Received: 20 September 2011, Revised: 11 November 2011, Accepted: 14 November 2011 Published online in Wiley Online Library
(wileyonlinelibrary.com) DOI 10.1002/jat.1789
Lead inhibits paraoxonase 2 but notparaoxonase 1 activity in human hepatomaHepG2 cellsWanida Sukketsiri,a Sureerut Porntadavity,b* Laddawal Phivthong-ngamc
* Correspondence to: S. Porntadavity, Department of Clinical Chemistry, Facultyof Medical Technology, Mahidol University, 2 Prannok Road, Bangkok Noi,Bangkok 10700 Thailand.E-mail: [email protected]
S. Lawanprasert, Department of Pharmacology and Physiology, Faculty ofPharmaceutical Sciences, Chulalongkorn University, 254 Phayathai Road,Pathumwan, Bangkok 10330 Thailand.E-mail: [email protected]
a Department of Pharmacology and Physiology, Faculty of PharmaceuticalSciences, Chulalongkorn University, Bangkok, Thailand
b Department of Clinical Chemistry, Faculty of Medical Technology, MahidolUniversity, Bangkok, Thailand
c Department of Pharmacology, Faculty of Medicine, Srinakharinwirot University,Bangkok, Thailand
INTRODUCTIONThe liver metabolizes and synthesizes various types of macromo-lecules, such as lipids, carbohydrates and proteins, as well as tox-icants. Hence, accumulated toxicants in the liver may disturb thebalance of cellular antioxidants, which consequently leads toliver damage and malfunction. Lead is a nonessential, toxicheavy metal that contaminates the environment, and chronicexposure to low levels of lead is a public health concern. Thedegree of lead toxicity depends on the accumulation of lead incertain tissues. Liver tissue is the largest repository (33%) of leadamong the soft tissues (Agency for Toxic Substances andDisease Registry, 2007). Several lines of evidence suggest thatlead mediates hepatotoxicity through various mechanisms,including effects on hepatic drug-metabolizing enzymes,hepatic necrosis (Sivaprasad et al., 2004; Berrahal et al., 2009),abnormal liver function (Al-Neamy et al., 2001) and liver cellproliferation through the enhanced expression of tumornecrosis factor-alpha (TNF-a; Kubo et al., 1996; Shinozuka et al.,1996; Apostoli et al., 2000). Lead also mediates hepatotoxicitythrough the induction of cellular oxidative stress (Aykin-Burnset al., 2003; Sivaprasad et al., 2004; Berrahal et al., 2009).
Paraoxonase 1 (PON1) and PON2 belong to the paraoxonasefamily, which have been structurally and experimentally identi-fied as calcium-dependent esterases/lactonases that catalyzethe hydrolysis of certain xenobiotics, such as organophosphates,unsaturated aliphatic esters, aromatic carboxylic esters andcarbamates, in addition to having antioxidative properties (Harelet al., 2004; Costa et al., 2005; Draganov et al., 2005; Khersonskyand Tawfik, 2005). Interestingly, both PON1 and PON2 are highly
expressed in the liver (Ng et al., 2001; Mackness et al., 2002).However, only the roles of PON1 have been revealed in the liver.PON1 expression decreases in chronic liver diseases, such asalcoholic liver disease, hepatitis and cirrhosis (Kilic et al., 2005;Ferre et al., 2006; Marsillach et al., 2007; Prakash et al., 2007). Itprotects against liver damage by mitigating CCl4-induced oxida-tive stress (Ferre et al., 2001). In addition, PON1 protects hepato-cytes against inflammation, fibrosis and liver disease (Marsillachet al., 2007, 2009; Zhang et al., 2008). PON1 is synthesized andsecreted from the liver into the blood stream. Lead inhibits theactivity of purified and serum PON1, which is the secreted formof PON1 and is the most studied form (Li et al., 2006; Ekinci andBeydemir 2010; Permpongpaiboon et al., 2011). Another form of
Wiley & Sons, Ltd.
W. Sukketsiri et al.
PON1 is cell-associated PON1, which is recruited to the plasmamembrane of liver cells for association into high-density lipopro-teins (HDL), to be secreted into the blood. There is no evidenceindicating any effect of lead on cell-associated PON1 in the liver.
PON2 shares homology with PON1 and is also believed to besimilar in structure. Unfortunately, evidence regarding PON2function in the liver is limited; however, it may play a critical rolethere, as it is an intracellular antioxidative protein (Ng et al.,2001). PON1 and PON2 possess antioxidant properties, andlead-induced hepatic toxicity has been proposed to be associ-ated with oxidative stress. Collectively, information regardingthe effects of lead on cell-associated PON1 and PON2 in the liverof humans and animals is still unclear. Hence, we investigatedthe effects of lead on cell-associated PON1 and PON2 enzymeactivities in human hepatoma HepG2 cells and the possiblemechanisms by which lead modulates these paraoxonases.
MATERIALS AND METHODS
Chemicals and Reagents
Reagents used in tissue culture and the protein assay kit werepurchased from GIBCO Life Technologies Inc. (Grand Island,NY, USA). 2′,7′-Dichlorodihydrofluorescein diacetate (DCFH-DA),dihydrocoumarin (DHC), dimethylsulfoxide (DMSO), leadacetate and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) were purchased from Sigma Chemical Company(St Louis, MO, USA). Calcium chloride (CaCl2), methanol and phenylacetate were purchased from Merck Company (Germany).Horseradish peroxidase (HRP)-conjugated secondary antibodyand a mouse monoclonal antibody against b-actin were obtainedfrom Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). A rabbitpolyclonal antibody against PON2 was purchased from Abcam PLC(UK). Enhanced chemiluminescence (ECL) western blotting detectionreagent was purchased from GE Healthcare (UK). All other chemicalswere reagent grade or the highest grade commercially available.
Cells Culture and Cell Viability
Human hepatoma HepG2 cells were cultured in RPMI1640supplemented with 10% fetal bovine serum, 1% penicillin–streptomycin and 1% L-glutamine. The cells were maintained at37 �C in a humidified incubator (5% CO2, 95% air). The HepG2 cells(3� 104 cell ml�1) were seeded in 96-well plates and were incu-bated for 24h at 37 �C prior to treatment with various concentra-tions of lead acetate (0, 0.05, 0.1, 0.5, 1, 10, 100 and 1000mgml�1,or 0, 0.13, 0.26, 1.32, 2.64, 26.36, 263.62 and 2636.2 mM,respectively) and incubation for 24, 48 or 72h. After treatment,mitochondrial metabolic activity, an indicator of cell viability,was determined by the MTT reduction assay, which is a modifiedcolorimetric method (Mosmann 1983). Briefly, MTT was added tothe cell culture at the final concentration of 0.5mgml�1 andincubated in a 5% CO2 incubator at 37 �C for 2 h. The media wereremoved, the remaining intracellular formazan crystals weresolubilized with 100ml of DMSO, and the optical density wasdetermined at 570nm using an ELISA microplate reader (Shimadzu,Japan). The results are expressed as the percentage ofMTT reduction.
Intracellular ROS
Intracellular oxidative stress was assayed through the oxidationof DCFH-DA. The accumulation of reactive oxygen species
(ROS) was determined by analyzing DCF as described previously(Wang and Joseph 1999). In brief, the cells were washed twicewith PBS and incubated with 50mM of DCFH-DA for 45min at37 �C in the dark. The formation of DCF was detected in theELISA microplate reader (Shimadzu, Japan) at an excitationwavelength of 485 nm and an emission wavelength of 530 nm.
Determination of Cell-associated PON1 Activity
The enzyme activity of cell-associated PON1 was determined asits arylesterase activity using phenyl acetate as a substrate, aspreviously described by Deakin et al. (2001). After 24, 48 or72 h of lead acetate treatment, HepG2 cells were collected, andcell-associated PON1 activity was measured spectrophotometri-cally (Shimadzu, Japan) at 270 nm. The activity of the enzymewas measured by the hydrolysis of phenyl acetate (1mM) in10mM Tris–HCl buffer (pH 8.0) containing 0.9mM CaCl2. Theenzyme activity was calculated from the molar extinction coeffi-cient of 1310 M
�1 cm�1. The arylesterase activity was determinedfrom the amount of the product formed (phenol) per minute permilligram of protein.
Cell Lysates
After the lead treatment, the HepG2 cells were washed threetimes with PBS and centrifuged at 5000 rpm for 10min at 4 �C.The cells were suspended in 0.1 M potassium phosphate buffer(pH 7.4). Then, the cells in suspension were lysed with a hand-held homogenizer and centrifuged at 10 000 rpm for 10min at4 �C, and the supernatant was stored at �80 �C until analysis.The protein concentrations were quantified using a BCA proteinkit assay.
Determination of PON2 Activity
The PON2 lactonase activity was determined using DHC as asubstrate (Draganov et al., 2000). The reaction was initiated byadding 20 ml of the cell lysate to 1ml of 50mM Tris–HCl buffer(pH 8.0) containing 1mM CaCl2 and 1mM DHC. The rate of DHChydrolysis was assessed by measuring the liberation of 3-(2-hydroxyphenyl)propionic acid at 270 nm at 37 �C using a spec-trophotometer (Shimadzu, Japan). The enzyme activity was calculatedfrom the molar extinction coefficient of 1295 M
�1 cm�1. PON2activity was determined from the amount of 3-(2-hydroxyphenyl)propionic acid formed per minute per milligram of protein.
Western Blot Analysis
Ten micrograms of cell lysate was mixed with an equal volumeof 2� sample buffer. The samples were boiled for 5min at95 �C and subjected to 10% sodium dodecyl sulfate (SDS)–poly-acrylamide gel electrophoresis. The proteins were transferred tonitrocellulose membranes. The membranes were blocked at 4 �Covernight in blocking buffer containing 5% nonfat dry milk inTris-buffered saline Tween (TBST) and then incubated with pri-mary polyclonal anti-rabbit antibody against PON2 (1:1250) atroom temperature for 2 h. The membranes were washed and in-cubated with the appropriate HRP-conjugated anti-rabbit IgGsecondary antibody (1:5000) for 1 h at room temperature. Themembrane was washed five times with TBST. Specific bandswere visualized by ECL reagent and quantitated densitometri-cally using the ImageJ program (NIH, Bethesda, MD, USA). The
J. Appl. Toxicol. 2012Wiley & Sons, Ltd.
120
Lead inhibits PON2 in HepG2 cells
membrane was stripped and blotted with b-actin, which wasused as an internal control.
100
80
60
40
20
00 0.05 0.1 0.5 1 10 100 1000
% C
ell v
iabi
lity
Lead acetate (µg/ml)
Figure 1. Hepatic toxicity of lead acetate in HepG2 cells. Cultured cellswere treated with 0.05, 0.1, 0.5, 1, 10, 100 or 1000mgml�1 of lead acetatefor 24, 48 or 72h. Cell viability was determined by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] reduction assay. Thedata are expressed as the means� SEM of values from four independentexperiments (* P< 0.001 compared with the control).
RNA Extraction and Quantification of PON2 mRNA byreal-time RT-PCR
Total RNA was collected from the cells with TrizolW reagent (Invi-trogen, USA) after 6 h of incubation with various concentrationsof lead acetate. RNA (1 mg of total RNA) was reverse-transcribedinto cDNA using an iScript™ Select cDNA Synthesis Kit (Bio-Rad,USA). Real-time polymerase chain reaction (PCR) was performedusing the iQ™5 Multicolor Real-Time PCR Detection System(Bio-Rad, USA). Each reaction contained 0.05 U ml�1 Taq DNApolymerase (Fermentas, Canada), 0.2mM dNTP mix, 1� reactionbuffer, 2.08mM MgCl2, SYBR Green I sDNA acid gel stain dye (BioBasic Inc., Canada), cDNA, and 1 pmol ml�1 of each specificprimer (forward primer, 5′ CAGAGGTTCTCCG CATCCA 3′; reverseprimer, 5′ GAGCAGCTTCCCATCATACAC 3′ for PON2; and forwardprimer, 5′ GACATTGCTCCTCCTGAGC 3′; reverse primer, 5′ACTCCTGCTTGCTGATCCAC 3′ for b-actin). The amplification pro-gram was as follows: 35 cycles of 95 �C for 30 s, an annealingstep (55.6 �C for 30 s), and an extension step (72 �C for 30 s).The levels of mRNA were calculated as the relative changes ofPON2 normalized to b-actin using iQ™ optical system softwareversion 2.0.
Effects of Calcium on PON2 Activity after Treatment withLead Acetate
The calcium experiments were modified from the methods ofGonzalvo et al. (1997) and Pla et al. (2007). The samples werepreincubated with various concentrations of lead acetate atroom temperature for 30min, followed by incubation with1mM CaCl2 for 30min. PON2 activity was determined as de-scribed by Draganov et al. (2000), except no calcium was presentin the buffer.
0 0.05 0.1 0.5 1 10 100
Lead acetate (µg/ml)
180
160
140
120
100
80
60
40
20
0
RO
S pr
oduc
tion
(%
of
cont
rol)
Figure 2. Effect of lead acetate on intracellular reactive oxygen species(ROS) in HepG2 cells. Cultured cells were treated with 0.05, 0.1, 0.5, 1, 10 or100mgml�1 of lead acetate for 1h. ROS were measured by the DCFH-DA(2′,7′-dichlorodihydrofluorescein diacetate) assay. The data are expressed asthe means� SEM of values from four independent experiments (* P< 0.05compared with the control).
Statistical Analysis
Each separate experiment was performed in triplicate, and eachindividual experiment was replicated four times (n= 4). All dataare presented as the means� standard errors of the means(SEM). Differences between groups were analyzed using analysisof variance (ANOVA) and a post hoc test. Values of P< 0.05 wereconsidered statistically significant.
RESULTS
Lead-induced Hepatocytotoxicity
Exposure to lead acetate at 0.05, 0.1, 0.5, 1, 10, 100 or 1000 mgml�1 (0.13, 0.26, 1.32, 2.64, 26.36, 263.62 or 2636.2 mM, respec-tively) for 24, 48 or 72 h was cytotoxic to cultured HepG2 cellsin a concentration- and time-dependent manner (Fig. 1). Leadacetate at 1000mgml�1 (2,636.2 mM) significantly decreased thepercentage of cell viability (estimated by MTT reduction) at 24,48 and 72 h by 69.72� 2.44, 74.29� 0.55 and 84.51� 1.50%P< 0.001), respectively, whereas low concentrations of leadacetate did not appear to be significantly toxic (cell viability>80%) to cells when compared with the control group. Thus,we used the nontoxic concentrations of 0.05–100mgml�1
Reactive oxygen species have been suggested to play an impor-tant role in lead toxicity; therefore, the influence of lead on intra-cellular ROS was determined. As shown in Fig. 2, the exposure ofHepG2 cells to 0.05, 0.1, 0.5, 1, 10 or 100 mgml�1 (0.13, 0.26, 1.32,2.64, 26.36 or 263.62 mM, respectively) of lead acetate for 1 h sig-nificantly increased intracellular ROS compared with the controlcells (P< 0.05). The exposure of the cells to concentrations oflead acetate of at least 10 mgml�1 (26.36mM) gradually increased
Figure 3. Effect of lead acetate on paraoxonase 1 (PON1) activity in HepG2cells. Cultured cells were treated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1 oflead acetate for 24, 48 or 72h. After exposure, PON1 activity toward phenylacetate was measured by spectrophotometry. The data are expressed asthe means� SEM of values from four independent experiments.
(A)
W. Sukketsiri et al.
the intracellular ROS levels to a peak at 10mgml�1 (26.36mM)and declined thereafter.
Lead acetate (µg/ml)
0 0.05 0.1 0. 5 1 10 100
PON 2
β-actin
PON 2
24 hrs
72 hrs
Effect of Lead Acetate on PON1 Activity in HepG2 Cells
The enzyme activity of cell-associated PON1 was determinedfrom HepG2 cells treated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1
(0.13, 0.26, 1.32, 2.64, 26.36 or 263.62 mM, respectively) of leadacetate for 24, 48 or 72 h. The exposure to lead acetate at all
0 0.05 0.1 0.5 1 10 100
Lead acetate (µg/ml)
120
100
80
60
40
20
0
PO
N2
acti
vity
(%
of
cont
rol)
Figure 4. Effect of lead acetate on PON2 activity in HepG2 cells. Culturedcells were treated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1 of lead acetate for4, 8, 24, 48 or 72 h. PON2 activity toward dihydrocoumarin was measuredby spectrophotometry. The data are expressed as the means� SEM ofvalues from four independent experiments (* P< 0.05 compared with thecontrol; # P< 0.001 compared with the control).
tested concentrations for 24, 48 or 72 h did not significantlyaffect the arylesterase activity of cell-associated PON1whencompared with the control group (Fig. 3).
Effect of Lead Acetate on PON2 Activity and Expression inHepG2 Cells
The PON2 activity was determined in cell lysates of HepG2 cellsexposed to 0.05, 0.1, 0.5, 1, 10 or 100mgml�1 (0.13, 0.26, 1.32,2.64, 26.36 or 263.62 mM, respectively) of lead acetate for 4, 8,24, 48 or 72 h (Fig. 4). Lead acetate significantly decreasedPON2 activity in a concentration- and time-dependent manner.Lead acetate significantly decreased PON2 activity at the short-est exposure time (4 h) at 0.5mgml�1 (1.32mM; Fig. 4). The longexposure (over 24 h) to lead acetate significantly decreasedPON2 activity at 0.05 mgml�1.
To further elucidate the cellular response to the decrease inPON2 activity and the increase in oxidative stress, PON2 proteinand transcript were measured by western blot analysis and real-time RT-PCR, respectively. Cell lysates of HepG2 cells exposed to0.05, 0.1, 0.5, 1, 10 or 100mgml�1 (0.13, 0.26, 1.32, 2.64, 26.36 or263.62 mM, respectively) of lead acetate for 24 or 72 h wereblotted with rabbit PON2 antibody. Two bands of the expected
β-actin
1.2
1.0
0.8
0.6
0.4
0.2
0
Fol
d of
exp
ress
ion
(PO
N2/
Act
in)
0 0.5 10
Lead acetate (µg/ml) 0.10.05 1 100
(B)
Figure 5. Effect of lead acetate on the level of PON2 protein in HepG2 cells.Cultured cells were treated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1 of lead ac-etate for 24 or 72h. The supernatant was separated by 10% SDS–PAGE.(A) Immunoblots of PON2: lane 1, control; lane 2, 0.05mgml�1 lead acetate;lane 3, 0.1 mgml�1 lead acetate; lane 4, 0.5 mgml�1 lead acetate; lane5, 1mgml�1 lead acetate; lane 6, 10mgml�1 lead acetate; lane 7, 100mgml�1
lead acetate. (B) Densitometric analysis of the PON2 band intensities,expressed as themeans� SEMof values from four independent experiments.
J. Appl. Toxicol. 2012Wiley & Sons, Ltd.
Lead inhibits PON2 in HepG2 cells
molecular sizes for PON2 of 42 and 44 kDa were observed(Fig. 5A). The densitometric analysis of the PON2 band intensity,normalized to that of b-actin, showed that lead acetate had nosignificant effects on PON2 protein level at any concentrationfor any treatment duration (Fig. 5B). In contrast, PON2 mRNAlevels, obtained from HepG2 cells treated with 0.05, 0.1, 0.5, 1,10 or 100mgml�1 (0.13, 0.26, 1.32, 2.64, 26.36 or 263.62 mM,respectively) of lead acetate for 6 h, were significantly increased;the highest expression of PON2 transcript was 3.32� 0.60-foldgreater than the control under 0.1 mgml�1 (0.26mM) lead acetateexposure (P< 0.05; Fig. 6).
0 0.1 10
Lead acetate (µg/ml)
4.0
3.0
2.0
1.0
0
PO
N2
mR
NA
(F
old
of e
xpre
ssio
n)
0.05 10.5 100
Figure 6. Effect of lead acetate on PON2 mRNA expression in HepG2cells. Cultured cells were treated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1
of lead acetate for 6 h. The mRNA levels were determined by real-timepolymerase chain reaction, using b-actin as the internal control. Theresults are expressed as the means� SEM of values from three indepen-dent experiments (* P< 0.05 compared with the control).
0.05 0.5 10
Lead acetate (µg/ml)
140
120
100
80
60
40
20
0
PO
N2
acti
vity
(%
of
cont
rol)
0.1 1 100
Figure 7. The restoration effect of calcium on lead-inhibited PON2 ac-tivity. HepG2 cells were incubated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1
of lead acetate for 30min. The restoration of PON2 activity was deter-mined as described in the ‘Materials and Methods’ section. The resultsare expressed as the means� SEM of values from three independentexperiments (* P< 0.01 compared with the control).
The Restoration of Lead-inhibited PON2 Activity by Calcium
Lead acetate was able to reduce the PON2 activity in a short pe-riod of time, so we speculated that the decrease in PON2 activitymight be mediated through lead-displaced Ca2+ ions at the ac-tive site of its structure. Hence, the restoration of lead-inhibitedPON2 activity by calcium was examined in HepG2 cell lysatespre-incubated with 0.05, 0.1, 0.5, 1, 10 or 100mgml�1 (0.13,0.26, 1.32, 2.64, 26.36 or 263.62mM, respectively) of lead acetatefor 30min (baseline) and further incubated with CaCl2 for an-other 30min. The pre-incubation with lead acetate inhibitedPON2 activity in a concentration-dependent manner. Exposure toCa2+ significantly restored PON2 activity to approximately 120.6,105.6, 100.3, 101.5 and 108.6% of baseline in the 0.05, 0.1, 0.5, 1and 10mgml�1 (0.13, 0.26, 1.32, 2.64 and 26.36mM, respectively)lead acetate exposure groups, respectively. Interestingly, PON2activity was not restored in cells treated with the highest concen-tration (100mgml�1; 263.62mM) of lead (Fig. 7).
DISCUSSIONLead induces hepatic toxicity by disturbing the cellular oxidativebalance. PON1 and PON2 act as antioxidant enzymes, and theyare highly expressed in the liver (Ng et al., 2001; Draganov andLa Du, 2004). Thus, lead-induced pro-oxidants may be modu-lated by the antioxidant enzymes PON1 and PON2. Therefore,we primarily investigated the effects of lead on the PON1 andPON2 activities, as well as the possible mechanism by which leadmodulates PON1 and PON2 in HepG2 cells. Our MTT assayshowed that lead-induced HepG2 cell injury and death are bothconcentration- and time-dependent and that they correspond tothe increase in intracellular ROS production. These results indi-cate that ROS accumulation may be involved in hepatic toxicity.Among the metal ions, lead is considered a poor inducer ofoxidative stress; however, it inhibits several antioxidant enzymes(Patrick, 2006). Lead-induced reductions of PON1 activity towardparaoxon and arylesterase have been observed in serum PON1,purified PON1 and PON1 of rat liver tissue (Li et al., 2006; Ekinciand Beydemir 2010; Pla et al., 2007; Sherein et al., 2009;Permpongpaiboon et al., 2011). We observed, however, anonsignificant change in the activity of cell-associated PON1 atall lead acetate concentrations and exposure durations in HepG2cells. Our results are in contrast to others and our previousreports. This unexpected result may have been obtained becausethe modulation of the activity of serum, secreted and cell-associated PON1 may involve several different factors (Hernandezet al., 2009). Although there is no clear evidence demonstrating aphysical or biological difference between the cell-associated andsecreted forms of PON1, a study on the structure of PON1 revealedthat there are probably some structural and catalytic differencesbetween the liver and serum enzyme, for the following reasons:(1) the additional calcium required for its activity is incorporatedduring the secretion process (Kuo and La Du, 1998); and (2) cell-associated PON1 is anchored to the plasma membrane by thetwo helices of PON1, and these two helices form a unique lid overthe pocket of the active site (the tunnel for the residing calcium) ofPON1 (Harel et al., 2004). These factors may have, in part, reducedthe effect of lead on PON1 activity through the interaction betweenlead and the active site of PON1.The effect of lead on PON2 was investigated in this study be-
cause (1) PON2 shares homology with and is proposed to have asimilar structure and catalytic activity to PON1; (2) PON2 serves
as an intracellular antioxidant that may play a critical role inameliorating lead-induced oxidative stress; and (3) PON2 ishighly expressed in the liver. Interestingly, we found that lead,even at low concentrations and short exposure durations, signif-icantly inhibited PON2 activity toward DHC. As noted in our find-ings, lead acetate was more effective at inhibiting PON2 activitythan PON1 activity in liver cells. This is difficult to explain clearlyat this point owing to a lack of prior research on PON2. However,one explanation for this result is that PON2 resides in the cytosolwithout being anchored to the membrane, so lead ions mayhave access to the PON2 active site (Ng et al., 2001). Further-more, PON2 has a larger active site pocket than PON1, whichmay result in an increased probability of an interaction betweenlead and the active site of PON2 (Draganov et al., 2000; Harelet al., 2004). Another possibility to explain this result is thecharacteristics of the PON1 active site. PON1 has two activities,esterase and lactonase, that share the same active site, butdifferent amino acid residues in the active site are involved inthe two hydrolysis reactions (Harel et al., 2004; Yeung et al.,2005). Therefore, amino acid residues at the active site of PON2that are involved in the lead-inhibited activity may be differentfrom those of PON1 because, in this study, PON2 enzyme activitywas determined to be lactonase activity, while PON1 was deter-mined to exhibit esterase activity.
Our results reveal that lead inhibited PON2 activity after theshortest exposure examined (4 h), which is unlikely to result froman effect on protein synthesis. In addition, PON2 is a calcium-dependent enzyme containing an active site pocket that hasthe structure of a central tunnel with a propeller containingtwo calcium atoms (Harel et al., 2004). Lead and several othermetal ions inhibit PON1 activity, but the enzyme activity isrestored by the addition of free calcium (Gil et al., 1994; Gonzalvoet al., 1997; Pla et al., 2007; Ekinci and Beydemir 2010). Therefore,we speculated that lead-induced decreases in PON2 activity maybe due, at least in part, to the displacement of a calcium atom inthe active site of the PON2 protein. We observed the restorationof PON2 activity by calcium. This result implies that lead inhibitedPON2 by preventing calcium from having its requisite effects onPON2 structure and hydrolytic activity. Thus, the lead-inhibitedPON2 activity observed in this study probably did not resultfrom the lead-induced elevation of intracellular oxidation, whichmay influence the sulfhydryl group present in PON2 (Harelet al., 2004).
In this study, we further investigated the response of HepG2cells to lead-induced oxidative stress and lead-reduced PON2 ac-tivity because PON2 is antioxidant enzyme that is upregulated inresponse to oxidative stress in macrophages (Rosenblat et al.,2003; Shiner et al., 2004, 2006). Therefore, we determined thelevels of PON2 protein and transcript in HepG2 cells exposedto lead acetate. Lead did not alter the level of PON2 protein re-gardless of the duration and concentration of lead treatment.However, we found a significant increase in PON2 transcript fol-lowing even the lowest dose of treatment. This may have beendue to the lower sensitivity of detection afforded by westernblot analysis. The increase in PON2 transcript implies that thecells are responsive to reductions in PON2 activity and increasesin oxidative stress, suggesting a positive feedback mechanism.However, we did not observe a strong or biphasic U-shaped re-sponse to oxidative stress, as has been previously reported inmacrophages (Rosenblat et al., 2003; Shiner et al., 2004, 2006).This may have been due to the different cell types and/or theoxidative inducers used in these studies. In this study, lead may
have induced oxidative stress to a lesser extent than previousagents or did not directly generate reactive oxygen species.
In conclusion, this study provides evidence that lead signifi-cantly inhibits PON2 activity toward dihydrocoumarin in a con-centration- and time-dependent manner, but does not affectcell-associated PON1 activity toward phenyl acetate in HepG2cells. In addition, the reduction of PON2 activity is reversed bythe addition of calcium. Our findings imply that HepG2 cells re-spond to lead-induced oxidative stress and decreases in PON2activity by upregulating PON2 expression.
Acknowledgments
This work was supported by the grant fund under the programStrategic Scholarships for Frontier Research Network for thePh.D. Program Thai Doctoral degree from the Office of the HigherEducation Commission, Bangkok, Thailand and Mahidol Univer-sity under the National Research Universities Initiative. Theauthor(s) disclose receipt of the following financial support forthe research and/or authorship of this article: the 90th Anniver-sary of Chulalongkorn University Fund (RatchadaphiseksomphotEndowment Fund).
ReferencesAgency for Toxic Substances and Disease Registry. 2007. Toxicological
Profile for Lead. Agency for Toxic Substances and Disease Registry:Atlanta, GA.
Al-Neamy FR, Almehdi AM, Alwash R, Pasha MA, Ibrahim A, Bener A.2001. Occupational lead exposure and amino acid profiles and liverfunction tests in industrial workers. Int. J. Environ. Health Res. 11(2):181–188.
Apostoli P, Huard C, Chaumontet C, Martel P, Allesio L, Mazzoleni G. 2000.Effects of four inorganic lead compounds on the proliferation andjunctional coupling of cultured REL liver cells. Am. J. Ind. Med. 38(3):340–348.
Aykin-Burns N, Laegeler A, Kellogg G, Ercal N. 2003. Oxidative effects oflead in young and adult Fisher 344 rats. Arch. Environ. Contam.Toxicol. 44(3): 417–420.
Berrahal AA, Lasram M, El Elj N, Kerkeni A, Gharbi N, El-Fazaa S. 2009.Effect of age-dependent exposure to lead on hepatotoxicity andnephrotoxicity in male rats. Environ. Toxicol. 26(1): 68–78.
Costa LG, Cole TB, Vitalone A, Furlong CE. 2005. Measurement of paraox-onase (PON1) status as a potential biomarker of susceptibility toorganophosphorate toxicity. Clin. Chim. Acta 352(1–2): 37–47.
Deakin S, Leviev I, Gomaraschi M, Calabresi L, Franceschini G, James RW.2001. Enzymatically active paraoxonase-1 is located at the externalmembrane of producing cells and released by a high affinity, satura-ble, desorption mechanism. J. Biol. Chem. 277(6): 4301–4308.
Draganov DI, La Du BN. 2004. Pharmacogenetics of paraoxonases: a briefreview. Naunyn Schmiedeberg’s Arch. Pharmacol. 369(1): 78–88.
Draganov DI, Stetson PL, Watson CE, Billecke SS, La Du BN. 2000. Rabbitserum paraoxonase 3 (PON3) is a high density lipoprotein-associatedlactonase and protects low density lipoprotein against oxidation. J.Biol. Chem. 275(43): 33435–33442.
Draganov DI, Teiber JF, Speelman A, Osawa Y, Sunahara R, La Du BN.2005. Human paraoxonases (PON1, PON2, and PON3) are lactonaseswith overlapping and distinct substrate specificities. J. Lipid Res. 46(6):1239–1247.
Ekinci D, Beydemir S. 2010. Purification of PON1 from human serum andassessment of enzyme kinetics against metal toxicity. Biol. Trace Elem.Res. 135(1–3): 112–120.
Ferre N, Camps J, Cabre M, Paul A, Joven J. 2001. Hepatic paraoxonaseactivity alterations and free radical production in rats with experi-mental cirrhosis. Metabolism 50(9): 997–1000.
Ferre N, Marsillach J, Camps J, Mackness B, Mackness M, Riu F, Coll B,Tous M, Joven J. 2006. Paraoxonase-1 is associated with oxidativestress, fibrosis and FAS expression in chronic liver diseases. J. Hepatol.45(1): 51–59.
Gil F, Gonzalvo MC, Hernandez AF, Villanueva E, Pla A. 1994. Differencesin the kinetic properties, effect of calcium and sensitivity to inhibitors
J. Appl. Toxicol. 2012Wiley & Sons, Ltd.
Lead inhibits PON2 in HepG2 cells
of paraoxon hydrolase activity in rat plasma and microsomal fractionfrom rat liver. Biochem. Pharmacol. 48(8): 1559–1568.
Gonzalvo MC, Gil F, Hernández AF, Villanueva E, Pla A. 1997. Inhibition ofparaoxonase activity in human liver microsomes by exposure toEDTA, metals and mercurials. Chem. Biol. Interact. 105(3): 169–179.
Harel M, Aharoni A, Gaidukov L, Brumshtein B, Khersonsky O, Meged R,Dvir H, Ravelli RB, McCarthy A, Toker L, Silman I, Sussman JL, TawfikDS. 2004. Structure and evolution of the serum paraoxonase familyof detoxifying and anti-atherosclerotc enzymes. Nat. Struct. Mol. Biol.11(5): 412–419.
Hernandez AF, Gil F, Leno E, Lopez O, Rodrigo L, Pla A. 2009. Interactionbetween human serum esterases and environmental metal com-pounds. Neurotoxicology 30(4): 628–635.
Khersonsky O, Tawfik DS. 2005. Structure–reactivity studies of serumparaoxonase PON1 suggest that its native activity is lactonase. Bio-chemistry 44(16): 6371–6382.
Kilic SS, Aydin S, Kilic N, Erman F, Aydin S, Celik I. 2005. Serum arylester-ase and paraoxonase activity in patients with chronic hepatitis.Wld J.Gastroenterol. 11(46): 7351–7354.
Kubo Y, Yasunaga M, Masuhara M, Terai S, Nakamura T, Okita K. 1996. He-patocyte proliferation induced in rats by lead nitrate is suppressed byseveral tumor necrosis factor alpha inhibitors. Hepatology 23(1):104–114.
Kuo CL, La Du B. 1998. Calcium binding by human and rabbit serumparaoxonases: structural stability and enzymatic activity. Drug Metab.Dispos. 26(7): 653–660.
Li WF, Pan MH, Chung MC, Ho CK, Chuang HY. 2006. Lead exposure is as-sociated with decreased serum paraoxonase1 (PON1) activity andgenotypes. Environ. Health Perspect. 114(8): 1233–1236.
Mackness B, Durrington P, Mackness M. 2002. The paraoxonase genefamily and coronary heart disease. Curr. Opin. Lipidol. 13: 357–362.
Marsillach J, Ferré N, Vila MC, Lligoña A, Mackness B, Mackness M,Deulofeu R, Sola R, Pares A, Pedro-Botel J, Joven J, Caballeria J, Camps J.2007. Serum paraoxonase-1 in chronic alcoholics: relationship withliver disease. Clin. Biochem. 40(9–10): 645–650.
Marsillach J, Camps J, Ferré N, Beltran R, Rull A, Mackness B, Mackness M,Joven J. 2009. Paraoxonase-1 is related to inflammation, fibrosis andPPAR delta in experimental liver disease. BMC Gastroenterol. 9: 3.
Mosmann T. 1983. Rapid colorimetric assay for cellular growth and sur-vival: application to proliferation and cytotoxicity assays. J. Immunol.Meth. 65: 55–63.
Ng CJ, Wadleigh DJ, Gangopadhyay A, Hama S, Grijalva VR, Navab M,Fogelman AM, Reddy ST. 2001. Paraoxonase-2 is a ubiquitouslyexpressed protein with antioxidant properties and is capable of pre-venting cell-mediated oxidative modification of low density lipopro-tein. J. Biol. Chem. 276(48): 44444–44449.
Patrick L. 2006. Lead toxicity path II: the role of free radical damage andthe use of antioxidants in the pathology and treatment of lead toxic-ity. Altern. Med. Rev. 11(2): 114–127.
Permpongpaiboon T, Nagila A, Pidetcha P, Tuangmungsakulchai K,Tantrarongroj S, Porntadavity S. 2011. Decreased paraoxonase 1 ac-tivity and increased oxidative stress in low lead exposed workers.Hum. Exp. Toxicol. 30(9): 1196–1203.
Pla A, Rodrigo L, Hernandez AF, Gil F, Lopez O. 2007. Effect of metal ionsand calcium on purified PON1 and PON3 from rat liver. Chem. Biol.Interact. 167(1): 63–70.
Prakash M, Shetty JK, Tripathy S, Verma M, Vasudev S, Bhandary PV. 2007.Serum paraoxonase in alcohol abusers associated with alcoholic liverdisease. Clin. Chim. Acta 378(1–2): 232–234.
Rosenblat M, Draganov D, Watson CE, Bisgaier CL, La Du BN, Aviram M.2003. Mouse macrophage paraoxonase 2 activity is increasedwhereas cellular paraoxonase 3 activity is decreased under oxidativestress. Arterioscler. Thromb. Vasc. Biol. 23(3): 468–474.
Sherein GS, Mohamed E, Manal K, Mona F, Manal H. 2009. Impact of leadexposure on serum paraoxonase 1 (PON1) activtiy and genotype inoccupationally exposed egyptian workers. Int. J. Med. Toxicol. LegalMed. 11(4): 6–16.
Shiner M, Fuhrman B, Aviram M. 2004. Paraoxonase 2 (PON2) expressionis upregulated via a reduced-nicotinamideadenine-dinucleotide-phosphate (NADPH)-oxidase-dependent mechanism during mono-cytes differentiation into macrophages. Free Radic. Biol. Med. 37(12):2052–2063.
Shiner M, Fuhrman B, Aviram M. 2006. A biphasic U-shape effect of cellu-lar oxidative stress on the macrophage anti-oxidant paraoxonase 2(PON2) enzymatic activity. Biochem. Biophys. Res. Commun. 349(3):1094–1099.
Shinozuka H, Ohmura T, Katyal SL, Zedda AI, Ledda-Columbano GM,Columbano A. 1996. Possible roles of nonparenchymal cells in hepa-tocyte proliferation induced by lead nitrate and by tumor necrosisfactor a. Hepatology 23(6): 1572–1577.
Sivaprasad R, Nagaraj M, Varalakshmi P. 2004. Combined efficacies oflipoic acid and 2,3-dimercaptosuccinic acid against lead-inducedlipid peroxidation in rat liver. J. Nutr. Biochem. 15(1): 18–23.
Wang H, Joseph JA. 1999. Quantifying cellular oxidative stress by dichlor-ofluorescein assay using microplate reader. Free Radic. Biol. Med.27(5–6): 612–616.
Yeung DT, Lenz DE, Cerasoli DM. 2005. Analysis of active-site amino-acidresidues of human serum paraoxonase using competitive substrates.FEBS J. 272(9): 2225–2230.
Zhang C, Peng W, Jiang X, Chen B, Zhu J, Zang Y, Zhang J, Zhu T, Qin J.2008. Transgene expression of human PON1 Q in mice protected theliver against CCl4-induced injury. J. Gene Med. 10(1): 94–100.
