of lambda diluent and left at 4°C for 8 h, to allow phage to diffuse into the liquid. This lysate was then titrated on a supF host (e.g. NM538) and on a sup ° lacZam host {e.g. NM430) using Xgal-IPTG to detect galactosidase activity resulting from suppression of the lacZ amber mutation. Blue plaques on the lacZ am host were picked, the phage purified on the same host, and grown preparatively.

3. Results and Discussion

(a) Vector construction

We describe the construction and use of a series of lambda replacement vectors tha t combine large capacity (up to 23 kb), the advantages offered by cloning into and excising from polytinkers, and the genetic selection of recombinant phages by their Spi- phenotype (Murray & Murray, 1975; Loenen & Brammar, 1980; Karn et al., 1980). The first step in the derivation of these vectors from A1059 (Karn et al., 1980) was the substi tut ion of a plasmid sequence carried in the middle f ragment of A1059 by E. coli DNA containing the trpE gene. The vector, EMBL1, allows considerable simplification in the use of DNA probes cloned in plasmids for screening of libraries of recombinant phages.

In a next step, we removed the target sites for EcoRI (EMBL2), and then subst i tuted the former B a m H I sites by polylinker sequences derived from those in pUC2. The polylinkers were first modified by the introduct ion of additional BgIII sites adjacent to either the EcoRI (pUC2-(RI-Bgl)) or the SalI (pUC2-(Sal-Bgl)) sites (see Fig. 2). Plasmids cut with BglII were then ligated to the EMBL2 vector digested with B a m H I , phages carrying a plasmid sequence at each of the former B a m H I sites were identified (EMBL2-Sal and EMBL2-RI) and arms and middle fragments were reassorted to give the vectors EMBL3 and EMBL4, each of which carries an asymmetrical polylinker sequence (see Figs 1 and 3).

LAMBDA REPLACEMENT VECTORS 837

(b) Genetic modifications

These vectors were further modified by introducing amber mutations, thereby allowing their use in newly developed genetic selection procedures (Seed, 1983).

To transfer Aam32Baml from Charon 4A to EMBL3 without introducing the closely linked BamHI site, we transferred these mutations on a DNA fragment extending from the left end of the genome to the first AvaI site (the AvaI site to the left of sbaml°: see Materials and Methods). Recombinant genomes were recovered on a supE recA host and tested for amber mutations by spot tests on sup ° and supE host strains.

A amB + and A + Barn phages were constructed by selecting for revertants on the appropriate host strains (see Materials and Methods, section (e)(vi)). The Sam7 mutation was introduced into the right arm by recombination in vivo (Materials and Methods) and then combined with either the Aam32 or the Baml mutation by ligation of appropriately marked vector DNAs cut with EcoRI.

Aam32Baml derivatives of EMBL3 (EMBL3A), in contrast to the parental phages EMBL3 and Charon 4A, make small plaques on standard supE hosts such as C600 and Q358, while their Spi- derivatives make minute plaques on Q359, a supE strain lysogenic for P2. We therefore investigated the use of more vigorous derivatives of EMBL3, alternative hosts or different combinations of amber mutations. These approaches show that, while the sbaml ° mutation itself has no detectable detrimental effect on the burst size of the vector, it does lead to a considerable reduction in the burst size when combined with the Aam32Baml mutations. This decrease is most extreme in supD hosts (data not shown) and is minimal if supF rather than supE hosts are used (see Table 2). Such a suppressor- dependent interaction implies that the sbaml ° mutation is a missense mutation in a gene whose product interacts with either the gene A product, the gene B product, or both. (From its location in the lambda genome the sbaml ° mutation is either in gene C, nuIII or both (Sanger et al., 1982).) The burst sizes of different EMBL3 derivatives in supE and supF hosts (Table 2) indicate that, while the detrimental interaction is partially alleviated by a compensating mutation (EMBL3B in Table 2), the preferred solution is to rely on suppression by supF rather than supE hosts. For this reason, a series of restriction-deficient supF hosts was made (see Table 1).

(c) Vector characterization

Restriction maps of the EMBL vectors were predicted based on the recently published DNA sequence of AcI 8s~ Sam7 (Sanger et al., 1982) together with the predicted limits of the b189, KH54 and nin5 deletions (F. J. Blattner, personal communication). Verification of the maps is not complete but generally confirms the predictions. One mQor discrepancy, an additional sequence of approximately 980 bp, has been observed in the region adjacent to the left polylinker of the vector. Since identical additional fragments were detected in both A1059 and a Abl89 phage (data not shown), we suggest that deletion b189 is shorter than previously estimated. This explanation is especially plausible, since the position of

838 A.-M. F R I S C H A U F ET AL.

a SmaI site within the additional sequence corresponds to an analogous site in ~t + DNA.

(d) Library construction

The vectors EMBL3 and EMBL4, as well as their genetically marked derivatives, can be used to clone fragments created by a number of different restriction enzymes (EcoRI, EcoRI*, BamHI, BgIII, BclI, XhoII, MboI, SalI, XhoI, a subset of AvaI sites). The use of MboI or Sau3A partial digestion offers an especially attractive possibility, combining highly random fragmentation with the easy ligation of Sau3A-created fragments to BamHI-cleaved lambda vector. To take full advantage of the vector, and especially to allow the establishment of libraries from small amounts of material (95% representation with a few #g of DNA), we have modified the usual library cloning protocol substituting biochemical and genetic selections in place of the usual size separation steps. Selection for chimaeric phages is provided by two different features of the phage: the red and gam genes carried by the middle fragment provide genetic selection, and the polylinker sequences of EMBL3 allow inactivation of the middle fragment by cleavage with both BamHI and EcoRI. Precipitation with isopropanol leaves the short cohesive fragments in the supernatant, thereby eliminating the possibility of religation of the middle fragment to the arms. In our experience, amplification of the library on hosts lysogenic for P2 will reduce the level of parental vector by four to five orders of magnitude, with the remaining background predominantly caused by residual unadsorbed phages recovered from the plate, compared to an enrichment of two orders of magnitude provided by the biochemical selection. These procedures can be used separately or consecutively. If, for special applications, a further reduction in the background is required, vector DNA prepared on non-modifying hosts (possibly recA- to avoid any possibility of Spi- phages arising) can be used and the unadsorbed phage selected against by amplifying the library on a restriction proficient host after selection on an r -m + P2 lysogen. Alternatively, a second cycle of library amplification can reduce the background by a few orders of magnitude. The biochemical selection should prove especially useful in cases where the propagation of the library in recA + cells, inherent in the Spi selection protocol, should be avoided. Amplification of the library on recA- hosts providing the required gamma function of ), in trans from a helper plasmid (G. Crouse, personal communication) may lead to enhanced stability of cloned reiterated sequences.

In the construction of any genomic library it is important to ensure that no ligation products of normally non-contiguous fragments will be recovered. This condition usually has been achieved by removing from the donor DNA fragments of half the packaging capacity, or smaller, by sizing steps (sucrose gradients, NaC1 gradients or gels). Similar to a protocol often used in the construction of cosmid libraries (Ish-Horowitz & Burke, 1981), in our protocol ligation of insert fragments to each other is avoided by a phosphatase treatment of the partially cleaved DNA, obviating the need for size selection. To verify the success of the phosphatase treatment, plasmid cut with a different enzyme (e.g. pBR322

LAMBDA REPLACEMENT VECTORS 839

digested with HindIII) can be added to separate reaction samples before and after the phosphatase reaction. These samples are then ligated as usual, and the fraction of religated plasmid is measured by bacterial transformation. In our experiments, we usually have observed a difference of roughly three orders of magnitude between the two samples, corresponding to extremely low levels of religation products in the constructed libraries. Alternatively, the phosphatase- treated DNA can be ligated to itself and compared on a get to an analogous sample of DNA not treated with phosphatase.

Partial digestion products were analysed by electrophoresis on 0.4°/o agarose gels using low voltage gradients. Digestion conditions resulting in material of an approximate number average length of 20kb, or above, were chosen (corresponding to a peak intensity on gels at approximately 40kb length). Usually, to further increase the randomness of fragmentation, material from two or three timepoints around this value was mixed in amounts adjusted to partly compensate for the increasing number of molecules created by digestion. Alternatively, digestion conditions can be optimized by measuring the fraction of Spi- phages after a trial ligation and packaging in vector excess.

The plating efficiency increases considerably during the course of the digestion, reflecting the increasing number of molecules within the size range required to give rise to packageable molecules. Further digestion beyond this optimum leads to a drop in plating efficiency, reflecting the formation of tigation products too short to be packaged (Table 3). Digestion conditions slightly before, or at the beginning of, the plateau should be chosen to maximize both length and random representation of the library sequences (Seed et al., 1982).

To ensure maximal efficiency of cloning of the added DNA, it is essential to perform ligations in molar excess of vector over insert fragments, especially in view of the uncertainty of the exact number average molecular weight of the partial digestion product. I f doubly cleaved vector is being used, ruling out competition by the middle fragment during the ligation reaction, equimolarity will be sufficient.

I f single cleaved vector is used, relying only on the Spi selection, a further increase in the amount of vector added will reduce the competition by the middle fragment and should lead to a further, asymptotic increase in the molar cloning yield (approaching a factor of 2 for very large excess). Due to the possible formation of ligation products carrying insert fragments ligated to the middle

TABLE 3

Yield in chimaeric phages as a function of digestion time (excess double cleaved vector)

Time (rain) Plaques P2 lysogen//~g mouse DNA

5 4.4 x lO s 10 3-0 x 105 20 1 "3 x 106 30 2-6 x 106 60 1-8 x 106

840 A.-M. FRISCHAUF ET AL.

TABLE 4

Yield of ehimaeric phages as function of vector to target ratio (10 min, 20 min, 30 min timepoints from Table 3 mixed)

P l a q u e s / p g m o u ~ DNA

Vec to r Mouse D N A (ng) EMBL3A(BamHI cut ) E M B L 3 A ( E c o R I + BamHI cu t )

100 ng 2 4.4 × 10 s 1-5 × 10 s 100 ng 10 2.2 × 10 s 4 '4 × I0 s 100 ng 20 6.1 × 10 s 6 . 6 × 10 s 100 ng 40 3 . 6 × 10 s 6.1 x 10 s 100 ng 140 6.3 × 104 7.9 x 104

fragment of the vector, structures which will then be lost during plating on the P2 lysogen, this asymptotic value is still expected to be a factor of two below the cloning yield obtainable by the double cleavage protocol. (Typical results of this type are shown in Table 4.) In our experience, for many applications, cloning yields are sufficiently high to allow the use of either of the protocols.

(e) Library screening

Libraries prepared in the vectors described here can be screened efficiently by standard plaque hybridization protocols. As an alternative, we also tested the use of a genetic selection protocol described by Seed {1983) applicable to libraries constructed in EMBL3A or EMBL3B. In this procedure, phage libraries constructed in a vector with two (or more) amber mutations in selectable genes are first amplified on a host strain containing a probe sequence cloned into a miniplasmid (PiVX, PiAN7 or similar) that carries a supF gene as selectable marker. Lambda phages containing sequences homologous to the probe sequence are able to integrate the probe plasmid by an homologous recombination event. Plating of the amplified library under conditions selecting for suppression of the phage amber mutations will allow selection of this type of recombinant, offering a genetic selection for phages carrying a sequence homology to the probe plasmid. PLAN7, constructed by R .H. Huang, is closely similar to PiVX, the probe plasmid described originally by Seed (1983}, differing in an increased copy number and the available restriction sites. The test systems used were two different H-2 cDNA fragments, as well as a cloned fragment of unique mouse DNA. To overcome potential recombination between the part of the polylinker shared by EMBL3A without insert and PLAN7, only libraries amplified on P2 lysogenic hosts were used. The libraries were then amplified by growth on the miniplasmid- containing strain carrying the selection sequence and the amplified library was plated on a sup ° lacZam host (NM430). Among a background of white plaques, probably arising by recombination between packaging phage and library phages, blue plaques were identified at low frequency ( 1 0 - 1 0 t o 1 0 - 1 1 ) . Both clones containing the expected sequences as well as presumptive products of non- homologous recombination events have been identified. The reasons for the low

LAMBDA REPLACEMENT VECTORS 841

recombinat ion frequency observed in these exper iments will be invest igated further. A potent ia l route to overcome this type of problem could be the use of an a l te rnat ive recombinat ion pa thway ; e.g. in a recBC sbcA host (Gillen et al., 1981).

In summary , a new l ambda rep lacement vector sys tem combining a large capaci ty with features allowing efficient l ibrary construct ion and clone character izat ion has been developed. We expect these vectors to be useful in m a n y different applicat ions requiring efficient cloning of large DNA fragments .

We thank Brian Seed, Peter Little, H. V. Huang, Gray Crouse and Gianni Cesareni for strains and discussions. We also thank Brian Seed for providing us with a copy of his manuscript before publication. We thank Vince Pirotta for materials and suggestions, Helene Cambier for enzymes, and Helen Senior and Gaby Pilz for excellent technical help. Guenther Zehetner and Frances Pace contributed to the restriction mapping of the vectors.

REFERENCES

Benton, W. D. & Davis, R. W. (1977). Science, 195, 180-182. Birnboim, H. C. & Doly, J. D. (1979). Nucl. Acids Res. 7, 1513-1523. Blin, N. & Stafford, D. W. (1976). Nucl. Acids Res. 3, 2303-2314. Blattner, F. R., Williams, B. G., Blechl, A. E., Denniston-Thompson, K., Faber, H. E.,

Furlong, L., Grunwald, J. D., Kiefer, D. 0., Moore, D. D., Schumm, J. W., Sheldon, E. L. & Smithies, O. (1977). Science, 195, 161-169.

Borck, J., Beggs, J. D., Brammar, W. J., Hopkins, A. S. & Murray, N. E. (1976). Mol. Gen. Genet. 145, 199-207.

Brammar, W. J. (1982). In Genetic Engineering (Williamson, R., ed.), pp. 53-79, Academic Press, New York.

Casadaban, M. J. & Cohen, S. N. (1980). J. Mol. Biol. 138, 179-207. Collins, J. & Hohn, B. (1978). Proc. Nat. Acad. Sci., U.S.A. 75, 4242-4246. Franklin, N. C. (1971). In Bacteriophage lambda (Hershey, A. D., ed.), pp. 621-638, Cold

Spring Harbor Laboratory Press, Cold Spring Harbor. Gillen, J. R., Willis, D. K. & Clark, A. J. (1981). J. Bacteriol. 145,521-532. Hanahan, D. & Meselson, M. (1980). Gene, 10, 63-67. Hohn, B. & Murray, K. (1977). Proc. Nat. Acad. Sci., U.S.A. 74, 3259-3264. Holmes, D. S. & Quigley, M. (1981). Anal. Biochem. 114, 193-197. Hopkins, A. S., Murray, N. E. & Brammar, W. J. (1976). J. Mol. Biol. 107, 549-569. Hubacek, J. & Glover, S. W. (1970). J. Mol. Biol. 50, I l l -127. Ish-Horowitz, D. & Burke, J. F. (1981). Nucl. Acids Res. 9, 2989-2998. Karn, J., Brenner, S., Barnett, L. & Cesareni, G. (1980). Proc. Nat. Acad. Sci., U.S.A. 77,

5172-5176. Lindahl, G. & Sunshine, M. (1972). Virology, 49, 180~187. Loenen, W. A. M. & Brammar, W. J. (1980). Gene, 20, 249-259. Murray, K. & Murray, N. E. (1975). J. Mol. Biol. 98, 551-564. Murray, N. E. (1983). In The Bacteriophage Lambda, vol. 2, in the press. Murray, N. E. & Murray, K. (1974). Nature (London), 251,476-481. Murray, N. E., Brammar, W. J. & Murray, K. (1977). Mol. Gen. Genet. 150, 53-61. Sain, B. & Murray, N. E. (1980). Mol. Gen. Genet. 180, 35-46. Sanger, F., Coulson, A. R., Hong, G. F., Hill, D. F. & Petersen, G. B. (1982). J. Mol. Biol.

152, 729-773. Scalenghe, F., Turco, E., EdstrSm, Pirrotta, V. & Melli, M. (1981). Chromosoma (Berlin),

82, 205-216. Seed, B. (1983). Nucl. Acids Res. 11, 2427-2445. Seed, B., Parker, R. C. & Davidson; N. (1982). Gene, 19, 201-209. Sternberg, N., Tiemeyer, D. & Enquist, L. (1977). Gene, 1,255-280. Vieira, J. & Messing, J. (1982). Gene, 19, 259-268.

842 A.-M. FRISCHAUF ET AL.

Weaver, R. F. & Weissman, C. (1979). Nuct. Acids Res. 7, 1175-1193. Williams, B. G. & Blattner, F. R. (1980). In Genetic Engineering (Setlow, J . K . &

Mullander, P., eds), vol. 2, p. 201, Plenum, New York. Yamamoto, K. R , AIberts, B. M., Benzinger, R., Lawhorne, L. & Treiber, G. (1970).

Virology, 40, 734-744.

Edited by P. Chambon